ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags35b01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF074969.1|AF074969 Triticum aestivum heat shock protein 70 (... 434 e-118
2gb|AC098572.2| Oryza sativa (japonica cultivar-group) chromosome... 224 3e-55
3dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 224 3e-55
4dbj|AK060410.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 6e-53
5gb|AY108828.1| Zea mays PCO138532 mRNA sequence 139 1e-29
6gb|AY104911.1| Zea mays PCO138533 mRNA sequence 109 1e-20
7gb|BT018142.1| Zea mays clone EL01N0555B07.c mRNA sequence 105 2e-19
8gb|AY105690.1| Zea mays PCO065072 mRNA sequence 94 6e-16
9gb|AY224466.1| Oryza sativa (japonica cultivar-group) isolate 23... 92 2e-15
10dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
11dbj|AK121949.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
12dbj|AK119535.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
13dbj|AK072071.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
14dbj|AK069937.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
15gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 92 2e-15
16emb|AL831810.4|CNS08CAN Oryza sativa chromosome 12, . BAC OSJNBa... 92 2e-15
17gb|BT016772.1| Zea mays clone Contig605 mRNA sequence 84 6e-13
18gb|DQ224261.1| Aquilegia pyrenaica putative heat shock protein 7... 84 6e-13
19gb|DQ224260.1| Aquilegia brevistyla putative heat shock protein ... 84 6e-13
20gb|DQ224258.1| Aquilegia formosa putative heat shock protein 70 ... 84 6e-13
21gb|BT024111.1| Zea mays clone EL01N0516B01 mRNA sequence 84 6e-13
22emb|X69213.1|PSST70 P.sativum Psst70 gene for heat-shock protein 82 2e-12
23gb|L03299.1|PEA70HSP Pisum sativum chloroplast stromal 70 kDa he... 82 2e-12
24gb|DQ224263.1| Semiaquilegia adoxoides putative heat shock prote... 76 1e-10
25gb|DQ224262.1| Aquilegia olympica putative heat shock protein 70... 76 1e-10
26gb|DQ224259.1| Aquilegia chrysantha putative heat shock protein ... 76 1e-10
27gb|U92815.1|CLU92815 Citrullus lanatus heat shock protein 70 pre... 62 2e-06
28emb|X73961.1|CSHSP70 C.sativus mRNA for heat shock protein 70 (h... 60 9e-06
29gb|DQ224254.1| Aquilegia formosa heak shock protein 70 (HSP70) m... 60 9e-06
30gb|AY072744.1| Dunaliella salina heat shock protein 70B (hsp70B)... 54 5e-04
31gb|AC140550.31| Medicago truncatula clone mth2-54a24, complete s... 52 0.002
32dbj|AB181295.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ... 52 0.002
33ref|NM_118561.2| Arabidopsis thaliana CPHSC70-1; ATP binding AT4... 50 0.008
34gb|AY072138.1| Arabidopsis thaliana putative hsp 70 protein (At4... 50 0.008
35emb|AL078637.1|ATT22A6 Arabidopsis thaliana DNA chromosome 4, BA... 50 0.008
36emb|AL161561.2|ATCHRIV61 Arabidopsis thaliana DNA chromosome 4, ... 50 0.008
37gb|BT001950.1| Arabidopsis thaliana clone U19959 putative hsp 70... 50 0.008
38emb|AL034399.6|HS191P20 Human DNA sequence from clone RP6-191P20... 46 0.13
39emb|AL137065.10| Human DNA sequence from clone RP11-4P13 on chro... 46 0.13
40emb|CR391911.15| Zebrafish DNA sequence from clone DKEYP-26A9 in... 44 0.52
41ref|XM_734475.1| Plasmodium chabaudi chabaudi hypothetical prote... 44 0.52
42emb|CR388402.15| Zebrafish DNA sequence from clone DKEY-97I21 in... 44 0.52
43ref|NM_124369.2| Arabidopsis thaliana cpHSC70-2 (HEAT SHOCK PROT... 42 2.0
44ref|NM_124370.3| Arabidopsis thaliana unknown protein AT5G49920 ... 42 2.0
45gb|AY766104.1| Dengue virus type 3 strain Singapore 8120/95, com... 42 2.0
46gb|AY665402.1| Dengue virus type 3 polyprotein gene, partial cds 42 2.0
47gb|AY632355.1| Dengue virus type 3 isolate AM2394 from Brazil po... 42 2.0
48gb|AY662691.1| Dengue virus type 3 from Singapore, complete genome 42 2.0
49gb|BT000919.1| Arabidopsis thaliana clone C105236 putative heat ... 42 2.0
50gb|AY099336.1| Dengue virus type 3 isolate D3/H/IMTSSA-SRI/2000/... 42 2.0
51gb|AF547260.1| Dengue virus type 3 612210 polyprotein gene, part... 42 2.0
52gb|AF547242.1| Dengue virus type 3 L57 polyprotein gene, partial... 42 2.0
53gb|AF547241.1| Dengue virus type 3 073 polyprotein gene, partial... 42 2.0
54gb|AF547240.1| Dengue virus type 3 SOM079 polyprotein gene, part... 42 2.0
55gb|AF547239.1| Dengue virus type 3 251991 polyprotein gene, part... 42 2.0
56gb|AF547238.1| Dengue virus type 3 1559 polyprotein gene, partia... 42 2.0
57gb|AF547237.1| Dengue virus type 3 1558 polyprotein gene, partia... 42 2.0
58gb|AF547236.1| Dengue virus type 3 1557 polyprotein gene, partia... 42 2.0
59gb|AF547235.1| Dengue virus type 3 D9397 polyprotein gene, parti... 42 2.0
60gb|AF547234.1| Dengue virus type 3 D5231 polyprotein gene, parti... 42 2.0
61gb|AF547233.1| Dengue virus type 3 D3197 polyprotein gene, parti... 42 2.0
62gb|AF547232.1| Dengue virus type 3 D2803 polyprotein gene, parti... 42 2.0
63gb|AF547231.1| Dengue virus type 3 D2863 polyprotein gene, parti... 42 2.0
64gb|AF547230.1| Dengue virus type 3 D2783 polyprotein gene, parti... 42 2.0
65gb|AF547229.1| Dengue virus type 3 D1440 polyprotein gene, parti... 42 2.0
66gb|AF547228.1| Dengue virus type 3 D1336 polyprotein gene, parti... 42 2.0
67gb|AF547227.1| Dengue virus type 3 D1307 polyprotein gene, parti... 42 2.0
68gb|AF547226.1| Dengue virus type 3 D1306 polyprotein gene, parti... 42 2.0
69gb|AF547225.1| Dengue virus type 3 D1266 polyprotein gene, parti... 42 2.0
70gb|AY080761.1| Arabidopsis thaliana At5g49910 mRNA sequence 42 2.0
71emb|AJ271605.2|DSA271605 Dunaliella salina mRNA for chloroplast-... 42 2.0
72gb|AC155270.3| Mus musculus BAC clone RP23-195H19 from chromosom... 42 2.0
73gb|AC154913.4| Ornithorhynchus anatinus BAC clone OABb-535A1 fro... 42 2.0
74gb|DQ401695.1| Dengue virus type 3 isolate mutant PhMH-J1-97, co... 42 2.0
75gb|DQ401694.1| Dengue virus type 3 isolate mutant InJ-I6-82, com... 42 2.0
76gb|DQ401693.1| Dengue virus type 3 isolate mutant BDH02-07, comp... 42 2.0
77gb|DQ401692.1| Dengue virus type 3 isolate mutant BDH02-04, comp... 42 2.0
78gb|DQ401691.1| Dengue virus type 3 isolate mutant BDH02-03, comp... 42 2.0
79gb|DQ401690.1| Dengue virus type 3 isolate InJ-16-82, complete g... 42 2.0
80gb|DQ401689.1| Dengue virus type 3 isolate mutant BDH02-01, comp... 42 2.0
81gb|AY496878.1| Dengue virus type 3 isolate BDH02-8 polyprotein g... 42 2.0
82gb|AY496876.1| Dengue virus type 3 isolate BDH02-6 polyprotein g... 42 2.0
83gb|AY496875.1| Dengue virus type 3 isolate BDH02-5 polyprotein g... 42 2.0
84gb|AY496872.1| Dengue virus type 3 isolate BDH02-2 polyprotein g... 42 2.0
85gb|AY496871.2| Dengue virus type 3 isolate BDH02-1, complete genome 42 2.0
86gb|AY496873.2| Dengue virus type 3 isolate BDH02-3, complete genome 42 2.0
87gb|AY496874.2| Dengue virus type 3 isolate BDH02-4, complete genome 42 2.0
88gb|AY496877.2| Dengue virus type 3 isolate BDH02-7, complete genome 42 2.0
89gb|AY496879.2| Dengue virus type 3 isolate PhMH-J1-97, complete ... 42 2.0
90dbj|AB214882.1| Dengue virus type 3 genomic RNA, neally complete... 42 2.0
91dbj|AB214881.1| Dengue virus type 3 genomic RNA, neally complete... 42 2.0
92dbj|AB214880.1| Dengue virus type 3 genomic RNA, neally complete... 42 2.0
93dbj|AB214879.1| Dengue virus type 3 genomic RNA, neally complete... 42 2.0
94gb|AY960633.1| Dengue virus type 3 isolate RGN576 polyprotein ge... 42 2.0
95gb|AY960632.1| Dengue virus type 3 isolate MTO3103 polyprotein g... 42 2.0
96gb|AY960629.1| Dengue virus type 3 isolate CEA4739 polyprotein g... 42 2.0
97gb|AY960628.1| Dengue virus type 3 isolate Bel73318 polyprotein ... 42 2.0
98gb|AY265857.1| Dengue virus type 3 isolate NAMRU-2 98901620 poly... 42 2.0
99gb|AY265856.1| Dengue virus type 3 isolate NAMRU-2 98901413 poly... 42 2.0
100gb|AY923865.1| Dengue virus type 3 strain C0360/94, complete genome 42 2.0
101gb|AY912458.1| Dengue virus type 3 strain KPS-4-0657/207 polypro... 42 2.0
102gb|AY912455.1| Dengue virus type 3 strain 98901640 polyprotein m... 42 2.0
103gb|AY912454.1| Dengue virus type 3 strain 98901590 polyprotein m... 42 2.0
104gb|AF217459.1|AF217459 Arabidopsis thaliana heat shock protein 7... 42 2.0
105gb|AF349753.1|AF349753 Dengue virus type 3 strain PaH881/88 poly... 42 2.0
106gb|AF317645.1|AF317645 Dengue virus type 3 strain 80-2, complete... 42 2.0
107dbj|AB189127.1| Dengue virus type 3 genomic RNA, complete genome... 42 2.0
108dbj|AB189126.1| Dengue virus type 3 genomic RNA, complete genome... 42 2.0
109dbj|AB189125.1| Dengue virus type 3 genomic RNA, complete genome... 42 2.0
110emb|AL935144.11| Zebrafish DNA sequence from clone CH211-89B14 i... 42 2.0
111dbj|AB024032.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 2.0
112emb|AJ563355.1|DVI563355 Dengue virus type 3 proviral partial ge... 42 2.0
113gb|M93130.1|DENCME Dengue type 3 virus complete genome RNA, comp... 42 2.0
114gb|AY676353.1| Dengue virus type 3 strain ThD3_0007_87, complete... 42 2.0
115gb|AY676352.1| Dengue virus type 3 strain ThD3_0010_87, complete... 42 2.0
116gb|AY676351.1| Dengue virus type 3 strain ThD3_0055_93, complete... 42 2.0
117gb|AY676350.1| Dengue virus type 3 strain ThD3_0104_93, complete... 42 2.0
118gb|AY676349.1| Dengue virus type 3 strain ThD3_1283_98, complete... 42 2.0
119gb|AY676348.1| Dengue virus type 3 strain ThD3_1687_98, complete... 42 2.0
120gb|AC122767.16| Mus musculus chromosome 7, clone RP24-143L4, com... 42 2.0
