ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags34e01
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC102156.16| Mus musculus chromosome 18, clone RP23-334L7, co... 44 0.50
2emb|CR936847.6| Mouse DNA sequence from clone DN-393H17 on chrom... 44 0.50
3emb|AL596136.5| Mouse DNA sequence from clone RP23-83I13 on chro... 44 0.50
4gb|AC102106.14| Mus musculus chromosome 18, clone RP23-92B24, co... 44 0.50
5emb|Z72787.1|SCYGR002C S.cerevisiae chromosome VII reading frame... 44 0.50
6emb|Z72786.1|SCYGR001C S.cerevisiae chromosome VII reading frame... 44 0.50
7ref|XM_713893.1| Candida albicans SC5314 hypothetical protein (C... 42 2.0
8ref|XM_713791.1| Candida albicans SC5314 hypothetical protein (C... 42 2.0
9gb|AC146297.3| Mus musculus BAC clone RP23-260F15 from chromosom... 42 2.0
10emb|AL389915.19| Human DNA sequence from clone RP11-438P9 on chr... 42 2.0
11dbj|AK136958.1| Mus musculus 12 days embryo embryonic body betwe... 42 2.0
12gb|AC006038.3| Homo sapiens BAC clone RP11-299C5 from 2, complet... 42 2.0
13gb|AC026325.17| Homo sapiens 3 BAC RP11-335L9 (Roswell Park Canc... 42 2.0
14gb|AE015927.1| Clostridium tetani E88, complete genome 42 2.0
15gb|AC134825.5| Mus musculus BAC clone RP24-456L17 from 9, comple... 42 2.0
16dbj|AP000729.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 2.0
17ref|NM_117262.2| Arabidopsis thaliana signal transducer AT4G1192... 40 7.8
18gb|AC159130.5| Mus musculus BAC clone RP23-401J13 from chromosom... 40 7.8
19gb|AC004763.1| Homo sapiens chromosome 5, P1 clone 854b11 (LBNL ... 40 7.8
20gb|AC165090.3| Mus musculus BAC clone RP23-95H4 from chromosome ... 40 7.8
21gb|AC131303.8| Mus musculus chromosome 1, clone RP24-119O19, com... 40 7.8
22gb|AE009140.1| Agrobacterium tumefaciens str. C58 circular chrom... 40 7.8
23gb|AC109170.10| Mus musculus chromosome 8, clone RP23-87B3, comp... 40 7.8
24ref|XM_849271.1| PREDICTED: Canis familiaris similar to fibrous ... 40 7.8
25ref|XM_390003.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 40 7.8
26gb|AC123794.4| Mus musculus BAC clone RP24-315P14 from chromosom... 40 7.8
27emb|AL021497.1|CEY51A2D Caenorhabditis elegans YAC Y51A2D, compl... 40 7.8
28gb|AC123556.4| Mus musculus BAC clone RP23-176M9 from 1, complet... 40 7.8
29emb|AL139123.15| Human DNA sequence from clone RP11-500G10 on ch... 40 7.8
30emb|AL034422.24|HS1141E15 Human DNA sequence from clone RP5-1141... 40 7.8
31gb|AY091235.1| Arabidopsis thaliana putative Srw1 protein (At4g1... 40 7.8
32gb|AY063875.1| Arabidopsis thaliana putative Srw1 protein (At4g1... 40 7.8
33emb|BX323591.13| Zebrafish DNA sequence from clone CH211-208C6 i... 40 7.8
34gb|AC090204.11| Homo sapiens chromosome 8, clone RP11-11N9, comp... 40 7.8
35gb|AC104384.3| Homo sapiens chromosome 8, clone CTD-2381M20, com... 40 7.8
36dbj|AK140727.1| Mus musculus adult male corpus striatum cDNA, RI... 40 7.8
37gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome 40 7.8
38gb|AC087808.2| Homo sapiens chromosome 8, clone RP11-89A16, comp... 40 7.8
39gb|AC131708.3| Mus musculus BAC clone RP24-127P5 from chromosome... 40 7.8
40gb|AC093044.1| Drosophila melanogaster, chromosome 2L, region 38... 40 7.8
41ref|NM_075222.2| Caenorhabditis elegans Y51A2D.4 (Y51A2D.4) mRNA... 40 7.8
42gb|DQ059035.1| Lotus corniculatus var. japonicus cell cycle swit... 40 7.8
43emb|BX826598.1|CNS0A42I Arabidopsis thaliana Full-length cDNA Co... 40 7.8
44gb|AC153890.8| Mus musculus BAC RP23-403C13 (Roswell Park Cance... 40 7.8
45emb|AL928887.13| Zebrafish DNA sequence from clone CH211-136O14 ... 40 7.8
46emb|AL713978.9| Mouse DNA sequence from clone RP23-159H8 on chro... 40 7.8
47dbj|AB023041.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 7.8
48gb|AC002428.1|AC002428 Human BAC clone GS1-39E22 from 5q31, comp... 40 7.8
49gb|AE003665.4| Drosophila melanogaster chromosome 2L, section 74... 40 7.8
50emb|AL935155.13| Mouse DNA sequence from clone RP23-334M3 on chr... 40 7.8
51dbj|AB007546.1| Homo sapiens gene for LECT2, complete cds 40 7.8
52gb|AC004364.1|AC004364 Drosophila melanogaster DNA sequence (P1 ... 40 7.8
53emb|AL808118.8| Mouse DNA sequence from clone RP23-287O8 on chro... 40 7.8
54emb|AL808128.4| Mouse DNA sequence from clone RP23-387C21 on chr... 40 7.8
55emb|AL669981.11| Mouse DNA sequence from clone RP23-335B9 on chr... 40 7.8
56emb|AL731805.8| Mouse DNA sequence from clone RP23-358E19 on chr... 40 7.8 
>gb|AC102156.16| Mus musculus chromosome 18, clone RP23-334L7, complete sequence
          Length = 221632

