Clone Name	rbags35a09
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK072794.1| Oryza sativa (japonica cultivar-group) cDNA clon...	119	1e-23
2	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	78	5e-11
3	dbj|AP003203.3| Oryza sativa (japonica cultivar-group) genomic D...	78	5e-11
4	emb|BX072038.1|CNS09RQY Single read from an extremity of a full-...	42	2.5
5	emb|BX068333.1|CNS09OW1 Single read from an extremity of a full-...	42	2.5
6	emb|BX065976.1|CNS09N2K Single read from an extremity of a full-...	42	2.5
7	emb|BX061993.1|CNS09JZX Single read from an extremity of a full-...	42	2.5
8	emb|BX061992.1|CNS09JZW Single read from an extremity of a full-...	42	2.5
9	emb|BX060238.1|CNS09IN6 Single read from an extremity of a full-...	42	2.5
10	emb|BX058442.1|CNS09H9A Single read from an extremity of a full-...	42	2.5
11	emb|BX052598.1|CNS09CQY Single read from an extremity of a full-...	42	2.5
12	emb|BX052597.1|CNS09CQX Single read from an extremity of a full-...	42	2.5
13	emb|BX052106.1|CNS09CDA Single read from an extremity of a full-...	42	2.5
14	emb|BX050826.1|CNS09BDQ Single read from an extremity of a full-...	42	2.5
15	emb|BX049822.1|CNS09ALU Single read from an extremity of a full-...	42	2.5
16	emb|BX030920.1|CNS08W0S Single read from an extremity of a full-...	42	2.5
17	emb|BX046543.1|CNS0982R Single read from an extremity of a full-...	42	2.5
18	emb|BX042049.1|CNS094LX Single read from an extremity of a full-...	42	2.5
19	emb|BX041561.1|CNS0948D Single read from an extremity of a full-...	42	2.5
20	emb|BX036960.1|CNS090OK Single read from an extremity of a full-...	42	2.5
21	emb|BX036058.1|CNS08ZZI Single read from an extremity of a full-...	42	2.5
22	emb|BX035771.1|CNS08ZRJ Single read from an extremity of a full-...	42	2.5
23	emb|BX029669.1|CNS08V21 Single read from an extremity of a full-...	42	2.5
24	emb|BX028992.1|CNS08UJ8 Single read from an extremity of a full-...	42	2.5
25	emb|BX028005.1|CNS08TRT Single read from an extremity of a full-...	42	2.5
26	emb|BX023222.1|CNS08Q2Y Single read from an extremity of a full-...	42	2.5
27	emb|BX023221.1|CNS08Q2X Single read from an extremity of a full-...	42	2.5
28	emb|BX022101.1|CNS08P7T Single read from an extremity of a full-...	42	2.5
29	emb|BX022052.1|CNS08P6G Single read from an extremity of a full-...	42	2.5
30	emb|BX019569.1|CNS08N9H Single read from an extremity of a full-...	42	2.5
31	emb|BX019150.1|CNS08MXU Single read from an extremity of a full-...	42	2.5
32	emb|BX018723.1|CNS08MLZ Single read from an extremity of a full-...	42	2.5
33	emb|BX018239.1|CNS08M8J Single read from an extremity of a full-...	42	2.5
34	emb|BX017233.1|CNS08LGL Single read from an extremity of a full-...	42	2.5
35	emb|BX016619.1|CNS08KZJ Single read from an extremity of a full-...	42	2.5
36	emb|BX016072.1|CNS08KKC Single read from an extremity of a full-...	42	2.5
37	emb|BX016032.1|CNS08KJ8 Single read from an extremity of a full-...	42	2.5
38	emb|BX014845.1|CNS08JM9 Single read from an extremity of a full-...	42	2.5
39	emb|BX014835.1|CNS08JLZ Single read from an extremity of a full-...	42	2.5
40	emb|BX012789.1|CNS08I15 Single read from an extremity of a full-...	42	2.5
41	emb|BX009476.1|CNS08FH4 Single read from an extremity of a full-...	42	2.5
42	emb|BX007868.1|CNS08E8G Single read from an extremity of a full-...	42	2.5
43	emb|BX007827.1|CNS08E7B Single read from an extremity of a full-...	42	2.5
44	emb|BX007030.1|CNS08DL6 Single read from an extremity of a full-...	42	2.5
45	emb|BX006166.1|CNS08CX6 Single read from an extremity of a full-...	42	2.5
46	emb|X57854.1|CTHDEG C.tropicalis hde gene for trifunctional enzy...	42	2.5
47	emb|AL596173.1| Listeria innocua Clip11262 complete genome, segm...	42	2.5
48	gb|AF154037.2| Streptococcus pneumoniae strain srf10 surface pro...	42	2.5
49	gb|AF154029.1| Streptococcus pneumoniae strain g408 surface prot...	42	2.5
50	gb|AF154018.1| Streptococcus pneumoniae strain g38 surface prote...	42	2.5
51	gb|AF154017.1| Streptococcus pneumoniae strain g378 surface prot...	42	2.5
52	gb|AF154016.1| Streptococcus pneumoniae strain g376 surface prot...	42	2.5
53	gb|AF154010.1| Streptococcus pneumoniae strain 8R1 surface prote...	42	2.5
54	gb|AF068650.1|AF068650 Streptococcus pneumoniae strain BG9163 ps...	42	2.5
55	gb|AF068645.1|AF068645 Streptococcus pneumoniae strain DBL6A psp...	42	2.5
56	gb|U72655.1|SPU72655 Streptococcus pneumoniae surface protein C ...	42	2.5
57	gb|M22765.1|YSAHDE Candida tropicalis peroxisomal trifunctional ...	42	2.5