121gb|M86733.1|DENENVAA Dengue virus type 3 structural proteins, co... 42 2.0
122gb|AY858048.1| Dengue virus type 3 strain TB55i, complete genome 42 2.0
123gb|AY858047.1| Dengue virus type 3 strain TB16, complete genome 42 2.0
124gb|AY858046.1| Dengue virus type 3 strain PI64, complete genome 42 2.0
125gb|AY858045.1| Dengue virus type 3 strain PH86, complete genome 42 2.0
126gb|AY858044.1| Dengue virus type 3 strain KJ71, complete genome 42 2.0
127gb|AY858042.1| Dengue virus type 3 strain KJ30i, complete genome 42 2.0
128gb|AY858041.1| Dengue virus type 3 strain FW06, complete genome 42 2.0
129gb|AY858040.1| Dengue virus type 3 strain FW01, complete genome 42 2.0
130gb|AY858039.1| Dengue virus type 3 strain den3_98, complete genome 42 2.0
131gb|AY858037.1| Dengue virus type 3 strain BA51, complete genome 42 2.0
132gb|M25277.1|DENSP5AA Dengue virus type 3 5' region of the genome... 42 2.0
133gb|L11620.1|DENENVGLYW Dengue virus type 3 membrane protein (prM... 42 2.0
134dbj|AB010990.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.0
135dbj|AB010989.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.0
136dbj|AB010988.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.0
137dbj|AB010987.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.0
138dbj|AB010986.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.0
139dbj|AB010985.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.0
140dbj|AB010984.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.0
141dbj|AB010983.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.0
142dbj|AB010982.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.0
143gb|L11427.1|DENENVGLYF Dengue virus type 3 membrane protein (prM... 42 2.0
144gb|L11442.1|DENENVGLYU Dengue virus type 3 membrane protein (prM... 42 2.0
145gb|L11441.1|DENENVGLYT Dengue virus type 3 membrane protein (prM... 42 2.0
146gb|L11439.1|DENENVGLYR Dengue virus type 3 membrane protein (prM... 42 2.0
147gb|L11438.1|DENENVGLYQ Dengue virus type 3 membrane protein (prM... 42 2.0
148gb|L11437.1|DENENVGLYP Dengue virus type 3 membrane protein (prM... 42 2.0
149gb|L11436.1|DENENVGLYO Dengue virus type 3 membrane protein (prM... 42 2.0
150gb|L11435.1|DENENVGLYN Dengue virus type 3 membrane protein (prM... 42 2.0
151gb|L11434.1|DENENVGLYM Dengue virus type 3 membrane protein (prM... 42 2.0
152gb|L11433.1|DENENVGLYL Dengue virus type 3 membrane protein (prM... 42 2.0
153gb|L11431.1|DENENVGLYJ Dengue virus type 3 membrane protein (prM... 42 2.0
154gb|L11430.1|DENENVGLYI Dengue virus type 3 membrane protein (prM... 42 2.0
155gb|L11429.1|DENENVGLYH Dengue virus type 3 membrane protein (prM... 42 2.0
156gb|L11428.1|DENENVGLYG Dengue virus type 3 membrane protein (prM... 42 2.0
157gb|L11426.1|DENENVGLYE Dengue virus type 3 membrane protein (prM... 42 2.0
158gb|L11425.1|DENENVGLYD Dengue virus type 3 membrane protein (prM... 42 2.0
159gb|L11423.1|DENENVGLYB Dengue virus type 3 membrane protein (prM... 42 2.0
160gb|AC164094.5| Mus musculus BAC clone RP23-133F10 from chromosom... 40 8.1
161ref|XM_517100.1| PREDICTED: Pan troglodytes similar to actin fil... 40 8.1
162gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 8.1
163gb|AE017129.1| Yersinia pestis biovar Medievalis str. 91001 sect... 40 8.1
164gb|AC159249.3| Mus musculus BAC clone RP24-177C7 from chromosome... 40 8.1
165gb|AC147625.3| Mus musculus BAC clone RP24-348P17 from chromosom... 40 8.1
166gb|AC147105.2| Mus musculus BAC clone RP24-66E5 from chromosome ... 40 8.1
167gb|AC145602.3| Mus musculus BAC clone RP24-240M7 from chromosome... 40 8.1
168gb|AC146597.3| Mus musculus BAC clone RP24-230I13 from chromosom... 40 8.1
169gb|AE009952.1| Yersinia pestis KIM, complete genome 40 8.1
170gb|AC182456.2| Mus musculus BAC clone RP24-65H21 from chromosome... 40 8.1
171gb|AC147709.1| Mus musculus BAC clone RP24-97E15 from chromosome... 40 8.1
172gb|AC144646.3| Mus musculus BAC clone RP24-388P5 from chromosome... 40 8.1
173gb|AC092129.3| Homo sapiens chromosome 16 clone RP11-140O8, comp... 40 8.1
174ref|XM_570650.1| Cryptococcus neoformans var. neoformans JEC21 t... 40 8.1
175gb|BC014113.1| Homo sapiens hypothetical protein LOC254848, mRNA... 40 8.1
176gb|AC121941.3| Mus musculus BAC clone RP24-209I3 from chromosome... 40 8.1
177gb|AC123034.5| Mus musculus BAC clone RP24-484E17 from chromosom... 40 8.1
178gb|AC112254.6| Homo sapiens BAC clone RP11-1156I21 from 4, compl... 40 8.1
179gb|AC024607.3| Mus musculus strain C57BL6/J chromosome 5 clone R... 40 8.1
180gb|AC117190.3| Mus musculus BAC clone RP23-55A21 from 2, complet... 40 8.1
181ref|XM_545904.2| PREDICTED: Canis familiaris similar to actin fi... 40 8.1
182gb|BC011471.1| Mus musculus B-cell CLL/lymphoma 7B, mRNA (cDNA c... 40 8.1
183gb|AC100209.13| Mus musculus chromosome 13, clone RP23-59L9, com... 40 8.1
184gb|AC151532.3| Mus musculus BAC clone RP24-279A12 from chromosom... 40 8.1
185gb|BC043614.2| Homo sapiens hypothetical protein LOC254848, mRNA... 40 8.1
186gb|AC175492.4| Mus musculus BAC clone RP24-76P21 from chromosome... 40 8.1
187emb|AL354993.24| Human DNA sequence from clone RP5-823G15 on chr... 40 8.1
188gb|AC091397.2| Rattus norvegicus strain Brown Norway clone RP31-... 40 8.1
189gb|AC090529.2| Rattus norvegicus strain Brown Norway clone RP31-... 40 8.1
190emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 40 8.1
191emb|AL133452.1|ATF26O13 Arabidopsis thaliana DNA chromosome 3, B... 40 8.1
192emb|AJ414156.1| Yersinia pestis strain CO92 complete genome; seg... 40 8.1
193gb|AC153135.5| Mus musculus BAC clone RP24-181M6 from chromosome... 40 8.1
194gb|AC142261.5| Mus musculus BAC clone RP24-469C3 from chromosome... 40 8.1
195gb|AC182038.2| Mus musculus BAC clone RP24-95H15 from chromosome... 40 8.1
196dbj|AK127962.1| Homo sapiens cDNA FLJ46074 fis, clone TESTI20019... 40 8.1
197emb|CR606819.1| full-length cDNA clone CS0DI066YF01 of Placenta ... 40 8.1
198gb|AC112233.3| Homo sapiens BAC clone RP11-211G17 from 4, comple... 40 8.1
199emb|CR594181.1| full-length cDNA clone CS0DL005YK22 of B cells (... 40 8.1
200gb|AC182366.4| Mus musculus BAC clone RP24-360I14 from chromosom... 40 8.1
201dbj|AK131643.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 40 8.1
202gb|AF404306.1| Rhizophydium sp. 136 mitochondrion, complete genome 40 8.1
203gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome... 40 8.1
204gb|AC177799.3| Mus musculus BAC clone RP24-374O22 from chromosom... 40 8.1
205dbj|AK155076.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 8.1
206gb|AY063759.1| Rattus norvegicus actin filament associated prote... 40 8.1
207gb|AC182447.2| Mus musculus BAC clone RP24-476M3 from chromosome... 40 8.1
208gb|AC163279.6| Mus musculus BAC clone RP24-112D16 from chromosom... 40 8.1
209gb|AC175663.3| Mus musculus BAC clone RP24-430F7 from chromosome... 40 8.1
210gb|AC155722.9| Mus musculus 6 BAC RP24-204J8 (Roswell Park Cance... 40 8.1
211gb|AC158653.7| Mus musculus 6 BAC RP23-418F10 (Roswell Park Canc... 40 8.1
212ref|NM_198595.1| Homo sapiens actin filament associated protein ... 40 8.1
213gb|AC127261.3| Mus musculus BAC clone RP24-316F4 from chromosome... 40 8.1
214ref|NM_021638.3| Homo sapiens actin filament associated protein ... 40 8.1
215gb|AC084593.1|CBRG42E09 Caenorhabditis briggsae cosmid G42E09, c... 40 8.1
216emb|BX936249.1| Gallus gallus finished cDNA, clone ChEST958k14 40 8.1
217emb|BX935075.1| Gallus gallus finished cDNA, clone ChEST74n16 40 8.1
218emb|BX931963.1| Gallus gallus finished cDNA, clone ChEST802g11 40 8.1
219dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 8.1
220gb|AF188700.1|AF188700 Homo sapiens actin filament associated pr... 40 8.1
221ref|NM_080900.1| Rattus norvegicus actin filament associated pro... 40 8.1
222ref|XM_579609.1| PREDICTED: Rattus norvegicus hypothetical gene ... 40 8.1
223gb|AC129774.4| Mus musculus BAC clone RP24-167G16 from chromosom... 40 8.1
224dbj|AK219291.1| Mus musculus cDNA, clone:Y2G0148A06, strand:plus... 40 8.1
225gb|BC032777.1| Homo sapiens actin filament associated protein, t... 40 8.1
226emb|BX936423.12| Zebrafish DNA sequence from clone DKEY-174M14 i... 40 8.1
227gb|AC004169.3|AC004169 Homo sapiens chromosome 4 clone C0236G06 ... 40 8.1
228gb|AF096709.1|AF096709 Drosophila virilis tyrosyl-tRNA synthetas... 40 8.1
229emb|BX510915.23| Zebrafish DNA sequence from clone DKEY-24M12 in... 40 8.1
230gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1... 40 8.1
231emb|AL845497.10| Mouse DNA sequence from clone RP23-232K9 on chr... 40 8.1
232gb|AC147108.3| Mus musculus BAC clone RP24-70D19 from 13, comple... 40 8.1
233gb|AC148329.3| Mus musculus BAC clone RP24-176F13 from Y, comple... 40 8.1
234gb|AC147630.4| Mus musculus BAC clone RP24-530L22 from Y, comple... 40 8.1
235ref|NM_009745.1| Mus musculus B-cell CLL/lymphoma 7B (Bcl7b), mRNA 40 8.1
236dbj|AB209676.1| Homo sapiens mRNA for actin filament associated ... 40 8.1
237emb|AJ011145.1|MMU011145 Mus musculus mRNA for protein encoded b... 40 8.1
238emb|AL929187.5| Mouse DNA sequence from clone RP23-8G6 on chromo... 40 8.1
239emb|AL731789.9| Mouse DNA sequence from clone RP23-52F6 on chrom... 40 8.1
240gb|L11440.1|DENENVGLYS Dengue virus type 3 membrane protein (prM... 40 8.1
241gb|L11424.1|DENENVGLYC Dengue virus type 3 membrane protein (prM... 40 8.1

