ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags35a07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL355504.17| Human DNA sequence from clone RP11-218A18 on ch... 42 1.5
2emb|Z92540.1|HS179I15A Human DNA sequence from clone RP1-179I15 ... 42 1.5
3gb|AC151775.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 40 5.8
4gb|AY522504.1| Lyngbya majuscula jamaicamide biosynthesis gene c... 40 5.8
5gb|AF289076.4| Homo sapiens chromosome 8 clone CTD-2372o24 map q... 40 5.8
6gb|AF186998.5| Homo sapiens chromosome 8 clone CTB-878E2 map q21... 40 5.8
7gb|AC153360.6| Mus musculus BAC clone RP23-321I6 from chromosome... 40 5.8
8gb|AC102575.11| Mus musculus chromosome 14, clone RP23-239P22, c... 40 5.8
9gb|AC103770.5| Homo sapiens chromosome 8, clone RP11-122A3, comp... 40 5.8
10gb|AC122332.4| Mus musculus BAC clone RP23-346G14 from chromosom... 40 5.8
11gb|AF028810.2|AF028810 Rhizobium leguminosarum bv. viciae VF39 a... 40 5.8
12gb|AC097717.3| Homo sapiens BAC clone RP11-650N19 from 2, comple... 40 5.8
13gb|AF040104.1|AF040104 Rhizobium leguminosarum bv. trifolii poly... 40 5.8

>emb|AL355504.17| Human DNA sequence from clone RP11-218A18 on chromosome 13 Contains a
             mitochondrial import receptor Tom22 pseudogene, complete
             sequence
          Length = 60159

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 29    aagataaatgcccttgttctccctc 53
             |||||||||||| ||||||||||||
Sbjct: 50666 aagataaatgcctttgttctccctc 50642



to top

>emb|Z92540.1|HS179I15A Human DNA sequence from clone RP1-179I15 on chromosome 13. Contains a
             novel gene, a mitochondrial import receptor TOM22
             pseudogene, the 5' end of the KL gene for klotho, ESTs,
             STSs and a CpG island, complete sequence
          Length = 146810

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 29    aagataaatgcccttgttctccctc 53
             |||||||||||| ||||||||||||
Sbjct: 82429 aagataaatgcctttgttctccctc 82405



to top

>gb|AC151775.1| Ornithorhynchus anatinus chromosome UNK clone OABb-307A1, complete
             sequence
          Length = 195598

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     acaaatatttacatttctgc 26
             ||||||||||||||||||||
Sbjct: 62703 acaaatatttacatttctgc 62684



to top

>gb|AY522504.1| Lyngbya majuscula jamaicamide biosynthesis gene cluster, complete
             sequence
          Length = 69900

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 278   gagcccctttaaccatacca 297
             ||||||||||||||||||||
Sbjct: 20233 gagcccctttaaccatacca 20214



to top

>gb|AF289076.4| Homo sapiens chromosome 8 clone CTD-2372o24 map q21.3, complete
             sequence
          Length = 101256

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 344   caaatgccatacaacagaacccct 367
             ||||||||||||||||| ||||||
Sbjct: 28892 caaatgccatacaacagcacccct 28869



to top

>gb|AF186998.5| Homo sapiens chromosome 8 clone CTB-878E2 map q21.3, complete sequence
          Length = 125222

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 344    caaatgccatacaacagaacccct 367
              ||||||||||||||||| ||||||
Sbjct: 114556 caaatgccatacaacagcacccct 114533



to top

>gb|AC153360.6| Mus musculus BAC clone RP23-321I6 from chromosome 10, complete sequence
          Length = 233014

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 345    aaatgccatacaacagaacc 364
              ||||||||||||||||||||
Sbjct: 155357 aaatgccatacaacagaacc 155338



to top

>gb|AC102575.11| Mus musculus chromosome 14, clone RP23-239P22, complete sequence
          Length = 238123

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 140    cggaactggagataatgaaa 159
              ||||||||||||||||||||
Sbjct: 150119 cggaactggagataatgaaa 150138



to top

>gb|AC103770.5| Homo sapiens chromosome 8, clone RP11-122A3, complete sequence
          Length = 176632

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 344   caaatgccatacaacagaacccct 367
             ||||||||||||||||| ||||||
Sbjct: 42082 caaatgccatacaacagcacccct 42105



to top

>gb|AC122332.4| Mus musculus BAC clone RP23-346G14 from chromosome 10, complete sequence
          Length = 214728

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 345    aaatgccatacaacagaacc 364
              ||||||||||||||||||||
Sbjct: 213477 aaatgccatacaacagaacc 213458



to top

>gb|AF028810.2|AF028810 Rhizobium leguminosarum bv. viciae VF39 acidic exopolysaccharide
             biosynthesis gene cluster, complete sequence
          Length = 20766

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 223   gcgcgaaatctggctgatgc 242
             ||||||||||||||||||||
Sbjct: 10648 gcgcgaaatctggctgatgc 10629



to top

>gb|AC097717.3| Homo sapiens BAC clone RP11-650N19 from 2, complete sequence
          Length = 142978

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 149   agataatgaaaagatgcaca 168
             ||||||||||||||||||||
Sbjct: 49297 agataatgaaaagatgcaca 49278



to top

>gb|AF040104.1|AF040104 Rhizobium leguminosarum bv. trifolii polysaccharide export protein
            (pssL), polysaccharide polymerization protein (pssK), and
            glycosyl transferase homolog (pssI) genes, complete cds
          Length = 4527

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 223  gcgcgaaatctggctgatgc 242
            ||||||||||||||||||||
Sbjct: 2336 gcgcgaaatctggctgatgc 2317


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,150,495
Number of Sequences: 3902068
Number of extensions: 4150495
Number of successful extensions: 120481
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 120448
Number of HSP's gapped (non-prelim): 33
length of query: 430
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 408
effective length of database: 17,147,199,772
effective search space: 6996057506976
effective search space used: 6996057506976
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top