ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags35a01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, co... 430 e-117
2emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274) 428 e-117
3gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complet... 428 e-117
4dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, co... 424 e-115
5dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, co... 404 e-110
6gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence 250 3e-63
7gb|BT016569.1| Zea mays clone Contig402 mRNA sequence 228 1e-56
8gb|AY103710.1| Zea mays PCO123562 mRNA sequence 228 1e-56
9ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predic... 182 6e-43
10dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 6e-43
11dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 6e-43
12dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clon... 180 3e-42
13gb|AY103585.1| Zea mays PCO123564 mRNA sequence 176 4e-41
14gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence 174 2e-40
15dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 2e-40
16ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predic... 172 6e-40
17gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence 161 2e-36
18dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 9e-36
19dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 9e-36
20gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence 151 2e-33
21gb|BT016301.1| Zea mays clone Contig134 mRNA sequence 141 2e-30
22gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (... 133 5e-28
23gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosom... 133 5e-28
24ref|NM_010436.2| Mus musculus H2A histone family, member X (H2af... 133 5e-28
25emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X 133 5e-28
26gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (... 133 5e-28
27dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells ... 133 5e-28
28dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RI... 133 5e-28
29gb|AY104486.1| Zea mays PCO109435 mRNA sequence 133 5e-28
30ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predic... 129 8e-27
31gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome... 129 8e-27
32gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome... 129 8e-27
33dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 129 8e-27
34gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome... 129 8e-27
35ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA 127 3e-26
36dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clon... 127 3e-26
37dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clon... 127 3e-26
38emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X 125 1e-25
39ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H... 123 5e-25
40gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 119 8e-24
41gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str... 119 8e-24
42dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 119 8e-24
43dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 119 8e-24
44dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D... 119 8e-24
45gb|AY109370.1| Zea mays CL2029_4 mRNA sequence 119 8e-24
46gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds 119 8e-24
47gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC... 115 1e-22
48gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC... 115 1e-22
49ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA 115 1e-22
50emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr... 115 1e-22
51gb|AY108339.1| Zea mays PCO070432 mRNA sequence 115 1e-22
52gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complet... 115 1e-22
53ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA 113 5e-22
54ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone... 113 5e-22
55dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 5e-22
56ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA 111 2e-21
57gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependen... 111 2e-21
58dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
59dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, co... 111 2e-21
60ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone... 109 8e-21
61dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, co... 107 3e-20
62ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA 105 1e-19
63gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 105 1e-19
64ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo... 105 1e-19
65ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
66ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
67ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
68ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
69ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
70ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
71ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
72ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
73ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
74ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
75ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
76ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone ... 105 1e-19
77ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
78ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
79ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, ... 105 1e-19
80ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, ... 105 1e-19
81ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone ... 105 1e-19
82gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with appar... 105 1e-19
83emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) 105 1e-19
84emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) 105 1e-19
85gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MG... 105 1e-19
86emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 105 1e-19
87ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA 105 1e-19
88emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 105 1e-19
89emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom... 105 1e-19
90emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 105 1e-19
91emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 105 1e-19
92gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MG... 105 1e-19
93gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MG... 105 1e-19
94dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKE... 105 1e-19
95dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 105 1e-19
96dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 105 1e-19
97ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA 105 1e-19
98gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365,... 105 1e-19
99gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, ... 105 1e-19
100gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 105 1e-19
101gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 105 1e-19
102ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA 105 1e-19
103ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA 105 1e-19
104ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA 105 1e-19
105gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 105 1e-19
106dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 105 1e-19
107dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-l... 105 1e-19
108dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
109ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA 105 1e-19
110ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA 105 1e-19
111ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (p... 105 1e-19
112gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, comp... 105 1e-19
113gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, comp... 105 1e-19
114gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp... 105 1e-19
115gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, comp... 105 1e-19
116gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, comp... 105 1e-19
117gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, comp... 105 1e-19
118gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, comp... 105 1e-19
119gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp... 105 1e-19
120gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene... 105 1e-19
121gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp... 105 1e-19
122ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA 105 1e-19
123gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 105 1e-19
124emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112... 105 1e-19
125gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 ... 105 1e-19
126gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 ... 101 2e-18
127gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 ... 101 2e-18
128ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone ... 101 2e-18
129ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone ... 101 2e-18
130ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone ... 101 2e-18
131ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone ... 101 2e-18
132ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone... 101 2e-18
133gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, comp... 101 2e-18
134ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA 101 2e-18
135ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA 100 8e-18
136ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA 100 8e-18
137gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 100 8e-18
138ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 100 8e-18
139gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone I... 100 8e-18
140ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 100 8e-18
141ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA 100 8e-18
142ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone ... 100 8e-18
143ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone ... 100 8e-18
144ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone ... 100 8e-18
145ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone ... 100 8e-18
146ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h... 100 8e-18
147gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds 100 8e-18
148gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, comp... 100 8e-18
149emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A ... 100 8e-18
150emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 100 8e-18
151emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 100 8e-18
152emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes 100 8e-18
153dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 100 8e-18
154dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-... 100 8e-18
155dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-... 100 8e-18
156dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-... 100 8e-18
157dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-... 100 8e-18
158gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ... 100 8e-18
159gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2... 100 8e-18
160dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full... 100 8e-18
161ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA 100 8e-18
162gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, comp... 100 8e-18
163gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, com... 100 8e-18
164gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, com... 100 8e-18
165gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, comp... 100 8e-18
166gb|BC062255.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M... 100 8e-18
167gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 100 8e-18
168gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (... 100 8e-18
169gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome... 100 8e-18
170gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 100 8e-18
171gb|BC053966.1| Mus musculus histone 2, H2aa2, mRNA (cDNA clone I... 100 8e-18
172ref|XM_667061.1| Plasmodium berghei strain ANKA histone h2a (PB3... 100 8e-18
173gb|BC089519.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M... 100 8e-18
174gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome... 100 8e-18
175emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a... 98 3e-17
176ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA 98 3e-17
177ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (p... 98 3e-17
178ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2... 98 3e-17
179ref|XM_574997.1| PREDICTED: Rattus norvegicus similar to histone... 98 3e-17
180gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp... 98 3e-17
181dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 3e-17
182gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complet... 98 3e-17
183gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, comp... 98 3e-17
184gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent ... 96 1e-16
185gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds 96 1e-16
186gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2... 96 1e-16
187gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds 96 1e-16
188ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, ... 94 5e-16
189ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, ... 94 5e-16
190ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, ... 94 5e-16
191ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, ... 94 5e-16
192ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, ... 94 5e-16
193ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ... 94 5e-16
194ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 94 5e-16
195ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi... 94 5e-16
196ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA 94 5e-16
197emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq... 94 5e-16
198emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 94 5e-16
199emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking r... 94 5e-16
200dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, comple... 94 5e-16
201gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, co... 94 5e-16
202gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, ... 94 5e-16
203gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, c... 94 5e-16
204gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, co... 94 5e-16
205gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks 94 5e-16
206ref|XM_527287.1| PREDICTED: Pan troglodytes similar to Histone H... 92 2e-15
207ref|XM_527283.1| PREDICTED: Pan troglodytes similar to Hist2h2aa... 92 2e-15
208ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H... 92 2e-15
209ref|XM_518286.1| PREDICTED: Pan troglodytes similar to Histone H... 92 2e-15
210gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG... 92 2e-15
211gb|BC017379.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG... 92 2e-15
212gb|BC104199.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG... 92 2e-15
213ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 92 2e-15
214ref|XM_871147.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 92 2e-15
215gb|BC069306.1| Homo sapiens histone 1, H2al, mRNA (cDNA clone MG... 92 2e-15
216gb|BC034487.2| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IM... 92 2e-15
217ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 92 2e-15
218ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 92 2e-15
219ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 92 2e-15
220ref|NG_001335.1| Homo sapiens genomic large histone family clust... 92 2e-15
221ref|NM_177688.2| Mus musculus H2A histone family, member J (H2af... 92 2e-15
222ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 92 2e-15
223ref|NM_003514.2| Homo sapiens histone 1, H2am (HIST1H2AM), mRNA 92 2e-15
224ref|NM_003512.3| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA 92 2e-15
225ref|NM_003511.2| Homo sapiens histone 1, H2al (HIST1H2AL), mRNA 92 2e-15
226ref|NM_003510.2| Homo sapiens histone 1, H2ak (HIST1H2AK), mRNA 92 2e-15
227gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple... 92 2e-15
228emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o... 92 2e-15
229emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro... 92 2e-15
230gb|AY270707.1| Homo sapiens clone SKA08-D09 putative promoter se... 92 2e-15
231emb|Z83739.1|HSZ83739 H.sapiens hH2A/d gene 92 2e-15
232emb|Z80778.1|HSH2AL H.sapiens H2A/l gene 92 2e-15
233emb|X83549.1|HSHISTN2A H.sapiens gene for histone H2A 92 2e-15
234emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2... 92 2e-15
235emb|CR624886.1| full-length cDNA clone CS0DK009YH13 of HeLa cell... 92 2e-15
236emb|CR621753.1| full-length cDNA clone CS0DI059YA15 of Placenta ... 92 2e-15
237gb|BC032686.1| Homo sapiens, clone IMAGE:5581652, mRNA 92 2e-15
238emb|CR608156.1| full-length cDNA clone CS0DI013YB19 of Placenta ... 92 2e-15
239gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 92 2e-15
240gb|U90551.1|HSU90551 Human histone 2A-like protein (H2A/l) mRNA,... 92 2e-15
241dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 92 2e-15
242gb|AY131993.1| Homo sapiens histone H2A (HIST1H2AM) gene, comple... 92 2e-15
243gb|AY131992.1| Homo sapiens histone H2A (HIST1H2AL) gene, comple... 92 2e-15
244gb|AY131991.1| Homo sapiens histone H2A (HIST1H2AK) gene, comple... 92 2e-15
245gb|BC085010.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG... 92 2e-15
246dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501 92 2e-15
247gb|AY894000.1| Synthetic construct Homo sapiens clone FLH130938.... 92 2e-15
248gb|AY893556.1| Synthetic construct Homo sapiens clone FLH130901.... 92 2e-15
249gb|AY893555.1| Synthetic construct Homo sapiens clone FLH130900.... 92 2e-15
250gb|AY893520.1| Synthetic construct Homo sapiens clone FLH130895.... 92 2e-15
251gb|BC112072.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 92 2e-15
252gb|BC071668.1| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG... 92 2e-15
253gb|BC105129.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 92 2e-15
254gb|BC050602.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG... 92 2e-15
255gb|BC032756.1| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG... 92 2e-15
256gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (... 92 2e-15
257gb|AY131984.1| Homo sapiens histone H2A (HIST1H2AC) gene, comple... 92 2e-15
258ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone p... 90 7e-15
259ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H... 90 7e-15
260gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:720558... 90 7e-15
261ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone ... 90 7e-15
262ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone ... 90 7e-15
263ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone ... 90 7e-15
264emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq... 90 7e-15
265emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 90 7e-15
266gb|AY104828.1| Zea mays PCO072413 mRNA sequence 90 7e-15
267gb|AY104826.1| Zea mays PCO099353 mRNA sequence 90 7e-15
268gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, com... 90 7e-15
269gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 90 7e-15
270gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c... 90 7e-15
271gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds 86 1e-13
272emb|X94693.1|TAH2A254 T.aestivum histone H2A gene 86 1e-13
273emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones 86 1e-13
274emb|X14730.1|CMHIST2A Duck H2A histone gene 86 1e-13
275gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, comple... 86 1e-13
276gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family me... 86 1e-13
277ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (H... 86 1e-13
278dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, comple... 86 1e-13
279ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g ... 84 4e-13
280emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA 84 4e-13
281emb|AL512384.9| Human DNA sequence from clone RP11-317E16 on chr... 84 4e-13
282emb|BX063165.1|CNS09KWH Single read from an extremity of a full-... 84 4e-13
283emb|BX009846.1|CNS08FRE Single read from an extremity of a full-... 84 4e-13
284gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and ... 84 4e-13
285gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp... 84 4e-13
286gb|AY104637.1| Zea mays PCO070433 mRNA sequence 84 4e-13
287ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA 82 2e-12
288ref|NM_021065.2| Homo sapiens histone 1, H2ad (HIST1H2AD), mRNA 82 2e-12
289ref|NM_021052.2| Homo sapiens histone 1, H2ae (HIST1H2AE), mRNA 82 2e-12
290emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o... 82 2e-12
291emb|BX063164.1|CNS09KWG Single read from an extremity of a full-... 82 2e-12
292emb|BX040864.1|CNS093P0 Single read from an extremity of a full-... 82 2e-12
293emb|BX019683.1|CNS08NCN Single read from an extremity of a full-... 82 2e-12
294emb|BX016451.1|CNS08KUV Single read from an extremity of a full-... 82 2e-12
295emb|BX008487.1|CNS08EPN Single read from an extremity of a full-... 82 2e-12
296emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-... 82 2e-12
297emb|Z80776.1|HSH2AG H.sapiens H2A/g gene 82 2e-12
298emb|X16495.1|MMHIST2A Murine H2A gene for histone H2A 82 2e-12
299gb|BC093807.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG... 82 2e-12
300emb|CR541999.1| Homo sapiens full open reading frame cDNA clone ... 82 2e-12
301emb|CR541970.1| Homo sapiens full open reading frame cDNA clone ... 82 2e-12
302dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
303gb|BC093862.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG... 82 2e-12
304gb|BC093809.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG... 82 2e-12
305gb|BC093836.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG... 82 2e-12
306dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic D... 82 2e-12
307gb|M60752.1|HUMHISAG Human histone H2A.1 (H2A) gene, complete cds 82 2e-12
308gb|AY131986.1| Homo sapiens histone H2A (HIST1H2AE) gene, comple... 82 2e-12
309gb|AY131985.1| Homo sapiens histone H2A (HIST1H2AD) gene, comple... 82 2e-12
310gb|BC060324.1| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MG... 80 7e-12
311ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H... 80 7e-12
312ref|NM_003517.2| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA 80 7e-12
313gb|AY648852.1| Homo sapiens histone H2A/r gene, complete cds 80 7e-12
314ref|XM_870470.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 80 7e-12
315gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (... 80 7e-12
316ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AF... 80 7e-12
317emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 80 7e-12
318emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X 80 7e-12
319gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (... 80 7e-12
320emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblas... 80 7e-12
321dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-1409... 80 7e-12
322gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX)... 80 7e-12
323ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (p... 80 7e-12
324gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (... 80 7e-12
325gb|AY110108.1| Zea mays CL14299_1 mRNA sequence 80 7e-12
326dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:C... 80 7e-12
327gb|AY131973.1| Homo sapiens histone H2A (HIST2H2AC) gene, comple... 80 7e-12
328gb|M11084.1|SUPHIS2A1 Sea urchin (P.miliaris) late histone H2A-1... 80 7e-12
329gb|M14140.1|SUPH2B2 P.miliaris histone H2A-2.1 gene, complete cds 80 7e-12
330ref|XM_870473.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 78 3e-11
331ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX ... 78 3e-11
332emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4 78 3e-11
333ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone... 78 3e-11
334ref|XM_527281.1| PREDICTED: Pan troglodytes similar to H2A histo... 76 1e-10
335ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H... 76 1e-10
336gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462 76 1e-10
337ref|NM_021066.2| Homo sapiens histone 1, H2aj (HIST1H2AJ), mRNA 76 1e-10
338ref|NM_003509.2| Homo sapiens histone 1, H2ai (HIST1H2AI), mRNA 76 1e-10
339gb|BC066234.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 76 1e-10
340gb|BC066232.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 76 1e-10
341gb|BC066233.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 76 1e-10
342gb|BC066237.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 76 1e-10
343gb|BC066236.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 76 1e-10
344gb|BC066235.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 76 1e-10
345ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A hist... 76 1e-10
346ref|XM_752558.1| Ustilago maydis 521 histone H2A (UM01504.1) par... 76 1e-10
347emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A... 76 1e-10
348emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o... 76 1e-10
349emb|BX016452.1|CNS08KUW Single read from an extremity of a full-... 76 1e-10
350emb|Z83742.1|HSZ83742 H.sapiens hH2A/c gene 76 1e-10
351emb|Z83736.1|HSZ83736 H.sapiens hH2A/e gene 76 1e-10
352ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (R... 76 1e-10
353gb|AY131990.1| Homo sapiens histone H2A (HIST1H2AJ) gene, comple... 76 1e-10
354gb|AY131989.1| Homo sapiens histone H2A (HIST1H2AI) gene, comple... 76 1e-10
355dbj|AK214754.1| Mus musculus cDNA, clone:Y2G0132O07, strand:minu... 76 1e-10
356ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 ... 76 1e-10
357ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 ... 76 1e-10
358gb|BC112256.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 76 1e-10
359gb|BC112254.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 76 1e-10
360gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complet... 76 1e-10
361ref|XM_527254.1| PREDICTED: Pan troglodytes similar to HIST2H3C ... 74 4e-10
362gb|BT016168.1| Zea mays clone Contig1 mRNA sequence 74 4e-10
363gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone... 74 4e-10
364gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC... 74 4e-10
365ref|NM_003513.2| Homo sapiens histone 1, H2ab (HIST1H2AB), mRNA 74 4e-10
366emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones 74 4e-10
367emb|Z83741.1|HSZ83741 H.sapiens hH2A/m gene 74 4e-10
368gb|AY131983.1| Homo sapiens histone H2A (HIST1H2AB) gene, comple... 74 4e-10
369gb|AY105006.1| Zea mays PCO108932 mRNA sequence 74 4e-10
370ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261... 72 2e-09
371gb|BC019308.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 72 2e-09
372gb|BC001629.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 72 2e-09
373ref|XM_954349.1| Neurospora crassa OR74A hypothetical protein (N... 72 2e-09
374ref|XM_331212.1| Neurospora crassa OR74A hypothetical protein (N... 72 2e-09
375ref|XM_602557.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 72 2e-09
376ref|NM_003516.2| Homo sapiens histone 2, H2aa (HIST2H2AA), mRNA 72 2e-09
377emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA 72 2e-09
378ref|XM_789760.1| PREDICTED: Strongylocentrotus purpuratus simila... 72 2e-09
379ref|XM_781115.1| PREDICTED: Strongylocentrotus purpuratus simila... 72 2e-09
380emb|CR457079.1| Homo sapiens full open reading frame cDNA clone ... 72 2e-09
381gb|AY062171.1| Neurospora crassa histone H2A (hh2A) and histone ... 72 2e-09
382ref|XM_928387.1| PREDICTED: Homo sapiens similar to Histone H2A.... 72 2e-09
383emb|CR541872.1| Homo sapiens full open reading frame cDNA clone ... 72 2e-09
384emb|CR536525.1| Homo sapiens full open reading frame cDNA clone ... 72 2e-09
385gb|AY894055.1| Synthetic construct Homo sapiens clone FLH131281.... 72 2e-09
386gb|AY894054.1| Synthetic construct Homo sapiens clone FLH130836.... 72 2e-09
387gb|BC098171.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 72 2e-09
388gb|BC096739.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 72 2e-09
389gb|L19779.1|HUMH2A2A Homo sapiens histone H2A.2 mRNA, complete cds 72 2e-09
390gb|AY131971.1| Homo sapiens histone H2A (HIST2H2AA) gene, comple... 72 2e-09
391ref|XM_527272.1| PREDICTED: Pan troglodytes similar to Histone H... 70 7e-09
392gb|BC016677.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone MG... 70 7e-09
393gb|BC067782.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone IM... 70 7e-09
394ref|NM_021064.3| Homo sapiens histone 1, H2ag (HIST1H2AG), mRNA 70 7e-09
395emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o... 70 7e-09
396gb|AY131987.1| Homo sapiens histone H2A (HIST1H2AG) gene, comple... 70 7e-09
397gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, comp... 70 7e-09
398dbj|AK207984.1| Mus musculus cDNA, clone:Y2G0109L23, strand:minu... 70 7e-09
399gb|L19778.1|HUMH2A1B Homo sapiens histone H2A.1b mRNA, complete cds 70 7e-09
400ref|NG_000827.2| Homo sapiens genomic histone family microcluste... 70 7e-09
401ref|XM_603142.2| PREDICTED: Bos taurus similar to histone 1, H2a... 68 3e-08
402gb|BC098891.1| Danio rerio zgc:114037, mRNA (cDNA clone MGC:1140... 68 3e-08
403ref|NM_001031826.1| Danio rerio zgc:114037 (zgc:114037), mRNA 68 3e-08
404ref|XM_683419.1| PREDICTED: Danio rerio similar to replication-d... 68 3e-08
405dbj|AK216150.1| Mus musculus cDNA, clone:Y2G0137G02, strand:minu... 68 3e-08
406emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 68 3e-08
407gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 68 3e-08
408ref|XM_527273.1| PREDICTED: Pan troglodytes similar to Histone H... 66 1e-07
409gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG... 66 1e-07
410gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG... 66 1e-07
411ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA 66 1e-07
412ref|XM_871500.1| PREDICTED: Bos taurus similar to Histone H2A.o ... 66 1e-07
413ref|XM_614586.2| PREDICTED: Bos taurus similar to Histone H2A.o ... 66 1e-07
414ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa... 66 1e-07
415ref|XM_591391.2| PREDICTED: Bos taurus similar to Histone H2A.o ... 66 1e-07
416ref|NM_080596.1| Homo sapiens histone 1, H2ah (HIST1H2AH), mRNA 66 1e-07
417ref|XR_003029.1| PREDICTED: Mus musculus similar to H2A histone ... 66 1e-07
418ref|XR_001920.1| PREDICTED: Mus musculus similar to H2A histone ... 66 1e-07
419ref|XM_906200.1| PREDICTED: Mus musculus similar to histone H2A ... 66 1e-07
420ref|XM_886305.1| PREDICTED: Mus musculus similar to histone H2A ... 66 1e-07
421gb|AC123686.11| Mus musculus chromosome 5, clone RP23-301L9, com... 66 1e-07
422ref|XM_785689.1| PREDICTED: Strongylocentrotus purpuratus simila... 66 1e-07
423emb|BX019514.1|CNS08N7Y Single read from an extremity of a full-... 66 1e-07
424emb|X06642.1|SPH2BAL3 Strongylocentrotus purpuratus late histone... 66 1e-07
425emb|X00089.1|HSHISH2A Human histone H2a gene 66 1e-07
426emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr... 66 1e-07
427dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
428gb|BC093851.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 66 1e-07
429gb|BC093849.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 66 1e-07
430gb|AY131988.1| Homo sapiens histone H2A (HIST1H2AH) gene, comple... 66 1e-07
431gb|AY158921.1| Mus musculus histone protein Hist1h2aa gene, comp... 66 1e-07
432ref|NM_214553.1| Strongylocentrotus purpuratus late histone L3 H... 66 1e-07
433gb|BC096705.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 66 1e-07
434emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4,... 66 1e-07
435emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa... 66 1e-07
436emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa... 66 1e-07
437gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 66 1e-07
438ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA 64 4e-07
439ref|XM_583411.2| PREDICTED: Bos taurus similar to Histone H2A.l ... 64 4e-07
440ref|XM_869647.1| PREDICTED: Bos taurus similar to Histone H2A.l ... 64 4e-07
441gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC... 64 4e-07
442gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMA... 64 4e-07
443gb|AY849374.1| Emiliania huxleyi histone H2A mRNA, complete cds 64 4e-07
444ref|XM_683706.1| PREDICTED: Danio rerio similar to histone H2A (... 64 4e-07
445dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 64 4e-07
446dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA... 64 4e-07
447dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 64 4e-07
448dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-... 64 4e-07
449dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN ... 64 4e-07
450dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 64 4e-07
451dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
452gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, compl... 64 4e-07
453dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
454dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
455gb|AY104725.1| Zea mays PCO121651 mRNA sequence 64 4e-07
456emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr... 64 4e-07
457ref|XM_318363.2| Anopheles gambiae str. PEST ENSANGP00000015971 ... 62 2e-06
458ref|XM_318365.1| Anopheles gambiae str. PEST ENSANGP00000015967 ... 62 2e-06
459ref|XM_307083.1| Anopheles gambiae str. PEST ENSANGP00000012043 ... 62 2e-06
460ref|XM_870822.1| PREDICTED: Bos taurus similar to H2A histone fa... 60 6e-06
461gb|AY849373.1| Emiliania huxleyi histone H2A.X mRNA, complete cds 60 6e-06
462emb|AJ245999.1|BNA245999 Brassica napus H2A gene for Histone H2A 60 6e-06
463gb|BC103043.1| Bos taurus cDNA clone MGC:128401 IMAGE:7983967, c... 60 6e-06
464ref|XM_683282.1| PREDICTED: Danio rerio similar to histone H2A (... 60 6e-06
465ref|XM_683060.1| PREDICTED: Danio rerio similar to replication-d... 60 6e-06
466ref|XM_694138.1| PREDICTED: Danio rerio similar to histone H2A (... 60 6e-06
467ref|XM_687955.1| PREDICTED: Danio rerio similar to histone H2A (... 60 6e-06
468ref|XM_682538.1| PREDICTED: Danio rerio similar to replication-d... 60 6e-06
469ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020 ... 60 6e-06
470gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds 58 3e-05
471ref|XM_866661.1| PREDICTED: Bos taurus similar to Histone H2A.o ... 58 3e-05
472gb|AY812081.1| Schistosoma japonicum SJCHGC05779 protein mRNA, p... 58 3e-05
473emb|CR722682.2|CNS0GKKG Tetraodon nigroviridis full-length cDNA 58 3e-05
474emb|CR709561.2|CNS0GAG5 Tetraodon nigroviridis full-length cDNA 58 3e-05
475emb|CR705936.2|CNS0G7NG Tetraodon nigroviridis full-length cDNA 58 3e-05
476gb|AY223124.1| Schistosoma japonicum clone ZZD1425 mRNA sequence 58 3e-05
477emb|CR681249.2|CNS0FOLP Tetraodon nigroviridis full-length cDNA 58 3e-05
478emb|CR673736.2|CNS0FITQ Tetraodon nigroviridis full-length cDNA 58 3e-05
479emb|CR659269.2|CNS0F7NV Tetraodon nigroviridis full-length cDNA 58 3e-05
480gb|AF517874.1| Griffithsia japonica isolate Gj10 histone protein... 58 3e-05
481emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes 58 3e-05
482gb|BC092032.1| Xenopus laevis hypothetical protein MGC83508, mRN... 58 3e-05
483gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),... 58 3e-05
484gb|AY131972.1| Homo sapiens histone H2A (HIST2H2AB) gene, comple... 58 3e-05
485ref|NM_196515.1| Oryza sativa (japonica cultivar-group) putative... 56 1e-04
486ref|NM_175065.2| Homo sapiens histone 2, H2ab (HIST2H2AB), mRNA 56 1e-04
487emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC... 56 1e-04
488gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica culti... 56 1e-04
489ref|XM_687127.1| PREDICTED: Danio rerio similar to replication-d... 56 1e-04
490ref|XM_683938.1| PREDICTED: Danio rerio similar to histone H2A (... 56 1e-04
491dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
492gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb00... 56 1e-04
493dbj|AK121515.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
494gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 56 1e-04
495gb|M13637.1|SULHIS2A Sea urchin (L.pictus) testis histone H2a mRNA 56 1e-04
496ref|XM_520760.1| PREDICTED: Pan troglodytes similar to H2A histo... 54 4e-04
497ref|NM_021840.2| Rattus norvegicus histone 2a (H2a), mRNA 54 4e-04
498ref|NM_006632.1| Homo sapiens solute carrier family 17 (sodium p... 54 4e-04
499gb|BC099140.1| Rattus norvegicus histone 2a, mRNA (cDNA clone MG... 54 4e-04
500ref|XM_361034.1| Magnaporthe grisea 70-15 hypothetical protein (... 54 4e-04

