Clone Information

BLAST Search Result

Clone Name	rbags34b03
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	ref\|XM_479419.1\| Oryza sativa (japonica cultivar-group), mRNA	172	1e-39
2	dbj\|AK107041.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	172	1e-39
3	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	129	1e-26
4	dbj\|AP005452.5\| Oryza sativa (japonica cultivar-group) genomic D...	129	1e-26
5	gb\|BT014111.1\| Lycopersicon esculentum clone 133215F, mRNA sequence	107	5e-20
6	gb\|AY104327.1\| Zea mays PCO078604 mRNA sequence	107	5e-20
7	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	84	7e-13
8	gb\|AC135257.1\| Genomic sequence for Oryza sativa, Nipponbare str...	84	7e-13
9	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	84	7e-13
10	dbj\|AK069305.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	84	7e-13
11	dbj\|AK059432.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	84	7e-13
12	gb\|AC136284.1\| Genomic sequence for Oryza sativa, Nipponbare str...	84	7e-13
13	gb\|AY106286.1\| Zea mays PCO078601 mRNA sequence	80	1e-11
14	ref\|NM_104489.2\| Arabidopsis thaliana NOP56 AT1G56110 (NOP56) mR...	76	2e-10
15	gb\|AC009894.2\| Arabidopsis thaliana chromosome I BAC T6H22 genom...	76	2e-10
16	gb\|AY102151.1\| Arabidopsis thaliana At1g56110/T6H22_9 mRNA, comp...	76	2e-10
17	gb\|AY052337.1\| Arabidopsis thaliana At1g56110/T6H22_9 mRNA sequence	76	2e-10
18	gb\|AY039541.1\| Arabidopsis thaliana At1g56110/T6H22_9 mRNA, comp...	76	2e-10
19	gb\|AF302492.1\|AF302492 Arabidopsis thaliana NOP56-like protein m...	76	2e-10
20	gb\|AY087080.1\| Arabidopsis thaliana clone 31447 mRNA, complete s...	76	2e-10
21	gb\|AC135505.15\| Medicago truncatula clone mth2-24j8, complete se...	74	7e-10
22	gb\|AY553910.1\| Brassica juncea putative preRNA processing ribonu...	58	4e-05
23	dbj\|AK116079.1\| Ciona intestinalis cDNA, clone:citb007m06, full ...	56	2e-04
24	gb\|AC138199.22\| Medicago truncatula clone mth2-15g10, complete s...	50	0.010
25	ref\|NM_112122.2\| Arabidopsis thaliana unknown protein AT3G12860 ...	48	0.039
26	ref\|XM_449423.1\| Candida glabrata CBS138 hypothetical protein (C...	48	0.039
27	emb\|CR380959.1\| Candida glabrata strain CBS138 chromosome M comp...	48	0.039
28	ref\|NM_213223.1\| Danio rerio zgc:85717 (zgc:85717), mRNA	46	0.16
29	gb\|CP000010.1\| Burkholderia mallei ATCC 23344 chromosome 1, comp...	46	0.16
30	ref\|XM_418351.1\| PREDICTED: Gallus gallus similar to LYRIC (LOC4...	46	0.16
31	gb\|BC067590.1\| Danio rerio zgc:85717, mRNA (cDNA clone MGC:85717...	46	0.16
32	ref\|XM_954128.1\| Neurospora crassa OR74A hypothetical protein (N...	46	0.16
33	ref\|XM_327159.1\| Neurospora crassa OR74A hypothetical protein (N...	46	0.16
34	gb\|CP000124.1\| Burkholderia pseudomallei 1710b chromosome I, com...	46	0.16
35	ref\|XM_800517.1\| Trypanosoma cruzi strain CL Brener nucleolar pr...	46	0.16
36	ref\|XM_789685.1\| PREDICTED: Strongylocentrotus purpuratus simila...	46	0.16
37	ref\|XM_783146.1\| PREDICTED: Strongylocentrotus purpuratus simila...	46	0.16
38	emb\|X83872.1\|HVDNACREB H.vulgaris mRNA for cAMP response element...	46	0.16
39	emb\|BX571965.1\| Burkholderia pseudomallei strain K96243, chromos...	46	0.16
40	emb\|CR376754.6\| Zebrafish DNA sequence from clone CH211-254O14 i...	46	0.16
41	emb\|BX957352.9\| Zebrafish DNA sequence from clone CH211-114O15 i...	46	0.16
42	emb\|CR381694.8\| Zebrafish DNA sequence from clone CH211-55I2 in ...	46	0.16
43	gb\|AY680460.1\| Macaca mulatta clone ds1_j02_t7_068 succinate deh...	46	0.16
44	ref\|XM_683055.1\| PREDICTED: Danio rerio similar to myristoylated...	46	0.16
45	emb\|BX000467.10\| Zebrafish DNA sequence from clone CH211-1K7 in ...	46	0.16
46	gb\|CP000109.1\| Thiomicrospira crunogena XCL-2, complete genome	44	0.62
47	ref\|XM_476021.1\| Oryza sativa (japonica cultivar-group), predic...	44	0.62
48	ref\|NM_212675.1\| Danio rerio eukaryotic translation initiation f...	44	0.62
49	ref\|XM_479549.1\| Oryza sativa (japonica cultivar-group), mRNA	44	0.62
50	gb\|BC106256.1\| Xenopus laevis cDNA clone MGC:130708 IMAGE:797958...	44	0.62
51	ref\|XM_361116.1\| Magnaporthe grisea 70-15 hypothetical protein (...	44	0.62
52	gb\|BC071085.1\| Xenopus laevis cDNA clone IMAGE:6631258, partial cds	44	0.62
53	gb\|AC130728.2\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.62
54	gb\|AC148920.1\| Mus musculus BAC clone RP23-273O10 from chromosom...	44	0.62
55	ref\|XM_658363.1\| Aspergillus nidulans FGSC A4 hypothetical prote...	44	0.62
56	ref\|XM_534598.2\| PREDICTED: Canis familiaris similar to Nuclear ...	44	0.62
57	ref\|XM_533935.2\| PREDICTED: Canis familiaris similar to Transcri...	44	0.62
58	ref\|XM_847563.1\| PREDICTED: Canis familiaris similar to lung can...	44	0.62
59	ref\|XM_387134.1\| Gibberella zeae PH-1 chromosome 4 hypothetical ...	44	0.62
60	emb\|BX629346.17\| Zebrafish DNA sequence from clone DKEY-16N21 in...	44	0.62
61	ref\|XM_792617.1\| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.62
62	emb\|BX050957.1\|CNS09BHD Single read from an extremity of a full-...	44	0.62
63	emb\|BX021535.1\|CNS08OS3 Single read from an extremity of a full-...	44	0.62
64	emb\|BX276106.6\| Zebrafish DNA sequence from clone DKEY-1N18 in l...	44	0.62
65	emb\|AL929183.14\| Zebrafish DNA sequence from clone CH211-142M8 i...	44	0.62
66	gb\|BC066706.1\| Danio rerio eukaryotic translation initiation fac...	44	0.62
67	gb\|AC153131.5\| Mus musculus BAC clone RP24-356O12 from chromosom...	44	0.62
68	ref\|XM_692813.1\| PREDICTED: Danio rerio similar to Eukaryotic tr...	44	0.62
69	ref\|XM_625921.1\| Cryptosporidium parvum Iowa II hypothetical pro...	44	0.62
70	gb\|BC097508.1\| Xenopus laevis cDNA clone IMAGE:5048572, partial cds	44	0.62
71	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.62
72	gb\|AY737016.1\| Oreochromis mossambicus clone Contig11 XNop56 mRN...	44	0.62
73	gb\|AC084533.1\|CBRG22N08 Caenorhabditis briggsae cosmid G22N08, c...	44	0.62
74	dbj\|AP005099.2\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.62
75	emb\|AJ277097.1\|HVU277097 Hordeum vulgare mRNA for putative kinet...	44	0.62
76	dbj\|AK099632.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.62
77	dbj\|AK073484.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.62
78	dbj\|AK066982.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.62
79	gb\|AC154719.2\| Mus musculus BAC clone RP24-370O15 from 16, compl...	44	0.62
80	dbj\|AK059026.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.62
81	gb\|AY103698.1\| Zea mays PCO083605 mRNA sequence	44	0.62
82	emb\|AL837525.5\| Mouse DNA sequence from clone RP23-233N12 on chr...	44	0.62
83	gb\|AC166253.18\| Mus musculus BAC RP23-231M6 (Roswell Park Cance...	42	2.4
