>ref|XM_753291.1| Ustilago maydis 521 hypothetical protein (UM02237.1) partial mRNA
          Length = 2703

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 70  agacctgccaaccagttcaaga 91
           ||||||||||||||||||||||
Sbjct: 619 agacctgccaaccagttcaaga 640

>gb|AY594694.1| Homo sapiens interferon gamma receptor 1 (IFNGR1) gene, complete cds
          Length = 34003

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 87   caagaaacctagctttatta 106
            ||||||||||||||||||||
Sbjct: 3612 caagaaacctagctttatta 3631

>emb|AL162594.13| Human DNA sequence from clone RP5-1037B23 on chromosome 1p13.1-13.3
             Contains the SYT6 gene for synaptotagmin VI and a CpG
             island, complete sequence
          Length = 114098

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   acaggccatatcaatcagac 125
             ||||||||||||||||||||
Sbjct: 72348 acaggccatatcaatcagac 72329

>emb|AL050337.6|HSJ503F13 Human DNA sequence from clone RP3-503F13 on chromosome 6q24.1-25.2
             Contains the IFNGR1 gene for interferon gamma receptor 1,
             the gene for class II cytokine receptor (IL22RA2)
             (interleukin 22-binding protein, IL22BP) and a putative
             CpG island, complete sequence
          Length = 113811

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 87    caagaaacctagctttatta 106
             ||||||||||||||||||||
Sbjct: 79370 caagaaacctagctttatta 79351

>gb|AC007400.4| Homo sapiens BAC clone RP11-319A7 from 2, complete sequence
          Length = 147971

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 158   cttgtccagcagcaggacaa 177
             ||||||||||||||||||||
Sbjct: 63281 cttgtccagcagcaggacaa 63300

>gb|AY312574.1| Deschampsia antarctica Rubisco activase beta form precursor (RCA2)
            mRNA, complete cds; nuclear gene for chloroplast product
          Length = 1646

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 155  atgcttgtccagcagcaggacaa 177
            |||||||||||| ||||||||||
Sbjct: 1237 atgcttgtccaggagcaggacaa 1259

>gb|AY312573.1| Deschampsia antarctica Rubisco activase alpha form precursor (RCA1)
            mRNA, complete cds; nuclear gene for chloroplast product
          Length = 1616

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 155  atgcttgtccagcagcaggacaa 177
            |||||||||||| ||||||||||
Sbjct: 1247 atgcttgtccaggagcaggacaa 1269

>ref|XM_548350.1| PREDICTED: Canis familiaris similar to torsin family 2, member A
            (LOC491229), mRNA
          Length = 1275

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 156  tgcttgtccagcagcagga 174
            |||||||||||||||||||
Sbjct: 1109 tgcttgtccagcagcagga 1091

>gb|AC090233.16| Homo sapiens chromosome 18, clone RP11-675P24, complete sequence
          Length = 167895

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 51    gctaccacactactgaaca 69
             |||||||||||||||||||
Sbjct: 57957 gctaccacactactgaaca 57939

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 157    gcttgtccagcagcaggac 175
              |||||||||||||||||||
Sbjct: 561127 gcttgtccagcagcaggac 561109

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 65      gaacaagacctgccaacca 83
               |||||||||||||||||||
Sbjct: 2269471 gaacaagacctgccaacca 2269489

>gb|AC022137.6| Homo sapiens chromosome 19 clone CTD-2224J9, complete sequence
          Length = 137950

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 154   gatgcttgtccagcagcag 172
             |||||||||||||||||||
Sbjct: 48553 gatgcttgtccagcagcag 48571

>emb|X60093.1|BPNIR1 B.pendula mRNA for nitrite reductase
          Length = 2472

 Score = 38.2 bits (19), Expect = 8.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 155 atgcttgtccagcagcaggacaa 177
           |||||||||||| ||||||||||
Sbjct: 24  atgcttgtccaggagcaggacaa 46


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,254,457
Number of Sequences: 3902068
Number of extensions: 1254457
Number of successful extensions: 78684
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78574
Number of HSP's gapped (non-prelim): 110
length of query: 182
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 160
effective length of database: 17,147,199,772
effective search space: 2743551963520
effective search space used: 2743551963520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)