>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9
          Length = 704

 Score =  430 bits (217), Expect = e-117
 Identities = 282/303 (93%), Gaps = 3/303 (0%)
 Strand = Plus / Minus

                                                                       
Query: 144 ggctactccttggcggcgggggccttcttcttgggggacttggtggccgtcttcttcttg 203
           ||||||||||||||||||    ||||||||||||||||||||||||  ||||||||||||
Sbjct: 505 ggctactccttggcggcga---ccttcttcttgggggacttggtggaggtcttcttcttg 449

                                                                       
Query: 204 ggcgacttggtctccttctcggcggcggcggtggacttcttcgggagaagaacagagttg 263
           |||||||||| |||||||||||||||||||| ||||||||| ||||| || || ||||||
Sbjct: 448 ggcgacttggcctccttctcggcggcggcgggggacttcttggggagcagcacggagttg 389

                                                                       
Query: 264 atgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctcc 323
           ||||||||||| || || |||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 388 atgttggggatcacgccaccgtgggcgatggtgacgccagcgagcagcctgccgagctcc 329

                                                                       
Query: 324 tggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtcc 383
           |||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 328 tggtcgttgcggacagcgagcagcaggtggcgcgggatgatgcgggtcttcttgttgtcc 269

                                                                       
Query: 384 ttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggcg 443
           |||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||
Sbjct: 268 ttggccgcgttgccggcaagctccagcacctcggcggcgaggtactcgaggacggcggcg 209

              
Query: 444 agg 446
           |||
Sbjct: 208 agg 206



to top

>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)
          Length = 2546

 Score =  428 bits (216), Expect = e-117
 Identities = 365/411 (88%), Gaps = 9/411 (2%)
 Strand = Plus / Minus

                                                                        
Query: 3    cctacagaaat-acagatacaatgt-acccttgctgcgccaatctaagaacagaagcact 60
            ||||||||||| ||||| ||||||  |||||||||  || |||||||| ||||||  |||
Sbjct: 2466 cctacagaaatcacagacacaatgccacccttgctcagcgaatctaaggacagaacgact 2407

                                                                        
Query: 61   gctcatctaactaaccaaaagactgctcatcttgtccatgagaaatggaacgaagcaaca 120
             ||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||
Sbjct: 2406 actcatctaactaaccaaaagactgctcatcttgtccacgagaaatggatctaagcaaca 2347

                                                                        
Query: 121  caggctaggctatgggtgcgggcggctactccttggcggcgggggccttcttcttggggg 180
              ||||| |||||||    ||    |||||||||||||||     |||||||||||||||
Sbjct: 2346 atggctatgctatgg----ggaattctactccttggcggcaa---ccttcttcttggggg 2294

                                                                        
Query: 181  acttggtggccgtcttcttcttgggcgacttggtctccttctcggcggcggcggtggact 240
            |||||||||  |||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 2293 acttggtggaggtcttcttcttgggcgacttggcctccttctcggcggcggcgggggact 2234

                                                                        
Query: 241  tcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgacgc 300
            |||| || || || || ||||||||  |||||||||| ||||||||||||||||||||||
Sbjct: 2233 tcttgggcagcagcacggagttgattgtggggatgacgccgccgtgggcgatggtgacgc 2174

                                                                        
Query: 301  cggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 360
            |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2173 cggcaagcagcctgccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 2114

                                                               
Query: 361  tgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 411
            |||||||| ||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 2113 tgatgcgggtcttcttgttgtccttggctgcgttgccggcaagctccagca 2063



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                              
Query: 413  ctcggcagcgaggtactcgaggacggcggcgagg 446
            |||||| |||||||||||||||||||||||||||
Sbjct: 1966 ctcggcggcgaggtactcgaggacggcggcgagg 1933



to top

>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds
          Length = 2546

 Score =  428 bits (216), Expect = e-117
 Identities = 365/411 (88%), Gaps = 9/411 (2%)
 Strand = Plus / Minus

                                                                        
Query: 3    cctacagaaat-acagatacaatgt-acccttgctgcgccaatctaagaacagaagcact 60
            ||||||||||| ||||| ||||||  |||||||||  || |||||||| ||||||  |||
Sbjct: 2466 cctacagaaatcacagacacaatgccacccttgctcagcgaatctaaggacagaacgact 2407

                                                                        
Query: 61   gctcatctaactaaccaaaagactgctcatcttgtccatgagaaatggaacgaagcaaca 120
             ||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||
Sbjct: 2406 actcatctaactaaccaaaagactgctcatcttgtccacgagaaatggatctaagcaaca 2347

                                                                        
Query: 121  caggctaggctatgggtgcgggcggctactccttggcggcgggggccttcttcttggggg 180
              ||||| |||||||    ||    |||||||||||||||     |||||||||||||||
Sbjct: 2346 atggctatgctatgg----ggaattctactccttggcggcaa---ccttcttcttggggg 2294

                                                                        
Query: 181  acttggtggccgtcttcttcttgggcgacttggtctccttctcggcggcggcggtggact 240
            |||||||||  |||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 2293 acttggtggaggtcttcttcttgggcgacttggcctccttctcggcggcggcgggggact 2234

                                                                        
Query: 241  tcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgacgc 300
            |||| || || || || ||||||||  |||||||||| ||||||||||||||||||||||
Sbjct: 2233 tcttgggcagcagcacggagttgattgtggggatgacgccgccgtgggcgatggtgacgc 2174

                                                                        
Query: 301  cggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 360
            |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2173 cggcaagcagcctgccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 2114

                                                               
Query: 361  tgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 411
            |||||||| ||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 2113 tgatgcgggtcttcttgttgtccttggctgcgttgccggcaagctccagca 2063



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                              
Query: 413  ctcggcagcgaggtactcgaggacggcggcgagg 446
            |||||| |||||||||||||||||||||||||||
Sbjct: 1966 ctcggcggcgaggtactcgaggacggcggcgagg 1933



to top

>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2
          Length = 717

 Score =  424 bits (214), Expect = e-115
 Identities = 332/370 (89%), Gaps = 11/370 (2%)
 Strand = Plus / Minus