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 40     atagaaagatcaaacagacgaa 61
              ||||||||||||||||||||||
Sbjct: 195141 atagaaagatcaaacagacgaa 195120
to top
>emb|CR936847.6| Mouse DNA sequence from clone DN-393H17 on chromosome 11, complete
             sequence
          Length = 170807

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 226   aacaacaacatcaagaaaataaatag 251
             ||||||||||||||||||| ||||||
Sbjct: 58946 aacaacaacatcaagaaaaaaaatag 58921
to top
>emb|AL596136.5| Mouse DNA sequence from clone RP23-83I13 on chromosome 11 Contains the
              Rabep1 gene for rabaptin, RAB GTPase binding effector
              protein 1, a ribosomal protein 23a (Rpl23a) pseudogene, a
              ribosomal protein 23A (Rpl23a) pseudogene, the Nup88 gene
              for nucleoporin 88, four novel genes, the C1qbp gene for
              complement component 1 q subcomponent binding protein, the
              Dhx33 gene for DEAH (Asp-Glu-Ala-His) box polypeptide 33, a
               novel pseudogene, a CARD domain pseudogene and six CpG
              islands, complete sequence
          Length = 254116

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 226    aacaacaacatcaagaaaataaatag 251
              ||||||||||||||||||| ||||||
Sbjct: 171035 aacaacaacatcaagaaaaaaaatag 171010
to top
>gb|AC102106.14| Mus musculus chromosome 18, clone RP23-92B24, complete sequence
          Length = 230823

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 40     atagaaagatcaaacagacgaa 61
              ||||||||||||||||||||||
Sbjct: 227252 atagaaagatcaaacagacgaa 227273
to top
>emb|Z72787.1|SCYGR002C S.cerevisiae chromosome VII reading frame ORF YGR002c
          Length = 2324

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 221 agaggaacaacaacatcaagaa 242
           ||||||||||||||||||||||
Sbjct: 85  agaggaacaacaacatcaagaa 64
to top
>emb|Z72786.1|SCYGR001C S.cerevisiae chromosome VII reading frame ORF YGR001c
          Length = 1973

