| Clone Name | rbags33n04 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ606031.1| Triticum aestivum partial mRNA for putative pyridine nucleotide-disulphide oxidoreductase Length = 723 Score = 765 bits (386), Expect = 0.0 Identities = 502/538 (93%), Gaps = 11/538 (2%) Strand = Plus / Minus Query: 81 gcacatcaccaacaattactcgcacagagaacaacgcatgacgatacaacacatatgtgc 140 |||||||||||||||||||||||||| |||||| ||| |||||||||||||||| Sbjct: 714 gcacatcaccaacaattactcgcacacagaaca---catag---tacaacacatatgtgc 661 Query: 141 agccagccagaggtttatttgttttgcctggagatgggccggctcaagcattcaggccca 200 ||||||||| |||||||||| ||||| ||| |||| ||||||||||| ||||||||| Sbjct: 660 agccagccataggtttatttcttttgtctgaagat----cggctcaagcactcaggccca 605 Query: 201 tctgcttcctcgtcttgccgacgaacaggtccttggatttgagcatccccggtatgcacc 260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 604 tctgcttcctcgtcttgccgacgaacaggtccttggatttgagcatccccggtatgcacc 545 Query: 261 cggtgagcgtcaggtagggcagctgcgccagcccttccttccttcccagggagacgatcg 320 ||||||||||||||||||| ||||| ||||| || ||||||||||| ||||||||||||| Sbjct: 544 cggtgagcgtcaggtagggtagctgtgccagtccgtccttccttccgagggagacgatcg 485 Query: 321 ccagcgggaacccggtgctgtaggtggcgagcttgctcggaggcgaccccttgatcagta 380 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 484 ccagcgggaagccggtgctgtaggtggcgagcttgctcggaggcgaccccttgatcagta 425 Query: 381 gcttcaggttcttcgctaccagcagcgcgtgcttctgggcgaggtacccttgtttgaant 440 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | | Sbjct: 424 gcttcaggttcttggctaccagcagcgcgtgcttctgggcgaggtacccttgtttg-att 366 Query: 441 tcaggaatatctgtgatgtcaccgattgcaaaaatgttatcgtgacccttcactctcaag 500 ||||||||||| ||||||||||| |||||||||||||||| || |||||||||||| | | Sbjct: 365 tcaggaatatcggtgatgtcaccaattgcaaaaatgttattgtaacccttcactcttagg 306 Query: 501 tccttctccaccattactcttcccttggtgtccaaagattccttcaggatggtatcatgt 560 ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 305 tccttttccaccattactcttcctttggtgtccaaagattccttcaggatggtatcatgt 246 Query: 561 agccacgatgaactcagtggcttgccaatacacacaaagtggcaatcagctgttattg 618 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 245 agccacgatgaactcagtggcttaccaatacacacaaagtggcaatcagctgttattg 188
>gb|BT009021.1| Triticum aestivum clone wdk3c.pk007.j3:fis, full insert mRNA sequence Length = 1349 Score = 745 bits (376), Expect = 0.0 Identities = 538/590 (91%), Gaps = 13/590 (2%) Strand = Plus / Minus Query: 33 cgtacatgtacattcacacttctgttaaaatgttcatcaccattctcggcacatcaccaa 92 |||||||||||||| |||||| ||||||||||||||||||||||| | |||||||||||| Sbjct: 1279 cgtacatgtacatttacacttttgttaaaatgttcatcaccattcgcagcacatcaccaa 1220 Query: 93 caattactcgcacagagaa----caacgcatgacgatacaacacatatgtgcagccagcc 148 || ||||||||||| | || ||| || ||| |||||||||||||||||||||| Sbjct: 1219 catttactcgcacatacaaaacacaagacaagacaatacaacacatatgtgcagccac-- 1162 Query: 149 agaggtttatttgttttgcctggagatgggccggctcaagcattcaggcccatctgcttc 208 | ||||||||||| || |||||||| ||||||||||||| ||||||||||||||| Sbjct: 1161 --atgtttatttgttctgtctggagat----cggctcaagcatttaggcccatctgcttc 1108 Query: 209 ctcgtcttgccgacgaacaggtccttggatttgagcatccccggtatgcacccggtgagc 268 |||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 1107 