                                                                       
Query: 82  actgctcatcttgtccatgagaaatggaac---gaagcaacacaggctaggctatggg-- 136
           ||||||||||||||||||||||||||||||   | ||||| || ||||||||||||||  
Sbjct: 592 actgctcatcttgtccatgagaaatggaacagagcagcaagactggctaggctatgggaa 533

                                                                       
Query: 137 tgcgggcggctactccttggcggcgggggccttcttcttgggggacttggtggccgtctt 196
           || || |||||||||||||| ||| | || |||||||||||||||||||| ||| | |||
Sbjct: 532 tggggacggctactccttggtggctgcggtcttcttcttgggggacttggcggcggcctt 473

                                                                       
Query: 197 cttcttgggcgacttggtctccttctcggcggcggcggtggacttcttcgggagaagaac 256
           ||      ||||||||| ||||||||||||||| |||| ||||||||| ||||| || ||
Sbjct: 472 ct------gcgacttggcctccttctcggcggctgcgggggacttcttggggagcagcac 419

                                                                       
Query: 257 agagttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttcc 316
            |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||
Sbjct: 418 ggagttgatgttggggatgacgccgccgtgggcgatggtgacgccggcgagcagcctgcc 359

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||||||||||||||||||| ||||||||||||||||||||||||||  |||||||
Sbjct: 358 gagctcctggtcgttgcggacggccagcagcaggtggcgcgggatgatgcgcgtcttctt 299

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||
Sbjct: 298 gttgtccttggccgcgttgccggcaagctccaggacctcggcggcgaggtactcgaggac 239

                     
Query: 437 ggcggcgagg 446
           ||||||||||
Sbjct: 238 ggcggcgagg 229



to top

>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3
          Length = 1153

 Score =  404 bits (204), Expect = e-110
 Identities = 299/329 (90%), Gaps = 5/329 (1%)
 Strand = Plus / Minus

                                                                       
Query: 123 ggctaggctatggg--tgcgggcggctactccttggcggcgggggccttcttcttggggg 180
           ||||||||||||||  || || |||||||||||||| ||| | || ||||||||||||||
Sbjct: 555 ggctaggctatggggatggggacggctactccttggtggctgcggtcttcttcttggggg 496

                                                                       
Query: 181 acttggtggccgtcttcttcttgggcgacttggt---ctccttctcggcggcggcggtgg 237
           |||||||||| | |||||||||||||||||||||   |||||||||||||||| ||| ||
Sbjct: 495 acttggtggcggccttcttcttgggcgacttggtggactccttctcggcggcgccggcgg 436

                                                                       
Query: 238 acttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtga 297
            |||||| ||||| || || |||||||||||||||||||| |||||||||||||||||||
Sbjct: 435 ccttcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatggtga 376

                                                                       
Query: 298 cgccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcg 357
           |||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 375 cgccggcgagcagcctgcccagctcctggtcgttgcggacggccagcagcaggtggcgcg 316

                                                                       
Query: 358 ggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcgg 417
           ||||||||||  ||||||||||||||||||||||||||||||| |||||||| | |||||
Sbjct: 315 ggatgatgcgcgtcttcttgttgtccttggccgcgttgccggcgagctccaggacctcgg 256

                                        
Query: 418 cagcgaggtactcgaggacggcggcgagg 446
           | |||||||||||||||||||||||||||
Sbjct: 255 cggcgaggtactcgaggacggcggcgagg 227



to top

>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence
          Length = 538

 Score =  250 bits (126), Expect = 3e-63
 Identities = 196/218 (89%), Gaps = 1/218 (0%)
 Strand = Plus / Plus

                                                                       
Query: 94  gtccatgagaaatggaacgaagcaacacaggctaggctatgggtgcgggcggctactcct 153
           |||||||||||||||| | ||||||||  ||||||||||||||  ||  |||||||||||
Sbjct: 120 gtccatgagaaatggatctaagcaacaatggctaggctatggggacga-cggctactcct 178

                                                                       
Query: 154 tggcggcgggggccttcttcttgggggacttggtggccgtcttcttcttgggcgacttgg 213
           | | |||||  | |||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 179 tcgtggcggccgtcttcttcttgggggacttggcggccgtcttcttcttgggcgacttgg 238

                                                                       
Query: 214 tctccttctcggcggcggcggtggacttcttcgggagaagaacagagttgatgttgggga 273
            |||||||||||||||||| | ||||||||| ||||| || || ||||||||||||||||
Sbjct: 239 cctccttctcggcggcggcaggggacttcttggggagcagcacggagttgatgttgggga 298

                                                 
Query: 274 tgacaccgccgtgggcgatggtgacgccggcgagcagc 311
           | ||||||||||||||||||||||||||||||||||||
Sbjct: 299 tcacaccgccgtgggcgatggtgacgccggcgagcagc 336



to top

>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence
          Length = 719

 Score =  228 bits (115), Expect = 1e-56
 Identities = 166/183 (90%)
 Strand = Plus / Minus

                                                                       
Query: 260 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 319
           |||||||||||||| ||| |||||||||||||||||||||||||  |||||| | |||||
Sbjct: 471 gttgatgttggggaggacgccgccgtgggcgatggtgacgccggacagcagcttgccgag 412

                                                                       
Query: 320 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 379
           ||||| ||||||||||| ||| || |||| ||||||||||||||||||| ||||||||||
Sbjct: 411 ctcctcgtcgttgcggatggcaaggagcacgtggcgcgggatgatgcgggtcttcttgtt 352

                                                                       
Query: 380 gtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
           ||||||||| ||||||||||| |||||||||| |||||| || |||||||||||||||||
Sbjct: 351 gtccttggcagcgttgccggccagctccagcacctcggcggccaggtactcgaggacggc 292

              
Query: 440 ggc 442
           |||
Sbjct: 291 ggc 289



to top

>gb|AY103710.1| Zea mays PCO123562 mRNA sequence
          Length = 770

 Score =  228 bits (115), Expect = 1e-56
 Identities = 166/183 (90%)
 Strand = Plus / Minus

                                                                       
Query: 260 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 319
           |||||||||||||| ||| |||||||||||||||||||||||||  |||||| | |||||
Sbjct: 471 gttgatgttggggaggacgccgccgtgggcgatggtgacgccggacagcagcttgccgag 412

                                                                       
Query: 320 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 379
           ||||| ||||||||||| ||| || |||| ||||||||||||||||||| ||||||||||
Sbjct: 411 ctcctcgtcgttgcggatggcaaggagcacgtggcgcgggatgatgcgggtcttcttgtt 352

                                                                       
Query: 380 gtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
           ||||||||| ||||||||||| |||||||||| |||||| || |||||||||||||||||
Sbjct: 351 gtccttggcagcgttgccggccagctccagcacctcggcggccaggtactcgaggacggc 292

              
Query: 440 ggc 442
           |||
Sbjct: 291 ggc 289



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 197 cttcttgggcgacttggtctcctt 220
           ||||||||||||||||| ||||||
Sbjct: 537 cttcttgggcgacttggcctcctt 514



to top

>ref|XM_475374.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 492

 Score =  182 bits (92), Expect = 6e-43
 Identities = 179/208 (86%)
 Strand = Plus / Minus

                                                                       
Query: 239 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
           |||||| ||||| || || | |||||||||||| |  || |||||||| |||||||||||
Sbjct: 393 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 334

                                                                       
Query: 299 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
           |||||| |||||| | |||||||||| |||||||||||  || ||||||| ||| |||||
Sbjct: 333 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 274

                                                                       
Query: 359 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           |||||| ||| ||||||||||||||   |||||||| || |||||||| |||| ||||||
Sbjct: 273 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 214

                                       
Query: 419 agcgaggtactcgaggacggcggcgagg 446
            |||||||||||||||||||||||||||
Sbjct: 213 ggcgaggtactcgaggacggcggcgagg 186



to top

>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full
           insert sequence
          Length = 912

 Score =  182 bits (92), Expect = 6e-43
 Identities = 179/208 (86%)
 Strand = Plus / Minus

                                                                       
Query: 239 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
           |||||| ||||| || || | |||||||||||| |  || |||||||| |||||||||||
Sbjct: 463 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 404

                                                                       
Query: 299 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
           |||||| |||||| | |||||||||| |||||||||||  || ||||||| ||| |||||
Sbjct: 403 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 344

                                                                       
Query: 359 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           |||||| ||| ||||||||||||||   |||||||| || |||||||| |||| ||||||
Sbjct: 343 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 284

                                       
Query: 419 agcgaggtactcgaggacggcggcgagg 446
            |||||||||||||||||||||||||||
Sbjct: 283 ggcgaggtactcgaggacggcggcgagg 256



to top

>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full
           insert sequence
          Length = 1097

 Score =  182 bits (92), Expect = 6e-43
 Identities = 179/208 (86%)
 Strand = Plus / Minus

                                                                       
Query: 239 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
           |||||| ||||| || || | |||||||||||| |  || |||||||| |||||||||||
Sbjct: 464 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 405

                                                                       
Query: 299 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
           |||||| |||||| | |||||||||| |||||||||||  || ||||||| ||| |||||
Sbjct: 404 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 345

                                                                       
Query: 359 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           |||||| ||| ||||||||||||||   |||||||| || |||||||| |||| ||||||
Sbjct: 344 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 285

                                       
Query: 419 agcgaggtactcgaggacggcggcgagg 446
            |||||||||||||||||||||||||||
Sbjct: 284 ggcgaggtactcgaggacggcggcgagg 257



to top

>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full
           insert sequence
          Length = 754

 Score =  180 bits (91), Expect = 3e-42
 Identities = 163/187 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 319
           |||||||||||| |  || || ||||| |||||||| |||||||| |||||| | |||||
Sbjct: 468 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 409

                                                                       
Query: 320 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 379
           ||||| |||||| | ||  || ||||||| ||||||||||||||| | | ||||||||||
Sbjct: 408 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 349

                                                                       
Query: 380 gtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
           |||| |||||||||| ||||| |||||||||| |||||||||||||||||||||||||||
Sbjct: 348 gtccctggccgcgttcccggcgagctccagcacctcggcagcgaggtactcgaggacggc 289

                  
Query: 440 ggcgagg 446
           |||||||
Sbjct: 288 ggcgagg 282



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 197 cttcttgggcgacttggtctccttctcggcggcggcgg 234
           ||||||||||||||||| ||||||  ||||||||||||
Sbjct: 540 cttcttgggcgacttggcctccttgccggcggcggcgg 503



to top

>gb|AY103585.1| Zea mays PCO123564 mRNA sequence
          Length = 1953

 Score =  176 bits (89), Expect = 4e-41
 Identities = 164/189 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 gagttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccg 317
           |||| ||||||||||| ||| |||||||| ||||||||||||||||| |||||| | |||
Sbjct: 591 gagtggatgttggggaggacgccgccgtgcgcgatggtgacgccggccagcagcttcccg 532

                                                                       
Query: 318 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 377
           ||||||| |||||||||||  || || |||| ||||||||||||||||||  ||||||||
Sbjct: 531 agctcctcgtcgttgcggatcgccaggagcacgtggcgcgggatgatgcgcgtcttcttg 472

                                                                       
Query: 378 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 437
           ||||| || |||||||| || || | |||||| | |||||| ||||||||||| ||||||
Sbjct: 471 ttgtctttcgccgcgttccctgccaactccagaacctcggcggcgaggtactccaggacg 412

                    
Query: 438 gcggcgagg 446
           |||||||||
Sbjct: 411 gcggcgagg 403



to top

>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence
          Length = 674

 Score =  174 bits (88), Expect = 2e-40
 Identities = 164/188 (87%), Gaps = 1/188 (0%)
 Strand = Plus / Minus

                                                                       
Query: 260 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttcc-ga 318
           |||||||||||| |  || ||||||||||||||||| |||||||  ||||||||||| ||
Sbjct: 429 gttgatgttgggcaacacgccgccgtgggcgatggtcacgccggtcagcagccttcccga 370

                                                                       
Query: 319 gctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgt 378
           |||||| |||||||||||  || ||||||| ||||||||||| ||||||  |||||||||
Sbjct: 369 gctcctcgtcgttgcggatcgccagcagcacgtggcgcgggacgatgcgcgtcttcttgt 310

                                                                       
Query: 379 tgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacgg 438
           |||||||||| ||||||||||| |||||||| | ||| || ||||||||||| |||||||
Sbjct: 309 tgtccttggcagcgttgccggcgagctccaggacctcagcggcgaggtactccaggacgg 250

                   
Query: 439 cggcgagg 446
           | ||||||
Sbjct: 249 ccgcgagg 242



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 197 cttcttgggcgacttggtctcctt 220
           ||||||||||||||||| ||||||
Sbjct: 504 cttcttgggcgacttggcctcctt 481



to top

>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full
           insert sequence
          Length = 797

 Score =  174 bits (88), Expect = 2e-40
 Identities = 178/208 (85%)
 Strand = Plus / Minus

                                                                       
Query: 239 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
           |||||||||||| || || | ||||||||| || |  || |||||||| |||||||||||
Sbjct: 467 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 408

                                                                       
Query: 299 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
            |||||||||||| | |||||||||| |||||||||||  || ||||||| ||| | |||
Sbjct: 407 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 348

                                                                       
Query: 359 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           |||||| ||| ||||||||||||||   |||||||| ||||| |||||||||| ||| ||
Sbjct: 347 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacctctgc 288

                                       
Query: 419 agcgaggtactcgaggacggcggcgagg 446
            |||||||||||||||||||||||||||
Sbjct: 287 ggcgaggtactcgaggacggcggcgagg 260



to top

>ref|NM_193707.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 480

 Score =  172 bits (87), Expect = 6e-40
 Identities = 162/187 (86%)
 Strand = Plus / Minus

                                                                       
Query: 260 gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 319
           |||||||||||| |  || || ||||| |||||||| |||||||| |||||| | |||||
Sbjct: 378 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 319

                                                                       
Query: 320 ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 379
           ||||| |||||| | ||  || ||||||| ||||||||||||||| | | ||||||||||
Sbjct: 318 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 259

                                                                       
Query: 380 gtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
           |||| |||||||||| ||||| |||||||||| |||||| ||||||||||||||||||||
Sbjct: 258 gtccctggccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggc 199

                  
Query: 440 ggcgagg 446
           |||||||
Sbjct: 198 ggcgagg 192



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 56/65 (86%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                       
Query: 170 cttcttgggggacttggtggccgtcttcttcttgggcgacttggtctccttctcggcggc 229
           ||||||||||||||||  ||||| ||||||   ||||||||||| ||||||  |||||||
Sbjct: 474 cttcttgggggacttgccggccgccttctt---gggcgacttggcctccttgccggcggc 418

                
Query: 230 ggcgg 234
           |||||
Sbjct: 417 ggcgg 413



to top

>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence
          Length = 699

 Score =  161 bits (81), Expect = 2e-36
 Identities = 162/189 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 gagttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccg 317
           |||| ||||||||||| ||| || ||||| ||||||||||||||||| |||||| | |||
Sbjct: 442 gagtggatgttggggaggacgccaccgtgcgcgatggtgacgccggccagcagcttcccg 383

                                                                       
Query: 318 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 377
           ||||||| |||||||||||  || || |||| ||||||||||||||||||  ||||||||
Sbjct: 382 agctcctcgtcgttgcggatcgccaggagcacgtggcgcgggatgatgcgcgtcttcttg 323

                                                                       
Query: 378 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 437
           ||||| || |||||||| || || | |||||| | |||||| ||||||||||| || |||
Sbjct: 322 ttgtctttcgccgcgttccctgccaactccagaacctcggcggcgaggtactccagaacg 263

                    
Query: 438 gcggcgagg 446
           |||||||||
Sbjct: 262 gcggcgagg 254



to top

>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full
           insert sequence
          Length = 824

 Score =  159 bits (80), Expect = 9e-36
 Identities = 158/184 (85%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| ||||| ||||||  |||||||||| ||||| |||||||| |   ||||||
Sbjct: 454 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 395

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||| || |||||| | | ||||||||| |  |||||| |||||||||||||
Sbjct: 394 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 335

                                                                       
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 442
           | | |||||||| ||||| |||||||||| |||||| |||||||||||||||||||||||
Sbjct: 334 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 275

               
Query: 443 gagg 446
           ||||
Sbjct: 274 gagg 271



to top

>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full
           insert sequence
          Length = 733

 Score =  159 bits (80), Expect = 9e-36
 Identities = 158/184 (85%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| ||||| ||||||  |||||||||| ||||| |||||||| |   ||||||
Sbjct: 453 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 394

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||| || |||||| | | ||||||||| |  |||||| |||||||||||||
Sbjct: 393 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 334