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 221  agaggaacaacaacatcaagaa 242
            ||||||||||||||||||||||
Sbjct: 1390 agaggaacaacaacatcaagaa 1369
to top
>ref|XM_713893.1| Candida albicans SC5314 hypothetical protein (CaO19_6024), mRNA
          Length = 1047

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 226 aacaacaacatcaagaaaataaata 250
           |||||||||| ||||||||||||||
Sbjct: 566 aacaacaacaacaagaaaataaata 590
to top
>ref|XM_713791.1| Candida albicans SC5314 hypothetical protein (CaO19_13445), mRNA
          Length = 1047

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 226 aacaacaacatcaagaaaataaata 250
           |||||||||| ||||||||||||||
Sbjct: 566 aacaacaacaacaagaaaataaata 590
to top
>gb|AC146297.3| Mus musculus BAC clone RP23-260F15 from chromosome 9, complete sequence
          Length = 176549

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 224    ggaacaacaacatcaagaaaataaa 248
              |||||||||||| ||||||||||||
Sbjct: 155915 ggaacaacaacaacaagaaaataaa 155891
to top
>emb|AL389915.19| Human DNA sequence from clone RP11-438P9 on chromosome 9 Contains a
             ribosomal protein S16 (RPS16) pseudogene, a peptidylprolyl
             isomerase A (cyclophilin A) (PPIA) pseudogene and a CpG
             island, complete sequence
          Length = 199601

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 267   gggtggaagcacagggtggta 287
             |||||||||||||||||||||
Sbjct: 42266 gggtggaagcacagggtggta 42246
to top
>dbj|AK136958.1| Mus musculus 12 days embryo embryonic body between diaphragm region
            and neck cDNA, RIKEN full-length enriched library,
            clone:9430012G10 product:unclassifiable, full insert
            sequence
          Length = 2457

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 224  ggaacaacaacatcaagaaaataaa 248
            |||||||||||| ||||||||||||
Sbjct: 1981 ggaacaacaacaacaagaaaataaa 1957
to top
>gb|AC006038.3| Homo sapiens BAC clone RP11-299C5 from 2, complete sequence
          Length = 184950

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 460   agaggtgaaggggggattatg 480
             |||||||||||||||||||||
Sbjct: 82712 agaggtgaaggggggattatg 82732
to top
>gb|AC026325.17| Homo sapiens 3 BAC RP11-335L9 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 162104

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 514  tatttgcttctggcaagggcc 534
            |||||||||||||||||||||
Sbjct: 3257 tatttgcttctggcaagggcc 3277
to top
>gb|AE015927.1| Clostridium tetani E88, complete genome
          Length = 2799251

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 403     gaatcaacaaaataattaacc 423
               |||||||||||||||||||||
Sbjct: 1729954 gaatcaacaaaataattaacc 1729934
to top
>gb|AC134825.5| Mus musculus BAC clone RP24-456L17 from 9, complete sequence
          Length = 173663

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 224    ggaacaacaacatcaagaaaataaa 248
              |||||||||||| ||||||||||||
Sbjct: 141660 ggaacaacaacaacaagaaaataaa 141684
to top
>dbj|AP000729.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-699D4, complete
             sequence
          Length = 160535

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 226   aacaacaacatcaagaaaataaata 250
             |||||||||||||| ||||||||||
Sbjct: 95680 aacaacaacatcaacaaaataaata 95656
to top
>ref|NM_117262.2| Arabidopsis thaliana signal transducer AT4G11920 mRNA, complete cds
          Length = 1895

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 68  ttagttacaatgctactacaagcattcc 95
           ||||||||  ||||||||||||||||||
Sbjct: 730 ttagttaccttgctactacaagcattcc 703
to top
>gb|AC159130.5| Mus musculus BAC clone RP23-401J13 from chromosome 6, complete sequence
          Length = 201901

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    aaataaataggcttggtcat 261
              ||||||||||||||||||||
Sbjct: 153161 aaataaataggcttggtcat 153180
to top
>gb|AC004763.1| Homo sapiens chromosome 5, P1 clone 854b11 (LBNL H44), complete
            sequence
          Length = 87050

