Clone Information

BLAST Search Result

Clone Name	rbags35a08
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	ref\|XM_479299.1\| Oryza sativa (japonica cultivar-group), mRNA	319	5e-84
2	dbj\|AK122129.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	319	5e-84
3	gb\|AF009413.1\|AF009413 Oryza sativa 10 kDa chaperonin mRNA, comp...	315	8e-83
4	dbj\|AK119728.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	311	1e-81
5	gb\|AY103856.1\| Zea mays PCO066521 mRNA sequence	248	2e-62
6	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	168	1e-38
7	dbj\|AP004671.2\| Oryza sativa (japonica cultivar-group) genomic D...	168	1e-38
8	dbj\|AK059154.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	139	1e-29
9	gb\|AY107730.1\| Zea mays PCO063745 mRNA sequence	129	1e-26
10	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	121	3e-24
11	gb\|AC125784.1\| Genomic sequence for Oryza sativa, Nipponbare str...	121	3e-24
12	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	121	3e-24
13	ref\|NM_129803.1\| Arabidopsis thaliana nucleic acid binding / tra...	44	0.47
14	gb\|AC146948.2\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.47
15	emb\|AL672176.10\| Zebrafish DNA sequence from clone BUSM1-12F11 i...	44	0.47
16	gb\|AC005956.4\| Arabidopsis thaliana chromosome 2 clone MHK10 map...	44	0.47
17	ref\|XM_704351.1\| PREDICTED: Danio rerio bromodomain-containing 2...	44	0.47
18	ref\|XM_704350.1\| PREDICTED: Danio rerio bromodomain-containing 2...	44	0.47
19	ref\|XM_704349.1\| PREDICTED: Danio rerio bromodomain-containing 2...	44	0.47
20	ref\|XM_704348.1\| PREDICTED: Danio rerio bromodomain-containing 2...	44	0.47
21	ref\|XM_704347.1\| PREDICTED: Danio rerio bromodomain-containing 2...	44	0.47
22	ref\|XM_704346.1\| PREDICTED: Danio rerio bromodomain-containing 2...	44	0.47
23	ref\|XM_685563.1\| PREDICTED: Danio rerio bromodomain-containing 2...	44	0.47
24	ref\|XM_704345.1\| PREDICTED: Danio rerio bromodomain-containing 2...	44	0.47
25	ref\|XM_704344.1\| PREDICTED: Danio rerio bromodomain-containing 2...	44	0.47
26	dbj\|AP008217.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.47
27	gb\|BC045866.1\| Danio rerio bromodomain-containing 2, mRNA (cDNA ...	44	0.47
28	dbj\|AK099053.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.47
29	dbj\|AK063436.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.47
30	emb\|BX510994.6\| Zebrafish DNA sequence from clone CH211-51F10 in...	44	0.47
31	gb\|DP000010.1\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.47
32	gb\|U03982.1\|PLU03982 Puma lentivirus 14 (gag), polyprotein (pol)...	44	0.47
33	ref\|XM_536038.2\| PREDICTED: Canis familiaris similar to Amyotrop...	42	1.9
34	gb\|AC135806.4\| Mus musculus BAC clone RP24-289M10 from chromosom...	42	1.9
35	gb\|AC124548.5\| Mus musculus BAC clone RP23-276P11 from 18, compl...	42	1.9
36	emb\|AL390121.6\| Human DNA sequence from clone RP11-147C23 on chr...	42	1.9
37	dbj\|AP007255.1\| Magnetospirillum magneticum AMB-1 DNA, complete ...	42	1.9
38	gb\|AY221653.1\| HIV-1 isolate 02HCH1-164 from South Korea nef pro...	42	1.9
39	gb\|DQ124215.2\| Dunaliella salina MAR-binding protein mRNA, compl...	42	1.9
40	dbj\|BS000076.1\| Pan troglodytes chromosome 22 clone:PTB-096O09, ...	42	1.9
41	dbj\|AP001683.1\| Homo sapiens genomic DNA, chromosome 21q, sectio...	42	1.9
42	gb\|U20824.1\|EHVU20824 Equine herpesvirus 2, complete genome	42	1.9
43	emb\|AL772394.7\| Mouse DNA sequence from clone RP23-67C1 on chrom...	42	1.9
44	dbj\|AP000472.2\| Homo sapiens genomic DNA, chromosome 21q21.1-q21...	42	1.9
45	dbj\|AP000454.2\| Homo sapiens genomic DNA, chromosome 21q21.2 clo...	42	1.9
46	gb\|AY741093.1\| Integration vector pJK202, complete sequence	40	7.4
47	ref\|NM_115515.1\| Arabidopsis thaliana unknown protein AT3G56570 ...	40	7.4
48	ref\|NM_148643.1\| Arabidopsis thaliana unknown protein AT1G68945 ...	40	7.4
49	ref\|NM_118242.2\| Arabidopsis thaliana kinase AT4G21230 mRNA, com...	40	7.4
50	ref\|NM_119198.4\| Arabidopsis thaliana ATP binding / protein bind...	40	7.4
51	ref\|NM_125003.1\| Arabidopsis thaliana nucleic acid binding / tra...	40	7.4
52	ref\|NM_124154.3\| Arabidopsis thaliana protein binding / signal t...	40	7.4
53	ref\|NM_116727.2\| Arabidopsis thaliana PDF2 (PROTODERMAL FACTOR2)...	40	7.4
54	gb\|AC111034.11\| Mus musculus chromosome 8, clone RP23-202K1, com...	40	7.4
55	gb\|AC154808.2\| Mus musculus BAC clone RP24-512K19 from chromosom...	40	7.4
56	ref\|XM_635916.1\| Dictyostelium discoideum hypothetical protein (...	40	7.4
57	gb\|AC154426.2\| Mus musculus BAC clone RP24-199A21 from chromosom...	40	7.4
58	gb\|AC163036.2\| Mus musculus BAC clone RP23-219G12 from chromosom...	40	7.4
59	ref\|XM_479765.1\| Oryza sativa (japonica cultivar-group), mRNA	40	7.4
60	gb\|AC123744.8\| Mus musculus chromosome 7, clone RP24-120F8, comp...	40	7.4
61	gb\|AC109257.8\| Mus musculus chromosome 7, clone RP23-362F15, com...	40	7.4
62	gb\|AC139637.17\| Mus musculus chromosome 15, clone RP24-253M12, c...	40	7.4
63	gb\|AF441530.1\| Pinus taeda PtTX3110 microsatellite sequence	40	7.4
64	gb\|CP000144.1\| Rhodobacter sphaeroides 2.4.1 chromosome 2, compl...	40	7.4
65	gb\|AC167019.4\| Mus musculus BAC clone RP23-262K24 from chromosom...	40	7.4
66	gb\|U88315.1\| Caenorhabditis elegans cosmid C37H5, complete sequence	40	7.4
67	gb\|AC137596.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	7.4
68	gb\|AY615358.1\| Mycoplasma gallisepticum strain D9604 pMGA multig...	40	7.4
69	gb\|AC140799.6\| Mus musculus chromosome 15, clone RP24-147N23, co...	40	7.4
70	ref\|XM_956829.1\| Neurospora crassa OR74A hypothetical protein (N...	40	7.4
71	ref\|XM_324665.1\| Neurospora crassa OR74A hypothetical protein (N...	40	7.4
72	gb\|AC147342.3\| Pan troglodytes BAC clone CH251-13D13 from Y, com...	40	7.4
73	gb\|AC147684.4\| Pan troglodytes BAC clone CH251-497P9 from Y, com...	40	7.4
74	gb\|AC147665.3\| Pan troglodytes BAC clone CH251-134K23 from Y, co...	40	7.4
75	gb\|AC147686.2\| Pan troglodytes BAC clone CH251-285E7 from Y, com...	40	7.4
76	gb\|AC147661.2\| Pan troglodytes BAC clone CH251-336D20 from Y, co...	40	7.4
77	gb\|AC147130.3\| Pan troglodytes BAC clone CH251-390G11 from Y, co...	40	7.4
78	gb\|AC146186.3\| Pan troglodytes BAC clone CH251-517F3 from Y, com...	40	7.4
79	gb\|AC147654.3\| Pan troglodytes BAC clone CH251-511H17 from Y, co...	40	7.4
80	gb\|AC147682.3\| Pan troglodytes BAC clone CH251-563H18 from Y, co...	40	7.4
81	gb\|AC149097.1\| Pan troglodytes BAC clone CH251-8I14 from Y, comp...	40	7.4
82	gb\|DQ226960.1\| Boechera divaricarpa isolate AD-B10 mRNA sequence	40	7.4
83	gb\|AY557904.1\| Saccharomyces cerevisiae clone FLH004145.01X YKL0...	40	7.4
84	gb\|AY129816.2\| Chrysiptera parasema high choriolytic enzyme mRNA...	40	7.4
85	gb\|AC110566.17\| Mus musculus chromosome 5, clone RP23-300A10, co...	40	7.4
86	gb\|AC140047.8\| Mus musculus chromosome 17, clone RP23-233F10, co...	40	7.4
87	gb\|AC006338.6\| Homo sapiens BAC clone RP11-539D10 from Y, comple...	40	7.4
88	gb\|AC142474.4\| Mus musculus BAC clone RP24-362N7 from chromosome...	40	7.4
89	gb\|AC124368.5\| Mus musculus BAC clone RP24-546J13 from chromosom...	40	7.4
90	gb\|AC113181.7\| Mus musculus chromosome 5, clone RP23-359I6, comp...	40	7.4
91	emb\|AJ744860.1\| uncultured bacterium pTB11 plasmid complete genome	40	7.4
92	ref\|XM_745279.1\| Aspergillus fumigatus Af293 hypothetical protei...	40	7.4
93	gb\|AC107664.8\| Mus musculus chromosome 17, clone RP23-103F2, com...	40	7.4
94	ref\|XM_448281.1\| Candida glabrata CBS138, CAGL0K01309g partial mRNA	40	7.4
95	gb\|AC132366.4\| Mus musculus BAC clone RP23-461N12 from chromosom...	40	7.4
96	gb\|AC133654.4\| Mus musculus BAC clone RP24-332N10 from chromosom...	40	7.4
97	gb\|AC126942.4\| Mus musculus BAC clone RP23-174P9 from chromosome...	40	7.4
98	gb\|BC042186.1\| Homo sapiens cDNA clone IMAGE:5393404, partial cds	40	7.4
99	ref\|XM_811341.1\| Trypanosoma cruzi strain CL Brener hypothetical...	40	7.4
100	gb\|AC124402.5\| Mus musculus BAC clone RP24-365M23 from chromosom...	40	7.4
101	ref\|XM_848871.1\| PREDICTED: Canis familiaris similar to ankyrin ...	40	7.4
102	emb\|CR691079.2\|CNS0FW6R Tetraodon nigroviridis full-length cDNA	40	7.4
103	gb\|AC092100.5\| Homo sapiens BAC clone RP11-666G4 from 7, complet...	40	7.4
104	emb\|CR657200.2\|CNS0F62E Tetraodon nigroviridis full-length cDNA	40	7.4
105	gb\|AC122734.6\| Mus musculus chromosome 10, clone RP24-108E17, co...	40	7.4
106	gb\|AC144378.2\| Pan troglodytes BAC clone RP43-20D17 from Y, comp...	40	7.4
107	gb\|AC142313.1\| Pan troglodytes BAC clone RP43-48C7 from Y, compl...	40	7.4
108	gb\|AC159017.2\| Pan troglodytes BAC clone CH251-571G18 from chrom...	40	7.4
109	gb\|AC158913.4\| Mus musculus chromosome 5, clone RP24-268J3, comp...	40	7.4
110	gb\|AY918932.1\| Schoenoplectus americanus clone SCAM.02 microsate...	40	7.4
111	gb\|AC095491.7\| Rattus norvegicus 4 BAC CH230-7L13 (Children's Ho...	40	7.4
112	emb\|AL592044.4\| Human DNA sequence from clone RP13-407F1 on chro...	40	7.4
113	emb\|AL590239.7\| Human DNA sequence from clone RP11-466D24 on chr...	40	7.4
114	ref\|XM_502947.1\| Yarrowia lipolytica CLIB122, YALI0D17600g predi...	40	7.4
115	emb\|AL359853.18\| Human DNA sequence from clone RP11-12M5 on chro...	40	7.4
116	emb\|AL356754.18\| Human DNA sequence from clone RP11-11C5 on chro...	40	7.4
117	emb\|AL354868.10\| Human DNA sequence from clone RP11-339A7 on chr...	40	7.4
118	emb\|AL050322.13\|HSJ727I10 Human DNA sequence from clone RP4-727I...	40	7.4
119	emb\|X71621.1\|SCELM1AA S.cerevisiae genes ELM1 and PRI2	40	7.4
120	emb\|BX057216.1\|CNS09GB8 Single read from an extremity of a full-...	40	7.4
121	gb\|AY045928.1\| Arabidopsis thaliana At1g68945 mRNA sequence	40	7.4
122	emb\|X07678.1\|CEHSP70F Caenorhabditis elegans hsp6F gene N-termin...	40	7.4
123	emb\|CR380957.1\| Candida glabrata strain CBS138 chromosome K comp...	40	7.4
124	gb\|AC162938.5\| Mus musculus BAC clone RP23-104D6 from chromosome...	40	7.4
125	emb\|AL939127.1\|SCO939127 Streptomyces coelicolor A3(2) complete ...	40	7.4