>gb|AF074969.1|AF074969 Triticum aestivum heat shock protein 70 (HSP70) mRNA, HSP70-S allele,
            complete cds
          Length = 1569

 Score =  434 bits (219), Expect = e-118
 Identities = 246/255 (96%)
 Strand = Plus / Minus

                                                                        
Query: 340  cagctccaggggtagggccagatccctgctgctggtagagggactgaccaagctgcatca 399
            ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 1278 cagctccaggggtagggcctgacccctgctgctggtagagggactgaccaagctgcatca 1219

                                                                        
Query: 400  cttcttggttcaacgcagctagtgcatcctttatcgtctctgtcgatccaccagcaacag 459
            ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
Sbjct: 1218 cttcttggttcaacgcagctagtgcatcctttatcgtctgtgtcgatccaccagcaacgg 1159

                                                                        
Query: 460  cgtcctggagttccttgagcttcccctccaccttctccttgacatcgccggggaccttgt 519
            || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1158 cgacctggagttccttgagcttcccctccaccttctccttgacatcgcctgggaccttgt 1099

                                                                        
Query: 520  ctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctggttcttgg 579
            | || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 1098 ccccgagctccttcagttgtttctcagtctggtagatcacagattctgcctggttcttgg 1039

                           
Query: 580  tgtcaattgcgtccc 594
            |||||||||||||||
Sbjct: 1038 tgtcaattgcgtccc 1024



 Score =  176 bits (89), Expect = 5e-41
 Identities = 123/133 (92%), Gaps = 1/133 (0%)
 Strand = Plus / Minus

                                                                        
Query: 181  tactaggcaatcctgttgaacaaaatcatactcacttgttgcaccatgtcctaacctaca 240
            |||||||||||| ||| ||||||| ||||||||||||||| || ||||||||||||||| 
Sbjct: 1442 tactaggcaatcatgtggaacaaattcatactcacttgtt-catcatgtcctaacctact 1384

                                                                        
Query: 241  gttctattcaattgctatcagtaaaatcagcgtctataacgtcaccaccatcgcctgtct 300
            |||||||||||||||| ||  |||||||||||||||| ||||||||||||||||||||||
Sbjct: 1383 gttctattcaattgctgtcgataaaatcagcgtctatgacgtcaccaccatcgcctgtct 1324

                         
Query: 301  tctcagatgggcc 313
            |||||||||||||
Sbjct: 1323 tctcagatgggcc 1311



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 56/65 (86%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                        
Query: 114  tgaactctccaaacctccaacatcacgaactc---cgataccctgacaggagacaaggtc 170
            |||||||||||||||||||||||||  |||||   | | |||||||||||| ||||||||
Sbjct: 1533 tgaactctccaaacctccaacatcaaaaactcgtacaacaccctgacaggaaacaaggtc 1474

                 
Query: 171  ccaat 175
             ||||
Sbjct: 1473 tcaat 1469



to top

>gb|AC098572.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
             OJ1234_D05, complete sequence
          Length = 107476

 Score =  224 bits (113), Expect = 3e-55
 Identities = 194/221 (87%)
 Strand = Plus / Minus

                                                                         
Query: 374   gtagagggactgaccaagctgcatcacttcttggttcaacgcagctagtgcatcctttat 433
             |||||||| ||| || |||||||||||||| |||||||  ||||| || |||||||| ||
Sbjct: 37314 gtagagggcctgccccagctgcatcacttcctggttcagagcagcgagagcatccttcat 37255

                                                                         
Query: 434   cgtctctgtcgatccaccagcaacagcgtcctggagttccttgagcttcccctccacctt 493
             ||||| |||||| ||||| ||||||||||||| ||| ||| | |||||| |||| |||||
Sbjct: 37254 cgtctgtgtcgagccacctgcaacagcgtccttgagctccgtcagcttcgcctcaacctt 37195

                                                                         
Query: 494   ctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtctggta 553
               |||| |||||||| ||||||||||| || |||||||||| ||||||||||||||||||
Sbjct: 37194 acccttcacatcgcctgggaccttgtcaccgagctccttcaattgtttctcagtctggta 37135

                                                      
Query: 554   gatcacagactctgcctggttcttggtgtcaattgcgtccc 594
             ||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 37134 gatgacagactctgcctggttcttggtgtcgattgcgtccc 37094



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  224 bits (113), Expect = 3e-55
 Identities = 194/221 (87%)
 Strand = Plus / Minus

                                                                            
Query: 374      gtagagggactgaccaagctgcatcacttcttggttcaacgcagctagtgcatcctttat 433
                |||||||| ||| || |||||||||||||| |||||||  ||||| || |||||||| ||
Sbjct: 13493268 gtagagggcctgccccagctgcatcacttcctggttcagagcagcgagagcatccttcat 13493209

                                                                            
Query: 434      cgtctctgtcgatccaccagcaacagcgtcctggagttccttgagcttcccctccacctt 493
                ||||| |||||| ||||| ||||||||||||| ||| ||| | |||||| |||| |||||
Sbjct: 13493208 cgtctgtgtcgagccacctgcaacagcgtccttgagctccgtcagcttcgcctcaacctt 13493149

                                                                            
Query: 494      ctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtctggta 553
                  |||| |||||||| ||||||||||| || |||||||||| ||||||||||||||||||
Sbjct: 13493148 acccttcacatcgcctgggaccttgtcaccgagctccttcaattgtttctcagtctggta 13493089

                                                         
Query: 554      gatcacagactctgcctggttcttggtgtcaattgcgtccc 594
                ||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 13493088 gatgacagactctgcctggttcttggtgtcgattgcgtccc 13493048



to top

>dbj|AK060410.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-D10, full
            insert sequence
          Length = 1581

 Score =  216 bits (109), Expect = 6e-53
 Identities = 193/221 (87%)
 Strand = Plus / Minus

                                                                        
Query: 374  gtagagggactgaccaagctgcatcacttcttggttcaacgcagctagtgcatcctttat 433
            |||||||| ||| || |||||||||||||| ||||||   ||||| || |||||||| ||
Sbjct: 1250 gtagagggcctgccccagctgcatcacttcctggttcggagcagcgagagcatccttcat 1191

                                                                        
Query: 434  cgtctctgtcgatccaccagcaacagcgtcctggagttccttgagcttcccctccacctt 493
            ||||| |||||| ||||| ||||||||||||| ||| ||| | |||||| |||| |||||
Sbjct: 1190 cgtctgtgtcgagccacctgcaacagcgtccttgagctccgtcagcttcgcctcaacctt 1131

                                                                        
Query: 494  ctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtctggta 553
              |||| |||||||| ||||||||||| || |||||||||| ||||||||||||||||||
Sbjct: 1130 acccttcacatcgcctgggaccttgtcaccgagctccttcaattgtttctcagtctggta 1071

                                                     
Query: 554  gatcacagactctgcctggttcttggtgtcaattgcgtccc 594
            ||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 1070 gatgacagactctgcctggttcttggtgtcgattgcgtccc 1030



to top

>gb|AY108828.1| Zea mays PCO138532 mRNA sequence
          Length = 662

 Score =  139 bits (70), Expect = 1e-29
 Identities = 180/214 (84%), Gaps = 2/214 (0%)
 Strand = Plus / Minus

                                                                       
Query: 374 gtagagggactgaccaagctgcatcacttcttggttcaacgcagctagtg-catccttta 432
           |||||||||||| |||| |||||| ||||| |||||||| ||| ||| || | ||||| |
Sbjct: 360 gtagagggactgcccaatctgcatgacttcctggttcaatgca-ctaatggcgtccttca 302

                                                                       
Query: 433 tcgtctctgtcgatccaccagcaacagcgtcctggagttccttgagcttcccctccacct 492
           |||||| ||| || |||||||||||||| |||| ||| || |  ||||||  ||| ||||
Sbjct: 301 tcgtctgtgtggagccaccagcaacagcatccttgagctcttgcagcttcgactcgacct 242

                                                                       
Query: 493 tctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtctggt 552
           || ||||||| ||||| ||||||||||| || || ||||||||||||||||| |||||||
Sbjct: 241 tccccttgacgtcgcccgggaccttgtcccctagttccttcagttgtttctcggtctggt 182

                                             
Query: 553 agatcacagactctgcctggttcttggtgtcaat 586
           | || || ||||| || |||||||||||||||||
Sbjct: 181 aaatgaccgactcggcttggttcttggtgtcaat 148



to top

>gb|AY104911.1| Zea mays PCO138533 mRNA sequence
          Length = 1751

 Score =  109 bits (55), Expect = 1e-20
 Identities = 178/219 (81%)
 Strand = Plus / Minus