                                                                       
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 442
           | | |||||||| ||||| |||||||||| |||||| |||||||||||||||||||||||
Sbjct: 333 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 274

               
Query: 443 gagg 446
           ||||
Sbjct: 273 gagg 270



to top

>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence
          Length = 772

 Score =  151 bits (76), Expect = 2e-33
 Identities = 172/204 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
           |||||| ||||| || || | ||| |||||||| |  ||||||||||| |||||||||||
Sbjct: 449 cttcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcgatggtgac 390

                                                                       
Query: 299 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
            ||  | |||||| | |||||||||| ||||||||||| |||||| || |||||||||||
Sbjct: 389 cccacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggtggcgcgg 330

                                                                       
Query: 359 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           |||||||||| | |||||||||||    ||||||||||| || |||||||| | ||| ||
Sbjct: 329 gatgatgcgggttttcttgttgtcgcgcgccgcgttgccagccagctccaggacctcagc 270

                                   
Query: 419 agcgaggtactcgaggacggcggc 442
            |||||||||||||||||||||||
Sbjct: 269 ggcgaggtactcgaggacggcggc 246



to top

>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence
          Length = 846

 Score =  141 bits (71), Expect = 2e-30
 Identities = 173/207 (83%)
 Strand = Plus / Minus

                                                                       
Query: 240 ttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgacg 299
           ||||| ||||| || |||| |||||||||||| |  || |||||||| ||||||||||||
Sbjct: 396 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 337

                                                                       
Query: 300 ccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggg 359
           ||||| || ||| | |||||||||| |||||||||||  || ||||| | ||| ||||||
Sbjct: 336 ccggccagtagcttcccgagctcctcgtcgttgcggatcgccagcagtacgtgccgcggg 277

                                                                       
Query: 360 atgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggca 419
           ||||| ||| ||||||||||||||   || ||||| || || | ||| || |||||||| 
Sbjct: 276 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 217

                                      
Query: 420 gcgaggtactcgaggacggcggcgagg 446
           |||||||||||||||||||| ||||||
Sbjct: 216 gcgaggtactcgaggacggcagcgagg 190



to top

>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:11561 IMAGE:3156946), complete cds
          Length = 1414

 Score =  133 bits (67), Expect = 5e-28
 Identities = 145/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||||| | |||||| |   ||||||
Sbjct: 383 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 324

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 323 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 264

                                                              
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 433
              |||||||||||| || |||||||| | |||||||| ||||||||||||
Sbjct: 263 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgag 213



to top

>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence
          Length = 185902

 Score =  133 bits (67), Expect = 5e-28
 Identities = 145/171 (84%)
 Strand = Plus / Plus

                                                                          
Query: 263    gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
              ||||||||| | ||| ||||| || |||||||| |||||| | |||||| |   ||||||
Sbjct: 149678 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 149737

                                                                          
Query: 323    ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
              || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 149738 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 149797

                                                                 
Query: 383    cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 433
                 |||||||||||| || |||||||| | |||||||| ||||||||||||
Sbjct: 149798 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgag 149848



to top

>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA
          Length = 1414

 Score =  133 bits (67), Expect = 5e-28
 Identities = 145/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||||| | |||||| |   ||||||
Sbjct: 383 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 324

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 323 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 264

                                                              
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 433
              |||||||||||| || |||||||| | |||||||| ||||||||||||
Sbjct: 263 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgag 213



to top

>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X
          Length = 2166

 Score =  133 bits (67), Expect = 5e-28
 Identities = 145/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||||| | |||||| |   ||||||
Sbjct: 962 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 903

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 902 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 843

                                                              
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 433
              |||||||||||| || |||||||| | |||||||| ||||||||||||
Sbjct: 842 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgag 792



to top

>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:6616 IMAGE:3490058), complete cds
          Length = 1367

 Score =  133 bits (67), Expect = 5e-28
 Identities = 145/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||||| | |||||| |   ||||||
Sbjct: 377 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 318

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 317 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 258

                                                              
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 433
              |||||||||||| || |||||||| | |||||||| ||||||||||||
Sbjct: 257 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgag 207



to top

>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430002L09
           product:H2A histone family, member X, full insert
           sequence
          Length = 1379

 Score =  133 bits (67), Expect = 5e-28
 Identities = 145/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||||| | |||||| |   ||||||
Sbjct: 406 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 347

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 346 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 287

                                                              
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 433
              |||||||||||| || |||||||| | |||||||| ||||||||||||
Sbjct: 286 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgag 236



to top

>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010005I09 product:H2A histone
           family, member X, full insert sequence
          Length = 564

 Score =  133 bits (67), Expect = 5e-28
 Identities = 145/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||||| | |||||| |   ||||||
Sbjct: 403 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 344

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 343 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 284

                                                              
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 433
              |||||||||||| || |||||||| | |||||||| ||||||||||||
Sbjct: 283 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgag 233



to top

>gb|AY104486.1| Zea mays PCO109435 mRNA sequence
          Length = 992

 Score =  133 bits (67), Expect = 5e-28
 Identities = 172/207 (83%)
 Strand = Plus / Minus

                                                                       
Query: 240 ttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgacg 299
           ||||| ||||| || |||| |||||||||||| |  || |||||||| ||||||||||||
Sbjct: 467 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 408

                                                                       
Query: 300 ccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggg 359
           ||||| || ||| | ||||||||||  ||||||||||  || ||||| | ||| ||||||
Sbjct: 407 ccggccagtagcttcccgagctcctcatcgttgcggatcgccagcagtacgtgtcgcggg 348

                                                                       
Query: 360 atgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggca 419
           ||||| ||| ||||||||||||||   || ||||| || || | ||| || |||||||| 
Sbjct: 347 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 288

                                      
Query: 420 gcgaggtactcgaggacggcggcgagg 446
           |||||||||||||||||||| ||||||
Sbjct: 287 gcgaggtactcgaggacggcagcgagg 261



to top

>ref|XM_475081.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 522

 Score =  129 bits (65), Expect = 8e-27
 Identities = 146/173 (84%)
 Strand = Plus / Minus

                                                                       
Query: 239 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
           |||||||||||| || || | ||||||||| || |  || |||||||| |||||||||||
Sbjct: 441 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 382

                                                                       
Query: 299 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
            |||||||||||| | |||||||||| |||||||||||  || ||||||| ||| | |||
Sbjct: 381 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 322

                                                                
Query: 359 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 411
           |||||| ||| ||||||||||||||   |||||||| ||||| ||||||||||
Sbjct: 321 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagca 269



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 420 gcgaggtactcgaggacggcggcgagg 446
           |||||||||||||||||||||||||||
Sbjct: 209 gcgaggtactcgaggacggcggcgagg 183



to top

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
            complete sequence
          Length = 93826

 Score =  129 bits (65), Expect = 8e-27
 Identities = 146/173 (84%)
 Strand = Plus / Plus

                                                                        
Query: 239  cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
            |||||| ||||| || || | |||||||||||| |  || |||||||| |||||||||||
Sbjct: 7377 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 7436

                                                                        
Query: 299  gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
            |||||| |||||| | |||||||||| |||||||||||  || ||||||| ||| |||||
Sbjct: 7437 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 7496

                                                                 
Query: 359  gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 411
            |||||| ||| ||||||||||||||   |||||||| || |||||||| ||||
Sbjct: 7497 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagca 7549



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                              
Query: 413  ctcggcagcgaggtactcgaggacggcggcgagg 446
            |||||| |||||||||||||||||||||||||||
Sbjct: 7627 ctcggcggcgaggtactcgaggacggcggcgagg 7660



to top

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
              complete sequence
          Length = 163130

 Score =  129 bits (65), Expect = 8e-27
 Identities = 146/173 (84%)
 Strand = Plus / Plus

                                                                          
Query: 239    cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
              |||||| ||||| || || | |||||||||||| |  || |||||||| |||||||||||
Sbjct: 101734 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 101793

                                                                          
Query: 299    gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
              |||||| |||||| | |||||||||| |||||||||||  || ||||||| ||| |||||
Sbjct: 101794 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 101853

                                                                   
Query: 359    gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 411
              |||||| ||| ||||||||||||||   |||||||| || |||||||| ||||
Sbjct: 101854 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagca 101906



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                                
Query: 413    ctcggcagcgaggtactcgaggacggcggcgagg 446
              |||||| |||||||||||||||||||||||||||
Sbjct: 101984 ctcggcggcgaggtactcgaggacggcggcgagg 102017



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  129 bits (65), Expect = 8e-27
 Identities = 146/173 (84%)
 Strand = Plus / Plus

                                                                            
Query: 239      cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
                |||||| ||||| || || | |||||||||||| |  || |||||||| |||||||||||
Sbjct: 22512327 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 22512386

                                                                            
Query: 299      gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
                |||||| |||||| | |||||||||| |||||||||||  || ||||||| ||| |||||
Sbjct: 22512387 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 22512446

                                                                     
Query: 359      gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 411
                |||||| ||| ||||||||||||||   |||||||| || |||||||| ||||
Sbjct: 22512447 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagca 22512499



 Score =  129 bits (65), Expect = 8e-27
 Identities = 146/173 (84%)
 Strand = Plus / Minus

                                                                          
Query: 239    cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
              |||||||||||| || || | ||||||||| || |  || |||||||| |||||||||||
Sbjct: 707404 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 707345

                                                                          
Query: 299    gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
               |||||||||||| | |||||||||| |||||||||||  || ||||||| ||| | |||
Sbjct: 707344 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 707285

                                                                   
Query: 359    gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 411
              |||||| ||| ||||||||||||||   |||||||| ||||| ||||||||||
Sbjct: 707284 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagca 707232



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                                  
Query: 413      ctcggcagcgaggtactcgaggacggcggcgagg 446
                |||||| |||||||||||||||||||||||||||
Sbjct: 22512577 ctcggcggcgaggtactcgaggacggcggcgagg 22512610



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 420    gcgaggtactcgaggacggcggcgagg 446
              |||||||||||||||||||||||||||
Sbjct: 707144 gcgaggtactcgaggacggcggcgagg 707118



to top

>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0041A22, complete sequence
          Length = 117919

 Score =  129 bits (65), Expect = 8e-27
 Identities = 146/173 (84%)
 Strand = Plus / Minus

                                                                         
Query: 239   cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
             |||||||||||| || || | ||||||||| || |  || |||||||| |||||||||||
Sbjct: 52603 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 52544

                                                                         
Query: 299   gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
              |||||||||||| | |||||||||| |||||||||||  || ||||||| ||| | |||
Sbjct: 52543 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 52484

                                                                  
Query: 359   gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagca 411
             |||||| ||| ||||||||||||||   |||||||| ||||| ||||||||||
Sbjct: 52483 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagca 52431



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 420   gcgaggtactcgaggacggcggcgagg 446
             |||||||||||||||||||||||||||
Sbjct: 52343 gcgaggtactcgaggacggcggcgagg 52317



to top

>ref|XM_478632.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 823

 Score =  127 bits (64), Expect = 3e-26
 Identities = 154/184 (83%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| || || ||||||  |||||||||| ||||| |||||||| |    | |||
Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||| || |||||| | | ||||||||| | ||||||| |||||||||||||
Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369

                                                                       
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 442
           | | |||||||| ||||| ||||| |||| ||| || |||||||||||||||||||||||
Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309

               
Query: 443 gagg 446
           ||||
Sbjct: 308 gagg 305



to top

>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full
           insert sequence
          Length = 823

 Score =  127 bits (64), Expect = 3e-26
 Identities = 154/184 (83%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| || || ||||||  |||||||||| ||||| |||||||| |    | |||
Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||| || |||||| | | ||||||||| | ||||||| |||||||||||||
Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369

                                                                       
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 442
           | | |||||||| ||||| ||||| |||| ||| || |||||||||||||||||||||||
Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309

               
Query: 443 gagg 446
           ||||
Sbjct: 308 gagg 305



to top

>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full
           insert sequence
          Length = 1718

 Score =  127 bits (64), Expect = 3e-26
 Identities = 154/184 (83%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| || || ||||||  |||||||||| ||||| |||||||| |    | |||
Sbjct: 489 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 430

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||| || |||||| | | ||||||||| | ||||||| |||||||||||||
Sbjct: 429 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 370

                                                                       
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 442
           | | |||||||| ||||| ||||| |||| ||| || |||||||||||||||||||||||
Sbjct: 369 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 310

               
Query: 443 gagg 446
           ||||
Sbjct: 309 gagg 306



to top

>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X
          Length = 1359

 Score =  125 bits (63), Expect = 1e-25
 Identities = 144/171 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||||| | |||||| |   ||||||
Sbjct: 387 gatgttgggcaggacgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctc 328

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||||||||
Sbjct: 327 ctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttcttgttgtc 268

                                                              
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 433
              |||||||||||| || |||||||| | |||||||| ||||||||||||
Sbjct: 267 gcgggccgcgttgcccgccagctccaggatctcggcagtgaggtactcgag 217



to top

>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700),
           mRNA
          Length = 393

 Score =  123 bits (62), Expect = 5e-25
 Identities = 110/126 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||    ||||||||||||||||||||||| | ||||||||  ||||||||||| ||
Sbjct: 222 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaggtactcgagcac 163

                 
Query: 437 ggcggc 442
            |||||
Sbjct: 162 cgcggc 157



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  119 bits (60), Expect = 8e-24
 Identities = 129/152 (84%)
 Strand = Plus / Plus

                                                                           
Query: 260     gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 319
               |||||||||||| |  || || ||||| |||||||| |||||||| |||||| | |||||
Sbjct: 9471244 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 9471303

                                                                           
Query: 320     ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 379
               ||||| |||||| | ||  || ||||||| ||||||||||||||| | | ||||||||||
Sbjct: 9471304 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 9471363

                                               
Query: 380     gtccttggccgcgttgccggcaagctccagca 411
               |||| |||||||||| ||||| ||||||||||
Sbjct: 9471364 gtccctggccgcgttcccggcgagctccagca 9471395



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                                 
Query: 413     ctcggcagcgaggtactcgaggacggcggcgagg 446
               ||||||||||||||||||||||||||||||||||
Sbjct: 9471498 ctcggcagcgaggtactcgaggacggcggcgagg 9471531



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 370      tcttcttgttgtccttggccgcgttgccggcaagctccagca 411
                |||||||||||||| | |||||||| ||||| ||||||||||
Sbjct: 28998212 tcttcttgttgtccctcgccgcgttcccggccagctccagca 28998171



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                                  
Query: 413      ctcggcagcgaggtactcgaggacggcggcgagg 446
                |||||| |||||||||||||||||||||| ||||
Sbjct: 28998065 ctcggcggcgaggtactcgaggacggcggagagg 28998032



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                     
Query: 197     cttcttgggcgacttggtctccttctcggcggcggcgg 234
               ||||||||||||||||| ||||||  ||||||||||||
Sbjct: 9471172 cttcttgggcgacttggcctccttgccggcggcggcgg 9471209



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 157      cggcgggggccttcttcttgg 177
                |||||||||||||||||||||
Sbjct: 30359282 cggcgggggccttcttcttgg 30359262



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 157      cggcgggggccttcttcttgg 177
                |||||||||||||||||||||
Sbjct: 29416086 cggcgggggccttcttcttgg 29416066



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                            
Query: 389     cgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 433
               |||||||||||| |||||||| | |||||| |  |||||||||||
Sbjct: 3353558 cgcgttgccggccagctccaggacctcggcggttaggtactcgag 3353514



to top

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  119 bits (60), Expect = 8e-24
 Identities = 129/152 (84%)
 Strand = Plus / Plus

                                                                          
Query: 260    gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 319
              |||||||||||| |  || || ||||| |||||||| |||||||| |||||| | |||||
Sbjct: 168644 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 168703

                                                                          
Query: 320    ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 379
              ||||| |||||| | ||  || ||||||| ||||||||||||||| | | ||||||||||
Sbjct: 168704 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 168763

                                              
Query: 380    gtccttggccgcgttgccggcaagctccagca 411
              |||| |||||||||| ||||| ||||||||||
Sbjct: 168764 gtccctggccgcgttcccggcgagctccagca 168795



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                                
Query: 413    ctcggcagcgaggtactcgaggacggcggcgagg 446
              ||||||||||||||||||||||||||||||||||
Sbjct: 168898 ctcggcagcgaggtactcgaggacggcggcgagg 168931



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 197    cttcttgggcgacttggtctccttctcggcggcggcgg 234
              ||||||||||||||||| ||||||  ||||||||||||
Sbjct: 168572 cttcttgggcgacttggcctccttgccggcggcggcgg 168609



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  119 bits (60), Expect = 8e-24
 Identities = 129/152 (84%)
 Strand = Plus / Plus

                                                                           
Query: 260     gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 319
               |||||||||||| |  || || ||||| |||||||| |||||||| |||||| | |||||
Sbjct: 9469365 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 9469424