126	emb\|AL670002.1\|NCB24G3 Neurospora crassa DNA linkage group II BA...	40	7.4
127	emb\|AL451012.1\|NCB21O8 Neurospora crassa DNA linkage group II BA...	40	7.4
128	emb\|AL163972.1\|ATT5P19 Arabidopsis thaliana DNA chromosome 3, BA...	40	7.4
129	emb\|AL161577.2\|ATCHRIV73 Arabidopsis thaliana DNA chromosome 4, ...	40	7.4
130	emb\|AL161554.2\|ATCHRIV54 Arabidopsis thaliana DNA chromosome 4, ...	40	7.4
131	emb\|AL161552.2\|ATCHRIV52 Arabidopsis thaliana DNA chromosome 4, ...	40	7.4
132	emb\|AL161502.2\|ATCHRIV14 Arabidopsis thaliana DNA chromosome 4, ...	40	7.4
133	emb\|AL021637.2\|ATF18F4 Arabidopsis thaliana DNA chromosome 4, BA...	40	7.4
134	emb\|AL021960.2\|ATF7J7 Arabidopsis thaliana DNA chromosome 4, BAC...	40	7.4
135	emb\|AJ400821.1\|CRU400821 Capsella rubella ORF1, ORF2, ORF3, ORF4...	40	7.4
136	gb\|AC155716.7\| Mus musculus 10 BAC RP24-177O15 (Roswell Park Can...	40	7.4
137	emb\|CR405705.11\| Zebrafish DNA sequence from clone DKEY-64E13 in...	40	7.4
138	emb\|AL672260.25\| Mouse DNA sequence from clone DN-127L1 on chrom...	40	7.4
139	ref\|NM_001025209.1\| Strongylocentrotus purpuratus soluble adenyl...	40	7.4
140	gb\|AC163901.2\| Mus musculus BAC clone RP23-269N21 from chromosom...	40	7.4
141	gb\|AY926532.1\| Strongylocentrotus purpuratus soluble adenylyl cy...	40	7.4
142	gb\|AF121899.3\| Homo sapiens chromosome 8 clone GS1-2d9 map 8q24....	40	7.4
143	dbj\|BS000662.3\| Pan troglodytes chromosome Y clone: PTB-143L19, ...	40	7.4
144	dbj\|BS000661.3\| Pan troglodytes chromosome Y clone: PTB-101K22, ...	40	7.4
145	dbj\|BS000547.1\| Pan troglodytes chromosome Y clone:PTB-232N08, c...	40	7.4
146	dbj\|BS000672.1\| Pan troglodytes chromosome Y clone:PTB-410J23, c...	40	7.4
147	gb\|AC114495.2\| Homo sapiens chromosome 1 clone RP11-490K7, compl...	40	7.4
148	gb\|AC125411.1\| Genomic sequence for Oryza sativa, Nipponbare str...	40	7.4
149	gb\|AC022762.8\| Homo sapiens chromosome 11, clone RP11-290F24, co...	40	7.4
150	gb\|DP000054.1\| Pan troglodytes chromosome Y, partial sequence	40	7.4
151	gb\|AC009384.7\| Drosophila melanogaster 3L BAC RP98-10L1 (Roswell...	40	7.4
152	gb\|AC044913.7\| Homo sapiens chromosome 15, clone RP11-446P9, com...	40	7.4
153	dbj\|AK021773.1\| Homo sapiens cDNA FLJ11711 fis, clone HEMBA1005152	40	7.4
154	gb\|AC069368.14\| Homo sapiens chromosome 15, clone CTD-2017F17, c...	40	7.4
155	gb\|AF351398.1\| Gossypium hirsutum clone JESPR160 microsatellite ...	40	7.4
156	gb\|AF351393.1\| Gossypium hirsutum clone JESPR155 microsatellite ...	40	7.4
157	gb\|AF351295.1\| Gossypium hirsutum clone JESPR56 microsatellite s...	40	7.4
158	gb\|AF351293.1\| Gossypium hirsutum clone JESPR54 microsatellite s...	40	7.4
159	gb\|AC103976.6\| Homo sapiens chromosome 15, clone RP11-121E15, co...	40	7.4
160	ref\|NM_140915.3\| Drosophila melanogaster CG14183-RA (CG14183), mRNA	40	7.4
161	gb\|AC160863.10\| Mus musculus 10 BAC RP23-234F23 (Roswell Park Ca...	40	7.4
162	gb\|AC026992.12\| Homo sapiens chromosome 15, clone RP11-352D13, c...	40	7.4
163	gb\|AC100822.2\| Homo sapiens chromosome 8, clone RP11-654O1, comp...	40	7.4
164	gb\|AC015890.9\| Mus musculus chromosome 10, clone RP21-244O21, co...	40	7.4
165	gb\|AC025741.5\| Homo sapiens BAC clone RP11-501E14 from 4, comple...	40	7.4
166	ref\|XM_696183.1\| PREDICTED: Danio rerio similar to Wu:fb33b12 pr...	40	7.4
167	ref\|XM_686721.1\| PREDICTED: Danio rerio similar to mBLVR (LOC563...	40	7.4
168	gb\|AY062575.1\| Arabidopsis thaliana Unknown protein (At4g04890; ...	40	7.4
169	gb\|AC182701.2\| Populus trichocarpa clone Pop1-74K8, complete seq...	40	7.4
170	gb\|AC026782.6\| Homo sapiens chromosome 5 clone CTD-2015A6, compl...	40	7.4
171	gb\|AC097627.1\| Genomic sequence for Oryza sativa, Nipponbare str...	40	7.4
172	ref\|XM_680829.1\| PREDICTED: Danio rerio similar to adaptor-relat...	40	7.4
173	gb\|AC113015.12\| Mus musculus chromosome 1, clone RP23-180E19, co...	40	7.4
174	gb\|AY058318.1\| Drosophila melanogaster GH08353 full length cDNA	40	7.4
175	gb\|AF424560.1\|AF424560 Arabidopsis thaliana AT4g04890/T1J1_3 mRN...	40	7.4
176	ref\|XM_625679.1\| Cryptosporidium parvum Iowa II hypothetical pro...	40	7.4
177	gb\|AC140419.8\| Mus musculus BAC clone RP24-435P9 from chromosome...	40	7.4
178	gb\|AC010088.4\| Homo sapiens BAC clone RP11-289L7 from Y, complet...	40	7.4
179	ref\|NM_071891.3\| Caenorhabditis elegans C37H5.5 (C37H5.5) mRNA, ...	40	7.4
180	ref\|NG_002806.1\| Homo sapiens adlican pseudogene (ADLICANP) on c...	40	7.4
181	gb\|AC147674.5\| Pan troglodytes BAC clone CH251-28I8 from chromos...	40	7.4
182	gb\|AC006983.4\|AC006983 Homo sapiens BAC clone RP11-70G12 from Y,...	40	7.4
183	gb\|AC025913.11\| Mus musculus 10 BAC RP23-287L13 (Roswell Park Ca...	40	7.4
184	gb\|AC156949.9\| Mus musculus 10 BAC RP24-347J14 (Roswell Park Can...	40	7.4
185	dbj\|AP008215.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.4
186	dbj\|AP008214.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.4
187	emb\|BX827036.1\|CNS0A2GJ Arabidopsis thaliana Full-length cDNA Co...	40	7.4
188	emb\|BX831820.1\|CNS0A1NJ Arabidopsis thaliana Full-length cDNA Co...	40	7.4
189	gb\|AC068400.10\| Homo sapiens chromosome 17, clone RP11-378E13, c...	40	7.4
190	gb\|AC151848.4\| Pan troglodytes BAC clone CH251-346F2 from chromo...	40	7.4
191	gb\|AC156943.1\| Pan troglodytes BAC clone CH251-607J5 from chromo...	40	7.4
192	gb\|AC011665.8\|AC011665 Arabidopsis thaliana chromosome 1 BAC T6L...	40	7.4
193	gb\|BT005761.1\| Arabidopsis thaliana clone RAFL15-17-A20 (R20741)...	40	7.4
194	gb\|AC019102.13\| Homo sapiens BAC clone RP11-457A20 from 2, compl...	40	7.4
195	gb\|AC004255.1\|AC004255 Arabidopsis thaliana BAC T1F9 chromosome ...	40	7.4
196	gb\|AC011302.3\|AC011302 Homo sapiens BAC clone RP11-333E9 from Y,...	40	7.4
197	gb\|AC025735.4\|AC025735 Homo sapiens BAC clone RP11-214M24 from Y...	40	7.4
198	gb\|AC006965.3\|AC006965 Homo sapiens PAC clone RP4-562J12 from Xq...	40	7.4
199	gb\|AC011491.7\| Homo sapiens chromosome 19 clone CTB-180A7, compl...	40	7.4
200	ref\|NG_004755.1\| Homo sapiens chromosome Y palindromes P1, P2, P...	40	7.4
201	gb\|AC147571.5\| Pan troglodytes BAC clone CH251-422I9 from chromo...	40	7.4
202	gb\|AC117516.5\| Homo sapiens 3 BAC RP11-845C18 (Roswell Park Canc...	40	7.4
203	gb\|AY089059.1\| Arabidopsis thaliana clone 249626 mRNA, complete ...	40	7.4
204	ref\|XM_235391.3\| PREDICTED: Rattus norvegicus processing of prec...	40	7.4
205	gb\|AC007556.3\| Homo sapiens BAC clone RP11-18C9 from 2, complete...	40	7.4
206	gb\|AC067960.5\| Homo sapiens BAC clone RP11-60M20 from 2, complet...	40	7.4
207	gb\|AC099661.11\| Homo sapiens 3 BAC RP11-110C15 (Roswell Park Can...	40	7.4
208	gb\|AC146011.4\| Pan troglodytes BAC clone RP43-42M15 from chromos...	40	7.4
209	gb\|AC012302.5\|AC012302 Mus musculus chromosome 10, clone RP21-24...	40	7.4
210	dbj\|AB016886.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	40	7.4
211	dbj\|AB056455.1\| Arabidopsis thaliana PDF2 gene for protodermal f...	40	7.4
212	dbj\|AB023029.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	40	7.4
213	dbj\|AP005657.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.4
214	ref\|XM_556194.1\| Anopheles gambiae str. PEST ENSANGP00000025455 ...	40	7.4
215	dbj\|AK099560.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.4
216	emb\|CT573326.1\| Pseudomonas entomophila str. L48 chromosome,comp...	40	7.4
217	gb\|AF128393.1\|T1J1 Arabidopsis thaliana BAC T1J1	40	7.4
218	emb\|AM055943.1\| Toxoplasma gondii, strain RH, genomic DNA chromo...	40	7.4
219	emb\|BX005201.7\| Zebrafish DNA sequence from clone CH211-129C21 i...	40	7.4
220	gb\|AC153824.9\| Mus musculus 10 BAC RP23-53D13 (Roswell Park Canc...	40	7.4
221	gb\|AY109005.1\| Zea mays PCO121752 mRNA sequence	40	7.4
222	emb\|Z73103.1\|CEC08F8 Caenorhabditis elegans Cosmid C08F8, comple...	40	7.4
223	gb\|AF132298.1\|AF132298 Eptatretus stouti broadly selective sodiu...	40	7.4
224	gb\|AF160182.1\|F17I23 Arabidopsis thaliana BAC F17I23	40	7.4
225	emb\|X69584.1\|SCXI12 S. cerevisiae 12kb sequence from chromosome ...	40	7.4
226	emb\|CT573215.2\| Medicago truncatula chromosome 5 clone mth2-51h2...	40	7.4
227	emb\|Z28040.1\|SCYKL040C S.cerevisiae chromosome XI reading frame ...	40	7.4
228	gb\|AE003515.4\| Drosophila melanogaster chromosome 3L, section 70...	40	7.4
229	gb\|AC152984.2\| Mus musculus 6 BAC RP23-462B3 (Roswell Park Cance...	40	7.4
230	gb\|BC098934.1\| Rattus norvegicus vanin 1, mRNA (cDNA clone MGC:1...	40	7.4
231	gb\|AC161256.3\| Mus musculus BAC clone RP24-70H20 from chromosome...	40	7.4
232	gb\|AE017126.1\| Prochlorococcus marinus subsp. marinus str. CCMP1...	40	7.4
233	gb\|AC153565.5\| Mus musculus 10 BAC RP23-228H2 (Roswell Park Canc...	40	7.4
234	dbj\|AB091472.1\| Aspergillus ochraceus top2 gene for DNA topoisom...	40	7.4
235	gb\|AC115876.18\| Mus musculus chromosome 1, clone RP24-356G6, com...	40	7.4
236	ref\|NM_001025623.1\| Rattus norvegicus vanin 1 (Vnn1), mRNA	40	7.4
237	gb\|AE017221.1\| Thermus thermophilus HB27, complete genome	40	7.4
238	gb\|AC144762.3\| Mus musculus BAC clone RP24-95D6 from 3, complete...	40	7.4
239	gb\|AC004073.1\|AC004073 Human Chromosome X, complete sequence	40	7.4
240	gb\|AC132433.3\| Mus musculus BAC clone RP23-214L14 from 13, compl...	40	7.4
241	gb\|AC144628.3\| Mus musculus BAC clone RP23-463L22 from 14, compl...	40	7.4
242	emb\|AL627228.31\| Mouse DNA sequence from clone RP23-137L22 on ch...	40	7.4
243	gb\|AC000022.1\|AC000022 Genomic sequence from Human Y, complete s...	40	7.4
244	emb\|CR382130.1\| Yarrowia lipolytica chromosome D of strain CLIB1...	40	7.4
245	gb\|AY839756.1\| Ovine herpesvirus 2 strain BJ1035, complete genome	40	7.4
246	gb\|AC159462.6\| Mus musculus BAC clone RP23-177D16 from chromosom...	40	7.4
247	emb\|AL645930.15\| Mouse DNA sequence from clone RP23-434L7 on chr...	40	7.4
248	gb\|M93696.1\|RP4TRBAO Plasmid RP4 (trbA-trbO) genes, complete cds	40	7.4
249	gb\|L27758.1\|BIACOMGEN Birmingham IncP-alpha plasmid (R18, R68, R...	40	7.4