---

>dbj|AK072794.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023138M03, full
           insert sequence
          Length = 1102

 Score =  119 bits (60), Expect = 1e-23
 Identities = 117/136 (86%)
 Strand = Plus / Minus

                                                                       
Query: 555 agatttcgagcttagtgttcctgaaatggagttcaataactgttggctcctggcgaattg 614
           ||||||||||||||||||||| || |||||||| ||||  ||||| | ||| || |||||
Sbjct: 725 agatttcgagcttagtgttcccgatatggagtttaatagttgttgacacctagcaaattg 666

                                                                       
Query: 615 actggtcaattcttcaaccaatgcatcaaaagcttgatcccttgtgcctgttgcaatcgc 674
           ||||||||| |||||||||| ||||||| ||  |||||||||||||||  || |||| ||
Sbjct: 665 actggtcaaatcttcaaccagtgcatcagaattttgatcccttgtgccctttccaatagc 606

                           
Query: 675 atcacctaatcttgtc 690
           |||| |||||||||||
Sbjct: 605 atcagctaatcttgtc 590



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 99/120 (82%)
 Strand = Plus / Minus

                                                                       
Query: 325 ctatcttgttggatcacccttaaggaggtcttccactgaggtcttgtattttgccatcaa 384
           ||||||| ||| ||| ||||| || |||||||| || ||| |  |||| ||||  |||||
Sbjct: 851 ctatcttcttgtatcccccttgagcaggtcttcaacggagcttctgtactttgtgatcaa 792

                                                                       
Query: 385 atcctttctttgatcaagcagctgtcgtgtttcttccaaactttgcatttgtccttcaac 444
           |||||| || |||||||| |||||  | |||||||||||||||| | |||||||||||||
Sbjct: 791 atccttcctctgatcaaggagctgctgcgtttcttccaaacttttcctttgtccttcaac 732

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 77.8 bits (39), Expect = 5e-11
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                            
Query: 555      agatttcgagcttagtgttcctgaaatggagttcaataactgttggctcctggcgaattg 614
                ||||||||||||||||||||| || |||||||| ||||  ||||| | ||| || |||||
Sbjct: 17315933 agatttcgagcttagtgttcccgatatggagtttaatagttgttgacacctagcaaattg 17315992