                                                                           
Query: 320     ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 379
               ||||| |||||| | ||  || ||||||| ||||||||||||||| | | ||||||||||
Sbjct: 9469425 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 9469484

                                               
Query: 380     gtccttggccgcgttgccggcaagctccagca 411
               |||| |||||||||| ||||| ||||||||||
Sbjct: 9469485 gtccctggccgcgttcccggcgagctccagca 9469516



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                                 
Query: 413     ctcggcagcgaggtactcgaggacggcggcgagg 446
               ||||||||||||||||||||||||||||||||||
Sbjct: 9469619 ctcggcagcgaggtactcgaggacggcggcgagg 9469652



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 370      tcttcttgttgtccttggccgcgttgccggcaagctccagca 411
                |||||||||||||| | |||||||| ||||| ||||||||||
Sbjct: 29089634 tcttcttgttgtccctcgccgcgttcccggccagctccagca 29089593



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                                  
Query: 413      ctcggcagcgaggtactcgaggacggcggcgagg 446
                |||||| |||||||||||||||||||||| ||||
Sbjct: 29089487 ctcggcggcgaggtactcgaggacggcggagagg 29089454



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                     
Query: 197     cttcttgggcgacttggtctccttctcggcggcggcgg 234
               ||||||||||||||||| ||||||  ||||||||||||
Sbjct: 9469293 cttcttgggcgacttggcctccttgccggcggcggcgg 9469330



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 157      cggcgggggccttcttcttgg 177
                |||||||||||||||||||||
Sbjct: 30450704 cggcgggggccttcttcttgg 30450684



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 157      cggcgggggccttcttcttgg 177
                |||||||||||||||||||||
Sbjct: 29507508 cggcgggggccttcttcttgg 29507488



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                            
Query: 389     cgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 433
               |||||||||||| |||||||| | |||||| |  |||||||||||
Sbjct: 3353669 cgcgttgccggccagctccaggacctcggcggttaggtactcgag 3353625



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  119 bits (60), Expect = 8e-24
 Identities = 129/152 (84%)
 Strand = Plus / Minus

                                                                            
Query: 260      gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 319
                |||||||||||| |  || || ||||| |||||||| |||||||| |||||| | |||||
Sbjct: 17417128 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 17417069

                                                                            
Query: 320      ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 379
                ||||| |||||| | ||  || ||||||| ||||||||||||||| | | ||||||||||
Sbjct: 17417068 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 17417009

                                                
Query: 380      gtccttggccgcgttgccggcaagctccagca 411
                |||| |||||||||| ||||| ||||||||||
Sbjct: 17417008 gtccctggccgcgttcccggcgagctccagca 17416977



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                                  
Query: 413      ctcggcagcgaggtactcgaggacggcggcgagg 446
                |||||| |||||||||||||||||||||||||||
Sbjct: 17416864 ctcggcggcgaggtactcgaggacggcggcgagg 17416831



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 56/65 (86%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                            
Query: 170      cttcttgggggacttggtggccgtcttcttcttgggcgacttggtctccttctcggcggc 229
                ||||||||||||||||  ||||| ||||||   ||||||||||| ||||||  |||||||
Sbjct: 17417224 cttcttgggggacttgccggccgccttctt---gggcgacttggcctccttgccggcggc 17417168

                     
Query: 230      ggcgg 234
                |||||
Sbjct: 17417167 ggcgg 17417163



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 287      ggcgatggtgacgccggcgag 307
                |||||||||||||||||||||
Sbjct: 23243788 ggcgatggtgacgccggcgag 23243768



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 46/54 (85%), Gaps = 3/54 (5%)
 Strand = Plus / Minus

                                                                      
Query: 170      cttcttgggggactt---ggtggccgtcttcttcttgggcgacttggtctcctt 220
                |||||||||||||||   |||||| |  |||||||| |||||||||| ||||||
Sbjct: 43063463 cttcttgggggacttggcggtggcggggttcttctttggcgacttggcctcctt 43063410



to top

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  119 bits (60), Expect = 8e-24
 Identities = 129/152 (84%)
 Strand = Plus / Minus

                                                                         
Query: 260   gttgatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgag 319
             |||||||||||| |  || || ||||| |||||||| |||||||| |||||| | |||||
Sbjct: 70520 gttgatgttgggcagcacgcctccgtgcgcgatggtcacgccggccagcagcttgccgag 70461

                                                                         
Query: 320   ctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgtt 379
             ||||| |||||| | ||  || ||||||| ||||||||||||||| | | ||||||||||
Sbjct: 70460 ctcctcgtcgttcctgatcgccagcagcacgtggcgcgggatgatcctgttcttcttgtt 70401

                                             
Query: 380   gtccttggccgcgttgccggcaagctccagca 411
             |||| |||||||||| ||||| ||||||||||
Sbjct: 70400 gtccctggccgcgttcccggcgagctccagca 70369



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                               
Query: 413   ctcggcagcgaggtactcgaggacggcggcgagg 446
             |||||| |||||||||||||||||||||||||||
Sbjct: 70256 ctcggcggcgaggtactcgaggacggcggcgagg 70223



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 56/65 (86%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                         
Query: 170   cttcttgggggacttggtggccgtcttcttcttgggcgacttggtctccttctcggcggc 229
             ||||||||||||||||  ||||| ||||||   ||||||||||| ||||||  |||||||
Sbjct: 70616 cttcttgggggacttgccggccgccttctt---gggcgacttggcctccttgccggcggc 70560

                  
Query: 230   ggcgg 234
             |||||
Sbjct: 70559 ggcgg 70555



to top

>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence
          Length = 1051

 Score =  119 bits (60), Expect = 8e-24
 Identities = 171/208 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
           |||||| || || ||||||| |||||| |||||||  ||||||||||| |||||||| ||
Sbjct: 486 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 427

                                                                       
Query: 299 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
           |||| | |||||| | || ||||||| |||||| ||||  || || |||| |||||||||
Sbjct: 426 gccgcccagcagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 367

                                                                       
Query: 359 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 418
            || |||||  |||||||||||||| |||| || || || || |||||||| | ||| ||
Sbjct: 366 aataatgcgagtcttcttgttgtccctggcagcattaccagcgagctccagaacctcagc 307

                                       
Query: 419 agcgaggtactcgaggacggcggcgagg 446
            |||||||| |||||||| |||||||||
Sbjct: 306 ggcgaggtattcgaggacagcggcgagg 279



to top

>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds
          Length = 714

 Score =  119 bits (60), Expect = 8e-24
 Identities = 171/208 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
           |||||| || || ||||||| |||||| |||||||  ||||||||||| |||||||| ||
Sbjct: 467 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 408

                                                                       
Query: 299 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
           |||| | | |||| | || ||||||| |||||| ||||  || || |||| |||||||||
Sbjct: 407 gccgcccaacagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 348

                                                                       
Query: 359 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 418
            || |||||  |||||||||||||| |||| || || ||||| |||||||| | ||| ||
Sbjct: 347 aataatgcgagtcttcttgttgtccctggcagcattaccggcgagctccagaacctcagc 288

                                       
Query: 419 agcgaggtactcgaggacggcggcgagg 446
            |||||||| |||||||| |||||||||
Sbjct: 287 ggcgaggtattcgaggacagcggcgagg 260



to top

>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165
           IMAGE:3355200), complete cds
          Length = 897

 Score =  115 bits (58), Expect = 1e-22
 Identities = 109/126 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 265

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||    ||||||||||||||||||||||| | ||||||||  | ||||||||| ||
Sbjct: 264 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaagtactcgagcac 205

                 
Query: 437 ggcggc 442
            |||||
Sbjct: 204 cgcggc 199



to top

>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456
           IMAGE:6671338), complete cds
          Length = 889

 Score =  115 bits (58), Expect = 1e-22
 Identities = 109/126 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 314 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 255

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||    ||||||||||||||||||||||| | ||||||||  | ||||||||| ||
Sbjct: 254 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaagtactcgagcac 195

                 
Query: 437 ggcggc 442
            |||||
Sbjct: 194 cgcggc 189



to top

>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA
          Length = 496

 Score =  115 bits (58), Expect = 1e-22
 Identities = 109/126 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 265

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||    ||||||||||||||||||||||| | ||||||||  | ||||||||| ||
Sbjct: 264 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaagtactcgagcac 205

                 
Query: 437 ggcggc 442
            |||||
Sbjct: 204 cgcggc 199



to top

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score =  115 bits (58), Expect = 1e-22
 Identities = 109/126 (86%)
 Strand = Plus / Minus

                                                                          
Query: 317    gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
              |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 100829 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 100770

                                                                          
Query: 377    gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
              ||||||    ||||||||||||||||||||||| | ||||||||  | ||||||||| ||
Sbjct: 100769 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaagtactcgagcac 100710

                    
Query: 437    ggcggc 442
               |||||
Sbjct: 100709 cgcggc 100704



to top

>gb|AY108339.1| Zea mays PCO070432 mRNA sequence
          Length = 811

 Score =  115 bits (58), Expect = 1e-22
 Identities = 112/130 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||||||||||| | | ||||||||||| ||||||| |||||||
Sbjct: 395 gagctcctcgtcgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttctt 336

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           |||||||   |||||||| ||||||||||| || | ||| ||||| || |||||||| ||
Sbjct: 335 gttgtcccgagccgcgttcccggcaagctcgagaacctcagcagcaagatactcgagcac 276

                     
Query: 437 ggcggcgagg 446
           ||| ||||||
Sbjct: 275 ggcagcgagg 266



to top

>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds
          Length = 1173

 Score =  115 bits (58), Expect = 1e-22
 Identities = 109/126 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 674 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 615

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||    ||||||||||||||||||||||| | ||||||||  | ||||||||| ||
Sbjct: 614 gttgtcgcgcgccgcgttgccggcaagctccaggatctcggcagtcaagtactcgagcac 555

                 
Query: 437 ggcggc 442
            |||||
Sbjct: 554 cgcggc 549



to top

>ref|XM_478633.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 830

 Score =  113 bits (57), Expect = 5e-22
 Identities = 111/129 (86%)
 Strand = Plus / Minus

                                                                       
Query: 318 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 377
           ||||||| ||||||||||||||||||| | | |||||| || |  |||||| ||||||||
Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380

                                                                       
Query: 378 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 437
           |||||| | |||||||| ||||| ||||| || | ||| || ||||||||||||||||||
Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacg 320

                    
Query: 438 gcggcgagg 446
           |||||||||
Sbjct: 319 gcggcgagg 311



to top

>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962),
           mRNA
          Length = 437

 Score =  113 bits (57), Expect = 5e-22
 Identities = 138/165 (83%)
 Strand = Plus / Minus

                                                                       
Query: 275 gacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctcctggtcgttgcg 334
           ||||||||| || |||||||| |||| | | |||||| |   |||||||| |||||||||
Sbjct: 338 gacaccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcg 279

                                                                       
Query: 335 gacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgtt 394
           || ||| ||| ||||||||||||||||||||||  |||||||||||||| | ||||||||
Sbjct: 278 gatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtccctcgccgcgtt 219

                                                        
Query: 395 gccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
           ||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 218 gcccgccagctccaggatctcggccgtcaggtactccagcacggc 174



to top

>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full
           insert sequence
          Length = 830

 Score =  113 bits (57), Expect = 5e-22
 Identities = 111/129 (86%)
 Strand = Plus / Minus

                                                                       
Query: 318 agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 377
           ||||||| ||||||||||||||||||| | | |||||| || |  |||||| ||||||||
Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380

                                                                       
Query: 378 ttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacg 437
           |||||| | |||||||| ||||| ||||| || | ||| || ||||||||||||||||||
Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacg 320

                    
Query: 438 gcggcgagg 446
           |||||||||
Sbjct: 319 gcggcgagg 311



to top

>ref|XM_482492.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 405

 Score =  111 bits (56), Expect = 2e-21
 Identities = 152/184 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| ||||| ||||||| ||||||||||||| || ||||||| |     |||||
Sbjct: 339 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 280

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||| ||||||||| | | ||| | ||| | ||| ||  |||||||||||||
Sbjct: 279 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 220

                                                                       
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 442
           |   |||||||| ||||| ||||| || | |||||| |||||||||||||||||||||||
Sbjct: 219 ccgcgccgcgttcccggcgagctcaagaacctcggcggcgaggtactcgaggacggcggc 160

               
Query: 443 gagg 446
           ||||
Sbjct: 159 gagg 156



to top

>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete
            cds
          Length = 2120

 Score =  111 bits (56), Expect = 2e-21
 Identities = 149/180 (82%)
 Strand = Plus / Minus

                                                                        
Query: 263  gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
            ||||||||| | ||| || || |||||||||||||||||| | |||||| |   ||||||
Sbjct: 1141 gatgttgggcaggacgcctccctgggcgatggtgacgccgcccagcagcttgttgagctc 1082

                                                                        
Query: 323  ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
            || ||||||||| ||||| ||| ||||||| || |||||||||||| |||||||||||||
Sbjct: 1081 ctcgtcgttgcgcacggccagctgcaggtgacgggggatgatgcgggtcttcttgttgtc 1022

                                                                        
Query: 383  cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 442
               ||| || |||||||| |||||||| | |||||| | ||| |||||||| || |||||
Sbjct: 1021 gcgggcggcattgccggccagctccaggatctcggcggtgagatactcgagcacagcggc 962



to top

>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full
           insert sequence
          Length = 747

 Score =  111 bits (56), Expect = 2e-21
 Identities = 134/160 (83%)
 Strand = Plus / Minus

                                                                       
Query: 287 ggcgatggtgacgccggcgagcagccttccgagctcctggtcgttgcggacggcgagcag 346
           ||||||||||||| || |||||||||| |  ||||||| ||||||||| || || ||| |
Sbjct: 431 ggcgatggtgacggcgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctg 372

                                                                       
Query: 347 caggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctc 406
            | ||| | ||| | ||| ||| |||||||||||||| | |||||||| || || |||||
Sbjct: 371 gatgtgcctcggcacgatccggttcttcttgttgtccctcgccgcgttccccgccagctc 312

                                                   
Query: 407 cagcagctcggcagcgaggtactcgaggacggcggcgagg 446
           ||||| |||||| |||||||||||||||||||||| ||||
Sbjct: 311 cagcacctcggcggcgaggtactcgaggacggcggagagg 272



to top

>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4
          Length = 725

 Score =  111 bits (56), Expect = 2e-21
 Identities = 152/184 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| ||||||||||||  |||||| |||||   | ||||||| |    ||||||
Sbjct: 421 gatgttgggcatgacaccgccgctggcgattgtgaccatgccgagcaggcgggagagctc 362

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||||||||||| | | ||||||||| | ||||||| |||||||||||||
Sbjct: 361 ctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 302

                                                                       
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 442
           | | |||||||| ||||| | |||||| | ||| || ||||| ||||| || ||||||||
Sbjct: 301 cctcgccgcgttcccggccaactccagaacctcagcggcgagatactccagcacggcggc 242

               
Query: 443 gagg 446
           ||||
Sbjct: 241 gagg 238



to top

>ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone H2A.x (H2a/x)
           (LOC500987), mRNA
          Length = 1569

 Score =  109 bits (55), Expect = 8e-21
 Identities = 142/171 (83%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || ||||| || |||||| | |||||| |   ||||||
Sbjct: 615 gatgttgggcaggacgccgccctgcgcgatagtcacgccgcccagcagcttgttgagctc 556

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || |||||||||||  || ||| |||||||||||||||| |||||  |||||||||||||
Sbjct: 555 ctcgtcgttgcggatagccagctgcaggtggcgcgggataatgcgcgtcttcttgttgtc 496

                                                              
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgag 433
           |   ||||||||||| || |||||||| | |||||||| ||||||||||||
Sbjct: 495 ccgagccgcgttgcccgccagctccaggatctcggcagtgaggtactcgag 445



to top

>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone
           wcH2A-10
          Length = 691

 Score =  107 bits (54), Expect = 3e-20
 Identities = 111/130 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||||||||||| | | ||||||||| | ||||||| |||||||
Sbjct: 369 gagctcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttctt 310

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||| | |||||||| ||||| | |||||| | ||| || ||||| ||||| || ||
Sbjct: 309 gttgtccctcgccgcgttcccggccaactccagaacctcagcggcgagatactccagcac 250

                     
Query: 437 ggcggcgagg 446
           ||||||||||
Sbjct: 249 ggcggcgagg 240



to top

>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                         
Query: 263   gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
             ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 64605 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 64546

                                                                         
Query: 323   ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
             || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 64545 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 64486

                                                                      
Query: 383   cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 64485 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 64429



 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                         
Query: 263   gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
             ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 60572 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 60631

                                                                         
Query: 323   ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
             || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 60632 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 60691

                                                                      
Query: 383   cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 60692 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 60748