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 209  ggtttggtgggaagaggaac 228
            ||||||||||||||||||||
Sbjct: 7343 ggtttggtgggaagaggaac 7324
to top
>gb|AC165090.3| Mus musculus BAC clone RP23-95H4 from chromosome 8, complete sequence
          Length = 252334

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 105   aacaggagggaacagagacaagtg 128
             ||||| ||||||||||||||||||
Sbjct: 17116 aacagaagggaacagagacaagtg 17093
to top
>gb|AC131303.8| Mus musculus chromosome 1, clone RP24-119O19, complete sequence
          Length = 187110

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 157   gctttggacaaaaacaacca 176
             ||||||||||||||||||||
Sbjct: 33871 gctttggacaaaaacaacca 33890
to top
>gb|AE009140.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 166
            of 256 of the complete sequence
          Length = 10972

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 546  atgcgcttcagcaagcggcggcattgga 573
            ||||||||||| ||||||||||| ||||
Sbjct: 2648 atgcgcttcaggaagcggcggcagtgga 2621
to top
>gb|AC109170.10| Mus musculus chromosome 8, clone RP23-87B3, complete sequence
          Length = 274518

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 105   aacaggagggaacagagacaagtg 128
             ||||| ||||||||||||||||||
Sbjct: 39884 aacagaagggaacagagacaagtg 39907
to top
>ref|XM_849271.1| PREDICTED: Canis familiaris similar to fibrous sheath interacting
           protein 2 (LOC611589), mRNA
          Length = 5133

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 218 ggaagaggaacaacaacatcaaga 241
           |||||| |||||||||||||||||
Sbjct: 654 ggaagaagaacaacaacatcaaga 677
to top
>ref|XM_390003.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09827.1)
           partial mRNA
          Length = 366

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 214 ggtgggaagaggaacaacaa 233
           ||||||||||||||||||||
Sbjct: 201 ggtgggaagaggaacaacaa 182
to top
>gb|AC123794.4| Mus musculus BAC clone RP24-315P14 from chromosome 8, complete sequence
          Length = 187246

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 105   aacaggagggaacagagacaagtg 128
             ||||| ||||||||||||||||||
Sbjct: 49189 aacagaagggaacagagacaagtg 49212
to top
>emb|AL021497.1|CEY51A2D Caenorhabditis elegans YAC Y51A2D, complete sequence
          Length = 139259

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 306   tcctcctggtaaaccatgac 325
             ||||||||||||||||||||
Sbjct: 41437 tcctcctggtaaaccatgac 41456
to top
>gb|AC123556.4| Mus musculus BAC clone RP23-176M9 from 1, complete sequence
          Length = 198900

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 157   gctttggacaaaaacaacca 176
             ||||||||||||||||||||
Sbjct: 87958 gctttggacaaaaacaacca 87939
to top
>emb|AL139123.15| Human DNA sequence from clone RP11-500G10 on chromosome 10 Contains
             three novel genes, a peptidylprolyl isomerase A
             (cyclophilin A) (PPIA) pseudogene, a meningioma expressed
             antigen 6 (MGEA6) pseudogene, a novel protein similar
             thioredoxin-like 2 (TXNL2) and four CpG islands, complete
             sequence
          Length = 209527

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   gtttggtgggaagaggaaca 229
             ||||||||||||||||||||
Sbjct: 53955 gtttggtgggaagaggaaca 53974
to top
>emb|AL034422.24|HS1141E15 Human DNA sequence from clone RP5-1141E15 on chromosome 20q11.23-12
              Contains the 5' end of GHRH gene for growth hormone
              releasing hormone, the MANBAL gene for mannosidase beta A
              lysosomal-like, the 5' end of the SRC gene for v-src avian
              sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog and a
              CpG island, complete sequence
          Length = 113681

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 229    aacaacatcaagaaaataaa 248
              ||||||||||||||||||||
Sbjct: 107401 aacaacatcaagaaaataaa 107382
to top
>gb|AY091235.1| Arabidopsis thaliana putative Srw1 protein (At4g11920) mRNA,
           complete cds
          Length = 1459