ctcgtcttgccgacaaacaggtccttggatttgagcatccctggtatgcacccggtgagc 1048 Query: 269 gtcaggtagggcagctgcgccagcccttccttccttcccagggagacgatcgccagcggg 328 |||||||| || ||||| |||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1047 gtcaggtacggtagctgagccagcccttccttccttccgagggagacgatcgccagcggg 988 Query: 329 aacccggtgctgtaggtggcgagcttgctcggaggcgaccccttgatcagtagcttcagg 388 || |||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||| Sbjct: 987 aagccggtgatgtaggtggcgagcttgctcggaggcgcccccttgatcagcagcttcagg 928 Query: 389 ttcttcgctaccagcagcgcgtgcttctgggcgaggtacccttgtttgaanttcaggaat 448 ||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||| Sbjct: 927 ttcttggctaccagcagcgcgtgcttctgggcgaggtacccttgtttg-atttcaggaat 869 Query: 449 atctgtgatgtcaccgattgcaaaaatgttatcgtgacccttcactctcaagtccttctc 508 ||| ||||||||||| |||||||||||||||| || |||||||||||||| |||||| || Sbjct: 868 atcagtgatgtcaccaattgcaaaaatgttattgtaacccttcactctcaggtccttttc 809 Query: 509 caccattactcttcccttggtgtccaaagattccttcaggatggtatcatgtagccacga 568 |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 808 caccattattcttcctttggtgtccaaagattccttcaggatggtatcatgtagccacga 749 Query: 569 tgaactcagtggcttgccaatacacacaaagtggcaatcagctgttattg 618 ||||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 748 tgaactcagtggcttaccgatacacacaaagtggcaatcagctgtaattg 699
>gb|AY107334.1| Zea mays PCO062090 mRNA sequence Length = 1457 Score = 383 bits (193), Expect = e-103 Identities = 373/432 (86%), Gaps = 1/432 (0%) Strand = Plus / Minus Query: 184 tcaagcattcaggcccatctgcttcctcgtcttgccgacgaacaggtccttggatttgag 243 |||| |||||||||||||||||||||||||||||| |||||| || ||| |||||||| Sbjct: 1100 tcaaccattcaggcccatctgcttcctcgtcttgctgacgaatagatccccggatttgat 1041 Query: 244 catccccggtatgcacccggtgagcgtcaggtagggcagctgcgccagcccttccttcct 303 ||| || || | ||||||| |||||||||| | || | ||| ||||||||||||||||| Sbjct: 1040 catgcctggcaagcacccgctgagcgtcagcaatggaaactgagccagcccttccttcct 981 Query: 304 tcccagggagacgatcgccagcgggaacccggtgctgtaggtggcgagcttgctcggagg 363 ||| || ||||||| ||||||||| | ||||||||||| || || || ||||| ||| Sbjct: 980 tccaagagagacgagcgccagcggatagccggtgctgtaagtcgccagtttgctgttagg 921 Query: 364 cgaccccttgatcagtagcttcaggttcttcgctaccagcagcgcgtgcttctgggcgag 423 |||||| |||||||||||||||||||||| || ||||||||||||||||||||||| Sbjct: 920 gagacccttggtcagtagcttcaggttcttcgccactagcagcgcgtgcttctgggcgag 861 Query: 424 gtacccttgtttgaanttcaggaatatctgtgatgtcaccgattgcaaaaatgttatcgt 483 |||||||||||||| |||||||||||||||||||||||| || ||||||||||||| Sbjct: 860 gtacccttgtttga-tttcaggaatatctgtgatgtcaccaatcgcaaaaatgttattaa 802 Query: 484 gacccttcactctcaagtccttctccaccattactcttcccttggtgtccaaagattcct 543 ||| |||||||| || ||||| |||||||||||||| |||||| | ||||| ||||||| Sbjct: 801 aacctttcactcttaaatccttttccaccattactctccccttgctatccaaggattcct 742 Query: 544 tcaggatggtatcatgtagccacgatgaactcagtggcttgccaatacacacaaagtggc 603 | ||||||||||||||||||||||| |||||||||||||| ||||| || |||||||||| Sbjct: 741 ttaggatggtatcatgtagccacgacgaactcagtggctttccaatgcatacaaagtggc 682 Query: 604 aatcagctgtta 615 |||||||||||| Sbjct: 681 aatcagctgtta 670