84	gb\|BC087358.1\| Xenopus laevis cDNA clone IMAGE:7205191	42	2.4
85	gb\|AC161382.4\| Mus musculus BAC clone RP23-25A17 from chromosome...	42	2.4
86	gb\|AC163390.2\| Mus musculus chromosome 1, clone RP24-300C19, com...	42	2.4
87	gb\|BC082559.1\| Mus musculus mediator of RNA polymerase II transc...	42	2.4
88	gb\|BC044302.1\| Mus musculus mediator of RNA polymerase II transc...	42	2.4
89	gb\|BC044207.1\| Mus musculus mediator of RNA polymerase II transc...	42	2.4
90	gb\|BC025475.1\| Mus musculus mediator of RNA polymerase II transc...	42	2.4
91	gb\|AC102219.11\| Mus musculus chromosome 15, clone RP24-96K14, co...	42	2.4
92	ref\|XM_641690.1\| Dictyostelium discoideum hypothetical protein (...	42	2.4
93	ref\|XM_636133.1\| Dictyostelium discoideum hypothetical protein (...	42	2.4
94	ref\|XM_635401.1\| Dictyostelium discoideum hypothetical protein (...	42	2.4
95	ref\|XM_467583.1\| Oryza sativa (japonica cultivar-group), mRNA	42	2.4
96	gb\|AC151804.1\| Solanum demissum chromosome 5 BAC PGEC475B22 geno...	42	2.4
97	gb\|AE017356.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	42	2.4
98	gb\|AE017349.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	42	2.4
99	gb\|AE017343.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	42	2.4
100	gb\|AC008196.8\| Drosophila melanogaster clone BACR30J14, complete...	42	2.4
101	ref\|XM_366910.1\| Magnaporthe grisea 70-15 chromosome VII hypothe...	42	2.4
102	ref\|XM_957409.1\| Neurospora crassa OR74A hypothetical protein (N...	42	2.4
103	ref\|XM_328994.1\| Neurospora crassa OR74A hypothetical protein (N...	42	2.4
104	gb\|AY614011.1\| Pelmatohydra robusta mRNA 5' cap-methyltransferas...	42	2.4
105	gb\|BC068393.1\| Danio rerio cDNA clone IMAGE:6961702, partial cds	42	2.4
106	gb\|AC133089.4\| Mus musculus BAC clone RP24-165M3 from chromosome...	42	2.4
107	ref\|XM_980768.1\| PREDICTED: Mus musculus neuron navigator 3 (Nav...	42	2.4
108	ref\|XM_001003696.1\| PREDICTED: Mus musculus similar to neuron na...	42	2.4
109	ref\|XM_001003704.1\| PREDICTED: Mus musculus similar to neuron na...	42	2.4
110	ref\|XM_001003712.1\| PREDICTED: Mus musculus similar to neuron na...	42	2.4
111	ref\|XM_001003689.1\| PREDICTED: Mus musculus similar to neuron na...	42	2.4
112	ref\|XM_001004140.1\| PREDICTED: Mus musculus RIKEN cDNA 9630020C0...	42	2.4
113	ref\|XM_001004137.1\| PREDICTED: Mus musculus RIKEN cDNA 9630020C0...	42	2.4
114	ref\|XM_745341.1\| Aspergillus fumigatus Af293 hypothetical protei...	42	2.4
115	ref\|XM_389573.1\| Gibberella zeae PH-1 chromosome 4 hypothetical ...	42	2.4
116	ref\|XM_389429.1\| Gibberella zeae PH-1 chromosome 4 hypothetical ...	42	2.4
117	ref\|XM_569941.1\| Cryptococcus neoformans var. neoformans JEC21 h...	42	2.4
118	ref\|XM_572993.1\| Cryptococcus neoformans var. neoformans JEC21 h...	42	2.4
119	ref\|XM_568517.1\| Cryptococcus neoformans var. neoformans JEC21 g...	42	2.4
120	gb\|AC121786.3\| Mus musculus BAC clone RP23-387F9 from chromosome...	42	2.4
121	gb\|AY142087.1\| Borrelia burgdorferi strain N40 plasmid group cp3...	42	2.4
122	gb\|AC121871.3\| Mus musculus BAC clone RP24-121J1 from chromosome...	42	2.4
123	gb\|AC100752.10\| Mus musculus chromosome 3, clone RP23-2A4, compl...	42	2.4
124	emb\|CR720005.2\|CNS0GII3 Tetraodon nigroviridis full-length cDNA	42	2.4
125	emb\|CR716569.2\|CNS0GFUQ Tetraodon nigroviridis full-length cDNA	42	2.4
126	emb\|CR697488.2\|CNS0G14S Tetraodon nigroviridis full-length cDNA	42	2.4
127	emb\|CR696725.2\|CNS0G0JL Tetraodon nigroviridis full-length cDNA	42	2.4
128	gb\|AC100120.9\| Mus musculus chromosome 10, clone RP23-40I1, comp...	42	2.4
129	emb\|AL353742.23\| Human DNA sequence from clone RP11-505C13 on ch...	42	2.4
130	ref\|XM_788664.1\| PREDICTED: Strongylocentrotus purpuratus simila...	42	2.4
131	ref\|XM_788091.1\| PREDICTED: Strongylocentrotus purpuratus simila...	42	2.4
132	emb\|BX011696.1\|CNS08H6S Single read from an extremity of a full-...	42	2.4
133	ref\|XM_778473.1\| PREDICTED: Strongylocentrotus purpuratus simila...	42	2.4
134	ref\|NM_001011242.1\| Xenopus tropicalis retinitis pigmentosa 9 (a...	42	2.4
135	emb\|BX294012.1\|NC80A10 Neurospora crassa DNA linkage group V Cos...	42	2.4
136	emb\|AL161518.2\|ATCHRIV30 Arabidopsis thaliana DNA chromosome 4, ...	42	2.4
137	emb\|AL049525.1\|ATF25I24 Arabidopsis thaliana DNA chromosome 4, B...	42	2.4
138	emb\|AJ294815.1\|MYA294815 Tapesia yallundae tyg1 gene for G prote...	42	2.4
139	emb\|AL606522.6\| Mouse DNA sequence from clone RP23-19L22 on chro...	42	2.4
140	emb\|BX004866.22\| Mouse DNA sequence from clone RP23-360A7 on chr...	42	2.4
141	emb\|CR376729.7\| Zebrafish DNA sequence from clone CH211-282K21 i...	42	2.4
142	gb\|AC023712.5\| Drosophila melanogaster X BAC RP98-1M22 (Roswell ...	42	2.4
143	dbj\|AK222455.1\| Ciona intestinalis mRNA for translation initiati...	42	2.4
144	ref\|NM_199640.1\| Danio rerio methionyl aminopeptidase 2 (metap2)...	42	2.4
145	emb\|X60437.2\|DSPTEH2 Drosophila subobscura Dnop56 gene and P tra...	42	2.4
146	gb\|AC023720.4\| Drosophila melanogaster X BAC RP98-7F15 (Roswell ...	42	2.4
147	gb\|AC023692.5\| Drosophila melanogaster X BAC RP98-15B10 (Roswell...	42	2.4
148	emb\|BX088710.15\| Zebrafish DNA sequence from clone DKEY-3L5 in l...	42	2.4
149	gb\|AC023682.4\| Drosophila melanogaster X BAC RP98-7F10 (Roswell ...	42	2.4
150	gb\|BC055563.1\| Danio rerio methionyl aminopeptidase 2, mRNA (cDN...	42	2.4
151	ref\|NM_166094.1\| Drosophila melanogaster SRPK CG8174-RC, transcr...	42	2.4
152	ref\|NM_166093.1\| Drosophila melanogaster SRPK CG8174-RA, transcr...	42	2.4
153	ref\|NM_142783.2\| Drosophila melanogaster Nop56 CG13849-RA (Nop56...	42	2.4
154	ref\|NM_137190.2\| Drosophila melanogaster SRPK CG8174-RB, transcr...	42	2.4
155	dbj\|AB128125.1\| Vigna angularis DNA, microsatellite locus CEDG02...	42	2.4
156	dbj\|AB128124.1\| Vigna angularis DNA, microsatellite locus CEDG02...	42	2.4
157	dbj\|AB128123.1\| Vigna angularis DNA, microsatellite locus CEDG02...	42	2.4
158	dbj\|AB128122.1\| Vigna angularis DNA, microsatellite locus CEDG02...	42	2.4
159	dbj\|AB128121.1\| Vigna angularis DNA, microsatellite locus CEDG02...	42	2.4
160	dbj\|AB128120.1\| Vigna angularis DNA, microsatellite locus CEDG02...	42	2.4
161	dbj\|AB128119.1\| Vigna angularis DNA, microsatellite locus CEDG02...	42	2.4
162	dbj\|AB128118.1\| Vigna angularis DNA, microsatellite locus CEDG02...	42	2.4
163	ref\|NM_079319.2\| Drosophila melanogaster Eukaryotic initiation f...	42	2.4
164	gb\|AC024600.5\| Homo sapiens chromosome 10 clone RP11-179K3, comp...	42	2.4
165	gb\|AC098487.1\| Homo sapiens BAC clone RP11-499E18 from 4, comple...	42	2.4
166	gb\|AE010192.1\| Pyrococcus furiosus DSM 3638, section 67 of 173 o...	42	2.4