 Score =  101 bits (51), Expect = 2e-18
 Identities = 105/123 (85%)
 Strand = Plus / Plus

                                                                          
Query: 317    gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
              |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 101186 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 101245

                                                                          
Query: 377    gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
              ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 101246 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 101305

                 
Query: 437    ggc 439
              |||
Sbjct: 101306 ggc 101308



to top

>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome
           13
          Length = 1357

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 818 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 759

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 758 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 699

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 698 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 642



to top

>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488308), mRNA
          Length = 456

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 399 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 340

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 339 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 280

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 279 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 223



to top

>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC611496), mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488291), mRNA
          Length = 387

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289),
           mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488278), mRNA
          Length = 576

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488272), mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132),
           mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488270), mRNA
          Length = 462

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 405 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 346

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 345 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 286

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 285 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 229



to top

>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488262), mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082),
           mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488254), mRNA
          Length = 417

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 360 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 301

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 300 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 241

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 240 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 184



to top

>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251),
           mRNA
          Length = 396

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 2 (LOC488268), mRNA
          Length = 402

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 1 (LOC488268), mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2
           (LOC665433), mRNA
          Length = 465

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 368 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 309

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 308 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 249

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 248 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 192



to top

>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1
           (LOC665433), mRNA
          Length = 467

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 370 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 311

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 310 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 251

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 250 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 194



to top

>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203),
           mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained
           intron
          Length = 497

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 367 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 308

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 307 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 248

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 247 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 191



to top

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                        
Query: 263  gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
            ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 1284 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 1225

                                                                        
Query: 323  ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
            || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 1224 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 1165

                                                                     
Query: 383  cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
               |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 1164 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 1108



to top

>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)
          Length = 1797

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                        
Query: 263  gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
            ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 1285 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 1226

                                                                        
Query: 323  ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
            || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 1225 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 1166

                                                                     
Query: 383  cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
               |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 1165 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 1109



to top

>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571
           IMAGE:30789778), complete cds
          Length = 1075

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 346 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 287

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 286 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 227

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 226 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 170



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
              novel gene, the genes for three H1, four H2a, five H2b,
              four H3 and four H4 histone family members, the 3' end of a
              variant of the Hfe gene for hemochromatosis protein (Mr2)
              and ten CpG islands, complete sequence
          Length = 184730

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                          
Query: 263    gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
              ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 163997 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 164056

                                                                          
Query: 323    ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
              || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 164057 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 164116

                                                                       
Query: 383    cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                 |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 164117 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 164173



 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                         
Query: 263   gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
             ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 55412 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 55353

                                                                         
Query: 323   ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
             || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 55352 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 55293

                                                                      
Query: 383   cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 55292 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 55236



 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                         
Query: 263   gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
             ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 51379 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 51438

                                                                         
Query: 323   ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
             || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 51439 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 51498

                                                                      
Query: 383   cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 51499 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 51555



 Score =  101 bits (51), Expect = 2e-18
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 14794 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 14735

                                                                         
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
             ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 14734 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 14675

                
Query: 437   ggc 439
             |||
Sbjct: 14674 ggc 14672



to top

>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA
          Length = 2493

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 380 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 321

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 320 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 261

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 260 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 204



to top

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                         
Query: 263   gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
             ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 33307 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 33366

                                                                         
Query: 323   ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
             || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 33367 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 33426

                                                                      
Query: 383   cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 33427 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 33483



 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                         
Query: 263   gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
             ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 10969 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 10910

                                                                         
Query: 323   ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
             || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 10909 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 10850

                                                                      
Query: 383   cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 10849 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 10793



to top

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                         
Query: 263   gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
             ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 59948 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 60007

                                                                         
Query: 323   ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
             || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 60008 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 60067

                                                                      
Query: 383   cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 60068 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 60124



 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                         
Query: 263   gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
             ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 52573 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 52632

                                                                         
Query: 323   ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
             || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 52633 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 52692

                                                                      
Query: 383   cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 52693 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 52749



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                          
Query: 263    gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
              ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 207873 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 207932

                                                                          
Query: 323    ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
              || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 207933 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 207992

                                                                       
Query: 383    cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                 |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 207993 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 208049



 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                          
Query: 263    gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
              ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 142474 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 142533

                                                                          
Query: 323    ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
              || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 142534 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 142593

                                                                       
Query: 383    cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                 |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 142594 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 142650



 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                          
Query: 263    gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
              ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 137747 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 137688

                                                                          
Query: 323    ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
              || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 137687 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 137628

                                                                       
Query: 383    cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                 |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 137627 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 137571



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 145/177 (81%)
 Strand = Plus / Plus

                                                                          
Query: 263    gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
              ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 174482 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 174541

                                                                          
Query: 323    ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
              || ||||||||||| ||| ||| |||||||||||||||| |||||  |||||||||||||
Sbjct: 174542 ctcgtcgttgcggatggccagctgcaggtggcgcgggataatgcgcgtcttcttgttgtc 174601

                                                                       
Query: 383    cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                 |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 174602 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactctagcacggc 174658



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                          
Query: 263    gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
              ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 136910 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 136969

                                                                          
Query: 323    ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
              || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 136970 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 137029

                                                                       
Query: 383    cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
                 |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 137030 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 137086



 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                          
Query: 263    gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
              ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 142156 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 142097

                                                                          
Query: 323    ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
              || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 142096 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 142037

                                        
Query: 383    cttggccgcgttgccggcaagctcca 408
                 |||||||||||| || |||||||
Sbjct: 142036 gcgggccgcgttgcccgccagctcca 142011



to top

>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771
           IMAGE:1263745), complete cds
          Length = 527

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 358 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 299

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 298 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 239

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 238 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 182



to top

>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847
           IMAGE:5713252), complete cds
          Length = 492

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 366 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 307

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 306 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 247

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 246 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 190



to top

>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:I0C0045N09 product:histone 1,
           H2ad, full insert sequence
          Length = 446

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 369 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 310

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 309 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 250

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 249 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 193



to top

>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730004H15 product:histone 1, H2ai, full insert
           sequence
          Length = 1396

 Score =  105 bits (53), Expect = 1e-19
 Identities = 147/177 (83%), Gaps = 1/177 (0%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| ||| |||||| |   ||||||
Sbjct: 347 gatgttgggcaggacgccgccctgcgcgatggtcacgc-ggccagcagcttgttgagctc 289

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 288 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 229

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 228 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 172



to top

>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920064A15 product:histone 1, H2ad, full
           insert sequence
          Length = 445

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 367 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 308

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 307 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 248

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 247 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 191



to top

>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA
          Length = 506

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 381 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 322

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 321 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 262

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 261 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 205



to top

>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds
          Length = 447

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 348 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 289

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 288 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 229

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 228 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 172



to top

>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds
          Length = 444

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 348 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 289

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 288 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 229

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 228 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 172



to top

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 606 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 547

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 546 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 487

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 486 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 430



to top

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 604 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 545

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 544 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 485

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 484 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 428



to top

>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA
          Length = 527

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 358 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 299

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 298 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 239

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 238 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 182



to top

>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA
          Length = 705

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 449 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 390

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 389 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 330

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 329 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 273



to top

>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone
            H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                        
Query: 263  gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
            ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 1493 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 1552

                                                                        
Query: 323  ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
            || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 1553 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 1612

                                                                     
Query: 383  cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
               |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 1613 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 1669



to top

>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1190022L06 product:HISTONE H2A
           homolog [Homo sapiens], full insert sequence
          Length = 705

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 449 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 390

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 389 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 330

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 329 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 273



to top

>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
           library, clone:9030420B16 product:histone 1, H2ac, full
           insert sequence
          Length = 2493

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 380 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 321

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 320 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 261

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 260 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 204



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  105 bits (53), Expect = 1e-19
 Identities = 125/149 (83%)
 Strand = Plus / Plus

                                                                            
Query: 263      gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
                ||||||||| ||||| ||||||  |||||||||| ||||| |||||||| |   ||||||
Sbjct: 14468549 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14468608

                                                                            
Query: 323      ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
                || ||||||||| || |||||| | | ||||||||| |  |||||| |||||||||||||
Sbjct: 14468609 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14468668

                                             
Query: 383      cttggccgcgttgccggcaagctccagca 411
                | | |||||||| ||||| ||||||||||
Sbjct: 14468669 cctcgccgcgttcccggcgagctccagca 14468697



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                            
Query: 287      ggcgatggtgacgccggcgagcagccttccgagctcctggtcgttgcggacggcgagcag 346
                ||||||||||||| || |||||||||| |  ||||||| ||||||||| || || ||| |
Sbjct: 20924481 ggcgatggtgacggcgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctg 20924540

                                                                            
Query: 347      caggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctc 406
                 | ||| | ||| | ||| ||| |||||||||||||| | |||||||| || || |||||
Sbjct: 20924541 gatgtgcctcggcacgatccggttcttcttgttgtccctcgccgcgttccccgccagctc 20924600

                     
Query: 407      cagca 411
                |||||
Sbjct: 20924601 cagca 20924605



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                                  
Query: 413      ctcggcagcgaggtactcgaggacggcggcgagg 446
                |||||| |||||||||||||||||||||||||||
Sbjct: 14468902 ctcggcggcgaggtactcgaggacggcggcgagg 14468935



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                                  
Query: 413      ctcggcagcgaggtactcgaggacggcggcgagg 446
                |||||| |||||||||||||||||||||| ||||
Sbjct: 20924705 ctcggcggcgaggtactcgaggacggcggagagg 20924738



to top

>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA
          Length = 393

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted)
           (Hist1h2an_predicted), mRNA
          Length = 546

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgtgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
           | | || |||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 cctcgctgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds
          Length = 1390

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 660



to top

>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds
          Length = 1390

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 660



to top

>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds
          Length = 1390

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 660



to top

>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds
          Length = 1390

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 660



to top

>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds
          Length = 1392

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 835 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 776

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 775 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 716

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 715 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 659



to top

>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds
          Length = 1381

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 833 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 774

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 773 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 714

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 713 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 657



to top

>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds
          Length = 1390

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 660



to top

>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds
          Length = 1390

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 660



to top

>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence
          Length = 1357

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 818 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 759

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 758 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 699

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 698 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 642



to top

>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds
          Length = 1387

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 833 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 774

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 773 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 714

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 713 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 657



to top

>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA
          Length = 387

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 160



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  105 bits (53), Expect = 1e-19
 Identities = 125/149 (83%)
 Strand = Plus / Plus

                                                                            
Query: 263      gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
                ||||||||| ||||| ||||||  |||||||||| ||||| |||||||| |   ||||||
Sbjct: 14422833 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14422892

                                                                            
Query: 323      ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
                || ||||||||| || |||||| | | ||||||||| |  |||||| |||||||||||||
Sbjct: 14422893 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14422952

                                             
Query: 383      cttggccgcgttgccggcaagctccagca 411
                | | |||||||| ||||| ||||||||||
Sbjct: 14422953 cctcgccgcgttcccggcgagctccagca 14422981



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                            
Query: 287      ggcgatggtgacgccggcgagcagccttccgagctcctggtcgttgcggacggcgagcag 346
                ||||||||||||| || |||||||||| |  ||||||| ||||||||| || || ||| |
Sbjct: 20850695 ggcgatggtgacggcgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctg 20850754

                                                                            
Query: 347      caggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctc 406
                 | ||| | ||| | ||| ||| |||||||||||||| | |||||||| || || |||||
Sbjct: 20850755 gatgtgcctcggcacgatccggttcttcttgttgtccctcgccgcgttccccgccagctc 20850814

                     
Query: 407      cagca 411
                |||||
Sbjct: 20850815 cagca 20850819



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                                  
Query: 413      ctcggcagcgaggtactcgaggacggcggcgagg 446
                |||||| |||||||||||||||||||||||||||
Sbjct: 14423186 ctcggcggcgaggtactcgaggacggcggcgagg 14423219



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                                  
Query: 413      ctcggcagcgaggtactcgaggacggcggcgagg 446
                |||||| |||||||||||||||||||||| ||||
Sbjct: 20850919 ctcggcggcgaggtactcgaggacggcggagagg 20850952



to top

>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118101

 Score =  105 bits (53), Expect = 1e-19
 Identities = 125/149 (83%)
 Strand = Plus / Minus

                                                                         
Query: 263   gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
             ||||||||| ||||| ||||||  |||||||||| ||||| |||||||| |   ||||||
Sbjct: 48743 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 48684

                                                                         
Query: 323   ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
             || ||||||||| || |||||| | | ||||||||| |  |||||| |||||||||||||
Sbjct: 48683 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 48624

                                          
Query: 383   cttggccgcgttgccggcaagctccagca 411
             | | |||||||| ||||| ||||||||||
Sbjct: 48623 cctcgccgcgttcccggcgagctccagca 48595



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                               
Query: 413   ctcggcagcgaggtactcgaggacggcggcgagg 446
             |||||| |||||||||||||||||||||||||||
Sbjct: 48390 ctcggcggcgaggtactcgaggacggcggcgagg 48357



to top

>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene
          Length = 668

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 459 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 400

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 399 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 340

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 339 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 283



to top

>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score =  101 bits (51), Expect = 2e-18
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||||||| |||||||||| |||||||||||  |||||||
Sbjct: 365 gagctcctcgtcgttgcggatggcgagctgcaggtggcgggggatgatgcgcgtcttctt 306

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 305 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 246

              
Query: 437 ggc 439
           |||
Sbjct: 245 ggc 243



to top

>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score =  101 bits (51), Expect = 2e-18
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||||||| |||||||||| |||||||||||  |||||||
Sbjct: 365 gagctcctcgtcgttgcggatggcgagctgcaggtggcgggggatgatgcgcgtcttctt 306

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 305 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 246

              
Query: 437 ggc 439
           |||
Sbjct: 245 ggc 243



to top

>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488304), mRNA
          Length = 588

 Score =  101 bits (51), Expect = 2e-18
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 429 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 370

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 369 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 310

              
Query: 437 ggc 439
           |||
Sbjct: 309 ggc 307



to top

>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299),
           mRNA
          Length = 387

 Score =  101 bits (51), Expect = 2e-18
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163

              
Query: 437 ggc 439
           |||
Sbjct: 162 ggc 160



to top

>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297),
           mRNA
          Length = 393

 Score =  101 bits (51), Expect = 2e-18
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163

              
Query: 437 ggc 439
           |||
Sbjct: 162 ggc 160



to top

>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x)
           (LOC489372), mRNA
          Length = 841

 Score =  101 bits (51), Expect = 2e-18
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 579 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 520

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  ||||||||||| ||
Sbjct: 519 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactcgagcac 460

              
Query: 437 ggc 439
           |||
Sbjct: 459 ggc 457



to top

>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129),
           mRNA
          Length = 393

 Score =  101 bits (51), Expect = 2e-18
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||| | || |||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 222 gttgtccctcgctgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163

              
Query: 437 ggc 439
           |||
Sbjct: 162 ggc 160



to top

>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds
          Length = 1390

 Score =  101 bits (51), Expect = 2e-18
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 806 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 747

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 746 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 687

              
Query: 437 ggc 439
           |||
Sbjct: 686 ggc 684



to top

>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA
          Length = 393

 Score =  101 bits (51), Expect = 2e-18
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163

              
Query: 437 ggc 439
           |||
Sbjct: 162 ggc 160



to top

>ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA
          Length = 390

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181



to top

>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA
          Length = 578

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 265 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 224



to top

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 208



to top

>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA
          Length = 393

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||| ||||||||||||||| |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtgacgcgggatgatgcgggtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           |||||||  |||||||||||| || |||||||| | ||||||
Sbjct: 222 gttgtcccgggccgcgttgcccgccagctccaggatctcggc 181



to top

>gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone IMAGE:3582122),
           partial cds
          Length = 543

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 208



to top

>ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616790), mRNA
          Length = 413

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 80/90 (88%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||| ||||||||||||||| |||||||
Sbjct: 302 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgggtcttctt 243

                                         
Query: 377 gttgtccttggccgcgttgccggcaagctc 406
           |||||||  |||||||||||| || |||||
Sbjct: 242 gttgtcccgggccgcgttgcccgccagctc 213



to top

>ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA
          Length = 390

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181



to top

>ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC670497), mRNA
          Length = 3003

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 288 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 229

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 228 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 187



to top

>ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC667728), mRNA
          Length = 3054

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 339 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 280

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 279 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 238



to top

>ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone family, member O
           (LOC677006), mRNA
          Length = 2991

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 276 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 217

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 216 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 175



to top

>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J
           (LOC632401), mRNA
          Length = 1833

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 378 gagctcctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttctt 319

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||| | ||||||||||| || |||||||| | ||||||
Sbjct: 318 gttgtccctcgccgcgttgcccgccagctccaggatctcggc 277



to top

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 208



to top

>gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds
          Length = 819

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 249

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 248 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 207



to top

>gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, complete cds
          Length = 1680