                                                                        
Query: 374  gtagagggactgaccaagctgcatcacttcttggttcaacgcagctagtgcatcctttat 433
            |||||||| ||| || | |||||| ||||| ||||||||||||   |  || ||||| ||
Sbjct: 1387 gtagagggcctgcccgatctgcatgacttcctggttcaacgcactcatggcgtccttcat 1328

                                                                        
Query: 434  cgtctctgtcgatccaccagcaacagcgtcctggagttccttgagcttcccctccacctt 493
            |||||  || || |||||||||||||| |||| ||| || |  ||||||  ||| || ||
Sbjct: 1327 cgtctgcgtggagccaccagcaacagcatccttgagctcttgcagcttcgactcgacttt 1268

                                                                        
Query: 494  ctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtctggta 553
            | ||||||| || || ||||||||||| || || ||||||||||| ||||| ||||||||
Sbjct: 1267 ccccttgacgtcacctgggaccttgtcccctagttccttcagttgcttctcggtctggta 1208

                                                   
Query: 554  gatcacagactctgcctggttcttggtgtcaattgcgtc 592
            ||| || ||||| || ||||||||||||||||| |||||
Sbjct: 1207 gatgaccgactcggcttggttcttggtgtcaatggcgtc 1169



to top

>gb|BT018142.1| Zea mays clone EL01N0555B07.c mRNA sequence
          Length = 1284

 Score =  105 bits (53), Expect = 2e-19
 Identities = 164/201 (81%)
 Strand = Plus / Minus

                                                                       
Query: 392 ctgcatcacttcttggttcaacgcagctagtgcatcctttatcgtctctgtcgatccacc 451
           |||||| ||||| ||||||||||||  ||  |  ||||| || ||||  ||||| |||| 
Sbjct: 949 ctgcatgacttcctggttcaacgcacttatggggtccttcattgtctgcgtcgagccact 890

                                                                       
Query: 452 agcaacagcgtcctggagttccttgagcttcccctccaccttctccttgacatcgccggg 511
           ||||||||| |||| ||| || |  ||||||  ||| || ||| ||||||| || || ||
Sbjct: 889 agcaacagcatccttgagctcttgcagcttcgactcgactttccccttgacgtcacctgg 830

                                                                       
Query: 512 gaccttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctg 571
           ||||||||| ||||| ||||||||||| ||||| ||||||||||| || ||||| || ||
Sbjct: 829 gaccttgtccccaagttccttcagttgcttctcggtctggtagatgaccgactcggcttg 770

                                
Query: 572 gttcttggtgtcaattgcgtc 592
           ||||||||||||||| |||||
Sbjct: 769 gttcttggtgtcaatggcgtc 749



to top

>gb|AY105690.1| Zea mays PCO065072 mRNA sequence
          Length = 1632

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 164/203 (80%)
 Strand = Plus / Minus

                                                                        
Query: 387  ccaagctgcatcacttcttggttcaacgcagctagtgcatcctttatcgtctctgtcgat 446
            |||| ||||||||| || |||||||  ||||| |  ||||| || ||  ||| ||| |||
Sbjct: 1233 ccaatctgcatcacctcctggttcagagcagccatggcatctttcatactctgtgttgat 1174

                                                                        
Query: 447  ccaccagcaacagcgtcctggagttccttgagcttcccctccaccttctccttgacatcg 506
            ||||||| ||  ||||| | ||| |||| ||||||| | ||||||||||| || |||   
Sbjct: 1173 ccaccagaaatggcgtctttgagctcctggagcttcacatccaccttctctttcacagga 1114

                                                                        
Query: 507  ccggggaccttgtctccaagctccttcagttgtttctcagtctggtagatcacagactct 566
             ||||||| ||||| ||||||||||||||||| |||||||||||||||| |||||| || 
Sbjct: 1113 gcggggactttgtcgccaagctccttcagttgcttctcagtctggtagaccacagaatcg 1054

                                   
Query: 567  gcctggttcttggtgtcaattgc 589
            ||||| || || ||||| |||||
Sbjct: 1053 gcctgattttttgtgtcgattgc 1031



to top

>gb|AY224466.1| Oryza sativa (japonica cultivar-group) isolate 23949 heat
           shock-related protein mRNA, partial cds
          Length = 1257

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                       
Query: 513 accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 572
           |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 992 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 933

                         
Query: 573 ttcttggtgtcaat 586
           || ||||| |||||
Sbjct: 932 tttttggtatcaat 919



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                           
Query: 513     accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 572
               |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 7990287 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 7990228

                             
Query: 573     ttcttggtgtcaat 586
               || ||||| |||||
Sbjct: 7990227 tttttggtatcaat 7990214



to top

>dbj|AK121949.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107J07, full
            insert sequence
          Length = 2462

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                        
Query: 513  accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 572
            |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 1883 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 1824

                          
Query: 573  ttcttggtgtcaat 586
            || ||||| |||||
Sbjct: 1823 tttttggtatcaat 1810



to top

>dbj|AK119535.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B03, full
            insert sequence
          Length = 1667

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                        
Query: 513  accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 572
            |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 1112 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 1053

                          
Query: 573  ttcttggtgtcaat 586
            || ||||| |||||
Sbjct: 1052 tttttggtatcaat 1039



to top

>dbj|AK072071.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013111L16, full
            insert sequence
          Length = 2201

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                        
Query: 513  accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 572
            |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 1628 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 1569

                          
Query: 573  ttcttggtgtcaat 586
            || ||||| |||||
Sbjct: 1568 tttttggtatcaat 1555



to top

>dbj|AK069937.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038F19, full
           insert sequence
          Length = 1293

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                       
Query: 513 accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 572
           |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 714 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 655

                         
Query: 573 ttcttggtgtcaat 586
           || ||||| |||||
Sbjct: 654 tttttggtatcaat 641



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                           
Query: 513     accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 572
               |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 7990168 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 7990109

                             
Query: 573     ttcttggtgtcaat 586
               || ||||| |||||
Sbjct: 7990108 tttttggtatcaat 7990095



to top

>emb|AL831810.4|CNS08CAN Oryza sativa chromosome 12, . BAC OSJNBa0077B14 of library OSJNBa
            from chromosome 12 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 153111

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Plus

                                                                        
Query: 513  accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 572
            |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 9883 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 9942

                          
Query: 573  ttcttggtgtcaat 586
            || ||||| |||||
Sbjct: 9943 tttttggtatcaat 9956



to top

>gb|BT016772.1| Zea mays clone Contig605 mRNA sequence
          Length = 1938

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                        
Query: 508  cggggaccttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctg 567
            ||||||| || || ||||||||||||||||| |||||||||||||||| |||||| || |
Sbjct: 1425 cggggactttatcgccaagctccttcagttgcttctcagtctggtagaccacagaatcgg 1366

                                  
Query: 568  cctggttcttggtgtcaattgc 589
            |||| || || |||||||||||
Sbjct: 1365 cctgattttttgtgtcaattgc 1344



to top

>gb|DQ224261.1| Aquilegia pyrenaica putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1268

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                        
Query: 489  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 548
            |||||||||||||||||  | |||||||||||||| | |||||| || || ||||| |||
Sbjct: 1072 accttctccttgacatcagcagggaccttgtctcccaactccttgagctgcttctccgtc 1013

                                                  
Query: 549  tggtagatcacagactctgcctggttcttggtgtcaat 586
            |||||||  ||||| ||||| |||||||| ||||||||
Sbjct: 1012 tggtagacaacagaatctgcttggttctttgtgtcaat 975



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 378  agggactgaccaagctgcatcacttcttggtt 409
            |||||||||||||||||||| ||||| |||||
Sbjct: 1183 agggactgaccaagctgcattacttcctggtt 1152



to top

>gb|DQ224260.1| Aquilegia brevistyla putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1271

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                        
Query: 489  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 548
            |||||||||||||||||  | |||||||||||||| | |||||| || || ||||| |||
Sbjct: 1075 accttctccttgacatcagcagggaccttgtctcccaactccttgagctgcttctccgtc 1016

                                                  
Query: 549  tggtagatcacagactctgcctggttcttggtgtcaat 586
            |||||||  ||||| ||||| |||||||| ||||||||
Sbjct: 1015 tggtagacaacagaatctgcttggttctttgtgtcaat 978



to top

>gb|DQ224258.1| Aquilegia formosa putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1271

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                        
Query: 489  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 548
            |||||||||||||||||  | |||||||||||||| | |||||| || || ||||| |||
Sbjct: 1075 accttctccttgacatcagcagggaccttgtctcccaactccttgagctgcttctccgtc 1016

                                                  
Query: 549  tggtagatcacagactctgcctggttcttggtgtcaat 586
            |||||||  ||||| ||||| |||||||| ||||||||
Sbjct: 1015 tggtagacaacagaatctgcttggttctttgtgtcaat 978



to top

>gb|BT024111.1| Zea mays clone EL01N0516B01 mRNA sequence
          Length = 2060

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                        
Query: 508  cggggaccttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctg 567
            ||||||| || || ||||||||||||||||| |||||||||||||||| |||||| || |
Sbjct: 1589 cggggactttatcgccaagctccttcagttgcttctcagtctggtagaccacagaatcgg 1530

                                  
Query: 568  cctggttcttggtgtcaattgc 589
            |||| || || |||||||||||
Sbjct: 1529 cctgattttttgtgtcaattgc 1508



to top

>emb|X69213.1|PSST70 P.sativum Psst70 gene for heat-shock protein
          Length = 4974

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 92/109 (84%)
 Strand = Plus / Minus

                                                                        
Query: 486  tccaccttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctca 545
            ||||||||||| || |||  | |||| || || ||||| ||||| |||| ||| ||||||
Sbjct: 3494 tccaccttctctttaacaggggcgggaactttctctcctagctctttcaattgcttctca 3435

                                                             
Query: 546  gtctggtagatcacagactctgcctggttcttggtgtcaattgcgtccc 594
            ||||||||||  ||||| |||||||||||||||||||| ||||| ||||
Sbjct: 3434 gtctggtagacaacagagtctgcctggttcttggtgtcgattgcttccc 3386



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 381  gactgaccaagctgcatcacttcttggtt 409
            ||||||||||||||||| ||||| |||||
Sbjct: 3599 gactgaccaagctgcataacttcctggtt 3571



to top

>gb|L03299.1|PEA70HSP Pisum sativum chloroplast stromal 70 kDa heat shock protein (hsp70)
            mRNA, complete cds
          Length = 2474

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 92/109 (84%)
 Strand = Plus / Minus

                                                                        
Query: 486  tccaccttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctca 545
            ||||||||||| || |||  | |||| || || ||||| ||||| |||| ||| ||||||
Sbjct: 1925 tccaccttctctttaacaggggcgggaactttctctcctagctctttcaattgcttctca 1866