>ref|XM_479299.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 297

 Score =  319 bits (161), Expect = 5e-84
 Identities = 251/281 (89%)
 Strand = Plus / Minus

                                                                       
Query: 197 agggtgcccagaatgtcgtcctctctgtagaggaggtactctttctcaggagcaagcttg 256
           ||||||||||  ||||| | ||||||| |||| ||||||||||| |||| ||||||||||
Sbjct: 287 agggtgcccaagatgtcatgctctctgaagagaaggtactctttttcagcagcaagcttg 228

                                                                       
Query: 257 acttcaagaccaccatactcaggcaggagcacatggtcgccttcctggagagcaacaggg 316
           ||||| || |||||||| ||||||||||| |||  ||| ||||||| |||||||||||||
Sbjct: 227 acttcgagtccaccatattcaggcaggagaacagtgtctccttccttgagagcaacaggg 168

                                                                       
Query: 317 atcagcttcccttccttgtcacggttgccagggccaacagccaccaccttaccagagttc 376
           |||||||| || ||||||||||| | ||||||||||||||||||||| ||||||||||| 
Sbjct: 167 atcagcttgccatccttgtcacgttcgccagggccaacagccaccactttaccagagttg 108

                                                                       
Query: 377 agctgcttggaggtctcggggaggaggatgccgccggcgctcttcttgggctgcaccacc 436
           ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
Sbjct: 107 agctgcttggacgtctcagggaggaggatgccgccggcgctcttcttgggctgcaccagc 48

                                                    
Query: 437 ttctccaccagcacccggttgaaggacgggatcagacgcct 477
           |||||||||||||| ||||| |  ||||||||||| |||||
Sbjct: 47  ttctccaccagcacgcggttcagcgacgggatcagccgcct 7

to top

>dbj|AK122129.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033132M21, full
           insert sequence
          Length = 574

 Score =  319 bits (161), Expect = 5e-84
 Identities = 251/281 (89%)
 Strand = Plus / Minus

                                                                       
Query: 197 agggtgcccagaatgtcgtcctctctgtagaggaggtactctttctcaggagcaagcttg 256
           ||||||||||  ||||| | ||||||| |||| ||||||||||| |||| ||||||||||
Sbjct: 362 agggtgcccaagatgtcatgctctctgaagagaaggtactctttttcagcagcaagcttg 303

                                                                       
Query: 257 acttcaagaccaccatactcaggcaggagcacatggtcgccttcctggagagcaacaggg 316
           ||||| || |||||||| ||||||||||| |||  ||| ||||||| |||||||||||||
Sbjct: 302 acttcgagtccaccatattcaggcaggagaacagtgtctccttccttgagagcaacaggg 243

                                                                       
Query: 317 atcagcttcccttccttgtcacggttgccagggccaacagccaccaccttaccagagttc 376
           |||||||| || ||||||||||| | ||||||||||||||||||||| ||||||||||| 
Sbjct: 242 atcagcttgccatccttgtcacgttcgccagggccaacagccaccactttaccagagttg 183

                                                                       
Query: 377 agctgcttggaggtctcggggaggaggatgccgccggcgctcttcttgggctgcaccacc 436
           ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
Sbjct: 182 agctgcttggacgtctcagggaggaggatgccgccggcgctcttcttgggctgcaccagc 123

                                                    
Query: 437 ttctccaccagcacccggttgaaggacgggatcagacgcct 477
           |||||||||||||| ||||| |  ||||||||||| |||||
Sbjct: 122 ttctccaccagcacgcggttcagcgacgggatcagccgcct 82

to top

>gb|AF009413.1|AF009413 Oryza sativa 10 kDa chaperonin mRNA, complete cds
          Length = 631

 Score =  315 bits (159), Expect = 8e-83
 Identities = 246/275 (89%)
 Strand = Plus / Minus

                                                                       
Query: 197 agggtgcccagaatgtcgtcctctctgtagaggaggtactctttctcaggagcaagcttg 256
           ||||||||||  ||||| | ||||||| |||| ||||||||||| |||| ||||||||||
Sbjct: 376 agggtgcccaagatgtcatgctctctgaagagaaggtactctttttcagcagcaagcttg 317

                                                                       
Query: 257 acttcaagaccaccatactcaggcaggagcacatggtcgccttcctggagagcaacaggg 316
           ||||| || |||||||| ||||||||||| |||  ||| ||||||| |||||||||||||
Sbjct: 316 acttcgagtccaccatattcaggcaggagaacagtgtctccttccttgagagcaacaggg 257

                                                                       
Query: 317 atcagcttcccttccttgtcacggttgccagggccaacagccaccaccttaccagagttc 376
           |||||||| || ||||||||||| | ||||||||||||||||||||| ||||||||||| 
Sbjct: 256 atcagcttgccatccttgtcacgttcgccagggccaacagccaccactttaccagagttg 197

                                                                       
Query: 377 agctgcttggaggtctcggggaggaggatgccgccggcgctcttcttgggctgcaccacc 436
           ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
Sbjct: 196 agctgcttggacgtctcagggaggaggatgccgccggcgctcttcttgggctgcaccagc 137

                                              
Query: 437 ttctccaccagcacccggttgaaggacgggatcag 471
           |||||||||||||| ||||| |  |||||||||||
Sbjct: 136 ttctccaccagcacgcggttcagcgacgggatcag 102

to top

>dbj|AK119728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-H07, full
           insert sequence
          Length = 572

 Score =  311 bits (157), Expect = 1e-81
 Identities = 250/281 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 agggtgcccagaatgtcgtcctctctgtagaggaggtactctttctcaggagcaagcttg 256
           ||||||||||  ||||| | ||||||| |||| ||||||||||| |||| ||||||||||
Sbjct: 361 agggtgcccaagatgtcatgctctctgaagagaaggtactctttttcagcagcaagcttg 302

                                                                       
Query: 257 acttcaagaccaccatactcaggcaggagcacatggtcgccttcctggagagcaacaggg 316
           ||||| || |||||||| ||||||||||| |||  ||| |||| || |||||||||||||
Sbjct: 301 acttcgagtccaccatattcaggcaggagaacagtgtctcctttcttgagagcaacaggg 242

                                                                       
Query: 317 atcagcttcccttccttgtcacggttgccagggccaacagccaccaccttaccagagttc 376
           |||||||| || ||||||||||| | ||||||||||||||||||||| ||||||||||| 
Sbjct: 241 atcagcttgccatccttgtcacgttcgccagggccaacagccaccactttaccagagttg 182

                                                                       
Query: 377 agctgcttggaggtctcggggaggaggatgccgccggcgctcttcttgggctgcaccacc 436
           ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
Sbjct: 181 agctgcttggacgtctcagggaggaggatgccgccggcgctcttcttgggctgcaccagc 122

                                                    
Query: 437 ttctccaccagcacccggttgaaggacgggatcagacgcct 477
           |||||||||||||| ||||| |  ||||||||||| |||||
Sbjct: 121 ttctccaccagcacgcggttcagcgacgggatcagccgcct 81

to top

>gb|AY103856.1| Zea mays PCO066521 mRNA sequence
          Length = 807

 Score =  248 bits (125), Expect = 2e-62
 Identities = 224/257 (87%)
 Strand = Plus / Minus

                                                                       
Query: 200 gtgcccagaatgtcgtcctctctgtagaggaggtactctttctcaggagcaagcttgact 259
           ||||||| |||||| ||||||||| |||||||||||||||| ||||  ||||||||||||
Sbjct: 501 gtgcccaaaatgtcatcctctctgaagaggaggtactctttatcagccgcaagcttgact 442

                                                                       
Query: 260 tcaagaccaccatactcaggcaggagcacatggtcgccttcctggagagcaacagggatc 319
           |||   ||||||||||| ||||| || |||  |||||||||||  |||||||| ||||||
Sbjct: 441 tcagatccaccatactcgggcagaagaacagtgtcgccttccttcagagcaactgggatc 382

                                                                       
Query: 320 agcttcccttccttgtcacggttgccagggccaacagccaccaccttaccagagttcagc 379
           || || ||| ||||||| || |  |||||||||||||||||||| ||| |||  ||||||
Sbjct: 381 agattgcctgccttgtcgcgctcaccagggccaacagccaccactttagcagcattcagc 322

                                                                       
Query: 380 tgcttggaggtctcggggaggaggatgccgccggcgctcttcttgggctgcaccaccttc 439
           |||||||| || || ||||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 321 tgcttggatgtttccgggaggaggatgccgccggcggtcttcttgggctgcaccagcttc 262

                            
Query: 440 tccaccagcacccggtt 456
           |||||||||||||||||
Sbjct: 261 tccaccagcacccggtt 245

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  168 bits (85), Expect = 1e-38
 Identities = 133/149 (89%)
 Strand = Plus / Minus

                                                                            
Query: 233      tactctttctcaggagcaagcttgacttcaagaccaccatactcaggcaggagcacatgg 292
                |||||||| |||| ||||||||||||||| || |||||||| ||||||||||| |||  |
Sbjct: 26653159 tactctttttcagcagcaagcttgacttcgagtccaccatattcaggcaggagaacagtg 26653100

                                                                            
Query: 293      tcgccttcctggagagcaacagggatcagcttcccttccttgtcacggttgccagggcca 352
                || ||||||| ||||||||||||||||||||| || ||||||||||| | ||||||||||
Sbjct: 26653099 tctccttccttgagagcaacagggatcagcttgccatccttgtcacgttcgccagggcca 26653040

                                             
Query: 353      acagccaccaccttaccagagttcagctg 381
                ||||||||||| ||||||||||| |||||
Sbjct: 26653039 acagccaccactttaccagagttgagctg 26653011



 Score =  133 bits (67), Expect = 7e-28
 Identities = 91/99 (91%)
 Strand = Plus / Minus

                                                                            
Query: 379      ctgcttggaggtctcggggaggaggatgccgccggcgctcttcttgggctgcaccacctt 438
                ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 26652501 ctgcttggacgtctcagggaggaggatgccgccggcgctcttcttgggctgcaccagctt 26652442

                                                       
Query: 439      ctccaccagcacccggttgaaggacgggatcagacgcct 477
                |||||||||||| ||||| |  ||||||||||| |||||
Sbjct: 26652441 ctccaccagcacgcggttcagcgacgggatcagccgcct 26652403

to top

>dbj|AP004671.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0524G08
          Length = 146690

 Score =  168 bits (85), Expect = 1e-38
 Identities = 133/149 (89%)
 Strand = Plus / Minus

                                                                         
Query: 233   tactctttctcaggagcaagcttgacttcaagaccaccatactcaggcaggagcacatgg 292
             |||||||| |||| ||||||||||||||| || |||||||| ||||||||||| |||  |
Sbjct: 70763 tactctttttcagcagcaagcttgacttcgagtccaccatattcaggcaggagaacagtg 70704