167	ref\|XM_704119.1\| PREDICTED: Danio rerio similar to Heat shock pr...	42	2.4
168	ref\|XM_683871.1\| PREDICTED: Danio rerio similar to Heat shock pr...	42	2.4
169	ref\|XM_704118.1\| PREDICTED: Danio rerio similar to Heat shock pr...	42	2.4
170	dbj\|AK168787.1\| Mus musculus 17 days embryo heart cDNA, RIKEN fu...	42	2.4
171	ref\|XM_682791.1\| PREDICTED: Danio rerio similar to heat shock pr...	42	2.4
172	ref\|XM_696969.1\| PREDICTED: Danio rerio hypothetical protein LOC...	42	2.4
173	dbj\|AK160579.1\| Mus musculus ES cells cDNA, RIKEN full-length en...	42	2.4
174	gb\|AF223353.1\|AF223353 Drosophila melanogaster nucleolar KKE/D r...	42	2.4
175	gb\|AC091223.2\| Drosophila melanogaster 3L BAC RP98-48G6 (Roswell...	42	2.4
176	dbj\|AK010552.1\| Mus musculus ES cells cDNA, RIKEN full-length en...	42	2.4
177	gb\|AY051644.1\| Drosophila melanogaster GM14238 full length cDNA	42	2.4
178	gb\|AF047663.3\| Caenorhabditis elegans cosmid W09G12, complete se...	42	2.4
179	gb\|AE015928.1\| Bacteroides thetaiotaomicron VPI-5482, complete g...	42	2.4
180	dbj\|AK005399.1\| Mus musculus adult female placenta cDNA, RIKEN f...	42	2.4
181	ref\|NM_067656.1\| Caenorhabditis elegans W09G12.7 (W09G12.7) mRNA...	42	2.4
182	gb\|AE003738.3\| Drosophila melanogaster chromosome 3R, section 76...	42	2.4
183	gb\|BC055404.1\| Mus musculus mediator of RNA polymerase II transc...	42	2.4
184	gb\|AC115748.8\| Mus musculus chromosome 1, clone RP23-13N24, comp...	42	2.4
185	dbj\|AP008218.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	2.4
186	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	2.4
187	gb\|AC008343.4\|AC008343 Drosophila melanogaster, chromosome 2R, r...	42	2.4
188	gb\|AF024682.1\| Drosophila guanche P element cluster, partial seq...	42	2.4
189	gb\|AF301149.1\|AF301149 Drosophila melanogaster SR protein kinase...	42	2.4
190	gb\|AC092672.3\| Homo sapiens BAC clone RP11-603F24 from 2, comple...	42	2.4
191	gb\|AC009236.4\| Homo sapiens BAC clone RP11-421J10 from 2, comple...	42	2.4
192	gb\|AC084645.1\|CBRG45L11 Caenorhabditis briggsae cosmid G45L11, c...	42	2.4
193	gb\|AC069120.9\| Homo sapiens chromosome 8, clone RP11-675F6, comp...	42	2.4
194	gb\|AE014845.1\| Plasmodium falciparum 3D7 chromosome 12, section ...	42	2.4
195	ref\|NM_025885.1\| Mus musculus mediator of RNA polymerase II tran...	42	2.4
196	gb\|AY060459.1\| Drosophila melanogaster SD03158 full insert cDNA	42	2.4
197	gb\|AE001581.1\| Borrelia burgdorferi B31 plasmid cp32-9, complete...	42	2.4
198	gb\|AC016813.20\| Homo sapiens chromosome 8, clone RP11-495O10, co...	42	2.4
199	dbj\|AP006841.1\| Bacteroides fragilis YCH46 DNA, complete genome	42	2.4
200	gb\|AC153890.8\| Mus musculus BAC RP23-403C13 (Roswell Park Cance...	42	2.4
201	dbj\|AP005284.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	2.4
202	dbj\|AK121427.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	42	2.4
203	gb\|AC153978.5\| Mus musculus 10 BAC RP24-217I1 (Roswell Park Canc...	42	2.4
204	gb\|AF156667.1\|AF156667 Vigna radiata RNA helicase (VRH1) mRNA, c...	42	2.4
205	gb\|AF213884.1\|AF213884S1 Homo sapiens nuclear factor of kappa li...	42	2.4
206	dbj\|AK110375.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	42	2.4
207	gb\|AC174163.2\| Gallus gallus BAC clone CH261-69O1 from chromosom...	42	2.4
208	emb\|CT030184.14\| Mouse DNA sequence from clone RP23-9C19 on chro...	42	2.4
209	emb\|CR381646.8\| Zebrafish DNA sequence from clone DKEY-241L7 in ...	42	2.4
210	gb\|AC007967.3\|AC007967 Homo sapiens clone NH0373F14, complete se...	42	2.4
211	emb\|CR761073.2\| Xenopus tropicalis finished cDNA, clone TEgg032c10	42	2.4
212	gb\|AE003811.3\| Drosophila melanogaster chromosome 2R, section 39...	42	2.4
213	gb\|AE003541.3\| Drosophila melanogaster chromosome 3L, section 44...	42	2.4
214	gb\|AE003436.3\| Drosophila melanogaster chromosome X, section 20 ...	42	2.4
215	gb\|AE003433.3\| Drosophila melanogaster chromosome X, section 17 ...	42	2.4
216	emb\|CT486003.10\| Mouse DNA sequence from clone RP23-415F11 on ch...	42	2.4
217	dbj\|AK122404.1\| Mus musculus mRNA for mKIAA0938 protein	42	2.4
218	gb\|BT001613.1\| Drosophila melanogaster RE33426 full insert cDNA	42	2.4
219	emb\|BX072581.5\| Zebrafish DNA sequence from clone DKEY-14K7 in l...	42	2.4
220	emb\|CT033751.4\| Mouse DNA sequence from clone RP24-236O3 on chro...	42	2.4
221	gb\|AF080118.1\|F8M12 Arabidopsis thaliana BAC F8M12	42	2.4
222	emb\|AL929079.14\| Mouse DNA sequence from clone RP23-387F9 on chr...	42	2.4
223	gb\|DP000011.1\| Oryza sativa (japonica cultivar-group) chromosome...	42	2.4
224	emb\|AL772415.6\|CNS08C9T Oryza sativa chromosome 12, . BAC OSJNBa...	42	2.4
225	emb\|CT030166.8\| Mouse DNA sequence from clone RP23-320I11 on chr...	42	2.4
226	gb\|BC087814.1\| Xenopus tropicalis retinitis pigmentosa 9 (autoso...	42	2.4
227	gb\|AC140330.3\| Mus musculus BAC clone RP23-410I24 from 6, comple...	42	2.4
228	gb\|AC001229.1\|F5I14 Sequence of BAC F5I14 from Arabidopsis thali...	42	2.4
229	emb\|Z83316.1\|CEB0379 Caenorhabditis elegans Cosmid B0379, comple...	42	2.4
230	gb\|AY780259.1\| Eucalyptus globulus subsp. globulus chloroplast, ...	42	2.4
231	dbj\|AP004976.1\| Lotus japonicus genomic DNA, chromosome 3, clone...	42	2.4
232	gb\|AC171730.1\| Lycopersicon esculentum chromosome 01 clone C01HB...	42	2.4
233	emb\|AL607030.15\| Mouse DNA sequence from clone RP23-304O12 on ch...	42	2.4
234	emb\|AL645930.15\| Mouse DNA sequence from clone RP23-434L7 on chr...	42	2.4
235	emb\|AL929066.7\| Mouse DNA sequence from clone RP23-68E1 on chrom...	42	2.4
236	gb\|L19197.1\|DROEIF2BET Drosophila melanogaster eIF-2 beta-subuni...	42	2.4
237	dbj\|AP003480.1\| Homo sapiens genomic DNA, chromosome 8q23, clone...	42	2.4
238	emb\|AL596263.8\| Mouse DNA sequence from clone RP23-392O2 on chro...	42	2.4
239	gb\|AC138358.12\| Mus musculus chromosome 1, clone RP24-147G10, co...	40	9.6
240	gb\|AC099576.12\| Mus musculus chromosome 3, clone RP23-93G15, com...	40	9.6
241	gb\|AC116384.9\| Mus musculus chromosome 3, clone RP23-20L19, comp...	40	9.6
242	gb\|BC032416.1\| Homo sapiens serine/arginine repetitive matrix 2,...	40	9.6
243	gb\|AC102140.15\| Mus musculus chromosome 3, clone RP23-286J21, co...	40	9.6
244	gb\|AC104554.7\| Mus musculus chromosome 5, clone RP24-441E22, com...	40	9.6
245	gb\|CP000024.1\| Streptococcus thermophilus CNRZ1066, complete genome	40	9.6
246	gb\|AC116696.20\| Mus musculus chromosome 3, clone RP24-425N23, co...	40	9.6
247	gb\|AC153879.1\| Mus musculus BAC RP23-264C21 (Roswell Park Cance...	40	9.6
248	gb\|AC119832.9\| Mus musculus chromosome 3, clone RP23-471I16, com...	40	9.6
249	gb\|AC153729.1\| Mus musculus BAC RP23-88C11 (Roswell Park Cancer...	40	9.6
