| Clone Name | rbags35c01 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|AC093133.3| Papio anubis clone RP41-57F8, complete sequence | 42 | 0.85 | 2 | emb|AL355137.23| Human DNA sequence from clone RP11-511D14 on ch... | 40 | 3.3 | 3 | gb|AC023449.11| Homo sapiens chromosome 15, clone RP11-345J18, c... | 40 | 3.3 | 4 | gb|AC109512.12| Homo sapiens chromosome 15, clone RP11-931B1, co... | 40 | 3.3 |
|---|
>gb|AC093133.3| Papio anubis clone RP41-57F8, complete sequence Length = 177993 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Plus Query: 154 acagcacccaggccacttcca 174 ||||||||||||||||||||| Sbjct: 119370 acagcacccaggccacttcca 119390
>emb|AL355137.23| Human DNA sequence from clone RP11-511D14 on chromosome 6p23-24.3 Contains the gene for a novel protein isentical to ribosomal protein L15 (RPL15), complete sequence Length = 190223 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 gtgaccaaacccactttaca 115 |||||||||||||||||||| Sbjct: 8470 gtgaccaaacccactttaca 8451
>gb|AC023449.11| Homo sapiens chromosome 15, clone RP11-345J18, complete sequence Length = 175336 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 ggagtacagcacccaggcca 168 |||||||||||||||||||| Sbjct: 99411 ggagtacagcacccaggcca 99430
>gb|AC109512.12| Homo sapiens chromosome 15, clone RP11-931B1, complete sequence Length = 189975 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 ggagtacagcacccaggcca 168 |||||||||||||||||||| Sbjct: 175788 ggagtacagcacccaggcca 175807 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,334,236 Number of Sequences: 3902068 Number of extensions: 1334236 Number of successful extensions: 20800 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 20796 Number of HSP's gapped (non-prelim): 4 length of query: 258 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 236 effective length of database: 17,147,199,772 effective search space: 4046739146192 effective search space used: 4046739146192 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)