                                                                         
Query: 293   tcgccttcctggagagcaacagggatcagcttcccttccttgtcacggttgccagggcca 352
             || ||||||| ||||||||||||||||||||| || ||||||||||| | ||||||||||
Sbjct: 70703 tctccttccttgagagcaacagggatcagcttgccatccttgtcacgttcgccagggcca 70644

                                          
Query: 353   acagccaccaccttaccagagttcagctg 381
             ||||||||||| ||||||||||| |||||
Sbjct: 70643 acagccaccactttaccagagttgagctg 70615



 Score =  133 bits (67), Expect = 7e-28
 Identities = 91/99 (91%)
 Strand = Plus / Minus

                                                                         
Query: 379   ctgcttggaggtctcggggaggaggatgccgccggcgctcttcttgggctgcaccacctt 438
             ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 70105 ctgcttggacgtctcagggaggaggatgccgccggcgctcttcttgggctgcaccagctt 70046

                                                    
Query: 439   ctccaccagcacccggttgaaggacgggatcagacgcct 477
             |||||||||||| ||||| |  ||||||||||| |||||
Sbjct: 70045 ctccaccagcacgcggttcagcgacgggatcagccgcct 70007

to top

>dbj|AK059154.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-C02, full
           insert sequence
          Length = 353

 Score =  139 bits (70), Expect = 1e-29
 Identities = 124/142 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 agggtgcccagaatgtcgtcctctctgtagaggaggtactctttctcaggagcaagcttg 256
           ||||||||||  ||||| | ||||||| |||| ||||||||||| |||| ||||||||||
Sbjct: 142 agggtgcccaagatgtcatgctctctgaagagaaggtactctttttcagcagcaagcttg 83

                                                                       
Query: 257 acttcaagaccaccatactcaggcaggagcacatggtcgccttcctggagagcaacaggg 316
           ||||| || |||||||| ||||||||||| |||  ||| ||||||| |||||||||||||
Sbjct: 82  acttcgagtccaccatattcaggcaggagaacagtgtctccttccttgagagcaacaggg 23

                                 
Query: 317 atcagcttcccttccttgtcac 338
           |||||||| || ||||||||||
Sbjct: 22  atcagcttgccatccttgtcac 1

to top

>gb|AY107730.1| Zea mays PCO063745 mRNA sequence
          Length = 654

 Score =  129 bits (65), Expect = 1e-26
 Identities = 140/165 (84%)
 Strand = Plus / Minus

                                                                       
Query: 311 acagggatcagcttcccttccttgtcacggttgccagggccaacagccaccaccttacca 370
           |||||||||||||| || ||| | ||||| |  |||||||||||||| || || ||| | 
Sbjct: 285 acagggatcagcttgccatccctatcacgatcaccagggccaacagcaacgactttagcg 226

                                                                       
Query: 371 gagttcagctgcttggaggtctcggggaggaggatgccgccggcgctcttcttgggctgc 430
           | |||||||||||||| |||||| |||||||||||||| |||||||||||  |||||| |
Sbjct: 225 gcgttcagctgcttggtggtctccgggaggaggatgccaccggcgctcttgctgggcttc 166

                                                        
Query: 431 accaccttctccaccagcacccggttgaaggacgggatcagacgc 475
           | || |||||||||||| |||||||| |  |||||||||||||||
Sbjct: 165 agcagcttctccaccagaacccggttcagcgacgggatcagacgc 121

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  121 bits (61), Expect = 3e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                            
Query: 379      ctgcttggaggtctcggggaggaggatgccgccggcgctcttcttgggctgcaccacctt 438
                |||||||| |||||| |||||||||||||||||||||||||| |||||||||| || |||
Sbjct: 14139331 ctgcttggtggtctccgggaggaggatgccgccggcgctcttgttgggctgcagcagctt 14139390

                                                 
Query: 439      ctccaccagcacccggttgaaggacgggatcag 471
                |||||||||||||||||| |  |||||||||||
Sbjct: 14139391 ctccaccagcacccggttcatcgacgggatcag 14139423



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                            
Query: 311      acagggatcagcttcccttccttgtcacggttgccagggccaacagccaccaccttacca 370
                ||||||||||| || || ||| ||||||| | |||||| ||||||||||| || ||  ||
Sbjct: 14137970 acagggatcagtttgccatccctgtcacgttcgccaggaccaacagccactacttttgca 14138029

                           
Query: 371      gagttcagctg 381
                || ||||||||
Sbjct: 14138030 gaattcagctg 14138040



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 146   tcctgcattaaagcagctgatgaa 169
             ||||| ||||||||||||||||||
Sbjct: 97822 tcctggattaaagcagctgatgaa 97799

to top

>gb|AC125784.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0012F18, from chromosome 3, complete sequence
          Length = 122903

 Score =  121 bits (61), Expect = 3e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                         
Query: 379   ctgcttggaggtctcggggaggaggatgccgccggcgctcttcttgggctgcaccacctt 438
             |||||||| |||||| |||||||||||||||||||||||||| |||||||||| || |||
Sbjct: 13622 ctgcttggtggtctccgggaggaggatgccgccggcgctcttgttgggctgcagcagctt 13681

                                              
Query: 439   ctccaccagcacccggttgaaggacgggatcag 471
             |||||||||||||||||| |  |||||||||||
Sbjct: 13682 ctccaccagcacccggttcatcgacgggatcag 13714



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                         
Query: 311   acagggatcagcttcccttccttgtcacggttgccagggccaacagccaccaccttacca 370
             ||||||||||| || || ||| ||||||| | |||||| ||||||||||| || ||  ||
Sbjct: 12261 acagggatcagtttgccatccctgtcacgttcgccaggaccaacagccactacttttgca 12320

                        
Query: 371   gagttcagctg 381
             || ||||||||
Sbjct: 12321 gaattcagctg 12331

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  121 bits (61), Expect = 3e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                            
Query: 379      ctgcttggaggtctcggggaggaggatgccgccggcgctcttcttgggctgcaccacctt 438
                |||||||| |||||| |||||||||||||||||||||||||| |||||||||| || |||
Sbjct: 14134306 ctgcttggtggtctccgggaggaggatgccgccggcgctcttgttgggctgcagcagctt 14134365

                                                 
Query: 439      ctccaccagcacccggttgaaggacgggatcag 471
                |||||||||||||||||| |  |||||||||||
Sbjct: 14134366 ctccaccagcacccggttcatcgacgggatcag 14134398



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                            
Query: 311      acagggatcagcttcccttccttgtcacggttgccagggccaacagccaccaccttacca 370
                ||||||||||| || || ||| ||||||| | |||||| ||||||||||| || ||  ||
Sbjct: 14132945 acagggatcagtttgccatccctgtcacgttcgccaggaccaacagccactacttttgca 14133004

                           
Query: 371      gagttcagctg 381
                || ||||||||
Sbjct: 14133005 gaattcagctg 14133015



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 146   tcctgcattaaagcagctgatgaa 169
             ||||| ||||||||||||||||||
Sbjct: 97822 tcctggattaaagcagctgatgaa 97799

to top

>ref|NM_129803.1| Arabidopsis thaliana nucleic acid binding / transcription factor/
           zinc ion binding AT2G42410 mRNA, complete cds
          Length = 645

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 509 tcttctccttcttcttcttggg 530
           ||||||||||||||||||||||
Sbjct: 65  tcttctccttcttcttcttggg 44

to top

>gb|AC146948.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone P0782F03 map
              near S2137, complete sequence
          Length = 197516

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 508    ctcttctccttcttcttcttgg 529
              ||||||||||||||||||||||
Sbjct: 169232 ctcttctccttcttcttcttgg 169253

to top

>emb|AL672176.10| Zebrafish DNA sequence from clone BUSM1-12F11 in linkage group 19
             Contains the 3' part of the rxrb gene for retinoid x
             receptor beta, a novel gene, the col11a2 gene for collagen
             type XI alpha-2,  the fabgl gene for FabG
             (beta-ketoacyl-[acyl-carrier-protein] reductase, E. coli)
             like, and the 3' part of the brd2 gene for
             bromodomain-containing protein 2, complete sequence
          Length = 100037

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 509   tcttctccttcttcttcttggg 530
             ||||||||||||||||||||||
Sbjct: 90833 tcttctccttcttcttcttggg 90854

to top

>gb|AC005956.4| Arabidopsis thaliana chromosome 2 clone MHK10 map EG05C12, complete
             sequence
          Length = 85835

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 509   tcttctccttcttcttcttggg 530
             ||||||||||||||||||||||
Sbjct: 41470 tcttctccttcttcttcttggg 41449

to top

>ref|XM_704351.1| PREDICTED: Danio rerio bromodomain-containing 2, transcript variant
            10 (brd2), mRNA
          Length = 2732

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 509  tcttctccttcttcttcttggg 530
            ||||||||||||||||||||||
Sbjct: 1715 tcttctccttcttcttcttggg 1694

to top

>ref|XM_704350.1| PREDICTED: Danio rerio bromodomain-containing 2, transcript variant 9
            (brd2), mRNA
          Length = 2562

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 509  tcttctccttcttcttcttggg 530
            ||||||||||||||||||||||
Sbjct: 1715 tcttctccttcttcttcttggg 1694

to top

>ref|XM_704349.1| PREDICTED: Danio rerio bromodomain-containing 2, transcript variant 8
            (brd2), mRNA
          Length = 2849

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 509  tcttctccttcttcttcttggg 530
            ||||||||||||||||||||||
Sbjct: 1832 tcttctccttcttcttcttggg 1811

to top

>ref|XM_704348.1| PREDICTED: Danio rerio bromodomain-containing 2, transcript variant 7
            (brd2), mRNA
          Length = 2502

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 509  tcttctccttcttcttcttggg 530
            ||||||||||||||||||||||
Sbjct: 1715 tcttctccttcttcttcttggg 1694

to top

>ref|XM_704347.1| PREDICTED: Danio rerio bromodomain-containing 2, transcript variant 6
            (brd2), mRNA
          Length = 2505

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 509  tcttctccttcttcttcttggg 530
            ||||||||||||||||||||||
Sbjct: 1715 tcttctccttcttcttcttggg 1694

to top

>ref|XM_704346.1| PREDICTED: Danio rerio bromodomain-containing 2, transcript variant 5
            (brd2), mRNA
          Length = 2562

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 509  tcttctccttcttcttcttggg 530
            ||||||||||||||||||||||
Sbjct: 1832 tcttctccttcttcttcttggg 1811

to top

>ref|XM_685563.1| PREDICTED: Danio rerio bromodomain-containing 2, transcript variant 1
            (brd2), mRNA
          Length = 2616

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 509  tcttctccttcttcttcttggg 530
            ||||||||||||||||||||||
Sbjct: 1832 tcttctccttcttcttcttggg 1811

to top

>ref|XM_704345.1| PREDICTED: Danio rerio bromodomain-containing 2, transcript variant 4
            (brd2), mRNA
          Length = 2705

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 509  tcttctccttcttcttcttggg 530
            ||||||||||||||||||||||
Sbjct: 1688 tcttctccttcttcttcttggg 1667

to top

>ref|XM_704344.1| PREDICTED: Danio rerio bromodomain-containing 2, transcript variant 3
            (brd2), mRNA
          Length = 2625

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 509  tcttctccttcttcttcttggg 530
            ||||||||||||||||||||||
Sbjct: 1832 tcttctccttcttcttcttggg 1811

to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 508     ctcttctccttcttcttcttgg 529
               ||||||||||||||||||||||
Sbjct: 8088613 ctcttctccttcttcttcttgg 8088634

to top

>gb|BC045866.1| Danio rerio bromodomain-containing 2, mRNA (cDNA clone
            IMAGE:3819897), partial cds
          Length = 1868

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 509  tcttctccttcttcttcttggg 530
            ||||||||||||||||||||||
Sbjct: 1845 tcttctccttcttcttcttggg 1824

to top

>dbj|AK099053.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013147L18, full
           insert sequence
          Length = 2799

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 508 ctcttctccttcttcttcttgg 529
           ||||||||||||||||||||||
Sbjct: 504 ctcttctccttcttcttcttgg 483

to top

>dbj|AK063436.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-115-E06, full
           insert sequence
          Length = 1661

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 508 ctcttctccttcttcttcttgg 529
           ||||||||||||||||||||||
Sbjct: 457 ctcttctccttcttcttcttgg 436

to top

>emb|BX510994.6| Zebrafish DNA sequence from clone CH211-51F10 in linkage group 19,
              complete sequence
          Length = 186973