>dbj|AK120153.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013029P18, full insert sequence Length = 2277 Score = 216 bits (109), Expect = 7e-53 Identities = 199/228 (87%), Gaps = 1/228 (0%) Strand = Plus / Minus Query: 388 gttcttcgctaccagcagcgcgtgcttctgggcgaggtacccttgtttgaanttcaggaa 447 |||||| ||||| ||||| || ||||| ||||| ||||| ||||| || || |||||||| Sbjct: 1896 gttctttgctactagcagagcatgcttatgggcaaggtaaccttgctt-aatttcaggaa 1838 Query: 448 tatctgtgatgtcaccgattgcaaaaatgttatcgtgacccttcactctcaagtccttct 507 |||||||||||||||| |||||||||||||||| | ||| || | ||| || ||||| | Sbjct: 1837 tatctgtgatgtcaccaattgcaaaaatgttattataaccttttattcttaaatcctttt 1778 Query: 508 ccaccattactcttcccttggtgtccaaagattccttcaggatggtatcatgtagccacg 567 ||||||||| |||||||||| ||||||| |||||||| || ||||||||||||||||| | Sbjct: 1777 ccaccattagtcttcccttgttgtccaaggattcctttagaatggtatcatgtagccatg 1718 Query: 568 atgaactcagtggcttgccaatacacacaaagtggcaatcagctgtta 615 ||||||| |||||||| || |||||||||||||||||||||||||||| Sbjct: 1717 atgaactgagtggcttaccgatacacacaaagtggcaatcagctgtta 1670
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 194 bits (98), Expect = 2e-46 Identities = 155/174 (89%) Strand = Plus / Minus Query: 442 caggaatatctgtgatgtcaccgattgcaaaaatgttatcgtgacccttcactctcaagt 501 |||||||||||||||||||||| |||||||||||||||| | ||| || | ||| || | Sbjct: 2778367 caggaatatctgtgatgtcaccaattgcaaaaatgttattataaccttttattcttaaat 2778308 Query: 502 ccttctccaccattactcttcccttggtgtccaaagattccttcaggatggtatcatgta 561 |||| |||||||||| |||||||||| ||||||| |||||||| || ||||||||||||| Sbjct: 2778307 ccttttccaccattagtcttcccttgttgtccaaggattcctttagaatggtatcatgta 2778248 Query: 562 gccacgatgaactcagtggcttgccaatacacacaaagtggcaatcagctgtta 615 |||| |||||||| |||||||| || |||||||||||||||||||||||||||| Sbjct: 2778247 gccatgatgaactgagtggcttaccgatacacacaaagtggcaatcagctgtta 2778194
>dbj|AP005412.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0050G13 Length = 150685 Score = 194 bits (98), Expect = 2e-46 Identities = 155/174 (89%) Strand = Plus / Minus Query: 442 caggaatatctgtgatgtcaccgattgcaaaaatgttatcgtgacccttcactctcaagt 501 |||||||||||||||||||||| |||||||||||||||| | ||| || | ||| || | Sbjct: 46595 caggaatatctgtgatgtcaccaattgcaaaaatgttattataaccttttattcttaaat 46536 Query: 502 ccttctccaccattactcttcccttggtgtccaaagattccttcaggatggtatcatgta 561 |||| |||||||||| |||||||||| ||||||| |||||||| || ||||||||||||| Sbjct: 46535 ccttttccaccattagtcttcccttgttgtccaaggattcctttagaatggtatcatgta 46476 Query: 562 gccacgatgaactcagtggcttgccaatacacacaaagtggcaatcagctgtta 615 |||| |||||||| |||||||| || |||||||||||||||||||||||||||| Sbjct: 46475 gccatgatgaactgagtggcttaccgatacacacaaagtggcaatcagctgtta 46422
>ref|NM_114287.2| Arabidopsis thaliana disulfide oxidoreductase/ electron carrier/ oxidoreductase AT3G44190 mRNA, complete cds Length = 1517 Score = 44.1 bits (22), Expect = 0.54 Identities = 34/38 (89%) Strand = Plus / Minus Query: 205 cttcctcgtcttgccgacgaacaggtccttggatttga 242 |||||||||||| ||||| ||||| ||||| ||||||| Sbjct: 1274 cttcctcgtcttcccgacaaacagatccttagatttga 1237
>gb|AC148001.6| Mus musculus BAC clone RP24-82P9 from chromosome 18, complete sequence Length = 181022 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Minus Query: 158 tttgttttgcctggagatgggc 179 |||||||||||||||||||||| Sbjct: 129624 tttgttttgcctggagatgggc 129603