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 68  ttagttacaatgctactacaagcattcc 95
           ||||||||  ||||||||||||||||||
Sbjct: 605 ttagttaccttgctactacaagcattcc 578
to top
>gb|AY063875.1| Arabidopsis thaliana putative Srw1 protein (At4g11920) mRNA,
           complete cds
          Length = 1911

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 68  ttagttacaatgctactacaagcattcc 95
           ||||||||  ||||||||||||||||||
Sbjct: 730 ttagttaccttgctactacaagcattcc 703
to top
>emb|BX323591.13| Zebrafish DNA sequence from clone CH211-208C6 in linkage group 7 Contains
              the gene for a novel protein similar to vertebrate
              suppression of tumorigenicity 5 (ST5), a novel gene, the
              gene for a novel protein similar to vertebrate RAS-like
              estrogen-regulated growth-inhibitor (RERG) and the gene for
              a novel protein similar to vertebrate serine/threonine
              kinase 33 (STK33), complete sequence
          Length = 201768

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 223    aggaacaacaacatcaagaaaata 246
              ||||||||||||| ||||||||||
Sbjct: 138857 aggaacaacaacaacaagaaaata 138834
to top
>gb|AC090204.11| Homo sapiens chromosome 8, clone RP11-11N9, complete sequence
          Length = 173191

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 229    aacaacatcaagaaaataaa 248
              ||||||||||||||||||||
Sbjct: 147031 aacaacatcaagaaaataaa 147012
to top
>gb|AC104384.3| Homo sapiens chromosome 8, clone CTD-2381M20, complete sequence
          Length = 163996

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 220   aagaggaacaacaacatcaa 239
             ||||||||||||||||||||
Sbjct: 80065 aagaggaacaacaacatcaa 80084
to top
>dbj|AK140727.1| Mus musculus adult male corpus striatum cDNA, RIKEN full-length
            enriched library, clone:C030022J19
            product:unclassifiable, full insert sequence
          Length = 3447

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 242  aaataaataggcttggtcat 261
            ||||||||||||||||||||
Sbjct: 2634 aaataaataggcttggtcat 2653
to top
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome
          Length = 2841581

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 546     atgcgcttcagcaagcggcggcattgga 573
               ||||||||||| ||||||||||| ||||
Sbjct: 1836575 atgcgcttcaggaagcggcggcagtgga 1836548
to top
>gb|AC087808.2| Homo sapiens chromosome 8, clone RP11-89A16, complete sequence
          Length = 189878

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 220    aagaggaacaacaacatcaa 239
              ||||||||||||||||||||
Sbjct: 147758 aagaggaacaacaacatcaa 147777
to top
>gb|AC131708.3| Mus musculus BAC clone RP24-127P5 from chromosome 6, complete sequence
          Length = 185214

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   aaataaataggcttggtcat 261
             ||||||||||||||||||||
Sbjct: 93054 aaataaataggcttggtcat 93073
to top
>gb|AC093044.1| Drosophila melanogaster, chromosome 2L, region 38A-38B, BAC clone
              BACR10H13, complete sequence
          Length = 165585

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 404    aatcaacaaaataattaacc 423
              ||||||||||||||||||||
Sbjct: 139618 aatcaacaaaataattaacc 139599
to top
>ref|NM_075222.2| Caenorhabditis elegans Y51A2D.4 (Y51A2D.4) mRNA, complete cds
          Length = 2076

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 306  tcctcctggtaaaccatgac 325
            ||||||||||||||||||||
Sbjct: 1188 tcctcctggtaaaccatgac 1207
to top
>gb|DQ059035.1| Lotus corniculatus var. japonicus cell cycle switch protein CCS52A
           mRNA, complete cds
          Length = 1921

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 68  ttagttacaatgctactacaagcattcc 95
           ||||||||  ||||||||||||||||||
Sbjct: 658 ttagttaccttgctactacaagcattcc 631
to top
>emb|BX826598.1|CNS0A42I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB45ZF08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1713

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 68  ttagttacaatgctactacaagcattcc 95
           ||||||||  ||||||||||||||||||
Sbjct: 717 ttagttaccttgctactacaagcattcc 690
to top
>gb|AC153890.8| Mus musculus  BAC RP23-403C13 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 202932