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 509    tcttctccttcttcttcttggg 530
              ||||||||||||||||||||||
Sbjct: 102795 tcttctccttcttcttcttggg 102774

to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 508     ctcttctccttcttcttcttgg 529
               ||||||||||||||||||||||
Sbjct: 8158443 ctcttctccttcttcttcttgg 8158464

to top

>gb|U03982.1|PLU03982 Puma lentivirus 14 (gag), polyprotein (pol), viral infectivity factor
            (vif),  and envelope precursor (env) genes, complete cds
          Length = 9100

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 509  tcttctccttcttcttcttggg 530
            ||||||||||||||||||||||
Sbjct: 8666 tcttctccttcttcttcttggg 8645

to top

>ref|XM_536038.2| PREDICTED: Canis familiaris similar to Amyotrophic lateral sclerosis
            2 chromosome region candidate gene protein 19
            (Partitioning-defective 3-like protein) (PAR3-L protein)
            (PAR3-beta) (LOC478879), mRNA
          Length = 4324

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 507  gctcttctccttcttcttctt 527
            |||||||||||||||||||||
Sbjct: 2448 gctcttctccttcttcttctt 2428

to top

>gb|AC135806.4| Mus musculus BAC clone RP24-289M10 from chromosome 18, complete
             sequence
          Length = 179327

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 508   ctcttctccttcttcttcttg 528
             |||||||||||||||||||||
Sbjct: 86418 ctcttctccttcttcttcttg 86438

to top

>gb|AC124548.5| Mus musculus BAC clone RP23-276P11 from 18, complete sequence
          Length = 173805

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 508   ctcttctccttcttcttcttg 528
             |||||||||||||||||||||
Sbjct: 15263 ctcttctccttcttcttcttg 15283

to top

>emb|AL390121.6| Human DNA sequence from clone RP11-147C23 on chromosome 1 Contains the 3'
              end of a novel gene, complete sequence
          Length = 150396

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 431    accaccttctccaccagcacc 451
              |||||||||||||||||||||
Sbjct: 147632 accaccttctccaccagcacc 147652

to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 382    cttggaggtctcggggaggaggatgccgccggcgctcttct 422
              ||||| ||| ||||||| || ||||||||||||| ||||||
Sbjct: 229436 cttggcggtgtcggggatgatgatgccgccggcggtcttct 229476



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 440     tccaccagcacccggttgaaggac 463
               |||||||||||||||| |||||||
Sbjct: 4166715 tccaccagcacccggtcgaaggac 4166692

to top

>gb|AY221653.1| HIV-1 isolate 02HCH1-164 from South Korea nef protein (nef) gene,
           complete cds
          Length = 654

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 508 ctcttctccttcttcttcttg 528
           |||||||||||||||||||||
Sbjct: 201 ctcttctccttcttcttcttg 181

to top

>gb|DQ124215.2| Dunaliella salina MAR-binding protein mRNA, complete cds
          Length = 2232

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 503  cgccgctcttctccttcttcttctt 527
            |||||||||| ||||||||||||||
Sbjct: 1477 cgccgctcttgtccttcttcttctt 1453

to top

>dbj|BS000076.1| Pan troglodytes chromosome 22 clone:PTB-096O09, map 22, complete
              sequences
          Length = 186284

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 509    tcttctccttcttcttcttgg 529
              |||||||||||||||||||||
Sbjct: 107093 tcttctccttcttcttcttgg 107113

to top

>dbj|AP001683.1| Homo sapiens genomic DNA, chromosome 21q, section 27/105
          Length = 340000

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 509    tcttctccttcttcttcttgg 529
              |||||||||||||||||||||
Sbjct: 171001 tcttctccttcttcttcttgg 171021

to top

>gb|U20824.1|EHVU20824 Equine herpesvirus 2, complete genome
          Length = 184427

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 506    cgctcttctccttcttcttct 526
              |||||||||||||||||||||
Sbjct: 106022 cgctcttctccttcttcttct 106042

to top

>emb|AL772394.7| Mouse DNA sequence from clone RP23-67C1 on chromosome 4, complete
             sequence
          Length = 89437

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78599 tcttctccttcttcttcttgg 78579



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78572 tcttctccttcttcttcttgg 78552



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78545 tcttctccttcttcttcttgg 78525



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78518 tcttctccttcttcttcttgg 78498



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78494 tcttctccttcttcttcttgg 78474



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78467 tcttctccttcttcttcttgg 78447



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78443 tcttctccttcttcttcttgg 78423



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78419 tcttctccttcttcttcttgg 78399



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78398 tcttctccttcttcttcttgg 78378



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78374 tcttctccttcttcttcttgg 78354



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78350 tcttctccttcttcttcttgg 78330



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78326 tcttctccttcttcttcttgg 78306



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78302 tcttctccttcttcttcttgg 78282



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78278 tcttctccttcttcttcttgg 78258



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 509   tcttctccttcttcttcttgg 529
             |||||||||||||||||||||
Sbjct: 78254 tcttctccttcttcttcttgg 78234



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 510   cttctccttcttcttcttgg 529
             ||||||||||||||||||||
Sbjct: 78229 cttctccttcttcttcttgg 78210

to top

>dbj|AP000472.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:B258A5,
              LL56-APP region, complete sequence
          Length = 169328

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 509    tcttctccttcttcttcttgg 529
              |||||||||||||||||||||
Sbjct: 164718 tcttctccttcttcttcttgg 164738

to top

>dbj|AP000454.2| Homo sapiens genomic DNA, chromosome 21q21.2 clone:21B23F24, LL56-APP
            region, complete sequence
          Length = 35875

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 509  tcttctccttcttcttcttgg 529
            |||||||||||||||||||||
Sbjct: 6352 tcttctccttcttcttcttgg 6372

to top

>gb|AY741093.1| Integration vector pJK202, complete sequence
          Length = 53204

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 404  atgccgccggcgctcttctt 423
            ||||||||||||||||||||
Sbjct: 7970 atgccgccggcgctcttctt 7951

to top

>ref|NM_115515.1| Arabidopsis thaliana unknown protein AT3G56570 mRNA, complete cds
          Length = 1596

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 831 ctcttctccttcttcttctt 812

to top

>ref|NM_148643.1| Arabidopsis thaliana unknown protein AT1G68945 mRNA, complete cds
          Length = 369

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 509 tcttctccttcttcttcttgggaaacaa 536
           |||||| ||||||||| |||||||||||
Sbjct: 178 tcttcttcttcttcttattgggaaacaa 151

to top

>ref|NM_118242.2| Arabidopsis thaliana kinase AT4G21230 mRNA, complete cds
          Length = 1987

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 509 tcttctccttcttcttcttg 528
           ||||||||||||||||||||
Sbjct: 32  tcttctccttcttcttcttg 51

to top

>ref|NM_119198.4| Arabidopsis thaliana ATP binding / protein binding / protein
           kinase/ protein serine/threonine kinase/
           protein-tyrosine kinase AT4G30520 mRNA, complete cds
          Length = 2407

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 116 ctcttctccttcttcttctt 135

to top

>ref|NM_125003.1| Arabidopsis thaliana nucleic acid binding / transcription factor/
           zinc ion binding AT5G56200 mRNA, complete cds
          Length = 1482

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 228 ctcttctccttcttcttctt 209

to top

>ref|NM_124154.3| Arabidopsis thaliana protein binding / signal transducer AT5G47800
           mRNA, complete cds
          Length = 1967

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 35  ctcttctccttcttcttctt 54

to top

>ref|NM_116727.2| Arabidopsis thaliana PDF2 (PROTODERMAL FACTOR2); DNA binding /
           transcription factor AT4G04890 (PDF2) mRNA, complete cds
          Length = 3049

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 34  ctcttctccttcttcttctt 53

to top

>gb|AC111034.11| Mus musculus chromosome 8, clone RP23-202K1, complete sequence
          Length = 200303

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 82944 tcttctccttcttcttcttg 82963

to top

>gb|AC154808.2| Mus musculus BAC clone RP24-512K19 from chromosome 13, complete sequence
          Length = 187080

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 100951 ctcttctccttcttcttctt 100970

to top

>ref|XM_635916.1| Dictyostelium discoideum hypothetical protein (DDB0218263), partial
           mRNA
          Length = 1560

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 90  ctcttctccttcttcttctt 71

to top

>gb|AC154426.2| Mus musculus BAC clone RP24-199A21 from chromosome 14, complete sequence
          Length = 210568

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 509    tcttctccttcttcttcttg 528
              ||||||||||||||||||||
Sbjct: 118291 tcttctccttcttcttcttg 118272

to top

>gb|AC163036.2| Mus musculus BAC clone RP23-219G12 from chromosome 17, complete
             sequence
          Length = 217187

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 71309 ctcttctccttcttcttctt 71290

to top

>ref|XM_479765.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 921

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 507 gctcttctccttcttcttct 526
           ||||||||||||||||||||
Sbjct: 280 gctcttctccttcttcttct 261

to top

>gb|AC123744.8| Mus musculus chromosome 7, clone RP24-120F8, complete sequence
          Length = 160977

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 4626 ctcttctccttcttcttctt 4645

to top

>gb|AC109257.8| Mus musculus chromosome 7, clone RP23-362F15, complete sequence
          Length = 158694

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 142491 ctcttctccttcttcttctt 142510

to top

>gb|AC139637.17| Mus musculus chromosome 15, clone RP24-253M12, complete sequence
          Length = 136076

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 90189 ctcttctccttcttcttctt 90170

to top

>gb|AF441530.1| Pinus taeda PtTX3110 microsatellite sequence
          Length = 363

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 111 ctcttctccttcttcttctt 130

to top

>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome
          Length = 943016

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 473    cgcctaatcgccgccatggccgag 496
              ||||| ||||||||||||||||||
Sbjct: 618952 cgcctcatcgccgccatggccgag 618975

to top

>gb|AC167019.4| Mus musculus BAC clone RP23-262K24 from chromosome 15, complete sequence
          Length = 207785

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 144    cctcctgcattaaagcagct 163
              ||||||||||||||||||||
Sbjct: 155150 cctcctgcattaaagcagct 155131

to top

>gb|U88315.1| Caenorhabditis elegans cosmid C37H5, complete sequence
          Length = 43721

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 8891 ctcttctccttcttcttctt 8872

to top

>gb|AC137596.2| Oryza sativa (japonica cultivar-group) chromosome 9 clone
             OSJNBb0031H05, complete sequence
          Length = 141200

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 504   gccgctcttctccttcttcttctt 527
             ||||||||||| ||||||||||||
Sbjct: 83862 gccgctcttcttcttcttcttctt 83839

to top

>gb|AY615358.1| Mycoplasma gallisepticum strain D9604 pMGA multigene locus, partial
           sequence
          Length = 9060

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 509 tcttctccttcttcttcttgggaaacaa 536
           |||||| |||||||||||||| ||||||
Sbjct: 811 tcttcttcttcttcttcttggaaaacaa 784

to top

>gb|AC140799.6| Mus musculus chromosome 15, clone RP24-147N23, complete sequence
          Length = 162329

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 34471 ctcttctccttcttcttctt 34452

to top

>ref|XM_956829.1| Neurospora crassa OR74A hypothetical protein (NCU05309.1) partial
           mRNA
          Length = 1329

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 378 ctcttctccttcttcttctt 359

to top

>ref|XM_324665.1| Neurospora crassa OR74A hypothetical protein (NCU05309.1) partial
           mRNA
          Length = 1329

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 378 ctcttctccttcttcttctt 359

to top

>gb|AC147342.3| Pan troglodytes BAC clone CH251-13D13 from Y, complete sequence
          Length = 146106

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 61200 ctcttctccttcttcttctt 61181

to top

>gb|AC147684.4| Pan troglodytes BAC clone CH251-497P9 from Y, complete sequence
          Length = 230902

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 212191 ctcttctccttcttcttctt 212210



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 12847 ctcttctccttcttcttctt 12828

to top

>gb|AC147665.3| Pan troglodytes BAC clone CH251-134K23 from Y, complete sequence
          Length = 190790

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 165460 ctcttctccttcttcttctt 165479

to top

>gb|AC147686.2| Pan troglodytes BAC clone CH251-285E7 from Y, complete sequence
          Length = 176158

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 59759 ctcttctccttcttcttctt 59740

to top

>gb|AC147661.2| Pan troglodytes BAC clone CH251-336D20 from Y, complete sequence
          Length = 160602

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 34252 ctcttctccttcttcttctt 34271

to top

>gb|AC147130.3| Pan troglodytes BAC clone CH251-390G11 from Y, complete sequence
          Length = 180797

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 104156 ctcttctccttcttcttctt 104137

to top

>gb|AC146186.3| Pan troglodytes BAC clone CH251-517F3 from Y, complete sequence
          Length = 187140

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 83133 ctcttctccttcttcttctt 83152

to top

>gb|AC147654.3| Pan troglodytes BAC clone CH251-511H17 from Y, complete sequence
          Length = 241654