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 490 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 431

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 430 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 389



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 346 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 405
           |||| |||||||||||||||||  |||||||||||||   |||||||||||| || ||||
Sbjct: 885 gcagatggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 944

                        
Query: 406 ccagcagctcggc 418
           |||| | ||||||
Sbjct: 945 ccaggatctcggc 957



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 267 ttggggatgacaccgccgtgggcgatggtgac 298
           ||||||| ||| ||||| ||||||||||||||
Sbjct: 806 ttggggaggaccccgccctgggcgatggtgac 837



to top

>emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A (partial)
          Length = 523

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 304 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 245

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 244 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 203



to top

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 317  gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
            |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 1098 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1039

                                                      
Query: 377  gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
            ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 1038 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 997



to top

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                        
Query: 263  gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
            ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 1909 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 1850

                                                                        
Query: 323  ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
            || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 1849 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 1790

                                      
Query: 383  cttggccgcgttgccggcaagctcca 408
               |||||||||||| || |||||||
Sbjct: 1789 gcgggccgcgttgcccgccagctcca 1764



to top

>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes
          Length = 3098

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 317  gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
            |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 1139 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1080

                                                      
Query: 377  gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
            ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 1079 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1038



to top

>dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930118D21 product:unclassifiable, full
           insert sequence
          Length = 2833

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 520 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 579

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 580 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 621



to top

>dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700048I17 product:histone gene complex
           2, full insert sequence
          Length = 578

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 265 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 224



to top

>dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4932439K17 product:histone gene complex
           2, full insert sequence
          Length = 2876

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 140 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 81

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 80  gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 39



to top

>dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610031H01 product:histone gene complex
           2, full insert sequence
          Length = 545

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 326 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 267

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 266 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 225



to top

>dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930558E18 product:histone gene complex
           2, full insert sequence
          Length = 1059

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 100 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 159

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 160 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 201



to top

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 317  gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
            |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 1288 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1229

                                                      
Query: 377  gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
            ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 1228 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1187



to top

>gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2a(B)-613, and histone
            H2b-613 (H2b) genes, complete cds
          Length = 2618

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                        
Query: 317  gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
            |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 1311 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1370

                                                      
Query: 377  gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
            ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 1371 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1412



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                       
Query: 346 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 405
           |||| |||||||||||||||||  |||||||||||||   |||||||||||| || ||||
Sbjct: 916 gcagatggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 857

                        
Query: 406 ccagcagctcggc 418
           |||| | ||||||
Sbjct: 856 ccaggatctcggc 844



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 267 ttggggatgacaccgccgtgggcgatggtgac 298
           ||||||| ||| ||||| ||||||||||||||
Sbjct: 995 ttggggaggaccccgccctgggcgatggtgac 964



to top

>dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched
           library, clone:2210403F13 product:histone gene complex
           2, full insert sequence
          Length = 2428

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 578 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 637

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 638 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 679



to top

>ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA
          Length = 393

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181



to top

>gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, complete cds
          Length = 1440

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 502 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 561

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 562 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 603



to top

>gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, complete cds
          Length = 1387

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 719 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678



to top

>gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, complete cds
          Length = 1387

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 719 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678



to top

>gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, complete cds
          Length = 1200

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 590 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 531

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 530 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 489



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                        
Query: 346  gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 405
            |||| |||||||||||||||||  |||||||||||||   |||||||||||| || ||||
Sbjct: 985  gcagatggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 1044

                         
Query: 406  ccagcagctcggc 418
            |||| | ||||||
Sbjct: 1045 ccaggatctcggc 1057



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 267 ttggggatgacaccgccgtgggcgatggtgac 298
           ||||||| ||| ||||| ||||||||||||||
Sbjct: 906 ttggggaggaccccgccctgggcgatggtgac 937



to top

>gb|BC062255.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone MGC:73680
           IMAGE:1448126), complete cds
          Length = 552

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 249 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 208



to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 70501 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 70442

                                                       
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
             ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 70441 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 70400



 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 64608 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 64667

                                                       
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
             ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 64668 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 64709



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| |||| |||||||||||||||||  |||||||
Sbjct: 45202 gagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttctt 45261

                                                       
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
             ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 45262 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 45303



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                         
Query: 346   gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 405
             |||| |||||||||||||||||  |||||||||||||   |||||||||||| || ||||
Sbjct: 44807 gcagatggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 44748

                          
Query: 406   ccagcagctcggc 418
             |||| | ||||||
Sbjct: 44747 ccaggatctcggc 44735



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 267   ttggggatgacaccgccgtgggcgatggtgac 298
             ||||||| ||| ||||| ||||||||||||||
Sbjct: 44886 ttggggaggaccccgccctgggcgatggtgac 44855



to top

>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:36202 IMAGE:5055276), complete cds
          Length = 550

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 334 gagctcctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttctt 275

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||| | ||||||||||| || |||||||| | ||||||
Sbjct: 274 gttgtccctcgccgcgttgcccgccagctccaggatctcggc 233



to top

>gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome 13, complete sequence
          Length = 189500

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                          
Query: 317    gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
              |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 132628 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 132569

                                                        
Query: 377    gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
              ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 132568 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 132527



to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 36085 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 36026

                                                       
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
             ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 36025 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 35984



 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 30192 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 30251

                                                       
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
             ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 30252 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 30293



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| |||| |||||||||||||||||  |||||||
Sbjct: 55491 gagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttctt 55432

                                                       
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
             ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 55431 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 55390



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                         
Query: 346   gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 405
             |||| |||||||||||||||||  |||||||||||||   |||||||||||| || ||||
Sbjct: 55886 gcagatggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 55945

                          
Query: 406   ccagcagctcggc 418
             |||| | ||||||
Sbjct: 55946 ccaggatctcggc 55958



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 267   ttggggatgacaccgccgtgggcgatggtgac 298
             ||||||| ||| ||||| ||||||||||||||
Sbjct: 55807 ttggggaggaccccgccctgggcgatggtgac 55838



to top

>gb|BC053966.1| Mus musculus histone 2, H2aa2, mRNA (cDNA clone IMAGE:1349026)
          Length = 570

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 259

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 258 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 217



to top

>ref|XM_667061.1| Plasmodium berghei strain ANKA histone h2a (PB300144.00.0), partial
           mRNA
          Length = 378

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 267 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 208

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 207 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 166



to top

>gb|BC089519.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone MGC:107211
           IMAGE:6771160), complete cds
          Length = 637

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 366 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 307

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 306 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 265



to top

>gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome 13, complete sequence
          Length = 208856

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                          
Query: 317    gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
              |||||||| ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||
Sbjct: 184237 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 184296

                                                        
Query: 377    gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
              ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 184297 gttgtcgcgggccgcgttgcccgccagctccaggatctcggc 184338



to top

>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2
          Length = 2927

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 82/93 (88%)
 Strand = Plus / Minus

                                                                        
Query: 326  gtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtcctt 385
            ||||||||||| ||| ||| ||||||||||||||||||||||| |||||||||||||   
Sbjct: 1273 gtcgttgcggatggccagctgcaggtggcgcgggatgatgcgggtcttcttgttgtcgcg 1214

                                             
Query: 386  ggccgcgttgccggcaagctccagcagctcggc 418
            |||||||||||| || |||||||| | ||||||
Sbjct: 1213 ggccgcgttgcccgccagctccaggatctcggc 1181



to top

>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 145/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| |||||||||||||||| |||||  |||||||||||||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggataatgcgcgtcttcttgttgtc 217

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactctagcacggc 160



to top

>ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (predicted)
           (Hist2h2aa_predicted), mRNA
          Length = 591

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 82/93 (88%)
 Strand = Plus / Minus

                                                                       
Query: 326 gtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtcctt 385
           ||||||||||| ||| ||| ||||||||||||||||||||||| |||||||||||||   
Sbjct: 471 gtcgttgcggatggccagctgcaggtggcgcgggatgatgcgggtcttcttgttgtcgcg 412

                                            
Query: 386 ggccgcgttgccggcaagctccagcagctcggc 418
           |||||||||||| || |||||||| | ||||||
Sbjct: 411 ggccgcgttgcccgccagctccaggatctcggc 379



to top

>ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2aa1 protein
           (LOC499676), mRNA
          Length = 675

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 82/93 (88%)
 Strand = Plus / Minus

                                                                       
Query: 326 gtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtcctt 385
           ||||||||||| ||| ||| ||||||||||||||||||||||| |||||||||||||   
Sbjct: 546 gtcgttgcggatggccagctgcaggtggcgcgggatgatgcgggtcttcttgttgtcgcg 487

                                            
Query: 386 ggccgcgttgccggcaagctccagcagctcggc 418
           |||||||||||| || |||||||| | ||||||
Sbjct: 486 ggccgcgttgcccgccagctccaggatctcggc 454



to top

>ref|XM_574997.1| PREDICTED: Rattus norvegicus similar to histone H2a(A)-613
           (LOC499675), mRNA
          Length = 510

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 82/93 (88%)
 Strand = Plus / Minus

                                                                       
Query: 326 gtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtcctt 385
           ||||||||||| ||| ||| ||||||||||||||||||||||| |||||||||||||   
Sbjct: 387 gtcgttgcggatggccagctgcaggtggcgcgggatgatgcgggtcttcttgttgtcgcg 328

                                            
Query: 386 ggccgcgttgccggcaagctccagcagctcggc 418
           |||||||||||| || |||||||| | ||||||
Sbjct: 327 ggccgcgttgcccgccagctccaggatctcggc 295



to top

>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds
          Length = 1201

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 145/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 870 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 811

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| |||||||||||||||| |||||  |||||||||||||
Sbjct: 810 ctcgtcgttgcggatggccagctgcaggtggcgcgggataatgcgcgtcttcttgttgtc 751

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 750 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactctagcacggc 694



to top

>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full
           insert sequence
          Length = 724

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                       
Query: 370 tcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtact 429
           |||||||||||||| | |||||||| ||||| |||||||||| |||||| ||||||||||
Sbjct: 345 tcttcttgttgtccctcgccgcgttcccggccagctccagcacctcggcggcgaggtact 286

                            
Query: 430 cgaggacggcggcgagg 446
           |||||||||||| ||||
Sbjct: 285 cgaggacggcggagagg 269



to top

>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence
          Length = 567

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 145/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 399 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 340

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           |  ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 339 cacgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 280

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              |||||||||||| || |||||||| | |||||| |  |||||||| || |||||
Sbjct: 279 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggc 223



to top

>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence
          Length = 531

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 145/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 363 gatgttgggcacgacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 304

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 303 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 244

                                                                    
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggc 439
              ||||||||||||  | |||||||| | |||||| |  |||||||| || |||||
Sbjct: 243 gcgggccgcgttgccctccagctccaggatctcggccgtcaggtactccagcacggc 187



to top

>gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent histone H2A mRNA,
           complete cds
          Length = 466

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 147/180 (81%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| || || |||||||||||||| ||| | |||||| |   ||||||
Sbjct: 357 gatgttgggcaggacccccccctgggcgatggtgactccgcccagcagcttgttgagctc 298

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||| ||||| ||| ||||||| || |||||||||||  |||||||||||||
Sbjct: 297 ctcgtcgttgcgcacggccagctgcaggtgacgggggatgatgcgagtcttcttgttgtc 238

                                                                       
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 442
              ||| || |||||||| |||||||| | |||||| | ||| |||||||| || |||||
Sbjct: 237 gcgggcggcattgccggccagctccaggatctcggcggtgagatactcgagcacagcggc 178



to top

>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds
          Length = 929

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 129/156 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||| | ||| ||||| || |||||||| |||| | | |||||| |   ||||||
Sbjct: 499 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 440

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || ||||||||||| ||| ||| ||||||||||||||||||||||  |||||||||||||
Sbjct: 439 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 380

                                               
Query: 383 cttggccgcgttgccggcaagctccagcagctcggc 418
              |||||| ||||| || |||||||| | ||||||
Sbjct: 379 gcgggccgcattgcccgccagctccaggatctcggc 344



to top

>gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2 late mRNA, complete cds
          Length = 430

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 168/208 (80%)
 Strand = Plus / Minus

                                                                       
Query: 239 cttcttcgggagaagaacagagttgatgttggggatgacaccgccgtgggcgatggtgac 298
           |||||| |||||||| ||||  | ||||||||||| |||||| || || |||||||||||
Sbjct: 372 cttcttggggagaaggacagcctggatgttggggaggacaccaccctgagcgatggtgac 313

                                                                       
Query: 299 gccggcgagcagccttccgagctcctggtcgttgcggacggcgagcagcaggtggcgcgg 358
            ||  |||| ||| |   |||||||| |||||||||||| || | | | || || || ||
Sbjct: 312 tcctccgagaagcttgttgagctcctcgtcgttgcggacagccaactgaagatgacgggg 253

                                                                       
Query: 359 gatgatgcggctcttcttgttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           |||||| | |||||||||||||||   ||| ||||||||||| ||||| || | ||| ||
Sbjct: 252 gatgatcctgctcttcttgttgtcgcgggcggcgttgccggcgagctcgaggatctcagc 193

                                       
Query: 419 agcgaggtactcgaggacggcggcgagg 446
            | |||||||||||||||||| ||||||
Sbjct: 192 ggtgaggtactcgaggacggctgcgagg 165



to top

>gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds
          Length = 375

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 150/184 (81%)
 Strand = Plus / Minus

                                                                       
Query: 263 gatgttggggatgacaccgccgtgggcgatggtgacgccggcgagcagccttccgagctc 322
           ||||||||||| |||||| || || ||||||||||| ||  | || ||| |   ||||||
Sbjct: 333 gatgttggggaggacaccaccctgagcgatggtgactcctcctagaagcttgttgagctc 274

                                                                       
Query: 323 ctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 382
           || |||||||||||| || ||| | || ||||| |||||||| | |||||||||||||||
Sbjct: 273 ctcgtcgttgcggacagccagctgaagatggcgggggatgatcctgctcttcttgttgtc 214

                                                                       
Query: 383 cttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggacggcggc 442
              ||| ||||||||||| ||||| || | ||| || | |||||||||||||||||| ||
Sbjct: 213 gcgggcggcgttgccggcgagctcgaggatctcagcggtgaggtactcgaggacggctgc 154

               
Query: 443 gagg 446
           ||||
Sbjct: 153 gagg 150



to top

>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895),
           mRNA
          Length = 390

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163

              
Query: 437 ggc 439
           |||
Sbjct: 162 ggc 160



to top

>ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427893),
           mRNA
          Length = 390

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163

              
Query: 437 ggc 439
           |||
Sbjct: 162 ggc 160



to top

>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891),
           mRNA
          Length = 390

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163

              
Query: 437 ggc 439
           |||
Sbjct: 162 ggc 160



to top

>ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427885),
           mRNA
          Length = 918

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163

              
Query: 437 ggc 439
           |||
Sbjct: 162 ggc 160



to top

>ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427881),
           mRNA
          Length = 534

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 426 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 367

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 366 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 307

              
Query: 437 ggc 439
           |||
Sbjct: 306 ggc 304



to top

>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA
          Length = 1220

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                        
Query: 317  gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
            |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 1112 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 1053

                                                                        
Query: 377  gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
            ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 1052 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 993

               
Query: 437  ggc 439
            |||
Sbjct: 992  ggc 990



to top

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Plus

                                                                        
Query: 317  gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
            |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 1249 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 1308

                                                                        
Query: 377  gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
            ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 1309 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 1368

               
Query: 437  ggc 439
            |||
Sbjct: 1369 ggc 1371



to top

>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC417952), mRNA
          Length = 1374

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Plus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 808 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 867

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 868 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 927

              
Query: 437 ggc 439
           |||
Sbjct: 928 ggc 930



to top

>ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA
          Length = 390

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 223

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 222 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 163

              
Query: 437 ggc 439
           |||
Sbjct: 162 ggc 160



to top

>emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B sequence
          Length = 1017

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Plus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 25  gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 84

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 85  gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 144

              
Query: 437 ggc 439
           |||
Sbjct: 145 ggc 147



to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                        
Query: 317  gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
            |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 5213 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 5154

                                                                        
Query: 377  gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
            ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 5153 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 5094

               
Query: 437  ggc 439
            |||
Sbjct: 5093 ggc 5091



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Plus

                                                                        
Query: 317  gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
            |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 2231 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 2290

                                                                        
Query: 377  gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
            ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 2291 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 2350

               
Query: 437  ggc 439
            |||
Sbjct: 2351 ggc 2353



to top

>emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking regions
          Length = 843

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 615 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 556

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 555 gttgtcgcgggccgcgttgcccgctagctccaggatctcggccgtcaggtactccagcac 496

              
Query: 437 ggc 439
           |||
Sbjct: 495 ggc 493



to top

>dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, complete cds
          Length = 1028

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 613 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 554

