>emb|BX251412.1| Tropheryma whipplei TW08/27, complete genome; segment 3/3
          Length = 302938

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 42     cgcagccaagtactcgagtttgc 64
              ||||||||| |||||||||||||
Sbjct: 173109 cgcagccaaatactcgagtttgc 173131

>emb|BX004880.9| Zebrafish DNA sequence from clone CH211-69B7 in linkage group 11,
              complete sequence
          Length = 194839

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 89     tttgagtagcattactata 107
              |||||||||||||||||||
Sbjct: 126092 tttgagtagcattactata 126110

>gb|AE014184.1| Tropheryma whipplei str. Twist, complete genome
          Length = 927303

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 42     cgcagccaagtactcgagtttgc 64
              ||||||||| |||||||||||||
Sbjct: 797437 cgcagccaaatactcgagtttgc 797459


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 545,144
Number of Sequences: 3902068
Number of extensions: 545144
Number of successful extensions: 29396
Number of sequences better than 10.0: 3
Number of HSP's better than 10.0 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29391
Number of HSP's gapped (non-prelim): 5
length of query: 194
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 172
effective length of database: 17,147,199,772
effective search space: 2949318360784
effective search space used: 2949318360784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)