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 219035 ctcttctccttcttcttctt 219054



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 22622 ctcttctccttcttcttctt 22603

to top

>gb|AC147682.3| Pan troglodytes BAC clone CH251-563H18 from Y, complete sequence
          Length = 196240

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 73814 ctcttctccttcttcttctt 73795

to top

>gb|AC149097.1| Pan troglodytes BAC clone CH251-8I14 from Y, complete sequence
          Length = 177481

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 8713 ctcttctccttcttcttctt 8732

to top

>gb|DQ226960.1| Boechera divaricarpa isolate AD-B10 mRNA sequence
          Length = 505

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 246 ctcttctccttcttcttctt 227

to top

>gb|AY557904.1| Saccharomyces cerevisiae clone FLH004145.01X YKL040C gene, complete
           cds
          Length = 771

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 510 cttctccttcttcttcttgg 529
           ||||||||||||||||||||
Sbjct: 403 cttctccttcttcttcttgg 384

to top

>gb|AY129816.2| Chrysiptera parasema high choriolytic enzyme mRNA, complete cds
          Length = 1178

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 509 tcttctccttcttcttcttg 528
           ||||||||||||||||||||
Sbjct: 141 tcttctccttcttcttcttg 122

to top

>gb|AC110566.17| Mus musculus chromosome 5, clone RP23-300A10, complete sequence
          Length = 175471

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 163863 ctcttctccttcttcttctt 163882

to top

>gb|AC140047.8| Mus musculus chromosome 17, clone RP23-233F10, complete sequence
          Length = 186632

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 428   tgcaccaccttctccaccagcacc 451
             |||||||||| |||||||||||||
Sbjct: 81475 tgcaccacctcctccaccagcacc 81498

to top

>gb|AC006338.6| Homo sapiens BAC clone RP11-539D10 from Y, complete sequence
          Length = 175990

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 94639 ctcttctccttcttcttctt 94620

to top

>gb|AC142474.4| Mus musculus BAC clone RP24-362N7 from chromosome 15, complete sequence
          Length = 172879

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 159938 ctcttctccttcttcttctt 159957

to top

>gb|AC124368.5| Mus musculus BAC clone RP24-546J13 from chromosome 14, complete
             sequence
          Length = 160510

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 93011 tcttctccttcttcttcttg 92992

to top

>gb|AC113181.7| Mus musculus chromosome 5, clone RP23-359I6, complete sequence
          Length = 213684

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 509   tcttctccttcttcttcttgggaa 532
             |||||| |||||||||||||||||
Sbjct: 40524 tcttcttcttcttcttcttgggaa 40501

to top

>emb|AJ744860.1| uncultured bacterium pTB11 plasmid complete genome
          Length = 68869

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 404   atgccgccggcgctcttctt 423
             ||||||||||||||||||||
Sbjct: 17223 atgccgccggcgctcttctt 17204

to top

>ref|XM_745279.1| Aspergillus fumigatus Af293 hypothetical protein (Afu1g06230) partial
            mRNA
          Length = 1338

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 510  cttctccttcttcttcttgg 529
            ||||||||||||||||||||
Sbjct: 1125 cttctccttcttcttcttgg 1106

to top

>gb|AC107664.8| Mus musculus chromosome 17, clone RP23-103F2, complete sequence
          Length = 208198

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 31605 ctcttctccttcttcttctt 31586

to top

>ref|XM_448281.1| Candida glabrata CBS138, CAGL0K01309g partial mRNA
          Length = 1257

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 509  tcttctccttcttcttcttg 528
            ||||||||||||||||||||
Sbjct: 1078 tcttctccttcttcttcttg 1059

to top

>gb|AC132366.4| Mus musculus BAC clone RP23-461N12 from chromosome 7, complete sequence
          Length = 183964

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 48455 tcttctccttcttcttcttg 48474

to top

>gb|AC133654.4| Mus musculus BAC clone RP24-332N10 from chromosome 15, complete sequence
          Length = 194622

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 144    cctcctgcattaaagcagct 163
              ||||||||||||||||||||
Sbjct: 187933 cctcctgcattaaagcagct 187952

to top

>gb|AC126942.4| Mus musculus BAC clone RP23-174P9 from chromosome 17, complete sequence
          Length = 182423

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 154970 ctcttctccttcttcttctt 154951

to top

>gb|BC042186.1| Homo sapiens cDNA clone IMAGE:5393404, partial cds
          Length = 814

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 509 tcttctccttcttcttcttg 528
           ||||||||||||||||||||
Sbjct: 470 tcttctccttcttcttcttg 451

to top

>ref|XM_811341.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053507049.179) partial mRNA
          Length = 3402

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 663 ctcttctccttcttcttctt 644

to top

>gb|AC124402.5| Mus musculus BAC clone RP24-365M23 from chromosome 12, complete
             sequence
          Length = 205782

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 80812 tcttctccttcttcttcttg 80793

to top

>ref|XM_848871.1| PREDICTED: Canis familiaris similar to ankyrin repeat domain 45
           (LOC611232), mRNA
          Length = 1558

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 509 tcttctccttcttcttcttg 528
           ||||||||||||||||||||
Sbjct: 266 tcttctccttcttcttcttg 247

to top

>emb|CR691079.2|CNS0FW6R Tetraodon nigroviridis full-length cDNA
          Length = 1125

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 507 gctcttctccttcttcttct 526
           ||||||||||||||||||||
Sbjct: 901 gctcttctccttcttcttct 920

to top

>gb|AC092100.5| Homo sapiens BAC clone RP11-666G4 from 7, complete sequence
          Length = 122099

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 59696 ctcttctccttcttcttctt 59677

to top

>emb|CR657200.2|CNS0F62E Tetraodon nigroviridis full-length cDNA
          Length = 929

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 507 gctcttctccttcttcttct 526
           ||||||||||||||||||||
Sbjct: 667 gctcttctccttcttcttct 686

to top

>gb|AC122734.6| Mus musculus chromosome 10, clone RP24-108E17, complete sequence
          Length = 178230

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 3951 ctcttctccttcttcttctt 3932

to top

>gb|AC144378.2| Pan troglodytes BAC clone RP43-20D17 from Y, complete sequence
          Length = 194240

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 22613 ctcttctccttcttcttctt 22594

to top

>gb|AC142313.1| Pan troglodytes BAC clone RP43-48C7 from Y, complete sequence
          Length = 191133

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 172434 ctcttctccttcttcttctt 172453

to top

>gb|AC159017.2| Pan troglodytes BAC clone CH251-571G18 from chromosome y, complete
              sequence
          Length = 196802

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 104975 ctcttctccttcttcttctt 104956

to top

>gb|AC158913.4| Mus musculus chromosome 5, clone RP24-268J3, complete sequence
          Length = 152822

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 46757 ctcttctccttcttcttctt 46776

to top

>gb|AY918932.1| Schoenoplectus americanus clone SCAM.02 microsatellite sequence
          Length = 442

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 126 ctcttctccttcttcttctt 107

to top

>gb|AC095491.7| Rattus norvegicus 4 BAC CH230-7L13 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 293757

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 510    cttctccttcttcttcttgg 529
              ||||||||||||||||||||
Sbjct: 162201 cttctccttcttcttcttgg 162220

to top

>emb|AL592044.4| Human DNA sequence from clone RP13-407F1 on chromosome 13, complete
              sequence
          Length = 236130

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 509    tcttctccttcttcttcttg 528
              ||||||||||||||||||||
Sbjct: 140613 tcttctccttcttcttcttg 140632

to top

>emb|AL590239.7| Human DNA sequence from clone RP11-466D24 on chromosome 6, complete
              sequence
          Length = 127316

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 116174 ctcttctccttcttcttctt 116193

to top

>ref|XM_502947.1| Yarrowia lipolytica CLIB122, YALI0D17600g predicted mRNA
          Length = 1098

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 509 tcttctccttcttcttcttg 528
           ||||||||||||||||||||
Sbjct: 826 tcttctccttcttcttcttg 807

to top

>emb|AL359853.18| Human DNA sequence from clone RP11-12M5 on chromosome 1 Contains five
             novel genes and a CpG island, complete sequence
          Length = 173031

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 32428 tcttctccttcttcttcttg 32409

to top

>emb|AL356754.18| Human DNA sequence from clone RP11-11C5 on chromosome 13 Contains a 60S
             ribosomal protein L21 (RPL21) pseudogene and the 3' end of
             a novel gene, complete sequence
          Length = 169888

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 92625 ctcttctccttcttcttctt 92644

to top

>emb|AL354868.10| Human DNA sequence from clone RP11-339A7 on chromosome 6 Contains a
              ribosomal protein L21 (RPL21) pseudogene, complete sequence
          Length = 164018

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 152920 ctcttctccttcttcttctt 152901



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 152898 ctcttctccttcttcttctt 152879

to top

>emb|AL050322.13|HSJ727I10 Human DNA sequence from clone RP4-727I10 on chromosome 20 Contains a
             novel gene, ESTs, STSs and GSSs, complete sequence
          Length = 114152

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 62828 ctcttctccttcttcttctt 62809

to top

>emb|X71621.1|SCELM1AA S.cerevisiae genes ELM1 and PRI2
          Length = 17564

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 510   cttctccttcttcttcttgg 529
             ||||||||||||||||||||
Sbjct: 17162 cttctccttcttcttcttgg 17181

to top

>emb|BX057216.1|CNS09GB8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 789

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 509 tcttctccttcttcttcttg 528
           ||||||||||||||||||||
Sbjct: 64  tcttctccttcttcttcttg 83

to top

>gb|AY045928.1| Arabidopsis thaliana At1g68945 mRNA sequence
          Length = 385

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 509 tcttctccttcttcttcttgggaaacaa 536
           |||||| ||||||||| |||||||||||
Sbjct: 191 tcttcttcttcttcttattgggaaacaa 218

to top

>emb|X07678.1|CEHSP70F Caenorhabditis elegans hsp6F gene N-terminal region
          Length = 2883

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 82  ctcttctccttcttcttctt 101

to top

>emb|CR380957.1| Candida glabrata strain CBS138 chromosome K complete sequence
          Length = 1302002

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 509    tcttctccttcttcttcttg 528
              ||||||||||||||||||||
Sbjct: 118426 tcttctccttcttcttcttg 118445

to top

>gb|AC162938.5| Mus musculus BAC clone RP23-104D6 from chromosome 9, complete sequence
          Length = 204657

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 170576 ctcttctccttcttcttctt 170595

to top

>emb|AL939127.1|SCO939127 Streptomyces coelicolor A3(2) complete genome; segment 24/29
          Length = 290850

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 479   atcgccgccatggccgagat 498
             ||||||||||||||||||||
Sbjct: 61095 atcgccgccatggccgagat 61076

to top

>emb|AL670002.1|NCB24G3 Neurospora crassa DNA linkage group II BAC clone B24G3
          Length = 77166

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 67861 ctcttctccttcttcttctt 67842

to top

>emb|AL451012.1|NCB21O8 Neurospora crassa DNA linkage group II BAC clone B21O8
          Length = 41593

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 2842 ctcttctccttcttcttctt 2823

to top

>emb|AL163972.1|ATT5P19 Arabidopsis thaliana DNA chromosome 3, BAC clone T5P19
          Length = 101539

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 71090 ctcttctccttcttcttctt 71071

to top

>emb|AL161577.2|ATCHRIV73 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 73
          Length = 194862

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 56919 ctcttctccttcttcttctt 56900

to top

>emb|AL161554.2|ATCHRIV54 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 54
          Length = 198715

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 509    tcttctccttcttcttcttg 528
              ||||||||||||||||||||
Sbjct: 133225 tcttctccttcttcttcttg 133206

to top

>emb|AL161552.2|ATCHRIV52 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 52
          Length = 198427

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 21256 ctcttctccttcttcttctt 21275

to top

>emb|AL161502.2|ATCHRIV14 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 14
          Length = 198563

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 14291 ctcttctccttcttcttctt 14272

to top

>emb|AL021637.2|ATF18F4 Arabidopsis thaliana DNA chromosome 4, BAC clone F18F4 (ESSA project)
          Length = 99725

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 38277 ctcttctccttcttcttctt 38296

to top

>emb|AL021960.2|ATF7J7 Arabidopsis thaliana DNA chromosome 4, BAC clone  F7J7 (ESSA project)
          Length = 91387

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 75022 tcttctccttcttcttcttg 75003

to top

>emb|AJ400821.1|CRU400821 Capsella rubella ORF1, ORF2, ORF3, ORF4, ORF5 and ORF6 (partial)
          Length = 26241