                                                             
Query: 546  gtctggtagatcacagactctgcctggttcttggtgtcaattgcgtccc 594
            ||||||||||  ||||| |||||||||||||||||||| ||||| ||||
Sbjct: 1865 gtctggtagacaacagagtctgcctggttcttggtgtcgattgcttccc 1817



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 381  gactgaccaagctgcatcacttcttggtt 409
            ||||||||||||||||| ||||| |||||
Sbjct: 2030 gactgaccaagctgcataacttcctggtt 2002



to top

>gb|DQ224263.1| Semiaquilegia adoxoides putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1268

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 489  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 548
            |||||||||||||| ||  | |||||||||||||| |||||||| || || ||||| |||
Sbjct: 1072 accttctccttgacttcagcagggaccttgtctcccagctccttgagctgcttctccgtc 1013

                                                  
Query: 549  tggtagatcacagactctgcctggttcttggtgtcaat 586
            |||||||  ||||| ||||| || ||||| ||||||||
Sbjct: 1012 tggtagacaacagaatctgcttgattctttgtgtcaat 975



to top

>gb|DQ224262.1| Aquilegia olympica putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1269

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 489  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 548
            ||||| |||||||||||  | |||||||||||||| | |||||| || || ||||| |||
Sbjct: 1073 accttttccttgacatcagcagggaccttgtctcccaactccttgagctgcttctccgtc 1014

                                                  
Query: 549  tggtagatcacagactctgcctggttcttggtgtcaat 586
            |||||||  ||||| ||||| |||||||| ||||||||
Sbjct: 1013 tggtagacaacagaatctgcttggttctttgtgtcaat 976



to top

>gb|DQ224259.1| Aquilegia chrysantha putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1271

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 489  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 548
            |||||||||||||||||  | |||||||||||||| | |||||| || || || || |||
Sbjct: 1075 accttctccttgacatcagcagggaccttgtctcccaactccttgagctgcttttccgtc 1016

                                                  
Query: 549  tggtagatcacagactctgcctggttcttggtgtcaat 586
            |||||||  ||||| ||||| |||||||| ||||||||
Sbjct: 1015 tggtagacaacagaatctgcttggttctttgtgtcaat 978



to top

>gb|U92815.1|CLU92815 Citrullus lanatus heat shock protein 70 precursor mRNA, complete cds
          Length = 2430

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                        
Query: 513  accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 572
            |||||||||||||||||||||||||| ||||| ||||| || |  ||||| || || |||
Sbjct: 1898 accttgtctccaagctccttcagttgcttctctgtctgatacacaacagaatcagcttgg 1839

                       
Query: 573  ttcttggtgtc 583
            ||||| |||||
Sbjct: 1838 ttcttcgtgtc 1828



to top

>emb|X73961.1|CSHSP70 C.sativus mRNA for heat shock protein 70 (hsp70)
          Length = 2511

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 516  ttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctggttc 575
            ||||||||||||||||||||||| ||||| ||||| || |  ||||| || |||||||||
Sbjct: 1959 ttgtctccaagctccttcagttgcttctctgtctgatacacaacagaatcagcctggttc 1900

              
Query: 576  tt 577
            ||
Sbjct: 1899 tt 1898



to top

>gb|DQ224254.1| Aquilegia formosa heak shock protein 70 (HSP70) mRNA, partial cds
          Length = 548

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 489 accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 548
           ||||||||||| ||| |  | || ||||| ||||| | |||||| ||||||||||| |||
Sbjct: 352 accttctccttcacagcagcaggtaccttttctcccaactccttgagttgtttctctgtc 293

                                                 
Query: 549 tggtagatcacagactctgcctggttcttggtgtcaat 586
           |||||||  ||||| || || |||||||| ||||||||
Sbjct: 292 tggtagacaacagaatcggcttggttctttgtgtcaat 255



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 378 agggactgaccaagctgcatcacttcttggtt 409
           |||||||||||||||||||| ||||| |||||
Sbjct: 463 agggactgaccaagctgcattacttcctggtt 432



to top

>gb|AY072744.1| Dunaliella salina heat shock protein 70B (hsp70B) mRNA, complete cds
          Length = 2732

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 533  cagttgtttctcagtctggtagatcacagactctgcctggttcttggtgtc 583
            |||||| || ||||||||||||||||    |||||||||||||||||||||
Sbjct: 1776 cagttgcttttcagtctggtagatcatgctctctgcctggttcttggtgtc 1726



to top

>gb|AC140550.31| Medicago truncatula clone mth2-54a24, complete sequence
          Length = 129388

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                         
Query: 513   accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 572
             ||||| ||||| ||||| |||| ||| || |||||||||||||  ||||| || ||||| 
Sbjct: 28897 accttttctcctagctctttcaattgcttttcagtctggtagacaacagagtccgcctga 28838

                                   
Query: 573   ttcttggtgtcaattgcgtccc 594
             ||||| ||||| ||||| ||||
Sbjct: 28837 ttctttgtgtctattgcatccc 28816



to top

>dbj|AB181295.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, clone:NbHsp70cp-1
          Length = 741

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 381 gactgaccaagctgcatcacttcttggttcaacgcagc 418
           ||||| || |||||||| ||||||||||||||||||||
Sbjct: 587 gactgtcccagctgcatgacttcttggttcaacgcagc 550



to top

>ref|NM_118561.2| Arabidopsis thaliana CPHSC70-1; ATP binding AT4G24280 (CPHSC70-1)
            mRNA, complete cds
          Length = 2456

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 381  gactgaccaagctgcatcacttcttggtt 409
            |||||||||| ||||||||||||||||||
Sbjct: 2121 gactgaccaatctgcatcacttcttggtt 2093



to top

>gb|AY072138.1| Arabidopsis thaliana putative hsp 70 protein (At4g24280) mRNA,
            complete cds
          Length = 2495

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 381  gactgaccaagctgcatcacttcttggtt 409
            |||||||||| ||||||||||||||||||
Sbjct: 2122 gactgaccaatctgcatcacttcttggtt 2094



to top

>emb|AL078637.1|ATT22A6 Arabidopsis thaliana DNA chromosome 4, BAC clone T22A6 (ESSA project)
          Length = 108459

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 381   gactgaccaagctgcatcacttcttggtt 409
             |||||||||| ||||||||||||||||||
Sbjct: 44346 gactgaccaatctgcatcacttcttggtt 44318



to top

>emb|AL161561.2|ATCHRIV61 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 61
          Length = 198402

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 381   gactgaccaagctgcatcacttcttggtt 409
             |||||||||| ||||||||||||||||||
Sbjct: 61003 gactgaccaatctgcatcacttcttggtt 60975



to top

>gb|BT001950.1| Arabidopsis thaliana clone U19959 putative hsp 70 protein (At4g24280)
            mRNA, complete cds
          Length = 2188

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 381  gactgaccaagctgcatcacttcttggtt 409
            |||||||||| ||||||||||||||||||
Sbjct: 2015 gactgaccaatctgcatcacttcttggtt 1987



to top

>emb|AL034399.6|HS191P20 Human DNA sequence from clone RP6-191P20 on chromosome Xq23 Contains
             the TEX13B gene for testis expressed sequence 13B, a novel
             pseudogene, the 3' end of the MID2 gene for midline 2
             (FXY2, RNF60, TRIM1), a novel  gene and a CpG island,
             complete sequence
          Length = 118456

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 526   gctccttcagttgtttctcagtctggt 552
             |||||||||||||| ||||||||||||
Sbjct: 24846 gctccttcagttgtgtctcagtctggt 24820



to top

>emb|AL137065.10| Human DNA sequence from clone RP11-4P13 on chromosome Xq22.1-23,
             complete sequence
          Length = 119311

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 526   gctccttcagttgtttctcagtctggt 552
             |||||||||||||| ||||||||||||
Sbjct: 51509 gctccttcagttgtgtctcagtctggt 51535



to top

>emb|CR391911.15| Zebrafish DNA sequence from clone DKEYP-26A9 in linkage group 1, complete
              sequence
          Length = 194115

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 21     tatatttttctgttgcatttgt 42
              ||||||||||||||||||||||
Sbjct: 157467 tatatttttctgttgcatttgt 157488



to top

>ref|XM_734475.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000461.00.0)
           partial mRNA
          Length = 489

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 22  atatttttctgttgcatttgtt 43
           ||||||||||||||||||||||
Sbjct: 156 atatttttctgttgcatttgtt 177



to top

>emb|CR388402.15| Zebrafish DNA sequence from clone DKEY-97I21 in linkage group 1,
             complete sequence
          Length = 155300

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 21    tatatttttctgttgcatttgt 42
             ||||||||||||||||||||||
Sbjct: 88901 tatatttttctgttgcatttgt 88922



to top

>ref|NM_124369.2| Arabidopsis thaliana cpHSC70-2 (HEAT SHOCK PROTEIN 70-7); ATP binding
            AT5G49910 (cpHSC70-2) mRNA, complete cds
          Length = 2731

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 381  gactgaccaagctgcatcacttcttggtt 409
            ||||| |||| ||||||||||||||||||
Sbjct: 2071 gactggccaatctgcatcacttcttggtt 2043



to top

>ref|NM_124370.3| Arabidopsis thaliana unknown protein AT5G49920 mRNA, complete cds
          Length = 1876

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 381  gactgaccaagctgcatcacttcttggtt 409
            ||||| |||| ||||||||||||||||||
Sbjct: 1711 gactggccaatctgcatcacttcttggtt 1739



to top

>gb|AY766104.1| Dengue virus type 3 strain Singapore 8120/95, complete genome
          Length = 10696

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY665402.1| Dengue virus type 3 polyprotein gene, partial cds
          Length = 1923

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 620 cttgtctccaagctccttcag 600



to top

>gb|AY632355.1| Dengue virus type 3 isolate AM2394 from Brazil polyprotein gene,
           partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY662691.1| Dengue virus type 3 from Singapore, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|BT000919.1| Arabidopsis thaliana clone C105236 putative heat shock protein 70
            (At5g49910) mRNA, complete cds
          Length = 2187

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 381  gactgaccaagctgcatcacttcttggtt 409
            ||||| |||| ||||||||||||||||||
Sbjct: 2015 gactggccaatctgcatcacttcttggtt 1987



to top

>gb|AY099336.1| Dengue virus type 3 isolate D3/H/IMTSSA-SRI/2000/1266, complete
           genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AF547260.1| Dengue virus type 3 612210 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547242.1| Dengue virus type 3 L57 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547241.1| Dengue virus type 3 073 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547240.1| Dengue virus type 3 SOM079 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547239.1| Dengue virus type 3 251991 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547238.1| Dengue virus type 3 1559 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547237.1| Dengue virus type 3 1558 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547236.1| Dengue virus type 3 1557 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547235.1| Dengue virus type 3 D9397 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547234.1| Dengue virus type 3 D5231 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547233.1| Dengue virus type 3 D3197 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547232.1| Dengue virus type 3 D2803 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547231.1| Dengue virus type 3 D2863 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547230.1| Dengue virus type 3 D2783 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547229.1| Dengue virus type 3 D1440 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547228.1| Dengue virus type 3 D1336 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547227.1| Dengue virus type 3 D1307 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547226.1| Dengue virus type 3 D1306 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547225.1| Dengue virus type 3 D1266 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AY080761.1| Arabidopsis thaliana At5g49910 mRNA sequence
          Length = 2331