250	ref\|NM_053424.1\| Rattus norvegicus solute carrier family 4, memb...	40	9.6
251	ref\|NM_120061.1\| Arabidopsis thaliana hydrolase, hydrolyzing O-g...	40	9.6
252	ref\|NM_105903.2\| Arabidopsis thaliana unknown protein AT1G72440 ...	40	9.6
253	ref\|NM_111476.1\| Arabidopsis thaliana unknown protein AT3G06020 ...	40	9.6
254	ref\|NM_100691.1\| Arabidopsis thaliana DNA binding AT1G08170 mRNA...	40	9.6
255	ref\|NM_179845.1\| Arabidopsis thaliana unknown protein AT2G31890 ...	40	9.6
256	ref\|NM_001036805.1\| Arabidopsis thaliana unknown protein AT5G144...	40	9.6
257	ref\|NM_121448.3\| Arabidopsis thaliana unknown protein AT5G14440 ...	40	9.6
258	ref\|NM_001036079.1\| Arabidopsis thaliana clathrin binding AT1G48...	40	9.6
259	ref\|NM_103771.2\| Arabidopsis thaliana clathrin binding AT1G48760...	40	9.6
260	ref\|NM_179454.1\| Arabidopsis thaliana clathrin binding AT1G48760...	40	9.6
261	ref\|NM_112883.3\| Arabidopsis thaliana STP4 (SUGAR TRANSPORTER); ...	40	9.6
262	ref\|NM_102492.2\| Arabidopsis thaliana unknown protein AT1G27300 ...	40	9.6
263	ref\|NM_128746.2\| Arabidopsis thaliana ATP binding / kinase/ prot...	40	9.6
264	gb\|AC116389.12\| Mus musculus chromosome 7, clone RP23-21B1, comp...	40	9.6
265	ref\|NM_147305.1\| Arabidopsis thaliana unknown protein AT2G12875 ...	40	9.6
266	ref\|NM_121432.1\| Arabidopsis thaliana transcription regulator AT...	40	9.6
267	ref\|NM_100832.1\| Arabidopsis thaliana ATP binding / kinase/ prot...	40	9.6
268	gb\|AC132886.18\| Mus musculus chromosome 13, clone RP24-267I21, c...	40	9.6
269	gb\|AC115786.8\| Mus musculus chromosome 5, clone RP23-170E15, com...	40	9.6
270	ref\|NM_112559.2\| Arabidopsis thaliana polygalacturonase AT3G1685...	40	9.6
271	gb\|AC139218.10\| Mus musculus chromosome 15, clone RP23-456O10, c...	40	9.6
272	gb\|AC166114.5\| Mus musculus BAC clone RP23-63J20 from chromosome...	40	9.6
273	gb\|AC161271.2\| Mus musculus BAC clone RP23-59D8 from chromosome ...	40	9.6
274	gb\|BC106206.1\| Xenopus laevis XNop56 protein, mRNA (cDNA clone M...	40	9.6
275	gb\|AC154808.2\| Mus musculus BAC clone RP24-512K19 from chromosom...	40	9.6
276	gb\|AC121304.7\| Mus musculus chromosome 3, clone RP24-63C3, compl...	40	9.6
277	gb\|AC164116.4\| Mus musculus BAC clone RP24-242F4 from chromosome...	40	9.6
278	gb\|AC154102.15\| Mus musculus chromosome 8, clone RP24-186O14, co...	40	9.6
279	gb\|AC121498.12\| Mus musculus chromosome 1, clone RP23-38P22, com...	40	9.6
280	gb\|AC159998.6\| Mus musculus BAC clone RP24-576J22 from chromosom...	40	9.6
281	gb\|AC120180.19\| Mus musculus chromosome 1, clone RP24-499I2, com...	40	9.6
282	gb\|BC007904.2\| Homo sapiens MARCKS-like 1, mRNA (cDNA clone MGC:...	40	9.6
283	gb\|AC116375.11\| Mus musculus chromosome 5, clone RP24-197K18, co...	40	9.6
284	gb\|AC156952.22\| Mus musculus 10 BAC RP24-385D2 (Roswell Park Can...	40	9.6
285	ref\|XM_632944.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
286	ref\|XM_633127.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
287	ref\|XM_632512.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
288	ref\|XM_632338.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
289	ref\|XM_632310.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
290	ref\|XM_632182.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
291	ref\|XM_632137.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
292	ref\|XM_631797.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
293	ref\|XM_631768.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
294	gb\|AC164883.5\| Mus musculus BAC clone RP23-88A20 from chromosome...	40	9.6
295	gb\|AC131083.8\| Mus musculus chromosome 1, clone RP23-444L13, com...	40	9.6
296	gb\|AC125027.12\| Mus musculus chromosome 8, clone RP24-68F20, com...	40	9.6
297	ref\|XM_642384.1\| Dictyostelium discoideum putative non-transport...	40	9.6
298	ref\|XM_550090.1\| Oryza sativa (japonica cultivar-group), mRNA	40	9.6
299	ref\|XM_641864.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
300	ref\|XM_641738.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
301	ref\|XM_641530.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
302	ref\|XM_641118.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
303	ref\|XM_641095.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
304	ref\|XM_640619.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
305	ref\|XM_640426.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
306	ref\|XM_640181.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
307	ref\|XM_639756.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
308	ref\|XM_639727.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
309	gb\|AC104202.13\| Mus musculus chromosome 5, clone RP24-558F5, com...	40	9.6
310	ref\|XM_639339.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
311	ref\|XM_639197.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
312	ref\|XM_639162.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
313	ref\|XM_638676.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
314	ref\|XM_638433.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
315	ref\|XM_638367.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
316	ref\|XM_638310.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
317	gb\|AC150387.2\| Branchiostoma floridae clone CH302-103N24, comple...	40	9.6
318	ref\|XM_637527.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
319	ref\|XM_637327.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
320	ref\|XM_637314.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
321	ref\|XM_637027.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
322	ref\|XM_636800.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
323	ref\|XM_636662.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
324	ref\|XM_636509.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
325	ref\|XM_636352.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
326	ref\|XM_635806.1\| Dictyostelium discoideum bifunctional polynucle...	40	9.6
327	ref\|XM_635332.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
328	ref\|XM_630255.1\| Dictyostelium discoideum gelsolin-related prote...	40	9.6
329	ref\|XM_631130.1\| Dictyostelium discoideum myosin (DDB0188441), p...	40	9.6
330	ref\|XM_630659.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
331	ref\|XM_630098.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
332	ref\|XM_629805.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
333	ref\|XM_629777.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
334	ref\|XM_629580.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
335	ref\|XM_629562.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