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 509  tcttctccttcttcttcttgggaaacaa 536
            |||||| |||||||||||| ||||||||
Sbjct: 7576 tcttcttcttcttcttcttcggaaacaa 7549

to top

>gb|AC155716.7| Mus musculus 10 BAC RP24-177O15 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 154016

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 100312 ctcttctccttcttcttctt 100293

to top

>emb|CR405705.11| Zebrafish DNA sequence from clone DKEY-64E13 in linkage group 17,
            complete sequence
          Length = 155058

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 2645 ctcttctccttcttcttctt 2664

to top

>emb|AL672260.25| Mouse DNA sequence from clone DN-127L1 on chromosome 3 Contains a
             Saccharomyces cerevisiae Nip7p homolog (pEachy) homolog
             pseudogene, a tumor protein translationally-controlled 1
             (Tpt1) pseudogene, a high mobility group box 2 (Hmgb2)
             pseudogene and the Cd2 gene for CD2 antigen, complete
             sequence
          Length = 169010

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 11685 tcttctccttcttcttcttg 11666

to top

>ref|NM_001025209.1| Strongylocentrotus purpuratus soluble adenylyl cyclase (LOC574069),
            mRNA
          Length = 5938

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 3666 ctcttctccttcttcttctt 3647

to top

>gb|AC163901.2| Mus musculus BAC clone RP23-269N21 from chromosome 17, complete sequence
          Length = 202092

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 182708 ctcttctccttcttcttctt 182727

to top

>gb|AY926532.1| Strongylocentrotus purpuratus soluble adenylyl cyclase mRNA, complete
            cds
          Length = 5938

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 3666 ctcttctccttcttcttctt 3647

to top

>gb|AF121899.3| Homo sapiens chromosome 8 clone GS1-2d9 map 8q24.3, complete sequence
          Length = 57150

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 21335 ctcttctccttcttcttctt 21354

to top

>dbj|BS000662.3| Pan troglodytes chromosome Y clone: PTB-143L19, complete sequence
          Length = 193499

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 166175 ctcttctccttcttcttctt 166156

to top

>dbj|BS000661.3| Pan troglodytes chromosome Y clone: PTB-101K22, complete sequence
          Length = 185790

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 147980 ctcttctccttcttcttctt 147961

to top

>dbj|BS000547.1| Pan troglodytes chromosome Y clone:PTB-232N08, complete sequences
          Length = 219991

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 214481 ctcttctccttcttcttctt 214462

to top

>dbj|BS000672.1| Pan troglodytes chromosome Y clone:PTB-410J23, complete sequence
          Length = 179523

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 83137 ctcttctccttcttcttctt 83118

to top

>gb|AC114495.2| Homo sapiens chromosome 1 clone RP11-490K7, complete sequence
          Length = 174903

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 3186 ctcttctccttcttcttctt 3167

to top

>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNAb0079B22, from chromosome 3, complete sequence
          Length = 156933

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 146   tcctgcattaaagcagctgatgaa 169
             ||||| ||||||||||||||||||
Sbjct: 31822 tcctggattaaagcagctgatgaa 31799

to top

>gb|AC022762.8| Homo sapiens chromosome 11, clone RP11-290F24, complete sequence
          Length = 186604

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 524    tcttgggaaacaagcaagag 543
              ||||||||||||||||||||
Sbjct: 151808 tcttgggaaacaagcaagag 151827

to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 508      ctcttctccttcttcttctt 527
                ||||||||||||||||||||
Sbjct: 14352699 ctcttctccttcttcttctt 14352718



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 508      ctcttctccttcttcttctt 527
                ||||||||||||||||||||
Sbjct: 14154896 ctcttctccttcttcttctt 14154877



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 508      ctcttctccttcttcttctt 527
                ||||||||||||||||||||
Sbjct: 13530303 ctcttctccttcttcttctt 13530322



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 508      ctcttctccttcttcttctt 527
                ||||||||||||||||||||
Sbjct: 13330721 ctcttctccttcttcttctt 13330702



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 9865249 ctcttctccttcttcttctt 9865268



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 9665534 ctcttctccttcttcttctt 9665515



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 9130292 ctcttctccttcttcttctt 9130311



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 8933879 ctcttctccttcttcttctt 8933860



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 8396704 ctcttctccttcttcttctt 8396723



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 8196973 ctcttctccttcttcttctt 8196954



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 4569155 ctcttctccttcttcttctt 4569174



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 4409613 ctcttctccttcttcttctt 4409594



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 913364 ctcttctccttcttcttctt 913383

to top

>gb|AC009384.7| Drosophila melanogaster 3L BAC RP98-10L1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 168652

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 79673 ctcttctccttcttcttctt 79692

to top

>gb|AC044913.7| Homo sapiens chromosome 15, clone RP11-446P9, complete sequence
          Length = 161549

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 133742 ctcttctccttcttcttctt 133761

to top

>dbj|AK021773.1| Homo sapiens cDNA FLJ11711 fis, clone HEMBA1005152
          Length = 1839

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 509  tcttctccttcttcttcttg 528
            ||||||||||||||||||||
Sbjct: 1237 tcttctccttcttcttcttg 1218

to top

>gb|AC069368.14| Homo sapiens chromosome 15, clone CTD-2017F17, complete sequence
          Length = 132080

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 15461 tcttctccttcttcttcttg 15442

to top

>gb|AF351398.1| Gossypium hirsutum clone JESPR160 microsatellite sequence
          Length = 460

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 89  ctcttctccttcttcttctt 70

to top

>gb|AF351393.1| Gossypium hirsutum clone JESPR155 microsatellite sequence
          Length = 609

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 122 ctcttctccttcttcttctt 103

to top

>gb|AF351295.1| Gossypium hirsutum clone JESPR56 microsatellite sequence
          Length = 255

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 164 ctcttctccttcttcttctt 145

to top

>gb|AF351293.1| Gossypium hirsutum clone JESPR54 microsatellite sequence
          Length = 555

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 340 ctcttctccttcttcttctt 321

to top

>gb|AC103976.6| Homo sapiens chromosome 15, clone RP11-121E15, complete sequence
          Length = 182826

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 510   cttctccttcttcttcttgggaaacaag 537
             ||||||||||||||||||  ||||||||
Sbjct: 70757 cttctccttcttcttctttagaaacaag 70784

to top

>ref|NM_140915.3| Drosophila melanogaster CG14183-RA (CG14183), mRNA
          Length = 2713

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 1681 ctcttctccttcttcttctt 1662

to top

>gb|AC160863.10| Mus musculus 10 BAC RP23-234F23 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 189718

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 44632 tcttctccttcttcttcttg 44651

to top

>gb|AC026992.12| Homo sapiens chromosome 15, clone RP11-352D13, complete sequence
          Length = 177902

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 151666 ctcttctccttcttcttctt 151647

to top

>gb|AC100822.2| Homo sapiens chromosome 8, clone RP11-654O1, complete sequence
          Length = 186380

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 111617 ctcttctccttcttcttctt 111636

to top

>gb|AC015890.9| Mus musculus chromosome 10, clone RP21-244O21, complete sequence
          Length = 160840

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 124545 ctcttctccttcttcttctt 124526

to top

>gb|AC025741.5| Homo sapiens BAC clone RP11-501E14 from 4, complete sequence
          Length = 190221

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 182670 ctcttctccttcttcttctt 182689

to top

>ref|XM_696183.1| PREDICTED: Danio rerio similar to Wu:fb33b12 protein (LOC572464),
           partial mRNA
          Length = 929

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 507 gctcttctccttcttcttct 526
           ||||||||||||||||||||
Sbjct: 633 gctcttctccttcttcttct 614

to top

>ref|XM_686721.1| PREDICTED: Danio rerio similar to mBLVR (LOC563359), mRNA
          Length = 3777

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 509  tcttctccttcttcttcttg 528
            ||||||||||||||||||||
Sbjct: 2385 tcttctccttcttcttcttg 2366

to top

>gb|AY062575.1| Arabidopsis thaliana Unknown protein (At4g04890; T1J1.3) mRNA,
           complete cds
          Length = 3044

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 30  ctcttctccttcttcttctt 49

to top

>gb|AC182701.2| Populus trichocarpa clone Pop1-74K8, complete sequence
          Length = 93140

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 509  tcttctccttcttcttcttg 528
            ||||||||||||||||||||
Sbjct: 7618 tcttctccttcttcttcttg 7599

to top

>gb|AC026782.6| Homo sapiens chromosome 5 clone CTD-2015A6, complete sequence
          Length = 214025

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 90585 ctcttctccttcttcttctt 90604

to top

>gb|AC097627.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0079B22, from chromosome 3, complete sequence
          Length = 125217

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 146   tcctgcattaaagcagctgatgaa 169
             ||||| ||||||||||||||||||
Sbjct: 27396 tcctggattaaagcagctgatgaa 27419

to top

>ref|XM_680829.1| PREDICTED: Danio rerio similar to adaptor-related protein complex 3,
            delta 1 subunit (LOC557718), mRNA
          Length = 2319

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 509  tcttctccttcttcttcttg 528
            ||||||||||||||||||||
Sbjct: 1366 tcttctccttcttcttcttg 1347

to top

>gb|AC113015.12| Mus musculus chromosome 1, clone RP23-180E19, complete sequence
          Length = 188389

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 60897 ctcttctccttcttcttctt 60916

to top

>gb|AY058318.1| Drosophila melanogaster GH08353 full length cDNA
          Length = 2731

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 1681 ctcttctccttcttcttctt 1662

to top

>gb|AF424560.1|AF424560 Arabidopsis thaliana AT4g04890/T1J1_3 mRNA, complete cds
          Length = 2993

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 34  ctcttctccttcttcttctt 53

to top

>ref|XM_625679.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd4_770),
            partial mRNA
          Length = 4320

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 1179 ctcttctccttcttcttctt 1160

to top

>gb|AC140419.8| Mus musculus BAC clone RP24-435P9 from chromosome 3, complete sequence
          Length = 157093

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 125510 ctcttctccttcttcttctt 125491

to top

>gb|AC010088.4| Homo sapiens BAC clone RP11-289L7 from Y, complete sequence
          Length = 107687

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 72006 ctcttctccttcttcttctt 72025

to top

>ref|NM_071891.3| Caenorhabditis elegans C37H5.5 (C37H5.5) mRNA, complete cds
          Length = 2435

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 537 ctcttctccttcttcttctt 518

to top

>ref|NG_002806.1| Homo sapiens adlican pseudogene (ADLICANP) on chromosome Y
          Length = 31571

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 23333 ctcttctccttcttcttctt 23352

to top

>gb|AC147674.5| Pan troglodytes BAC clone CH251-28I8 from chromosome y, complete
             sequence
          Length = 193266

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 90267 ctcttctccttcttcttctt 90286

to top

>gb|AC006983.4|AC006983 Homo sapiens BAC clone RP11-70G12 from Y, complete sequence
          Length = 180345

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 64747 ctcttctccttcttcttctt 64728

to top

>gb|AC025913.11| Mus musculus 10 BAC RP23-287L13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 228124

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 145330 ctcttctccttcttcttctt 145311

to top

>gb|AC156949.9| Mus musculus 10 BAC RP24-347J14 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 149183

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 95460 tcttctccttcttcttcttg 95441

to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 504      gccgctcttctccttcttcttctt 527
                ||||||||||| ||||||||||||
Sbjct: 21627236 gccgctcttcttcttcttcttctt 21627213

to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8,
              complete sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 507    gctcttctccttcttcttct 526
              ||||||||||||||||||||
Sbjct: 745350 gctcttctccttcttcttct 745331

to top

>emb|BX827036.1|CNS0A2GJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB89ZF08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 2292

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 116 ctcttctccttcttcttctt 135

to top

>emb|BX831820.1|CNS0A1NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH31ZC03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1965

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 35  ctcttctccttcttcttctt 54

to top

>gb|AC068400.10| Homo sapiens chromosome 17, clone RP11-378E13, complete sequence
          Length = 205588

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 105485 ctcttctccttcttcttctt 105504

to top

>gb|AC151848.4| Pan troglodytes BAC clone CH251-346F2 from chromosome y, complete
              sequence
          Length = 147582

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 122491 ctcttctccttcttcttctt 122510

to top

>gb|AC156943.1| Pan troglodytes BAC clone CH251-607J5 from chromosome y, complete
              sequence
          Length = 193730

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 188865 ctcttctccttcttcttctt 188846

to top

>gb|AC011665.8|AC011665 Arabidopsis thaliana chromosome 1 BAC T6L1 genomic sequence, complete
             sequence
          Length = 100515

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 509   tcttctccttcttcttcttgggaaacaa 536
             |||||| ||||||||| |||||||||||
Sbjct: 68780 tcttcttcttcttcttattgggaaacaa 68753

to top

>gb|BT005761.1| Arabidopsis thaliana clone RAFL15-17-A20 (R20741) putative
           photoreceptor-interacting protein (At5g47800) mRNA,
           complete cds
          Length = 1971