                                   
Query: 615      actggtcaattcttcaacc 633
                ||||||||| |||||||||
Sbjct: 17315993 actggtcaaatcttcaacc 17316011



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                            
Query: 631      accaatgcatcaaaagcttgatcccttgtgcctgttgcaatcgcatcacctaatcttgtc 690
                |||| ||||||| ||  |||||||||||||||  || |||| |||||| |||||||||||
Sbjct: 17316807 accagtgcatcagaattttgatcccttgtgccctttccaatagcatcagctaatcttgtc 17316866

                          
Query: 691      accaactgat 700
                  ||||||||
Sbjct: 17316867 gtcaactgat 17316876



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                  
Query: 395      tgatcaagcagctgtcgtgtttcttccaaactttgcatttgtccttcaac 444
                |||||||| |||||  | |||||||||||||||| | |||||||||||||
Sbjct: 17305886 tgatcaaggagctgctgcgtttcttccaaacttttcctttgtccttcaac 17305935

---

>dbj|AP003203.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1080D07
          Length = 173856

 Score = 77.8 bits (39), Expect = 5e-11
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                         
Query: 555   agatttcgagcttagtgttcctgaaatggagttcaataactgttggctcctggcgaattg 614
             ||||||||||||||||||||| || |||||||| ||||  ||||| | ||| || |||||
Sbjct: 82194 agatttcgagcttagtgttcccgatatggagtttaatagttgttgacacctagcaaattg 82253

                                
Query: 615   actggtcaattcttcaacc 633
             ||||||||| |||||||||
Sbjct: 82254 actggtcaaatcttcaacc 82272



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                         
Query: 631   accaatgcatcaaaagcttgatcccttgtgcctgttgcaatcgcatcacctaatcttgtc 690
             |||| ||||||| ||  |||||||||||||||  || |||| |||||| |||||||||||
Sbjct: 83068 accagtgcatcagaattttgatcccttgtgccctttccaatagcatcagctaatcttgtc 83127

                       
Query: 691   accaactgat 700
               ||||||||
Sbjct: 83128 gtcaactgat 83137



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 395   tgatcaagcagctgtcgtgtttcttccaaactttgcatttgtccttcaac 444
             |||||||| |||||  | |||||||||||||||| | |||||||||||||
Sbjct: 72147 tgatcaaggagctgctgcgtttcttccaaacttttcctttgtccttcaac 72196

---

>emb|BX072038.1|CNS09RQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 218 cccttgtgcctgttgcaatcg 238

---

>emb|BX068333.1|CNS09OW1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 389

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 252 cccttgtgcctgttgcaatcg 272

---

>emb|BX065976.1|CNS09N2K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 212 cccttgtgcctgttgcaatcg 232

---

>emb|BX061993.1|CNS09JZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 240 cccttgtgcctgttgcaatcg 260

---

>emb|BX061992.1|CNS09JZW Single read from an extremity of a full-length cDNA clone made from
            Anopheles gambiae total adult females. 5-PRIME end of
            clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae
            (African malaria mosquito)
          Length = 1057

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 653  cccttgtgcctgttgcaatcg 673
            |||||||||||||||||||||
Sbjct: 1015 cccttgtgcctgttgcaatcg 995

---

>emb|BX060238.1|CNS09IN6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 196

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 79  cccttgtgcctgttgcaatcg 99

---

>emb|BX058442.1|CNS09H9A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 347

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 118 cccttgtgcctgttgcaatcg 138

---

>emb|BX052598.1|CNS09CQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 789

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 231 cccttgtgcctgttgcaatcg 251

---

>emb|BX052597.1|CNS09CQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 679 cccttgtgcctgttgcaatcg 659

---

>emb|BX052106.1|CNS09CDA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 527