336	ref\|XM_628986.1\| Dictyostelium discoideum hypothetical protein (...	40	9.6
337	gb\|AC159201.2\| Mus musculus BAC clone RP23-340E6 from chromosome...	40	9.6
338	gb\|AC163351.2\| Mus musculus BAC clone RP23-150D4 from chromosome...	40	9.6
339	gb\|AC154483.2\| Mus musculus BAC clone RP24-113B3 from chromosome...	40	9.6
340	gb\|AC166346.5\| Mus musculus BAC clone RP24-83P13 from chromosome...	40	9.6
341	gb\|AC168117.2\| Mus musculus BAC clone RP23-461G13 from chromosom...	40	9.6
342	ref\|XM_510752.1\| PREDICTED: Pan troglodytes similar to splicing ...	40	9.6
343	gb\|AC164110.4\| Mus musculus BAC clone RP23-307N19 from chromosom...	40	9.6
344	gb\|AC152821.5\| Mus musculus BAC clone RP24-366H21 from chromosom...	40	9.6
345	gb\|AC154707.2\| Mus musculus BAC clone RP24-353D1 from chromosome...	40	9.6
346	gb\|AC163660.4\| Mus musculus BAC clone RP23-283J16 from chromosom...	40	9.6
347	gb\|AC135668.5\| Mus musculus BAC clone RP23-280P7 from chromosome...	40	9.6
348	gb\|AC165948.2\| Mus musculus BAC clone RP24-430M9 from chromosome...	40	9.6
349	gb\|AC158397.2\| Mus musculus BAC clone RP23-274H19 from chromosom...	40	9.6
350	gb\|AC169129.2\| Mus musculus BAC clone RP23-259N3 from chromosome...	40	9.6
351	gb\|AC160986.5\| Mus musculus BAC clone RP23-258K21 from chromosom...	40	9.6
352	gb\|AC132617.4\| Mus musculus BAC clone RP23-230A6 from chromosome...	40	9.6
353	gb\|AC166832.2\| Mus musculus BAC clone RP23-220N17 from chromosom...	40	9.6
354	gb\|AC161818.3\| Mus musculus BAC clone RP23-198H15 from chromosom...	40	9.6
355	gb\|AC165236.5\| Mus musculus chromosome 5, clone RP23-348C18, com...	40	9.6
356	gb\|AC153580.19\| Mus musculus 6 BAC RP23-389F23 (Roswell Park Can...	40	9.6
357	ref\|XM_509279.1\| PREDICTED: Pan troglodytes methionyl aminopepti...	40	9.6
358	ref\|XM_469139.1\| Oryza sativa (japonica cultivar-group), mRNA	40	9.6
359	gb\|DQ216256.1\| Taeniopygia guttata clone 0063P0022E08 eukaryote ...	40	9.6
360	gb\|DQ216255.1\| Taeniopygia guttata clone 0061P0007C10 eukaryote ...	40	9.6
361	gb\|AC166649.5\| Mus musculus chromosome 5, clone RP23-379D24, com...	40	9.6
362	gb\|AC161202.15\| Mus musculus chromosome 8, clone RP23-479K12, co...	40	9.6
363	gb\|AC164539.4\| Mus musculus chromosome 1, clone wi1-168J17, comp...	40	9.6
364	gb\|AC167138.6\| Mus musculus chromosome 15, clone RP24-358O3, com...	40	9.6
365	gb\|AC099707.14\| Mus musculus chromosome 1, clone RP23-329C7, com...	40	9.6
366	gb\|AC113536.10\| Mus musculus chromosome 17, clone RP23-77L13, co...	40	9.6
367	gb\|AC167168.5\| Mus musculus chromosome 1, clone RP23-100P14, com...	40	9.6
368	gb\|AC166984.7\| Mus musculus chromosome 15, clone RP24-359A11, co...	40	9.6
369	gb\|AC100043.9\| Mus musculus chromosome 3, clone RP23-32D13, comp...	40	9.6
370	gb\|AC162373.11\| Mus musculus chromosome 18, clone RP23-410M11, c...	40	9.6
371	ref\|NM_192004.1\| Oryza sativa (japonica cultivar-group), predic...	40	9.6
372	gb\|AF423306.2\| Mus musculus strain 129/SvEv sodium-calcium excha...	40	9.6
373	gb\|AC161192.12\| Mus musculus chromosome 5, clone RP23-382I10, co...	40	9.6
374	ref\|NM_022539.1\| Rattus norvegicus methionine aminopeptidase 2 (...	40	9.6
375	ref\|XM_513266.1\| PREDICTED: Pan troglodytes similar to putative ...	40	9.6
376	gb\|AC101908.8\| Mus musculus chromosome 1, clone RP24-275J1, comp...	40	9.6
377	gb\|AC162523.9\| Mus musculus chromosome 8, clone RP23-370L21, com...	40	9.6
378	gb\|AC163272.6\| Mus musculus chromosome 3, clone RP24-388P8, comp...	40	9.6
379	gb\|AC101802.9\| Mus musculus chromosome 1, clone RP24-221A4, comp...	40	9.6
380	ref\|NM_006392.2\| Homo sapiens nucleolar protein 5A (56kDa with K...	40	9.6
381	gb\|AC167331.3\| Mus musculus chromosome 1, clone RP23-301L19, com...	40	9.6
382	ref\|NM_023009.4\| Homo sapiens MARCKS-like 1 (MARCKSL1), mRNA	40	9.6
383	gb\|AC154107.3\| Mus musculus BAC clone RP23-67L1 from chromosome ...	40	9.6
384	gb\|AC124637.10\| Mus musculus chromosome 15, clone RP23-458B6, co...	40	9.6
385	gb\|AC110194.11\| Mus musculus chromosome 7, clone RP23-238J3, com...	40	9.6
386	gb\|AC101924.24\| Mus musculus chromosome 1, clone RP24-391B5, com...	40	9.6
387	gb\|AC157931.11\| Mus musculus chromosome 5, clone RP24-159I10, co...	40	9.6
388	ref\|NM_181603.1\| Danio rerio SWI/SNF related, matrix associated,...	40	9.6
389	gb\|AY205256.1\| Danio rerio brahma protein-like protein 1 (brg1) ...	40	9.6
390	gb\|AE014832.1\| Plasmodium falciparum 3D7 chromosome 10 section 4...	40	9.6
391	gb\|AC102490.7\| Mus musculus chromosome 1, clone RP24-512M8, comp...	40	9.6
392	gb\|AC123744.8\| Mus musculus chromosome 7, clone RP24-120F8, comp...	40	9.6
393	gb\|AC147706.3\| Felis catus clone RP86-363G23, complete sequence	40	9.6
394	gb\|AE014828.1\| Plasmodium falciparum 3D7 chromosome 14 section 1...	40	9.6
395	gb\|AC138204.7\| Mus musculus chromosome 3, clone RP23-381G8, comp...	40	9.6
396	gb\|BT018451.1\| Zea mays clone EL01N0407E11.d mRNA sequence	40	9.6
397	gb\|AC109257.8\| Mus musculus chromosome 7, clone RP23-362F15, com...	40	9.6
398	gb\|BC076581.1\| Mus musculus opioid binding protein/cell adhesion...	40	9.6
399	gb\|AF369890.1\|AF369890S1 Branchiostoma floridae extracellular ma...	40	9.6
400	gb\|AY330134.1\| Pinus contorta clone PCL3011 microsatellite sequence	40	9.6
401	gb\|AC151955.2\| Populus trichocarpa clone Pop1-041G20, complete s...	40	9.6
402	gb\|AC123645.7\| Mus musculus chromosome 15, clone RP23-99N19, com...	40	9.6
403	gb\|AC109276.12\| Mus musculus chromosome 1, clone RP23-461J11, co...	40	9.6
404	ref\|NM_001033622.1\| Bos taurus similar to nucleolar protein 5A (...	40	9.6
405	gb\|AC158308.4\| Mus musculus chromosome 3, clone RP23-182M12, com...	40	9.6
406	gb\|AC163093.5\| Mus musculus chromosome 18, clone RP23-144P22, co...	40	9.6
407	gb\|AC105772.5\| Oryza sativa (japonica cultivar-group) chromosome...	40	9.6
408	gb\|AC161496.6\| Mus musculus chromosome 3, clone RP23-119A9, comp...	40	9.6
409	gb\|AF155622.1\| Polistes dominulus microsatellite Pdom136 sequence	40	9.6
410	gb\|AF120373.1\| Polistes tenebricosus microsatellite Pbe216 sequence	40	9.6
411	gb\|AF119644.1\| Polistes nimphus microsatellite Pbe269 sequence	40	9.6
412	gb\|AE017348.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	40	9.6
413	gb\|AE017346.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	40	9.6
414	gb\|AE017341.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	40	9.6
415	gb\|AY186660.1\| Cancer magister clone Cma32 microsatellite sequence	40	9.6
416	gb\|AY145454.1\| Bemisia tabaci microsatellite Bem12 sequence	40	9.6
417	gb\|AF263126.1\| Polybioides tabidus microsatellite 147 sequence	40	9.6
418	gb\|AF263121.1\| Polybioides tabidus microsatellite 108 sequence	40	9.6