>ref|XM_422763.1| PREDICTED: Gallus gallus similar to SUMO1/sentrin specific protease 5 (LOC424955), mRNA Length = 3015 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Plus Query: 35 tacatgtacattcacacttctg 56 |||||||||||||||||||||| Sbjct: 1804 tacatgtacattcacacttctg 1825
>emb|AL353814.1|ATF26G5 Arabidopsis thaliana DNA chromosome 3, BAC clone F26G5 Length = 102873 Score = 44.1 bits (22), Expect = 0.54 Identities = 34/38 (89%) Strand = Plus / Plus Query: 205 cttcctcgtcttgccgacgaacaggtccttggatttga 242 |||||||||||| ||||| ||||| ||||| ||||||| Sbjct: 83341 cttcctcgtcttcccgacaaacagatccttagatttga 83378
>gb|BT008451.1| Arabidopsis thaliana At3g44190 gene, complete cds Length = 1104 Score = 44.1 bits (22), Expect = 0.54 Identities = 34/38 (89%) Strand = Plus / Minus Query: 205 cttcctcgtcttgccgacgaacaggtccttggatttga 242 |||||||||||| ||||| ||||| ||||| ||||||| Sbjct: 1068 cttcctcgtcttcccgacaaacagatccttagatttga 1031
>emb|BX823155.1|CNS0A7AM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB93ZH08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1316 Score = 44.1 bits (22), Expect = 0.54 Identities = 34/38 (89%) Strand = Plus / Minus Query: 205 cttcctcgtcttgccgacgaacaggtccttggatttga 242 |||||||||||| ||||| ||||| ||||| ||||||| Sbjct: 1103 cttcctcgtcttcccgacaaacagatccttagatttga 1066
>emb|BX823570.1|CNS0A6LH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS51ZG01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1359 Score = 44.1 bits (22), Expect = 0.54 Identities = 34/38 (89%) Strand = Plus / Minus Query: 205 cttcctcgtcttgccgacgaacaggtccttggatttga 242 |||||||||||| ||||| ||||| ||||| ||||||| Sbjct: 1136 cttcctcgtcttcccgacaaacagatccttagatttga 1099
>gb|AY084651.1| Arabidopsis thaliana clone 114123 mRNA, complete sequence Length = 1505 Score = 44.1 bits (22), Expect = 0.54 Identities = 34/38 (89%) Strand = Plus / Minus Query: 205 cttcctcgtcttgccgacgaacaggtccttggatttga 242 |||||||||||| ||||| ||||| ||||| ||||||| Sbjct: 1274 cttcctcgtcttcccgacaaacagatccttagatttga 1237
>gb|BT002026.1| Arabidopsis thaliana putative protein (At3g44190) mRNA, complete cds Length = 1423 Score = 44.1 bits (22), Expect = 0.54 Identities = 34/38 (89%) Strand = Plus / Minus Query: 205 cttcctcgtcttgccgacgaacaggtccttggatttga 242 |||||||||||| ||||| ||||| ||||| ||||||| Sbjct: 1164 cttcctcgtcttcccgacaaacagatccttagatttga 1127
>gb|AC107663.10| Mus musculus chromosome 13, clone RP23-99G9, complete sequence Length = 213163 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 gctgcgccagcccttccttccttcc 306 ||||| ||||||||||||||||||| Sbjct: 93611 gctgccccagcccttccttccttcc 93635
>gb|AC153139.5| Mus musculus BAC clone RP23-411M4 from chromosome 13, complete sequence Length = 192541 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 282 gctgcgccagcccttccttccttcc 306 ||||| ||||||||||||||||||| Sbjct: 161962 gctgccccagcccttccttccttcc 161986
>gb|AC064856.5| Homo sapiens BAC clone RP11-264N11 from 2, complete sequence Length = 107706 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 228 ggtccttggatttgagcatcc 248 ||||||||||||||||||||| Sbjct: 4867 ggtccttggatttgagcatcc 4847