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 118 cccttgtgcctgttgcaatcg 138

---

>emb|BX050826.1|CNS09BDQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 222 cccttgtgcctgttgcaatcg 242

---

>emb|BX049822.1|CNS09ALU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 231 cccttgtgcctgttgcaatcg 251

---

>emb|BX030920.1|CNS08W0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 236 cccttgtgcctgttgcaatcg 256

---

>emb|BX046543.1|CNS0982R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 904 cccttgtgcctgttgcaatcg 884

---

>emb|BX042049.1|CNS094LX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 226 cccttgtgcctgttgcaatcg 246

---

>emb|BX041561.1|CNS0948D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 242

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 79  cccttgtgcctgttgcaatcg 99

---

>emb|BX036960.1|CNS090OK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 238 cccttgtgcctgttgcaatcg 258

---

>emb|BX036058.1|CNS08ZZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 235 cccttgtgcctgttgcaatcg 255

---

>emb|BX035771.1|CNS08ZRJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 231 cccttgtgcctgttgcaatcg 251

---

>emb|BX029669.1|CNS08V21 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 118 cccttgtgcctgttgcaatcg 138

---

>emb|BX028992.1|CNS08UJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 762

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 118 cccttgtgcctgttgcaatcg 138

---

>emb|BX028005.1|CNS08TRT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 240 cccttgtgcctgttgcaatcg 260

---

>emb|BX023222.1|CNS08Q2Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 261 cccttgtgcctgttgcaatcg 281

---

>emb|BX023221.1|CNS08Q2X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 820 cccttgtgcctgttgcaatcg 800

---

>emb|BX022101.1|CNS08P7T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 214

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 115 cccttgtgcctgttgcaatcg 135

---

>emb|BX022052.1|CNS08P6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 118 cccttgtgcctgttgcaatcg 138

---

>emb|BX019569.1|CNS08N9H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 237 cccttgtgcctgttgcaatcg 257

---

>emb|BX019150.1|CNS08MXU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 334

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 59  cccttgtgcctgttgcaatcg 79

---

>emb|BX018723.1|CNS08MLZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 505

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 229 cccttgtgcctgttgcaatcg 249

---

>emb|BX018239.1|CNS08M8J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 224 cccttgtgcctgttgcaatcg 244

---

>emb|BX017233.1|CNS08LGL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 233 cccttgtgcctgttgcaatcg 253

---

>emb|BX016619.1|CNS08KZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 248 cccttgtgcctgttgcaatcg 268

---

>emb|BX016072.1|CNS08KKC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 73  cccttgtgcctgttgcaatcg 93

---

>emb|BX016032.1|CNS08KJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 229 cccttgtgcctgttgcaatcg 249

---

>emb|BX014845.1|CNS08JM9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 226 cccttgtgcctgttgcaatcg 246

---

>emb|BX014835.1|CNS08JLZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 206 cccttgtgcctgttgcaatcg 226

---

>emb|BX012789.1|CNS08I15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 485

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 197 cccttgtgcctgttgcaatcg 217

---

>emb|BX009476.1|CNS08FH4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 216 cccttgtgcctgttgcaatcg 236

---

>emb|BX007868.1|CNS08E8G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 194 cccttgtgcctgttgcaatcg 214

---

>emb|BX007827.1|CNS08E7B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 240 cccttgtgcctgttgcaatcg 260

---

>emb|BX007030.1|CNS08DL6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 238 cccttgtgcctgttgcaatcg 258

---

>emb|BX006166.1|CNS08CX6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 653 cccttgtgcctgttgcaatcg 673
           |||||||||||||||||||||
Sbjct: 227 cccttgtgcctgttgcaatcg 247

---

>emb|X57854.1|CTHDEG C.tropicalis hde gene for trifunctional enzyme,
            hydratase-dehydrogenase-epimerase
          Length = 4196