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 381  gactgaccaagctgcatcacttcttggtt 409
            ||||| |||| ||||||||||||||||||
Sbjct: 2071 gactggccaatctgcatcacttcttggtt 2043



to top

>emb|AJ271605.2|DSA271605 Dunaliella salina mRNA for chloroplast-localised heat shock protein
            (hsp70B gene)
          Length = 2764

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 540  ttctcagtctggtagatcacagactctgcctggttcttggt 580
            ||||| |||||||||||||    ||||||||||||||||||
Sbjct: 1825 ttctccgtctggtagatcatgctctctgcctggttcttggt 1785



to top

>gb|AC155270.3| Mus musculus BAC clone RP23-195H19 from chromosome 12, complete sequence
          Length = 215502

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 21     tatatttttctgttgcatttgttca 45
              |||||||||||||| ||||||||||
Sbjct: 128858 tatatttttctgtttcatttgttca 128834



to top

>gb|AC154913.4| Ornithorhynchus anatinus BAC clone OABb-535A1 from chromosome unknown,
              complete sequence
          Length = 199332

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 330    ccgtcagctccagctccaggg 350
              |||||||||||||||||||||
Sbjct: 144619 ccgtcagctccagctccaggg 144639



to top

>gb|DQ401695.1| Dengue virus type 3 isolate mutant PhMH-J1-97, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401694.1| Dengue virus type 3 isolate mutant InJ-I6-82, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401693.1| Dengue virus type 3 isolate mutant BDH02-07, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401692.1| Dengue virus type 3 isolate mutant BDH02-04, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401691.1| Dengue virus type 3 isolate mutant BDH02-03, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401690.1| Dengue virus type 3 isolate InJ-16-82, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401689.1| Dengue virus type 3 isolate mutant BDH02-01, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY496878.1| Dengue virus type 3 isolate BDH02-8 polyprotein gene, partial cds
          Length = 3033

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY496876.1| Dengue virus type 3 isolate BDH02-6 polyprotein gene, partial cds
          Length = 3033

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY496875.1| Dengue virus type 3 isolate BDH02-5 polyprotein gene, partial cds
          Length = 3033

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY496872.1| Dengue virus type 3 isolate BDH02-2 polyprotein gene, partial cds
          Length = 3033

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY496871.2| Dengue virus type 3 isolate BDH02-1, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY496873.2| Dengue virus type 3 isolate BDH02-3, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY496874.2| Dengue virus type 3 isolate BDH02-4, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY496877.2| Dengue virus type 3 isolate BDH02-7, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY496879.2| Dengue virus type 3 isolate PhMH-J1-97, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB214882.1| Dengue virus type 3 genomic RNA, neally complete genome,
           strain:D3/Hu/TL129NIID/2005
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB214881.1| Dengue virus type 3 genomic RNA, neally complete genome,
           strain:D3/Hu/TL109NIID/2005
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB214880.1| Dengue virus type 3 genomic RNA, neally complete genome,
           strain:D3/Hu/TL029NIID/2005
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB214879.1| Dengue virus type 3 genomic RNA, neally complete genome,
           strain:D3/Hu/TL018NIID/2005
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY960633.1| Dengue virus type 3 isolate RGN576 polyprotein gene, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY960632.1| Dengue virus type 3 isolate MTO3103 polyprotein gene, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY960629.1| Dengue virus type 3 isolate CEA4739 polyprotein gene, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY960628.1| Dengue virus type 3 isolate Bel73318 polyprotein gene, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY265857.1| Dengue virus type 3 isolate NAMRU-2 98901620 polyprotein gene,
           partial cds
          Length = 2207

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 510 cttgtctccaagctccttcag 490



to top

>gb|AY265856.1| Dengue virus type 3 isolate NAMRU-2 98901413 polyprotein gene,
           partial cds
          Length = 2207

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 510 cttgtctccaagctccttcag 490



to top

>gb|AY923865.1| Dengue virus type 3 strain C0360/94, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY912458.1| Dengue virus type 3 strain KPS-4-0657/207 polyprotein mRNA, partial
           cds
          Length = 3469

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY912455.1| Dengue virus type 3 strain 98901640 polyprotein mRNA, partial cds
          Length = 3469

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY912454.1| Dengue virus type 3 strain 98901590 polyprotein mRNA, partial cds
          Length = 3469

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AF217459.1|AF217459 Arabidopsis thaliana heat shock protein 70 (Hsc70-7) mRNA, complete
            cds; nuclear gene for chloroplast product
          Length = 2157

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 381  gactgaccaagctgcatcacttcttggtt 409
            ||||| |||| ||||||||||||||||||
Sbjct: 2015 gactggccaatctgcatcacttcttggtt 1987



to top

>gb|AF349753.1|AF349753 Dengue virus type 3 strain PaH881/88 polyprotein precursor, prM-E
           genes, partial cds
          Length = 2150

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 454 cttgtctccaagctccttcag 434



to top

>gb|AF317645.1|AF317645 Dengue virus type 3 strain 80-2, complete genome
          Length = 10696

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB189127.1| Dengue virus type 3 genomic RNA, complete genome, strain: 98901517
           DHF DV-3
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB189126.1| Dengue virus type 3 genomic RNA, complete genome, strain: 98901437
           DSS DV-3
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB189125.1| Dengue virus type 3 genomic RNA, complete genome, strain: 98901403
           DSS DV-3
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>emb|AL935144.11| Zebrafish DNA sequence from clone CH211-89B14 in linkage group 23,
             complete sequence
          Length = 155322

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 237   tacagttctattcaattgcta 257
             |||||||||||||||||||||
Sbjct: 44112 tacagttctattcaattgcta 44092



to top

>dbj|AB024032.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9P8
          Length = 70670

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 381   gactgaccaagctgcatcacttcttggtt 409
             ||||| |||| ||||||||||||||||||
Sbjct: 36113 gactggccaatctgcatcacttcttggtt 36085



to top

>emb|AJ563355.1|DVI563355 Dengue virus type 3 proviral partial gene for polyprotein, genomic
           RNA
          Length = 2348

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 542 cttgtctccaagctccttcag 522



to top

>gb|M93130.1|DENCME Dengue type 3 virus complete genome RNA, complete cds
          Length = 10696

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676353.1| Dengue virus type 3 strain ThD3_0007_87, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676352.1| Dengue virus type 3 strain ThD3_0010_87, complete genome
          Length = 10709

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676351.1| Dengue virus type 3 strain ThD3_0055_93, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676350.1| Dengue virus type 3 strain ThD3_0104_93, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676349.1| Dengue virus type 3 strain ThD3_1283_98, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676348.1| Dengue virus type 3 strain ThD3_1687_98, complete genome
          Length = 10702

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AC122767.16| Mus musculus chromosome 7, clone RP24-143L4, complete sequence
          Length = 192484

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 525    agctccttcagttgtttctcagtct 549
              |||||||||| ||||||||||||||
Sbjct: 116930 agctccttcatttgtttctcagtct 116954



to top

>gb|M86733.1|DENENVAA Dengue virus type 3 structural proteins, complete cds
          Length = 2297

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 663 cttgtctccaagctccttcag 643



to top

>gb|AY858048.1| Dengue virus type 3 strain TB55i, complete genome
          Length = 10697

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY858047.1| Dengue virus type 3 strain TB16, complete genome
          Length = 10658

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 764 cttgtctccaagctccttcag 744



to top

>gb|AY858046.1| Dengue virus type 3 strain PI64, complete genome
          Length = 10699

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 786 cttgtctccaagctccttcag 766



to top

>gb|AY858045.1| Dengue virus type 3 strain PH86, complete genome
          Length = 10695

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 793 cttgtctccaagctccttcag 773



to top

>gb|AY858044.1| Dengue virus type 3 strain KJ71, complete genome
          Length = 10685

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 783 cttgtctccaagctccttcag 763



to top

>gb|AY858042.1| Dengue virus type 3 strain KJ30i, complete genome
          Length = 10690

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY858041.1| Dengue virus type 3 strain FW06, complete genome
          Length = 10687

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 783 cttgtctccaagctccttcag 763



to top

>gb|AY858040.1| Dengue virus type 3 strain FW01, complete genome
          Length = 10704

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 792 cttgtctccaagctccttcag 772



to top

>gb|AY858039.1| Dengue virus type 3 strain den3_98, complete genome
          Length = 10661

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 783 cttgtctccaagctccttcag 763



to top

>gb|AY858037.1| Dengue virus type 3 strain BA51, complete genome
          Length = 10705

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 792 cttgtctccaagctccttcag 772



to top

>gb|M25277.1|DENSP5AA Dengue virus type 3 5' region of the genome encoding structural
           proteins
          Length = 3000

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|L11620.1|DENENVGLYW Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>dbj|AB010990.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain Z026
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010989.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM181
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010988.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM180
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010987.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM119
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010986.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM098
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010985.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM091
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010984.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM086
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010983.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM068
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010982.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM006
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>gb|L11427.1|DENENVGLYF Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11442.1|DENENVGLYU Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11441.1|DENENVGLYT Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11439.1|DENENVGLYR Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11438.1|DENENVGLYQ Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11437.1|DENENVGLYP Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11436.1|DENENVGLYO Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11435.1|DENENVGLYN Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11434.1|DENENVGLYM Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11433.1|DENENVGLYL Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11431.1|DENENVGLYJ Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11430.1|DENENVGLYI Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11429.1|DENENVGLYH Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11428.1|DENENVGLYG Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11426.1|DENENVGLYE Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11425.1|DENENVGLYD Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11423.1|DENENVGLYB Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 515 cttgtctccaagctccttcag 535
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AC164094.5| Mus musculus BAC clone RP23-133F10 from chromosome 6, complete sequence
          Length = 216271

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 525    agctccttcagttgtttctc 544
              ||||||||||||||||||||
Sbjct: 116707 agctccttcagttgtttctc 116726



to top

>ref|XM_517100.1| PREDICTED: Pan troglodytes similar to actin filament associated
            protein; actin filament-associated protein, 110 kDa
            (LOC461110), mRNA
          Length = 2649

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 2327 ccgtcagctccagctccagg 2308



to top

>gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 4, complete
              sequence
          Length = 1783081