>gb|AC160651.2| Pan troglodytes BAC clone CH251-489P13 from chromosome unknown, complete sequence Length = 209305 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 228 ggtccttggatttgagcatcc 248 ||||||||||||||||||||| Sbjct: 12506 ggtccttggatttgagcatcc 12486
>ref|NM_116172.3| Arabidopsis thaliana unknown protein AT3G63070 mRNA, complete cds Length = 4429 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 aaatgttcatcaccattctc 79 |||||||||||||||||||| Sbjct: 1525 aaatgttcatcaccattctc 1506
>gb|AC158304.11| Mus musculus chromosome 7, clone RP24-192F23, complete sequence Length = 166451 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 296 tccttccttcccagggagac 315 |||||||||||||||||||| Sbjct: 111676 tccttccttcccagggagac 111695
>gb|AC158787.14| Mus musculus chromosome 15, clone RP23-136G8, complete sequence Length = 203772 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 tcaggcccatctgcttcctc 211 |||||||||||||||||||| Sbjct: 182713 tcaggcccatctgcttcctc 182694
>ref|XM_715689.1| Candida albicans SC5314 hypothetical protein (CaO19_11825), mRNA Length = 3813 Score = 40.1 bits (20), Expect = 8.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 430 ttgtttgaanttcaggaatatct 452 ||||||||| ||||||||||||| Sbjct: 2283 ttgtttgaatttcaggaatatct 2261
>ref|XM_715560.1| Candida albicans SC5314 hypothetical protein (CaO19_4348), mRNA Length = 3813 Score = 40.1 bits (20), Expect = 8.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 430 ttgtttgaanttcaggaatatct 452 ||||||||| ||||||||||||| Sbjct: 2283 ttgtttgaatttcaggaatatct 2261
>ref|XM_659299.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6787.2), mRNA Length = 1761 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 269 gtcaggtagggcagctgcgccagc 292 |||||||||||||||||| ||||| Sbjct: 1175 gtcaggtagggcagctgctccagc 1152
>gb|AC125531.3| Mus musculus BAC clone RP23-396D12 from chromosome 10, complete sequence Length = 219818 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 578 tggcttgccaatacacacaa 597 |||||||||||||||||||| Sbjct: 113510 tggcttgccaatacacacaa 113529
>gb|AC140359.2| Mus musculus BAC clone RP24-240P8 from chromosome 5, complete sequence Length = 167021 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tgcgtacatgtacattcaca 50 |||||||||||||||||||| Sbjct: 74880 tgcgtacatgtacattcaca 74899
>gb|AC122045.3| Mus musculus BAC clone RP24-449H18 from 5, complete sequence Length = 142673 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tgcgtacatgtacattcaca 50 |||||||||||||||||||| Sbjct: 96839 tgcgtacatgtacattcaca 96858
>gb|AC166568.2| Spironucleus vortens clone JGIBAWF-9N8, complete sequence Length = 38345 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 406 cgcgtgcttctgggcgaggt 425 |||||||||||||||||||| Sbjct: 35606 cgcgtgcttctgggcgaggt 35587
>gb|AC166575.1| Mus musculus BAC clone RP23-99E16 from chromosome 17, complete sequence Length = 200353 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gccagcccttccttccttcc 306 |||||||||||||||||||| Sbjct: 41557 gccagcccttccttccttcc 41576
>emb|AL139328.8| Human DNA sequence from clone RP11-84N7 on chromosome 13 Contains part of the DGKH gene for diacylglycerol kinase eta, complete sequence Length = 148430 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 agcccttccttccttcccag 309 |||||||||||||||||||| Sbjct: 73093 agcccttccttccttcccag 73074