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 608  cgaattgactggtcaattctt 628
            |||||||||||||||||||||
Sbjct: 1462 cgaattgactggtcaattctt 1482

---

>emb|AL596173.1| Listeria innocua Clip11262 complete genome, segment 11/12
          Length = 305050

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 68     tcaaacaagttcacatcgcccattt 92
              ||||||||||| |||||||||||||
Sbjct: 110924 tcaaacaagttgacatcgcccattt 110900

---

>gb|AF154037.2| Streptococcus pneumoniae strain srf10 surface protein PspC (pspC)
           gene, pspC-1.1 allele, complete cds
          Length = 3845

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 195 cccttctgcatggactactcc 215
           |||||||||||||||||||||
Sbjct: 657 cccttctgcatggactactcc 637

---

>gb|AF154029.1| Streptococcus pneumoniae strain g408 surface protein PspC (pspC)
           gene, pspC-6.10 allele, complete cds
          Length = 3223

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 195 cccttctgcatggactactcc 215
           |||||||||||||||||||||
Sbjct: 657 cccttctgcatggactactcc 637

---

>gb|AF154018.1| Streptococcus pneumoniae strain g38 surface protein PspC (pspC)
           gene, pspC-6.2 allele, complete cds
          Length = 2947

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 195 cccttctgcatggactactcc 215
           |||||||||||||||||||||
Sbjct: 657 cccttctgcatggactactcc 637

---

>gb|AF154017.1| Streptococcus pneumoniae strain g378 surface protein PspC (pspC)
           gene, pspC-6.7 allele, complete cds
          Length = 3064

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 195 cccttctgcatggactactcc 215
           |||||||||||||||||||||
Sbjct: 657 cccttctgcatggactactcc 637

---

>gb|AF154016.1| Streptococcus pneumoniae strain g376 surface protein PspC (pspC)
           gene, pspC-6.6 allele, complete cds
          Length = 3007

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 195 cccttctgcatggactactcc 215
           |||||||||||||||||||||
Sbjct: 657 cccttctgcatggactactcc 637

---

>gb|AF154010.1| Streptococcus pneumoniae strain 8R1 surface protein PspC (pspC)
           gene, pspC-6.11 allele, complete cds
          Length = 2932

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 195 cccttctgcatggactactcc 215
           |||||||||||||||||||||
Sbjct: 657 cccttctgcatggactactcc 637

---

>gb|AF068650.1|AF068650 Streptococcus pneumoniae strain BG9163 pspC gene, partial cds
          Length = 2612

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 195 cccttctgcatggactactcc 215
           |||||||||||||||||||||
Sbjct: 268 cccttctgcatggactactcc 248

---

>gb|AF068645.1|AF068645 Streptococcus pneumoniae strain DBL6A pspC gene, partial cds
          Length = 1590

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 195 cccttctgcatggactactcc 215
           |||||||||||||||||||||
Sbjct: 243 cccttctgcatggactactcc 223

---

>gb|U72655.1|SPU72655 Streptococcus pneumoniae surface protein C (pspC) gene, complete
           cds
          Length = 3463

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 195 cccttctgcatggactactcc 215
           |||||||||||||||||||||
Sbjct: 435 cccttctgcatggactactcc 415

---

>gb|M22765.1|YSAHDE Candida tropicalis peroxisomal trifunctional enzyme
           hydratase-dehydrogenase-epimerase (HDE) mRNA, complete
           cds
          Length = 2830

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 608 cgaattgactggtcaattctt 628
           |||||||||||||||||||||
Sbjct: 725 cgaattgactggtcaattctt 745


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,831,899
Number of Sequences: 3902068
Number of extensions: 5831899
Number of successful extensions: 102694
Number of sequences better than 10.0: 57
Number of HSP's better than 10.0 without gapping: 57
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 102603
Number of HSP's gapped (non-prelim): 91
length of query: 731
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 708
effective length of database: 17,143,297,704
effective search space: 12137454774432
effective search space used: 12137454774432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)

---