419	gb\|AF263113.1\| Polybioides tabidus microsatellite 83 sequence	40	9.6
420	gb\|DQ151612.1\| Corylus avellana clone 115 microsatellite CAC-C11...	40	9.6
421	gb\|DQ151604.1\| Corylus avellana clone 5 microsatellite CAC-C005 ...	40	9.6
422	gb\|AF165913.1\| Loligo pealei microsatellite Lp1 sequence	40	9.6
423	gb\|AY016021.1\| Mus musculus clone 03245 alpha globin gene cluste...	40	9.6
424	gb\|AY023478.1\| Oryza sativa microsatellite MRG5803 containing (T...	40	9.6
425	gb\|AC102508.9\| Mus musculus chromosome 3, clone RP24-220M17, com...	40	9.6
426	gb\|CP000070.1\| Trypanosoma brucei chromosome 7, complete sequence	40	9.6
427	gb\|AY022300.1\| Oryza sativa microsatellite MRG4625 containing (A...	40	9.6
428	gb\|AY022281.1\| Oryza sativa microsatellite MRG4606 containing (A...	40	9.6
429	gb\|AF296172.1\| Saguinus oedipus Friedreich ataxia GAA trinucleot...	40	9.6
430	gb\|M98854.1\|APLPPNPY Aplysia californica neuropeptide Y mRNA, co...	40	9.6
431	gb\|CP000067.1\| Trypanosoma brucei chromosome 4, complete sequence	40	9.6
432	gb\|AC004493.1\| Homo sapiens chromosome 16, cosmid clone 373C8 (L...	40	9.6
433	gb\|AC087606.2\| Trypanosoma brucei chromosome 4 clone RPCI93-4J6,...	40	9.6
434	gb\|AC091527.21\| Trypanosoma brucei chromosome 7 clone RPCI93-33N...	40	9.6
435	gb\|AC080131.9\| Trypanosoma brucei chromosome 4 clone RPCI93-2H8,...	40	9.6
436	gb\|AC159439.1\| Trypanosoma brucei chromosome 7 clone RPCI93-2F2,...	40	9.6
437	gb\|AC154871.13\| Mus musculus chromosome 1, clone RP23-354B17, co...	40	9.6
438	gb\|AC157211.7\| Mus musculus chromosome 1, clone RP23-204C6, comp...	40	9.6
439	gb\|AC157554.7\| Mus musculus chromosome 15, clone RP24-324P21, co...	40	9.6
440	gb\|AC165225.5\| Mus musculus chromosome 3, clone RP24-70J13, comp...	40	9.6
441	gb\|AC139231.11\| Mus musculus chromosome 1, clone RP24-87I22, com...	40	9.6
442	gb\|AC119899.8\| Mus musculus chromosome 5, clone RP24-235E5, comp...	40	9.6
443	gb\|AC102124.16\| Mus musculus chromosome 18, clone RP23-188D1, co...	40	9.6
444	gb\|AC102499.10\| Mus musculus chromosome 1, clone RP24-151M13, co...	40	9.6
445	gb\|AC101728.10\| Mus musculus chromosome 19, clone RP23-328I5, co...	40	9.6
446	gb\|AC101691.7\| Mus musculus chromosome 19, clone RP23-220B4, com...	40	9.6
447	gb\|AC134415.8\| Mus musculus chromosome 3, clone RP24-224P21, com...	40	9.6
448	gb\|BC006757.1\| Mus musculus MARCKS-like 1, mRNA (cDNA clone MGC:...	40	9.6
449	gb\|AC152065.4\| Mus musculus BAC clone RP23-16D9 from chromosome ...	40	9.6
450	gb\|AC159319.2\| Mus musculus BAC clone RP23-37C8 from chromosome ...	40	9.6
451	gb\|AC163676.4\| Mus musculus BAC clone RP24-81A22 from chromosome...	40	9.6
452	gb\|AC164430.3\| Mus musculus BAC clone RP23-441D9 from chromosome...	40	9.6
453	gb\|AC159247.2\| Mus musculus BAC clone RP24-249C9 from chromosome...	40	9.6
454	gb\|AC154194.2\| Mus musculus BAC clone RP24-401L2 from chromosome...	40	9.6
455	gb\|AC163622.4\| Mus musculus BAC clone RP24-566G6 from chromosome...	40	9.6
456	gb\|AC151601.5\| Mus musculus BAC clone RP23-241H10 from chromosom...	40	9.6
457	gb\|BC077021.1\| Xenopus tropicalis hypothetical protein LOC447963...	40	9.6
458	gb\|BC080046.1\| Xenopus laevis hypothetical protein LOC446286, mR...	40	9.6
459	gb\|BC058068.1\| Danio rerio serine/arginine repetitive matrix 1, ...	40	9.6
460	gb\|AC114984.18\| Mus musculus chromosome 18, clone RP23-248F9, co...	40	9.6
461	gb\|AC150004.3\| Mus musculus chromosome 7, clone RP24-368P9, comp...	40	9.6
462	gb\|AC102232.12\| Mus musculus chromosome 18, clone RP24-76F12, co...	40	9.6
463	gb\|AC115724.10\| Mus musculus chromosome 3, clone RP23-20L18, com...	40	9.6
464	gb\|AC129942.7\| Mus musculus chromosome 8, clone RP23-267A22, com...	40	9.6
465	gb\|AC131330.25\| Mus musculus chromosome 14, clone RP23-477H13, c...	40	9.6
466	gb\|AC135357.3\| Mus musculus chromosome 8 clone RP24-84L15, compl...	40	9.6
467	gb\|AC130481.11\| Mus musculus chromosome 1, clone RP24-125E22, co...	40	9.6
468	gb\|AC102413.8\| Mus musculus chromosome 3, clone RP24-462F18, com...	40	9.6
469	gb\|AC131915.7\| Mus musculus chromosome 5, clone RP24-491C20, com...	40	9.6
470	gb\|AC131980.9\| Mus musculus chromosome 1, clone RP24-170O7, comp...	40	9.6
471	gb\|AC129554.13\| Mus musculus chromosome 17, clone RP24-358N7, co...	40	9.6
472	gb\|AC107688.13\| Mus musculus chromosome 7, clone RP24-170K5, com...	40	9.6
473	gb\|AC131919.13\| Mus musculus chromosome 15, clone RP24-239J20, c...	40	9.6
474	gb\|AC115968.10\| Mus musculus chromosome 1, clone RP24-72P6, comp...	40	9.6
475	gb\|AC107868.9\| Mus musculus chromosome 17, clone RP23-405A17, co...	40	9.6
476	gb\|AC102458.8\| Mus musculus chromosome 1, clone RP24-312N11, com...	40	9.6
477	gb\|AC102595.9\| Mus musculus chromosome 10, clone RP23-360M11, co...	40	9.6
478	gb\|AY648748.1\| Danio rerio myc-regulated DEAD/H box 18 RNA helic...	40	9.6
479	gb\|AY648738.1\| Danio rerio FLJ22626-like mRNA, complete cds	40	9.6
480	gb\|AC123658.9\| Mus musculus chromosome 15, clone RP23-192C13, co...	40	9.6
481	gb\|AC138289.8\| Mus musculus chromosome 1, clone RP24-329K3, comp...	40	9.6
482	gb\|AC158548.10\| Mus musculus chromosome 5, clone RP23-258F17, co...	40	9.6
483	gb\|AY693706.1\| Candida albicans elongation factor 3 (CEF3) gene,...	40	9.6
484	gb\|AC158594.12\| Mus musculus 10 BAC RP23-197I5 (Roswell Park Can...	40	9.6
485	gb\|AC147079.4\| Pan troglodytes BAC clone RP43-184E24 from 7, com...	40	9.6
486	gb\|AY521282.1\| Amegilla dawsoni clone Beetri94 microsatellite se...	40	9.6
487	gb\|AC095999.8\| Rattus norvegicus 4 BAC CH230-12B2 (Children's Ho...	40	9.6
488	gb\|AC119167.5\| Mus musculus chromosome 15, clone RP24-344D17, co...	40	9.6
489	gb\|AY693314.1\| Saccharomyces cerevisiae clone FLH158476.01X YGR1...	40	9.6
490	gb\|AC120364.7\| Mus musculus chromosome 8, clone RP24-291F20, com...	40	9.6
491	gb\|AC131989.8\| Mus musculus chromosome 14, clone RP24-186N15, co...	40	9.6
492	gb\|BC073553.1\| Xenopus laevis hypothetical protein LOC443662, mR...	40	9.6
493	gb\|BC073300.1\| Xenopus laevis MGC80689 protein, mRNA (cDNA clone...	40	9.6
494	gb\|AC129931.19\| Mus musculus chromosome 15, clone RP23-136I22, c...	40	9.6
495	gb\|AC008221.5\| Drosophila melanogaster clone BACR30B13, complete...	40	9.6
496	gb\|AC117570.11\| Mus musculus chromosome 9, clone RP23-18M12, com...	40	9.6
497	gb\|AC130673.10\| Mus musculus chromosome 15, clone RP24-97F15, co...	40	9.6
498	gb\|AC035247.4\| Mus musculus strain C57BL6/J chromosome 6 clone R...	40	9.6
499	ref\|XM_364075.1\| Magnaporthe grisea 70-15 hypothetical protein (...	40	9.6
500	ref\|XM_608513.2\| PREDICTED: Bos taurus similar to smooth muscle ...	40	9.6