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 553 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 494

              
Query: 437 ggc 439
           |||
Sbjct: 493 ggc 491



to top

>gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, complete cds
          Length = 575

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 300 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 241

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 240 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 181

              
Query: 437 ggc 439
           |||
Sbjct: 180 ggc 178



to top

>gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, complete cds
          Length = 740

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 460 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 401

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 400 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 341

              
Query: 437 ggc 439
           |||
Sbjct: 340 ggc 338



to top

>gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, complete cds
          Length = 827

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 443 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 384

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 383 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 324

              
Query: 437 ggc 439
           |||
Sbjct: 323 ggc 321



to top

>gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, complete cds
          Length = 743

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 305 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 246

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 245 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 186

              
Query: 437 ggc 439
           |||
Sbjct: 185 ggc 183



to top

>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks
          Length = 1564

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Plus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| |||||||||| |||||||||||  |||||||
Sbjct: 364 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 423

                                                                       
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactcgaggac 436
           ||||||   |||||||||||| || |||||||| | |||||| |  |||||||| || ||
Sbjct: 424 gttgtcgcgggccgcgttgcccgctagctccaggatctcggccgtcaggtactccagcac 483

              
Query: 437 ggc 439
           |||
Sbjct: 484 ggc 486



to top

>ref|XM_527287.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC471909),
           mRNA
          Length = 537

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||| ||
Sbjct: 426 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 367

                                                                 
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
           ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 366 gttgtcgcgggctgcgttgcccgccagctccaggatctcggcagttaggtactc 313



to top

>ref|XM_527283.1| PREDICTED: Pan troglodytes similar to Hist2h2aa1 protein
           (LOC471905), mRNA
          Length = 555

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| |||||||||||| |||||| |||||||
Sbjct: 444 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 385

                                                                 
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
           ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 384 gttgtcgcgggcggcgttgcccgccagctccaggatctcggcagtcaggtactc 331



to top

>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507),
           mRNA
          Length = 846

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||||||
Sbjct: 228 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 169

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || || ||||| | ||||||
Sbjct: 168 gttgtcgcgggccgcgttgccagccagttccaggatctcggc 127



to top

>ref|XM_518286.1| PREDICTED: Pan troglodytes similar to Histone H2A.l (H2A/l)
           (LOC462490), mRNA
          Length = 565

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 265

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 264 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 223



to top

>gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125892
           IMAGE:40031339), complete cds
          Length = 438

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || || ||||| | ||||||
Sbjct: 222 gttgtcgcgggccgcgttgccagccagttccaggatctcggc 181



to top

>gb|BC017379.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MGC:1730
           IMAGE:2988620), complete cds
          Length = 1656

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 334 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 275

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 274 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 233



to top

>gb|BC104199.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125893
           IMAGE:40031340), complete cds
          Length = 438

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || || ||||| | ||||||
Sbjct: 222 gttgtcgcgggccgcgttgccagccagttccaggatctcggc 181



to top

>ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC524176), mRNA
          Length = 449

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||| |||||||| |||||  |||||||
Sbjct: 283 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggataatgcgcgtcttctt 224

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           |||||||  |||||||||||| || |||||||| | ||||||
Sbjct: 223 gttgtcccgggccgcgttgcccgccagctccaggatctcggc 182



to top

>ref|XM_871147.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC618824), mRNA
          Length = 453

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| |||||||||||  || ||| ||||||| ||||||||||||||| |||||||
Sbjct: 282 gagctcctcgtcgttgcggattgccagctgcaggtgacgcgggatgatgcgggtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||| |||  |||||||||||| || |||||||| | ||||||
Sbjct: 222 gttatcccgggccgcgttgcccgccagctccaggatctcggc 181



to top

>gb|BC069306.1| Homo sapiens histone 1, H2al, mRNA (cDNA clone MGC:97481
           IMAGE:7262757), complete cds
          Length = 469

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| |||||||||||| |||||| |||||||
Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 249

                                                                 
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
           ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 248 gttgtcgcgggcggcgttgcccgccagctccaggatctcggcagtcaggtactc 195



to top

>gb|BC034487.2| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IMAGE:4825623), with
           apparent retained intron
          Length = 2884

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||||||
Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 259

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || || ||||| | ||||||
Sbjct: 258 gttgtcgcgggccgcgttgccagccagttccaggatctcggc 217



to top

>ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616611), mRNA
          Length = 393

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||| |||||||| || ||| |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggataatacgggtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           |||||||  |||||||||||| || |||||||| | ||||||
Sbjct: 222 gttgtcccgggccgcgttgcccgccagctccaggatctcggc 181



to top

>ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616875), mRNA
          Length = 449

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||| || |||||||||||  |||||||
Sbjct: 283 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 224

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           |||||||  |||||||||||| || |||||||| | ||||||
Sbjct: 223 gttgtcccgggccgcgttgcccgccagctccaggatctcggc 182



to top

>ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC529277), mRNA
          Length = 522

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||| ||||||||||||||  |||||||
Sbjct: 283 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgcgtcttctt 224

                                         
Query: 377 gttgtccttggccgcgttgccggcaagctc 406
           |||||||  |||||||||||| || |||||
Sbjct: 223 gttgtcccgggccgcgttgcccgccagctc 194



to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6
          Length = 269712

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                          
Query: 317    gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
              |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 108456 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 108397

                                                        
Query: 377    gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
              ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 108396 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 108355



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                          
Query: 318    agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 377
              ||||||| ||||||||||| ||| ||| ||||||||||||||||||||||| ||||||| 
Sbjct: 201255 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttctta 201196

                   
Query: 378    ttgtc 382
              |||||
Sbjct: 201195 ttgtc 201191



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                          
Query: 318    agctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 377
              ||||||| ||||||||||| ||| ||| ||||||| || |||||||||||| ||||||||
Sbjct: 182963 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 183022

                                                       
Query: 378    ttgtccttggccgcgttgccggcaagctccagcagctcggc 418
              |||||   ||| |||||||| || |||||||| | ||||||
Sbjct: 183023 ttgtcgcgggcggcgttgcccgccagctccaggatctcggc 183063



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                         
Query: 346   gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 405
             ||||||||||||||||||||||| |||||||||||||   |||||| ||||| || ||||
Sbjct: 17258 gcaggtggcgcgggatgatgcgggtcttcttgttgtcgcgggccgcattgcccgccagct 17317

                          
Query: 406   ccagcagctcggc 418
             |||| | ||||||
Sbjct: 17318 ccaggatctcggc 17330



to top

>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA
          Length = 1754

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||| || |||||||||||  |||||||
Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 240

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||| | ||||||||||| || |||||||| | ||||||
Sbjct: 239 gttgtccctcgccgcgttgcccgccagctccaggatctcggc 198



to top

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||||||
Sbjct: 56394 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 56335

                                                       
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
             ||||||   |||||||||||| || || ||||| | ||||||
Sbjct: 56334 gttgtcgcgggccgcgttgccagccagttccaggatctcggc 56293



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Plus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| ||| |||||||||||| |||||| |||||||
Sbjct: 28816 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 28875

                                                                   
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
             ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 28876 gttgtcgcgggcggcgttgcccgccagctccaggatctcggcagtcaggtactc 28929



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                        
Query: 317  gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
            |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||| ||
Sbjct: 1584 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 1525

                                                                  
Query: 377  gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
            ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 1524 gttgtcgcgggctgcgttgcccgccagctccaggatctcggcagttaggtactc 1471



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             ||||||||  |||||||||| ||| ||| | ||||| ||||||||||||||  |||||||
Sbjct: 85961 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 86020

                                                       
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
             ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 86021 gttgtcgcgggccgcgttgccagccagctccaggatctcggc 86062



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 86/102 (84%)
 Strand = Plus / Minus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             ||||||||  |||||||||| ||| ||| | ||||| ||||||||||||||  |||||||
Sbjct: 79993 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 79934

                                                       
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
             ||||||   |||||||||||| || |||||||| | ||||||
Sbjct: 79933 gttgtcgcgggccgcgttgccagccagctccaggatctcggc 79892



to top

>ref|NM_003514.2| Homo sapiens histone 1, H2am (HIST1H2AM), mRNA
          Length = 487

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||| ||
Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 259

                                                                 
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
           ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 258 gttgtcgcgggctgcgttgcccgccagctccaggatctcggcagttaggtactc 205



to top

>ref|NM_003512.3| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA
          Length = 546

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 370 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 311

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 310 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 269



to top

>ref|NM_003511.2| Homo sapiens histone 1, H2al (HIST1H2AL), mRNA
          Length = 470

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| |||||||||||| |||||| |||||||
Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 249

                                                                 
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
           ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 248 gttgtcgcgggcggcgttgcccgccagctccaggatctcggcagtcaggtactc 195



to top

>ref|NM_003510.2| Homo sapiens histone 1, H2ak (HIST1H2AK), mRNA
          Length = 460

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || || ||||| | ||||||
Sbjct: 222 gttgtcgcgggccgcgttgccagccagttccaggatctcggc 181



to top

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                          
Query: 317    gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
              |||||||| ||||||||||| ||| ||| ||||||| || |||||||||||  |||||||
Sbjct: 108662 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 108721

                                                        
Query: 377    gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
              ||||||| | ||||||||||| || |||||||| | ||||||
Sbjct: 108722 gttgtccctcgccgcgttgcccgccagctccaggatctcggc 108763



to top

>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3
             Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ,
             H2AFN, and H2BFN histone genes, the OR2B2 gene for
             olfactory receptor 2B2, histone H2B family member I
             pseudogene H2BFIP, a hypothetical protein pseudogene,
             ESTs, STSs, GSSs and CpG islands, complete sequence
          Length = 100374

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Plus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||| ||
Sbjct: 56609 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 56668

                                                                   
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
             ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 56669 gttgtcgcgggctgcgttgcccgccagctccaggatctcggcagttaggtactc 56722



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| ||| |||||||||||| |||||| |||||||
Sbjct: 29377 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 29318

                                                                   
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
             ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 29317 gttgtcgcgggcggcgttgcccgccagctccaggatctcggcagtcaggtactc 29264



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                        
Query: 317  gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
            |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||||||
Sbjct: 1799 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 1858

                                                      
Query: 377  gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
            ||||||   |||||||||||| || || ||||| | ||||||
Sbjct: 1859 gttgtcgcgggccgcgttgccagccagttccaggatctcggc 1900



to top

>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the
             3' part of the HFE gene for haemochromatosis protein, two
             genes for novel histone 4 family members, two genes for
             novel histone 1 family members, three genes for novel
             histone 2B family members, a gene for a novel histone 2A
             family member, a novel pseudogene, STSs, GSSs, ESTs and
             CpG islands, complete sequence
          Length = 101099

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 30837 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 30778

                                                       
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
             ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 30777 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 30736



to top

>gb|AY270707.1| Homo sapiens clone SKA08-D09 putative promoter sequence
          Length = 457

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 110 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 51

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 50  gttgtcgcgagccgcgttgccggccagctccaggatctcggc 9



to top

>emb|Z83739.1|HSZ83739 H.sapiens hH2A/d gene
          Length = 650

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||||||
Sbjct: 425 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 366

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || || ||||| | ||||||
Sbjct: 365 gttgtcgcgggccgcgttgccagccagttccaggatctcggc 324



to top

>emb|Z80778.1|HSH2AL H.sapiens H2A/l gene
          Length = 601

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 421 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 362

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 361 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 320



to top

>emb|X83549.1|HSHISTN2A H.sapiens gene for histone H2A
          Length = 776

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| |||||||||||| |||||| |||||||
Sbjct: 534 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 475

                                                                 
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
           ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 474 gttgtcgcgggcggcgttgcccgccagctccaggatctcggcagtcaggtactc 421



to top

>emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2A and H2B
          Length = 1661

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                        
Query: 317  gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
            |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||| ||
Sbjct: 1373 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 1314

                                                                  
Query: 377  gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
            ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 1313 gttgtcgcgggctgcgttgcccgccagctccaggatctcggcagttaggtactc 1260



to top

>emb|CR624886.1| full-length cDNA clone CS0DK009YH13 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1446

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 312 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 253

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 252 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 211



to top

>emb|CR621753.1| full-length cDNA clone CS0DI059YA15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1462

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 312 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 253

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 252 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 211



to top

>gb|BC032686.1| Homo sapiens, clone IMAGE:5581652, mRNA
          Length = 1138

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||| ||
Sbjct: 333 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 274

                                                                 
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
           ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 273 gttgtcgcgggctgcgttgcccgccagctccaggatctcggcagttaggtactc 220



to top

>emb|CR608156.1| full-length cDNA clone CS0DI013YB19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1620

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 298 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 239

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 238 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 197



to top

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
             hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
             sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                         
Query: 317   gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
             |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 16545 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 16604

                                                       
Query: 377   gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
             ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 16605 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 16646



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                          
Query: 346    gcaggtggcgcgggatgatgcggctcttcttgttgtccttggccgcgttgccggcaagct 405
              ||||||||||||||||||||||| |||||||||||||   |||||| ||||| || ||||
Sbjct: 107743 gcaggtggcgcgggatgatgcgggtcttcttgttgtcgcgggccgcattgcccgccagct 107684

                           
Query: 406    ccagcagctcggc 418
              |||| | ||||||
Sbjct: 107683 ccaggatctcggc 107671



to top

>gb|U90551.1|HSU90551 Human histone 2A-like protein (H2A/l) mRNA, complete cds
          Length = 1666

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 379 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 320

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 319 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 278



to top

>dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130307C13 product:HISTONE H2A homolog
           [Gallus gallus], full insert sequence
          Length = 1754

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||||||| || |||||||||||  |||||||
Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 240

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||| | ||||||||||| || |||||||| | ||||||
Sbjct: 239 gttgtccctcgccgcgttgcccgccagctccaggatctcggc 198



to top

>gb|AY131993.1| Homo sapiens histone H2A (HIST1H2AM) gene, complete cds
          Length = 1119

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||| ||
Sbjct: 655 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 596

                                                                 
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
           ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 595 gttgtcgcgggctgcgttgcccgccagctccaggatctcggcagttaggtactc 542



to top

>gb|AY131992.1| Homo sapiens histone H2A (HIST1H2AL) gene, complete cds
          Length = 1173

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| |||||||||||| |||||| |||||||
Sbjct: 674 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 615

                                                                 
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggcagcgaggtactc 430
           ||||||   ||| |||||||| || |||||||| | ||||||||  ||||||||
Sbjct: 614 gttgtcgcgggcggcgttgcccgccagctccaggatctcggcagtcaggtactc 561



to top

>gb|AY131991.1| Homo sapiens histone H2A (HIST1H2AK) gene, complete cds
          Length = 1119

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||||||
Sbjct: 655 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 596

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || || ||||| | ||||||
Sbjct: 595 gttgtcgcgggccgcgttgccagccagttccaggatctcggc 554



to top

>gb|BC085010.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MGC:99519
           IMAGE:5933682), complete cds
          Length = 1516

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 331 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 272

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 271 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 230



to top

>dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501
          Length = 1723

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||||||
Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 358

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || || ||||| | ||||||
Sbjct: 359 gttgtcgcgggccgcgttgccagccagttccaggatctcggc 400



to top

>gb|AY894000.1| Synthetic construct Homo sapiens clone FLH130938.01L histone 1 H2ac
           (HIST1H2AC) mRNA, partial cds
          Length = 393

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 222 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 181



to top

>gb|AY893556.1| Synthetic construct Homo sapiens clone FLH130901.01X histone 1 H2ac
           (HIST1H2AC) mRNA, complete cds
          Length = 393

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 222 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 181



to top

>gb|AY893555.1| Synthetic construct Homo sapiens clone FLH130900.01X histone 1 H2ac
           (HIST1H2AC) mRNA, complete cds
          Length = 393

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||  |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||    |||||||||||||| |||||||| | ||||||
Sbjct: 222 gttgtcgcgagccgcgttgccggccagctccaggatctcggc 181



to top

>gb|AY893520.1| Synthetic construct Homo sapiens clone FLH130895.01X histone 1 H2ak
           (HIST1H2AK) mRNA, complete cds
          Length = 393

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 317 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcggctcttctt 376
           |||||||| ||||||||||| ||| ||| ||| ||||||||||||||||||| |||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

                                                     
Query: 377 gttgtccttggccgcgttgccggcaagctccagcagctcggc 418
           ||||||   |||||||||||| || || ||||| | ||||||
Sbjct: 222 gttgtcgcgggccgcgttgccagccagttccaggatctcggc 181


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,153,307
Number of Sequences: 3902068
Number of extensions: 4153307
Number of successful extensions: 104445
Number of sequences better than 10.0: 650
Number of HSP's better than 10.0 without gapping: 662
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 98419
Number of HSP's gapped (non-prelim): 5950
length of query: 446
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 424
effective length of database: 17,147,199,772
effective search space: 7270412703328
effective search space used: 7270412703328
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top