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 23  ctcttctccttcttcttctt 42

to top

>gb|AC019102.13| Homo sapiens BAC clone RP11-457A20 from 2, complete sequence
          Length = 158242

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 79951 ctcttctccttcttcttctt 79970

to top

>gb|AC004255.1|AC004255 Arabidopsis thaliana BAC T1F9 chromosome 1, complete sequence
          Length = 97789

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 23607 ctcttctccttcttcttctt 23588



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 23548 ctcttctccttcttcttctt 23529

to top

>gb|AC011302.3|AC011302 Homo sapiens BAC clone RP11-333E9 from Y, complete sequence
          Length = 178137

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 29447 ctcttctccttcttcttctt 29466

to top

>gb|AC025735.4|AC025735 Homo sapiens BAC clone RP11-214M24 from Y, complete sequence
          Length = 85472

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 82720 ctcttctccttcttcttctt 82739

to top

>gb|AC006965.3|AC006965 Homo sapiens PAC clone RP4-562J12 from Xq23, complete sequence
          Length = 132068

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 30567 ctcttctccttcttcttctt 30548

to top

>gb|AC011491.7| Homo sapiens chromosome 19 clone CTB-180A7, complete sequence
          Length = 118820

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 50590 tcttctccttcttcttcttg 50571

to top

>ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P3 and inverted repeat IR2
               (P1-P2-P3-IR2@) on chromosome Y
          Length = 4538292

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 3125319 ctcttctccttcttcttctt 3125300



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 2923025 ctcttctccttcttcttctt 2923044



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 1509647 ctcttctccttcttcttctt 1509628



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 1289280 ctcttctccttcttcttctt 1289299

to top

>gb|AC147571.5| Pan troglodytes BAC clone CH251-422I9 from chromosome y, complete
             sequence
          Length = 169828

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 22622 ctcttctccttcttcttctt 22603

to top

>gb|AC117516.5| Homo sapiens 3 BAC RP11-845C18 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 172997

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 509    tcttctccttcttcttcttg 528
              ||||||||||||||||||||
Sbjct: 109884 tcttctccttcttcttcttg 109865

to top

>gb|AY089059.1| Arabidopsis thaliana clone 249626 mRNA, complete sequence
          Length = 1071

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 305 ctcttctccttcttcttctt 286

to top

>ref|XM_235391.3| PREDICTED: Rattus norvegicus processing of precursor 1, ribonuclease
            P/MRP family, (S. cerevisiae) (predicted)
            (Pop1_predicted), mRNA
          Length = 3371

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 2914 ctcttctccttcttcttctt 2895

to top

>gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete sequence
          Length = 167358

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 68510 ctcttctccttcttcttctt 68491

to top

>gb|AC067960.5| Homo sapiens BAC clone RP11-60M20 from 2, complete sequence
          Length = 63740

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 58197 ctcttctccttcttcttctt 58178

to top

>gb|AC099661.11| Homo sapiens 3 BAC RP11-110C15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 155898

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 14329 ctcttctccttcttcttctt 14348

to top

>gb|AC146011.4| Pan troglodytes BAC clone RP43-42M15 from chromosome y, complete
             sequence
          Length = 204487

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 81451 ctcttctccttcttcttctt 81432

to top

>gb|AC012302.5|AC012302 Mus musculus chromosome 10, clone RP21-247L16, complete sequence
          Length = 130427

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 6589 ctcttctccttcttcttctt 6570

to top

>dbj|AB016886.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCA23
          Length = 82503

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 31094 ctcttctccttcttcttctt 31113

to top

>dbj|AB056455.1| Arabidopsis thaliana PDF2 gene for protodermal factor2, complete
           cds
          Length = 5818

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 315 ctcttctccttcttcttctt 334

to top

>dbj|AB023029.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K24C1
          Length = 29498

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 282 ctcttctccttcttcttctt 263

to top

>dbj|AP005657.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0427G12
          Length = 185545

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 507   gctcttctccttcttcttct 526
             ||||||||||||||||||||
Sbjct: 44570 gctcttctccttcttcttct 44551

to top

>ref|XM_556194.1| Anopheles gambiae str. PEST ENSANGP00000025455 (ENSANGG00000005425),
            mRNA
          Length = 1472

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 509  tcttctccttcttcttcttg 528
            ||||||||||||||||||||
Sbjct: 1434 tcttctccttcttcttcttg 1415

to top

>dbj|AK099560.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013034J05, full
           insert sequence
          Length = 1205

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 507 gctcttctccttcttcttct 526
           ||||||||||||||||||||
Sbjct: 280 gctcttctccttcttcttct 261

to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 432     ccaccttctccaccagcacc 451
               ||||||||||||||||||||
Sbjct: 3150631 ccaccttctccaccagcacc 3150650

to top

>gb|AF128393.1|T1J1 Arabidopsis thaliana BAC T1J1
          Length = 53778

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 6344 ctcttctccttcttcttctt 6325

to top

>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib
          Length = 2013089

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 508     ctcttctccttcttcttctt 527
               ||||||||||||||||||||
Sbjct: 1492268 ctcttctccttcttcttctt 1492249

to top

>emb|BX005201.7| Zebrafish DNA sequence from clone CH211-129C21 in linkage group 22,
              complete sequence
          Length = 184499

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 509    tcttctccttcttcttcttg 528
              ||||||||||||||||||||
Sbjct: 145959 tcttctccttcttcttcttg 145940

to top

>gb|AC153824.9| Mus musculus 10 BAC RP23-53D13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 233119

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 509    tcttctccttcttcttcttg 528
              ||||||||||||||||||||
Sbjct: 211814 tcttctccttcttcttcttg 211795

to top

>gb|AY109005.1| Zea mays PCO121752 mRNA sequence
          Length = 921

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 471 gacgcctaatcgccgccatggccg 494
           ||||| ||||||||||||||||||
Sbjct: 86  gacgcgtaatcgccgccatggccg 109

to top

>emb|Z73103.1|CEC08F8 Caenorhabditis elegans Cosmid C08F8, complete sequence
          Length = 32677

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 18014 tcttctccttcttcttcttg 17995

to top

>gb|AF132298.1|AF132298 Eptatretus stouti broadly selective sodium/nucleoside transporter
           hfCNT mRNA, complete cds
          Length = 2516

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 508 ctcttctccttcttcttctt 527
           ||||||||||||||||||||
Sbjct: 228 ctcttctccttcttcttctt 209

to top

>gb|AF160182.1|F17I23 Arabidopsis thaliana BAC F17I23
          Length = 134784

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 44398 ctcttctccttcttcttctt 44417

to top

>emb|X69584.1|SCXI12 S. cerevisiae 12kb sequence from chromosome XI, left arm
          Length = 12399

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 510 cttctccttcttcttcttgg 529
           ||||||||||||||||||||
Sbjct: 287 cttctccttcttcttcttgg 306

to top

>emb|CT573215.2| Medicago truncatula chromosome 5 clone mth2-51h23, COMPLETE SEQUENCE
          Length = 121342

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 66871 tcttctccttcttcttcttg 66852

to top

>emb|Z28040.1|SCYKL040C S.cerevisiae chromosome XI reading frame ORF YKL040c
          Length = 1804

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 510 cttctccttcttcttcttgg 529
           ||||||||||||||||||||
Sbjct: 609 cttctccttcttcttcttgg 628

to top

>gb|AE003515.4| Drosophila melanogaster chromosome 3L, section 70 of 83 of the complete
              sequence
          Length = 234263

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 232262 ctcttctccttcttcttctt 232281

to top

>gb|AC152984.2| Mus musculus 6 BAC RP23-462B3 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 185001

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   tcttctccttcttcttcttg 528
             ||||||||||||||||||||
Sbjct: 58359 tcttctccttcttcttcttg 58340

to top

>gb|BC098934.1| Rattus norvegicus vanin 1, mRNA (cDNA clone MGC:114385
            IMAGE:7441890), complete cds
          Length = 2421

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 243  caggagcaagcttgacttca 262
            ||||||||||||||||||||
Sbjct: 1481 caggagcaagcttgacttca 1462

to top

>gb|AC161256.3| Mus musculus BAC clone RP24-70H20 from chromosome 9, complete sequence
          Length = 190832

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 104086 ctcttctccttcttcttctt 104105

to top

>gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome
          Length = 1751080

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 430    caccaccttctccaccagca 449
              ||||||||||||||||||||
Sbjct: 430925 caccaccttctccaccagca 430944

to top

>gb|AC153565.5| Mus musculus 10 BAC RP23-228H2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 187589

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 163792 ctcttctccttcttcttctt 163773

to top

>dbj|AB091472.1| Aspergillus ochraceus top2 gene for DNA topoisomerase II, partial cds
          Length = 3371

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 3278 ctcttctccttcttcttctt 3259

to top

>gb|AC115876.18| Mus musculus chromosome 1, clone RP24-356G6, complete sequence
          Length = 163698

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 99838 ctcttctccttcttcttctt 99857

to top

>ref|NM_001025623.1| Rattus norvegicus vanin 1 (Vnn1), mRNA
          Length = 2421

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 243  caggagcaagcttgacttca 262
            ||||||||||||||||||||
Sbjct: 1481 caggagcaagcttgacttca 1462

to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 448    cacccggttgaaggacggga 467
              ||||||||||||||||||||
Sbjct: 643768 cacccggttgaaggacggga 643787

to top

>gb|AC144762.3| Mus musculus BAC clone RP24-95D6 from 3, complete sequence
          Length = 198005

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 85639 ctcttctccttcttcttctt 85658

to top

>gb|AC004073.1|AC004073 Human Chromosome X, complete sequence
          Length = 79612

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 508  ctcttctccttcttcttctt 527
            ||||||||||||||||||||
Sbjct: 1303 ctcttctccttcttcttctt 1284

to top

>gb|AC132433.3| Mus musculus BAC clone RP23-214L14 from 13, complete sequence
          Length = 229555

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 125452 ctcttctccttcttcttctt 125433

to top

>gb|AC144628.3| Mus musculus BAC clone RP23-463L22 from 14, complete sequence
          Length = 174162

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 509    tcttctccttcttcttcttg 528
              ||||||||||||||||||||
Sbjct: 161050 tcttctccttcttcttcttg 161069

to top

>emb|AL627228.31| Mouse DNA sequence from clone RP23-137L22 on chromosome 4, complete
             sequence
          Length = 193813

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 30438 ctcttctccttcttcttctt 30419

to top

>gb|AC000022.1|AC000022 Genomic sequence from Human Y, complete sequence
          Length = 43795

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   ctcttctccttcttcttctt 527
             ||||||||||||||||||||
Sbjct: 38988 ctcttctccttcttcttctt 38969

to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 509     tcttctccttcttcttcttg 528
               ||||||||||||||||||||
Sbjct: 2161517 tcttctccttcttcttcttg 2161498

to top

>gb|AY839756.1| Ovine herpesvirus 2 strain BJ1035, complete genome
          Length = 135135

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 421    cttgggctgcaccaccttctccac 444
              |||| |||||||||||||||||||
Sbjct: 113469 cttgtgctgcaccaccttctccac 113446

to top

>gb|AC159462.6| Mus musculus BAC clone RP23-177D16 from chromosome 10, complete sequence
          Length = 200663

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 508    ctcttctccttcttcttctt 527
              ||||||||||||||||||||
Sbjct: 126525 ctcttctccttcttcttctt 126506

to top

>emb|AL645930.15| Mouse DNA sequence from clone RP23-434L7 on chromosome 3, complete
              sequence
          Length = 227993

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 509    tcttctccttcttcttcttg 528
              ||||||||||||||||||||
Sbjct: 101351 tcttctccttcttcttcttg 101332

to top

>gb|M93696.1|RP4TRBAO Plasmid RP4 (trbA-trbO) genes, complete cds
          Length = 13205

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 404  atgccgccggcgctcttctt 423
            ||||||||||||||||||||
Sbjct: 3004 atgccgccggcgctcttctt 2985

to top

>gb|L27758.1|BIACOMGEN Birmingham IncP-alpha plasmid (R18, R68, RK2, RP1, RP4) complete genome
          Length = 60099

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 404   atgccgccggcgctcttctt 423
             ||||||||||||||||||||
Sbjct: 20961 atgccgccggcgctcttctt 20942


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,223,746
Number of Sequences: 3902068
Number of extensions: 6223746
Number of successful extensions: 635088
Number of sequences better than 10.0: 249
Number of HSP's better than 10.0 without gapping: 253
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 629143
Number of HSP's gapped (non-prelim): 5945
length of query: 545
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 522
effective length of database: 17,143,297,704
effective search space: 8948801401488
effective search space used: 8948801401488
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result