>emb|AL020995.14|HS117O3 Human DNA sequence from clone RP1-117O3 on chromosome 1p33-34.3 Contains the 3' end of a novel gene, the AK2 gene for adenylate kinase 2, the gene for ornithine decarboxylase-like (ODC-p) and a CpG island, complete sequence Length = 150997 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gccagcccttccttccttcc 306 |||||||||||||||||||| Sbjct: 145628 gccagcccttccttccttcc 145647
>gb|AC074336.14| Mus musculus Strain C57BL6/J chromosome 1 BAC, RP23-366C17, Complete Sequence, complete sequence Length = 217768 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 294 cttccttccttcccagggag 313 |||||||||||||||||||| Sbjct: 149455 cttccttccttcccagggag 149474
>emb|Z11595.1|EBHCOMPMR Eptatretus burgeri partial mRNA for hagfish complement Length = 4902 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 492 actctcaagtccttctccac 511 |||||||||||||||||||| Sbjct: 2681 actctcaagtccttctccac 2662
>emb|AL022018.1|DMC8D8 Drosophila melanogaster cosmid clone 8D8 Length = 38397 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 279 gcagctgcgccagcccttccttcc 302 |||||||||||||||| ||||||| Sbjct: 26291 gcagctgcgccagcccatccttcc 26268
>gb|AC090881.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, RP23-465G4, Complete Sequence, complete sequence Length = 167475 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 gccagcccttccttccttcc 306 |||||||||||||||||||| Sbjct: 15373 gccagcccttccttccttcc 15354
>gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 181360 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 279 gcagctgcgccagcccttccttcc 302 |||||||||||||||| ||||||| Sbjct: 22682 gcagctgcgccagcccatccttcc 22659
>gb|AY119282.1| Drosophila melanogaster SD27341 full insert cDNA Length = 2338 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 279 gcagctgcgccagcccttccttcc 302 |||||||||||||||| ||||||| Sbjct: 1245 gcagctgcgccagcccatccttcc 1268
>ref|NM_206602.1| Drosophila melanogaster CG11418-RB, transcript variant B (CG11418), mRNA Length = 1372 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 279 gcagctgcgccagcccttccttcc 302 |||||||||||||||| ||||||| Sbjct: 300 gcagctgcgccagcccatccttcc 323
>ref|NM_130548.2| Drosophila melanogaster CG11418-RA, transcript variant A (CG11418), mRNA Length = 2317 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 279 gcagctgcgccagcccttccttcc 302 |||||||||||||||| ||||||| Sbjct: 1245 gcagctgcgccagcccatccttcc 1268
>gb|AC106822.3| Homo sapiens chromosome 5 clone RP11-772C9, complete sequence Length = 115988 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 292 cccttccttccttcccaggg 311 |||||||||||||||||||| Sbjct: 105831 cccttccttccttcccaggg 105812
>gb|AC104288.4| Drosophila melanogaster X BAC RP98-30G24 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 164252 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 279 gcagctgcgccagcccttccttcc 302 |||||||||||||||| ||||||| Sbjct: 82197 gcagctgcgccagcccatccttcc 82174