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 487    ccaccttctccttgacatcg 506
              ||||||||||||||||||||
Sbjct: 461214 ccaccttctccttgacatcg 461195



to top

>gb|AE017129.1| Yersinia pestis biovar Medievalis str. 91001 section 3 of 16 of the
              complete genome
          Length = 290002

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 526    gctccttcagttgtttctca 545
              ||||||||||||||||||||
Sbjct: 138274 gctccttcagttgtttctca 138293



to top

>gb|AC159249.3| Mus musculus BAC clone RP24-177C7 from chromosome y, complete sequence
          Length = 146406

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    tttatgatatatatttttct 31
             ||||||||||||||||||||
Sbjct: 32465 tttatgatatatatttttct 32446



to top

>gb|AC147625.3| Mus musculus BAC clone RP24-348P17 from chromosome Y, complete sequence
          Length = 176911

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    tttatgatatatatttttct 31
             ||||||||||||||||||||
Sbjct: 76074 tttatgatatatatttttct 76055



to top

>gb|AC147105.2| Mus musculus BAC clone RP24-66E5 from chromosome Y, complete sequence
          Length = 223344

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     tttatgatatatatttttct 31
              ||||||||||||||||||||
Sbjct: 163875 tttatgatatatatttttct 163856



to top

>gb|AC145602.3| Mus musculus BAC clone RP24-240M7 from chromosome Y, complete sequence
          Length = 160337

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tttatgatatatatttttct 31
              ||||||||||||||||||||
Sbjct: 134099 tttatgatatatatttttct 134118



to top

>gb|AC146597.3| Mus musculus BAC clone RP24-230I13 from chromosome Y, complete sequence
          Length = 181426

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     tttatgatatatatttttct 31
              ||||||||||||||||||||
Sbjct: 112347 tttatgatatatatttttct 112328



to top

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 526     gctccttcagttgtttctca 545
               ||||||||||||||||||||
Sbjct: 1039240 gctccttcagttgtttctca 1039259



to top

>gb|AC182456.2| Mus musculus BAC clone RP24-65H21 from chromosome y, complete sequence
          Length = 194102

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     tttatgatatatatttttct 31
              ||||||||||||||||||||
Sbjct: 109407 tttatgatatatatttttct 109388



to top

>gb|AC147709.1| Mus musculus BAC clone RP24-97E15 from chromosome Y, complete sequence
          Length = 197983

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     tttatgatatatatttttct 31
              ||||||||||||||||||||
Sbjct: 174328 tttatgatatatatttttct 174309



to top

>gb|AC144646.3| Mus musculus BAC clone RP24-388P5 from chromosome Y, complete sequence
          Length = 151248

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    tttatgatatatatttttct 31
             ||||||||||||||||||||
Sbjct: 66035 tttatgatatatatttttct 66016



to top

>gb|AC092129.3| Homo sapiens chromosome 16 clone RP11-140O8, complete sequence
          Length = 190333

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 493    tctccttgacatcgccgggg 512
              ||||||||||||||||||||
Sbjct: 103364 tctccttgacatcgccgggg 103383



to top

>ref|XM_570650.1| Cryptococcus neoformans var. neoformans JEC21 translation repressor
            (CND01700) partial mRNA
          Length = 4559

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 487  ccaccttctccttgacatcg 506
            ||||||||||||||||||||
Sbjct: 3909 ccaccttctccttgacatcg 3890



to top

>gb|BC014113.1| Homo sapiens hypothetical protein LOC254848, mRNA (cDNA clone
           IMAGE:4544270), with apparent retained intron
          Length = 2136

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 330 ccgtcagctccagctccagg 349
           ||||||||||||||||||||
Sbjct: 330 ccgtcagctccagctccagg 349



to top

>gb|AC121941.3| Mus musculus BAC clone RP24-209I3 from chromosome 2, complete sequence
          Length = 165818

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 525    agctccttcagttgtttctc 544
              ||||||||||||||||||||
Sbjct: 122438 agctccttcagttgtttctc 122457



to top

>gb|AC123034.5| Mus musculus BAC clone RP24-484E17 from chromosome 13, complete
             sequence
          Length = 177675

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 14    tatgatatatatttttctgt 33
             ||||||||||||||||||||
Sbjct: 72147 tatgatatatatttttctgt 72166



to top

>gb|AC112254.6| Homo sapiens BAC clone RP11-1156I21 from 4, complete sequence
          Length = 91840

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 1890 ccgtcagctccagctccagg 1909



to top

>gb|AC024607.3| Mus musculus strain C57BL6/J chromosome 5 clone RP23-240H6, complete
             sequence
          Length = 197273

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 365   ctgctgctggtagagggactgacc 388
             |||||||||| |||||||||||||
Sbjct: 96792 ctgctgctgggagagggactgacc 96815



to top

>gb|AC117190.3| Mus musculus BAC clone RP23-55A21 from 2, complete sequence
          Length = 189549

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 525    agctccttcagttgtttctc 544
              ||||||||||||||||||||
Sbjct: 104350 agctccttcagttgtttctc 104331



to top

>ref|XM_545904.2| PREDICTED: Canis familiaris similar to actin filament associated
            protein (LOC488786), mRNA
          Length = 2574

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 2179 ccgtcagctccagctccagg 2160



to top

>gb|BC011471.1| Mus musculus B-cell CLL/lymphoma 7B, mRNA (cDNA clone MGC:18340
            IMAGE:3660754), complete cds
          Length = 1638

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 365  ctgctgctggtagagggactgacc 388
            |||||||||| |||||||||||||
Sbjct: 1133 ctgctgctgggagagggactgacc 1156



to top

>gb|AC100209.13| Mus musculus chromosome 13, clone RP23-59L9, complete sequence
          Length = 215769

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 479   cttcccctccaccttctcct 498
             ||||||||||||||||||||
Sbjct: 29961 cttcccctccaccttctcct 29942



to top

>gb|AC151532.3| Mus musculus BAC clone RP24-279A12 from chromosome y, complete
            sequence
          Length = 158231

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 12   tttatgatatatatttttct 31
            ||||||||||||||||||||
Sbjct: 5698 tttatgatatatatttttct 5717



to top

>gb|BC043614.2| Homo sapiens hypothetical protein LOC254848, mRNA (cDNA clone
           IMAGE:6050645), partial cds
          Length = 3021

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 330 ccgtcagctccagctccagg 349
           ||||||||||||||||||||
Sbjct: 776 ccgtcagctccagctccagg 795



to top

>gb|AC175492.4| Mus musculus BAC clone RP24-76P21 from chromosome y, complete sequence
          Length = 203854

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     tttatgatatatatttttct 31
              ||||||||||||||||||||
Sbjct: 190676 tttatgatatatatttttct 190657



to top

>emb|AL354993.24| Human DNA sequence from clone RP5-823G15 on chromosome 20q13.2-13.3
             Contains the PPIAL2 gene for peptidylprolyl isomerase A
             (cyclophilin A)-like 2 (pseudogene) and the 3' end of the
             gene for a novel protein (FLJ33887), complete sequence
          Length = 106736

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 475   tgagcttcccctccaccttc 494
             ||||||||||||||||||||
Sbjct: 21865 tgagcttcccctccaccttc 21846



to top

>gb|AC091397.2| Rattus norvegicus strain Brown Norway clone RP31-246E3, complete
             sequence
          Length = 73920

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 365   ctgctgctggtagagggactgacc 388
             |||||||||| |||||||||||||
Sbjct: 57043 ctgctgctggaagagggactgacc 57066



to top

>gb|AC090529.2| Rattus norvegicus strain Brown Norway clone RP31-160L19, complete
            sequence
          Length = 165686

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 365  ctgctgctggtagagggactgacc 388
            |||||||||| |||||||||||||
Sbjct: 7266 ctgctgctggaagagggactgacc 7289



to top

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 526     gctccttcagttgtttctca 545
               ||||||||||||||||||||
Sbjct: 1033689 gctccttcagttgtttctca 1033708



to top

>emb|AL133452.1|ATF26O13 Arabidopsis thaliana DNA chromosome 3, BAC clone F26O13
          Length = 94349

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 6     tagtgatttatgatatatattttt 29
             |||||||||||||||| |||||||
Sbjct: 49942 tagtgatttatgatatgtattttt 49965



to top

>emb|AJ414156.1| Yersinia pestis strain CO92 complete genome; segment 16/20
          Length = 220050

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 526   gctccttcagttgtttctca 545
             ||||||||||||||||||||
Sbjct: 59323 gctccttcagttgtttctca 59304



to top

>gb|AC153135.5| Mus musculus BAC clone RP24-181M6 from chromosome 13, complete sequence
          Length = 164002

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 479   cttcccctccaccttctcct 498
             ||||||||||||||||||||
Sbjct: 58360 cttcccctccaccttctcct 58379



to top

>gb|AC142261.5| Mus musculus BAC clone RP24-469C3 from chromosome unknown, complete
             sequence
          Length = 179858

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    tttatgatatatatttttct 31
             ||||||||||||||||||||
Sbjct: 36741 tttatgatatatatttttct 36722



to top

>gb|AC182038.2| Mus musculus BAC clone RP24-95H15 from chromosome y, complete sequence
          Length = 183498

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    tttatgatatatatttttct 31
             ||||||||||||||||||||
Sbjct: 19866 tttatgatatatatttttct 19847



to top

>dbj|AK127962.1| Homo sapiens cDNA FLJ46074 fis, clone TESTI2001915, highly  similar
            to Homo sapiens actin filament associated protein (AFAP)
          Length = 1638

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 1159 ccgtcagctccagctccagg 1140



to top

>emb|CR606819.1| full-length cDNA clone CS0DI066YF01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1517

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 ccgtcagctccagctccagg 349
           ||||||||||||||||||||
Sbjct: 693 ccgtcagctccagctccagg 674



to top

>gb|AC112233.3| Homo sapiens BAC clone RP11-211G17 from 4, complete sequence
          Length = 51878

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    atttatgatatatatttttc 30
             ||||||||||||||||||||
Sbjct: 27280 atttatgatatatatttttc 27261



to top

>emb|CR594181.1| full-length cDNA clone CS0DL005YK22 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 2434

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 330 ccgtcagctccagctccagg 349
           ||||||||||||||||||||
Sbjct: 706 ccgtcagctccagctccagg 725



to top

>gb|AC182366.4| Mus musculus BAC clone RP24-360I14 from chromosome y, complete sequence
          Length = 154476

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    tttatgatatatatttttct 31
             ||||||||||||||||||||
Sbjct: 88653 tttatgatatatatttttct 88634



to top

>dbj|AK131643.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
            library, clone:1520401C12 product:B-cell CLL/lymphoma 7B,
            full insert sequence
          Length = 1555