>ref|XM_479419.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1951

 Score =  172 bits (87), Expect = 1e-39
 Identities = 150/171 (87%)
 Strand = Plus / Minus

                                                                        
Query: 532  aatagcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtc 591
            |||||||||||||||||||||||||||||| || ||||||| ||||||||| || |||||
Sbjct: 1351 aatagcagctttcatcacatcaaggttcttacgcggtgcaatacccttgtcatagaagtc 1292

                                                                        
Query: 592  tagtctctcctcaacctgttcacgcagcttctcaccaaaaatggagctgctcatatctga 651
            ||||||||||||||| ||||| |||||||||| ||| ||||  ||| |  |||  |||||
Sbjct: 1291 tagtctctcctcaacttgttcgcgcagcttctgaccgaaaactgaggtattcaactctga 1232

                                                               
Query: 652  atagcagtcaatacgtgaagcaatggaacatttgtttgccaggtatcgagc 702
            ||| ||||| || ||||| |||||||||||||| |||||||||||||||||
Sbjct: 1231 ataacagtcgatgcgtgaggcaatggaacatttatttgccaggtatcgagc 1181



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 284  ttcttctttttcttcttcttggg 306
            |||||||||||||||||||||||
Sbjct: 1626 ttcttctttttcttcttcttggg 1604

to top

>dbj|AK107041.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-121-C03, full
            insert sequence
          Length = 1951

 Score =  172 bits (87), Expect = 1e-39
 Identities = 150/171 (87%)
 Strand = Plus / Minus

                                                                        
Query: 532  aatagcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtc 591
            |||||||||||||||||||||||||||||| || ||||||| ||||||||| || |||||
Sbjct: 1351 aatagcagctttcatcacatcaaggttcttacgcggtgcaatacccttgtcatagaagtc 1292