>gb|AC015468.5|AC015468 Homo sapiens chromosome 8, clone RP11-369E15, complete sequence Length = 189662 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 ccagcccttccttccttccc 307 |||||||||||||||||||| Sbjct: 111608 ccagcccttccttccttccc 111627
>gb|AC019181.4| Homo sapiens BAC clone RP11-272E3 from 2, complete sequence Length = 190998 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 454 tgatgtcaccgattgcaaaa 473 |||||||||||||||||||| Sbjct: 82239 tgatgtcaccgattgcaaaa 82258
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 402 gcagcgcgtgcttctgggcgaggt 425 ||||||||||||||||| |||||| Sbjct: 127601 gcagcgcgtgcttctggacgaggt 127624
>gb|AC007385.3| Homo sapiens BAC clone RP11-325M10 from 2, complete sequence Length = 188062 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 gtttatttgttttgcctgga 172 |||||||||||||||||||| Sbjct: 5166 gtttatttgttttgcctgga 5147
>gb|AC006142.1|AC006142 Homo sapiens PAC clone RP4-572A3, complete sequence Length = 143623 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 292 cccttccttccttcccaggg 311 |||||||||||||||||||| Sbjct: 58827 cccttccttccttcccaggg 58808
>gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 of 74 of the complete sequence Length = 308311 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 279 gcagctgcgccagcccttccttcc 302 |||||||||||||||| ||||||| Sbjct: 193517 gcagctgcgccagcccatccttcc 193494
>emb|CT030030.12| Mouse DNA sequence from clone RP23-123J19 on chromosome 12, complete sequence Length = 201738 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 506 ctccaccattactcttcccttggt 529 |||| ||||||||||||||||||| Sbjct: 81483 ctcccccattactcttcccttggt 81460
>gb|AC134554.6| Mus musculus BAC clone RP24-313F7 from chromosome 15, complete sequence Length = 148029 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 tcaggcccatctgcttcctc 211 |||||||||||||||||||| Sbjct: 93666 tcaggcccatctgcttcctc 93647
>gb|AC005291.1|AC005291 Homo sapiens chromosome 17, clone hRPK.401_O_9, complete sequence Length = 198582 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 288 ccagcccttccttccttcccaggg 311 |||||||||| ||||||||||||| Sbjct: 148254 ccagcccttctttccttcccaggg 148231
>emb|AL163816.1|ATT20O10 Arabidopsis thaliana DNA chromosome 3, BAC clone T20O10 Length = 83122 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 aaatgttcatcaccattctc 79 |||||||||||||||||||| Sbjct: 48056 aaatgttcatcaccattctc 48037
>gb|AC129777.4| Mus musculus BAC clone RP23-281H23 from 8, complete sequence Length = 228174 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gccagcccttccttccttcc 306 |||||||||||||||||||| Sbjct: 32454 gccagcccttccttccttcc 32473 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,045,851 Number of Sequences: 3902068 Number of extensions: 6045851 Number of successful extensions: 598258 Number of sequences better than 10.0: 53 Number of HSP's better than 10.0 without gapping: 53 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 597724 Number of HSP's gapped (non-prelim): 524 length of query: 619 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 596 effective length of database: 17,143,297,704 effective search space: 10217405431584 effective search space used: 10217405431584 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)