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 365  ctgctgctggtagagggactgacc 388
            |||||||||| |||||||||||||
Sbjct: 1052 ctgctgctgggagagggactgacc 1075



to top

>gb|AF404306.1| Rhizophydium sp. 136 mitochondrion, complete genome
          Length = 68834

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    atttatgatatatatttttc 30
             ||||||||||||||||||||
Sbjct: 10172 atttatgatatatatttttc 10191



to top

>gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome y, complete sequence
          Length = 155247

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    tttatgatatatatttttct 31
             ||||||||||||||||||||
Sbjct: 80974 tttatgatatatatttttct 80955



to top

>gb|AC177799.3| Mus musculus BAC clone RP24-374O22 from chromosome y, complete sequence
          Length = 128487

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tttatgatatatatttttct 31
             ||||||||||||||||||||
Sbjct: 37536 tttatgatatatatttttct 37555



to top

>dbj|AK155076.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630119L09
            product:B-cell CLL/lymphoma 7B, full insert sequence
          Length = 1550

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 365  ctgctgctggtagagggactgacc 388
            |||||||||| |||||||||||||
Sbjct: 1038 ctgctgctgggagagggactgacc 1061



to top

>gb|AY063759.1| Rattus norvegicus actin filament associated protein (Afap) mRNA,
            complete cds
          Length = 2911

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 1915 ccgtcagctccagctccagg 1896



to top

>gb|AC182447.2| Mus musculus BAC clone RP24-476M3 from chromosome y, complete sequence
          Length = 175402

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tttatgatatatatttttct 31
              ||||||||||||||||||||
Sbjct: 167922 tttatgatatatatttttct 167941



to top

>gb|AC163279.6| Mus musculus BAC clone RP24-112D16 from chromosome y, complete
            sequence
          Length = 198421

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 12   tttatgatatatatttttct 31
            ||||||||||||||||||||
Sbjct: 1311 tttatgatatatatttttct 1330



to top

>gb|AC175663.3| Mus musculus BAC clone RP24-430F7 from chromosome y, complete sequence
          Length = 144867

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tttatgatatatatttttct 31
             ||||||||||||||||||||
Sbjct: 13483 tttatgatatatatttttct 13502



to top

>gb|AC155722.9| Mus musculus 6 BAC RP24-204J8 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 198481

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 521  tccaagctccttcagttgtttctc 544
            ||||||||||||||||| ||||||
Sbjct: 8410 tccaagctccttcagttctttctc 8387



to top

>gb|AC158653.7| Mus musculus 6 BAC RP23-418F10 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 185818

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 521    tccaagctccttcagttgtttctc 544
              ||||||||||||||||| ||||||
Sbjct: 130021 tccaagctccttcagttctttctc 129998



to top

>ref|NM_198595.1| Homo sapiens actin filament associated protein (AFAP), transcript
            variant 2, mRNA
          Length = 7484

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 2118 ccgtcagctccagctccagg 2099



to top

>gb|AC127261.3| Mus musculus BAC clone RP24-316F4 from chromosome unknown, complete
              sequence
          Length = 168193

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tttatgatatatatttttct 31
              ||||||||||||||||||||
Sbjct: 119024 tttatgatatatatttttct 119043



to top

>ref|NM_021638.3| Homo sapiens actin filament associated protein (AFAP), transcript
            variant 1, mRNA
          Length = 7496

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 2130 ccgtcagctccagctccagg 2111



to top

>gb|AC084593.1|CBRG42E09 Caenorhabditis briggsae cosmid G42E09, complete sequence
          Length = 41984

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    tgcaaatagctgaaaaacaa 88
             ||||||||||||||||||||
Sbjct: 11349 tgcaaatagctgaaaaacaa 11330



to top

>emb|BX936249.1| Gallus gallus finished cDNA, clone ChEST958k14
          Length = 1216

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 58   tagaacaagcatgcaaatag 77
            ||||||||||||||||||||
Sbjct: 1090 tagaacaagcatgcaaatag 1071



to top

>emb|BX935075.1| Gallus gallus finished cDNA, clone ChEST74n16
          Length = 1604

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 58  tagaacaagcatgcaaatag 77
           ||||||||||||||||||||
Sbjct: 492 tagaacaagcatgcaaatag 473



to top

>emb|BX931963.1| Gallus gallus finished cDNA, clone ChEST802g11
          Length = 1613

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 58  tagaacaagcatgcaaatag 77
           ||||||||||||||||||||
Sbjct: 500 tagaacaagcatgcaaatag 481



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 497     cttgacatcgccggggaccttgtc 520
               |||||| |||||||||||||||||
Sbjct: 5480652 cttgacctcgccggggaccttgtc 5480629



to top

>gb|AF188700.1|AF188700 Homo sapiens actin filament associated protein (AFAP) mRNA, complete
            cds
          Length = 7279

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 1912 ccgtcagctccagctccagg 1893



to top

>ref|NM_080900.1| Rattus norvegicus actin filament associated protein (Afap), mRNA
          Length = 2911

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 1915 ccgtcagctccagctccagg 1896



to top

>ref|XM_579609.1| PREDICTED: Rattus norvegicus hypothetical gene supported by NM_080900
            (LOC497697), mRNA
          Length = 2239

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 1915 ccgtcagctccagctccagg 1896



to top

>gb|AC129774.4| Mus musculus BAC clone RP24-167G16 from chromosome y, complete
            sequence
          Length = 168396

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 12   tttatgatatatatttttct 31
            ||||||||||||||||||||
Sbjct: 9256 tttatgatatatatttttct 9275



to top

>dbj|AK219291.1| Mus musculus cDNA, clone:Y2G0148A06, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000031692, based on BLAT search
          Length = 357

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 365 ctgctgctggtagagggactgacc 388
           |||||||||| |||||||||||||
Sbjct: 333 ctgctgctgggagagggactgacc 356



to top

>gb|BC032777.1| Homo sapiens actin filament associated protein, transcript variant 2,
            mRNA (cDNA clone MGC:44840 IMAGE:4914388), complete cds
          Length = 2458

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 1936 ccgtcagctccagctccagg 1917



to top

>emb|BX936423.12| Zebrafish DNA sequence from clone DKEY-174M14 in linkage group 20,
             complete sequence
          Length = 170767

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    aatagctgaaaaacaatgca 92
             ||||||||||||||||||||
Sbjct: 85475 aatagctgaaaaacaatgca 85456



to top

>gb|AC004169.3|AC004169 Homo sapiens chromosome 4 clone C0236G06 map 4p16, complete
           sequence
          Length = 189805

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 330 ccgtcagctccagctccagg 349
           ||||||||||||||||||||
Sbjct: 111 ccgtcagctccagctccagg 92



to top

>gb|AF096709.1|AF096709 Drosophila virilis tyrosyl-tRNA synthetase gene, partial cds; and
             failed axon connections protein (fax) gene, complete cds
          Length = 15911

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 12    tttatgatatatatttttctgttg 35
             |||||||||||||||||| |||||
Sbjct: 13100 tttatgatatatatttttatgttg 13123



to top

>emb|BX510915.23| Zebrafish DNA sequence from clone DKEY-24M12 in linkage group 21,
              complete sequence
          Length = 253718

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 227    tgtcctaacctacagttctattca 250
              |||||||||| |||||||||||||
Sbjct: 145049 tgtcctaaccgacagttctattca 145072



to top

>gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome
          Length = 1751080

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 534     agttgtttctcagtctggta 553
               ||||||||||||||||||||
Sbjct: 1734060 agttgtttctcagtctggta 1734079



to top

>emb|AL845497.10| Mouse DNA sequence from clone RP23-232K9 on chromosome 2, complete
             sequence
          Length = 157619

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 525   agctccttcagttgtttctc 544
             ||||||||||||||||||||
Sbjct: 74143 agctccttcagttgtttctc 74162



to top

>gb|AC147108.3| Mus musculus BAC clone RP24-70D19 from 13, complete sequence
          Length = 188893

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 14     tatgatatatatttttctgt 33
              ||||||||||||||||||||
Sbjct: 151418 tatgatatatatttttctgt 151437



to top

>gb|AC148329.3| Mus musculus BAC clone RP24-176F13 from Y, complete sequence
          Length = 149159

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    tttatgatatatatttttct 31
             ||||||||||||||||||||
Sbjct: 77108 tttatgatatatatttttct 77089



to top

>gb|AC147630.4| Mus musculus BAC clone RP24-530L22 from Y, complete sequence
          Length = 180127

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     tttatgatatatatttttct 31
              ||||||||||||||||||||
Sbjct: 107319 tttatgatatatatttttct 107300



to top

>ref|NM_009745.1| Mus musculus B-cell CLL/lymphoma 7B (Bcl7b), mRNA
          Length = 1546

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 365  ctgctgctggtagagggactgacc 388
            |||||||||| |||||||||||||
Sbjct: 1036 ctgctgctgggagagggactgacc 1059



to top

>dbj|AB209676.1| Homo sapiens mRNA for actin filament associated protein variant
            protein
          Length = 2260

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 330  ccgtcagctccagctccagg 349
            ||||||||||||||||||||
Sbjct: 1638 ccgtcagctccagctccagg 1619



to top

>emb|AJ011145.1|MMU011145 Mus musculus mRNA for protein encoded by BCL7B gene
          Length = 1546

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 365  ctgctgctggtagagggactgacc 388
            |||||||||| |||||||||||||
Sbjct: 1036 ctgctgctgggagagggactgacc 1059



to top

>emb|AL929187.5| Mouse DNA sequence from clone RP23-8G6 on chromosome 2, complete
             sequence
          Length = 145146

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 525   agctccttcagttgtttctc 544
             ||||||||||||||||||||
Sbjct: 35755 agctccttcagttgtttctc 35736



to top

>emb|AL731789.9| Mouse DNA sequence from clone RP23-52F6 on chromosome X, complete
             sequence
          Length = 218939

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 244   ctattcaattgctatcagtaaaat 267
             ||||||||||||||||||| ||||
Sbjct: 17938 ctattcaattgctatcagtcaaat 17915



to top

>gb|L11440.1|DENENVGLYS Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 516 ttgtctccaagctccttcag 535
           ||||||||||||||||||||
Sbjct: 357 ttgtctccaagctccttcag 338



to top

>gb|L11424.1|DENENVGLYC Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 515 cttgtctccaagctccttca 534
           ||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttca 339


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,925,685
Number of Sequences: 3902068
Number of extensions: 5925685
Number of successful extensions: 140075
Number of sequences better than 10.0: 241
Number of HSP's better than 10.0 without gapping: 240
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 139496
Number of HSP's gapped (non-prelim): 573
length of query: 594
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 571
effective length of database: 17,143,297,704
effective search space: 9788822988984
effective search space used: 9788822988984
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top