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 238   aagaaaataaataggcttgg 257
             ||||||||||||||||||||
Sbjct: 38273 aagaaaataaataggcttgg 38254
to top
>emb|AL928887.13| Zebrafish DNA sequence from clone CH211-136O14 in linkage group 23,
             complete sequence
          Length = 174456

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 401   aggaatcaacaaaataatta 420
             ||||||||||||||||||||
Sbjct: 52177 aggaatcaacaaaataatta 52158
to top
>emb|AL713978.9| Mouse DNA sequence from clone RP23-159H8 on chromosome X, complete
              sequence
          Length = 183455

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 489    gaacattttgatctgggtttttgt 512
              ||||||||| ||||||||||||||
Sbjct: 151529 gaacattttaatctgggtttttgt 151506
to top
>dbj|AB023041.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPE11
          Length = 83650

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 491   acattttgatctgggttttt 510
             ||||||||||||||||||||
Sbjct: 30416 acattttgatctgggttttt 30435
to top
>gb|AC002428.1|AC002428 Human BAC clone GS1-39E22 from 5q31, complete sequence
          Length = 143875

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   ggtttggtgggaagaggaac 228
             ||||||||||||||||||||
Sbjct: 67497 ggtttggtgggaagaggaac 67478
to top
>gb|AE003665.4| Drosophila melanogaster chromosome 2L, section 74 of 83 of the complete
              sequence
          Length = 157875

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 404    aatcaacaaaataattaacc 423
              ||||||||||||||||||||
Sbjct: 114949 aatcaacaaaataattaacc 114930
to top
>emb|AL935155.13| Mouse DNA sequence from clone RP23-334M3 on chromosome 2, complete
             sequence
          Length = 123205

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 290   tacaggtgctctcttgtcctcctg 313
             |||||||||||||||| |||||||
Sbjct: 21496 tacaggtgctctcttgccctcctg 21519
to top
>dbj|AB007546.1| Homo sapiens gene for LECT2, complete cds
          Length = 11134

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 209  ggtttggtgggaagaggaac 228
            ||||||||||||||||||||
Sbjct: 4745 ggtttggtgggaagaggaac 4726
to top
>gb|AC004364.1|AC004364 Drosophila melanogaster DNA sequence (P1 DS00863 (D58)), complete
             sequence
          Length = 78857

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 404   aatcaacaaaataattaacc 423
             ||||||||||||||||||||
Sbjct: 70651 aatcaacaaaataattaacc 70632
to top
>emb|AL808118.8| Mouse DNA sequence from clone RP23-287O8 on chromosome 4, complete
             sequence
          Length = 164068

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 232   aacatcaagaaaataaataggctt 255
             ||||| ||||||||||||||||||
Sbjct: 96805 aacatgaagaaaataaataggctt 96782
to top
>emb|AL808128.4| Mouse DNA sequence from clone RP23-387C21 on chromosome 2, complete
              sequence
          Length = 184736

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 408    aacaaaataattaacctgtg 427
              ||||||||||||||||||||
Sbjct: 132483 aacaaaataattaacctgtg 132464
to top
>emb|AL669981.11| Mouse DNA sequence from clone RP23-335B9 on chromosome 4, complete
              sequence
          Length = 222981

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 238    aagaaaataaataggcttgg 257
              ||||||||||||||||||||
Sbjct: 130189 aagaaaataaataggcttgg 130208
to top
>emb|AL731805.8| Mouse DNA sequence from clone RP23-358E19 on chromosome 11, complete
             sequence
          Length = 111002

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 507   ttttgtctatttgcttctggcaag 530
             |||||||||||||||| |||||||
Sbjct: 81248 ttttgtctatttgcttgtggcaag 81271


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,148,905
Number of Sequences: 3902068
Number of extensions: 6148905
Number of successful extensions: 119503
Number of sequences better than 10.0: 56
Number of HSP's better than 10.0 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 119367
Number of HSP's gapped (non-prelim): 136
length of query: 574
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 551
effective length of database: 17,143,297,704
effective search space: 9445957034904
effective search space used: 9445957034904
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top