                                                                        
Query: 592  tagtctctcctcaacctgttcacgcagcttctcaccaaaaatggagctgctcatatctga 651
            ||||||||||||||| ||||| |||||||||| ||| ||||  ||| |  |||  |||||
Sbjct: 1291 tagtctctcctcaacttgttcgcgcagcttctgaccgaaaactgaggtattcaactctga 1232

                                                               
Query: 652  atagcagtcaatacgtgaagcaatggaacatttgtttgccaggtatcgagc 702
            ||| ||||| || ||||| |||||||||||||| |||||||||||||||||
Sbjct: 1231 ataacagtcgatgcgtgaggcaatggaacatttatttgccaggtatcgagc 1181



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 284  ttcttctttttcttcttcttggg 306
            |||||||||||||||||||||||
Sbjct: 1626 ttcttctttttcttcttcttggg 1604

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  129 bits (65), Expect = 1e-26
 Identities = 92/101 (91%)
 Strand = Plus / Minus

                                                                            
Query: 532      aatagcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtc 591
                |||||||||||||||||||||||||||||| || ||||||| ||||||||| || |||||
Sbjct: 27875697 aatagcagctttcatcacatcaaggttcttacgcggtgcaatacccttgtcatagaagtc 27875638

                                                         
Query: 592      tagtctctcctcaacctgttcacgcagcttctcaccaaaaa 632
                ||||||||||||||| ||||| |||||||||| ||| ||||
Sbjct: 27875637 tagtctctcctcaacttgttcgcgcagcttctgaccgaaaa 27875597



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                       
Query: 648      ctgaatagcagtcaatacgtgaagcaatggaacatttgtttgccaggtatcgagc 702
                ||||||| ||||| || ||||| |||||||||||||| |||||||||||||||||
Sbjct: 27875500 ctgaataacagtcgatgcgtgaggcaatggaacatttatttgccaggtatcgagc 27875446



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 284      ttcttctttttcttcttcttggg 306
                |||||||||||||||||||||||
Sbjct: 27876076 ttcttctttttcttcttcttggg 27876054



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 284      ttcttctttttcttcttcttgg 305
                ||||||||||||||||||||||
Sbjct: 28808681 ttcttctttttcttcttcttgg 28808702



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 284      ttcttctttttcttcttctt 303
                ||||||||||||||||||||
Sbjct: 17614083 ttcttctttttcttcttctt 17614064



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 284      ttcttctttttcttcttctt 303
                ||||||||||||||||||||
Sbjct: 10408376 ttcttctttttcttcttctt 10408357



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 284     ttcttctttttcttcttctt 303
               ||||||||||||||||||||
Sbjct: 1971606 ttcttctttttcttcttctt 1971587

to top

>dbj|AP005452.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0453E03
          Length = 159980

 Score =  129 bits (65), Expect = 1e-26
 Identities = 92/101 (91%)
 Strand = Plus / Minus

                                                                         
Query: 532   aatagcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtc 591
             |||||||||||||||||||||||||||||| || ||||||| ||||||||| || |||||
Sbjct: 39055 aatagcagctttcatcacatcaaggttcttacgcggtgcaatacccttgtcatagaagtc 38996

                                                      
Query: 592   tagtctctcctcaacctgttcacgcagcttctcaccaaaaa 632
             ||||||||||||||| ||||| |||||||||| ||| ||||
Sbjct: 38995 tagtctctcctcaacttgttcgcgcagcttctgaccgaaaa 38955



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                    
Query: 648   ctgaatagcagtcaatacgtgaagcaatggaacatttgtttgccaggtatcgagc 702
             ||||||| ||||| || ||||| |||||||||||||| |||||||||||||||||
Sbjct: 38858 ctgaataacagtcgatgcgtgaggcaatggaacatttatttgccaggtatcgagc 38804



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 284   ttcttctttttcttcttcttggg 306
             |||||||||||||||||||||||
Sbjct: 39434 ttcttctttttcttcttcttggg 39412

to top

>gb|BT014111.1| Lycopersicon esculentum clone 133215F, mRNA sequence
          Length = 1534

 Score =  107 bits (54), Expect = 5e-20
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                        
Query: 530  tcaatagcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaag 589
            ||||||||||||||||||||||| ||||| || || |||||||| |||||||| ||||||
Sbjct: 1354 tcaatagcagctttcatcacatctaggttttttcgtggtgcaacccccttgtcataaaag 1295

                                                      
Query: 590  tctagtctctcctcaacctgttcacgcagcttctcaccaaaa 631
            ||||| | ||||||||| |||||||| || ||||| ||||||
Sbjct: 1294 tctagacgctcctcaacttgttcacggagtttctctccaaaa 1253

to top

>gb|AY104327.1| Zea mays PCO078604 mRNA sequence
          Length = 1960

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                        
Query: 529  gtcaatagcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaa 588
            ||||||||| |||||||||||||||||||| || || || |||||||||||||| || ||
Sbjct: 1356 gtcaatagcggctttcatcacatcaaggtttttacgaggcgcaacacccttgtcatagaa 1297

                                                                        
Query: 589  gtctagtctctcctcaacctgttcacgcagcttctcaccaaaaatggagctgctcatatc 648
             || ||||||||||| || || ||||||| ||| |  ||||| |  ||| ||||    ||
Sbjct: 1296 ttccagtctctcctcgacttgctcacgcaacttttgcccaaagacagaggtgctagcctc 1237

                                                                  
Query: 649  tgaatagcagtcaatacgtgaagcaatggaacatttgtttgccaggtatcgagc 702
             || ||||||||||| ||||||||||| || ||||||||||||||||| |||||
Sbjct: 1236 cgagtagcagtcaatgcgtgaagcaatcgagcatttgtttgccaggtaacgagc 1183

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                            
Query: 536      gcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagt 595
                ||||||||||||||||||||||| || || ||||||||||||||||| || |||||||  
Sbjct: 13197687 gcagctttcatcacatcaaggtttttacgaggtgcaacacccttgtcatagaagtctaac 13197746

                                          
Query: 596      ctctcctcaacctgttcacgcagctt 621
                | ||||||||| || ||||| |||||
Sbjct: 13197747 cgctcctcaacttgctcacgaagctt 13197772



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 281      cggttcttctttttcttcttcttggg 306
                ||||||||||| ||||||||||||||
Sbjct: 13197312 cggttcttcttcttcttcttcttggg 13197337



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 284      ttcttctttttcttcttctt 303
                ||||||||||||||||||||
Sbjct: 25702988 ttcttctttttcttcttctt 25703007



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 284      ttcttctttttcttcttctt 303
                ||||||||||||||||||||
Sbjct: 14212710 ttcttctttttcttcttctt 14212691

to top

>gb|AC135257.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1113A07,
             from chromosome 3, complete sequence
          Length = 151173

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                         
Query: 536   gcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagt 595
             ||||||||||||||||||||||| || || ||||||||||||||||| || |||||||  
Sbjct: 28951 gcagctttcatcacatcaaggtttttacgaggtgcaacacccttgtcatagaagtctaac 28892

                                       
Query: 596   ctctcctcaacctgttcacgcagctt 621
             | ||||||||| || ||||| |||||
Sbjct: 28891 cgctcctcaacttgctcacgaagctt 28866



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 281   cggttcttctttttcttcttcttggg 306
             ||||||||||| ||||||||||||||
Sbjct: 29326 cggttcttcttcttcttcttcttggg 29301

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                            
Query: 536      gcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagt 595
                ||||||||||||||||||||||| || || ||||||||||||||||| || |||||||  
Sbjct: 13194462 gcagctttcatcacatcaaggtttttacgaggtgcaacacccttgtcatagaagtctaac 13194521

                                          
Query: 596      ctctcctcaacctgttcacgcagctt 621
                | ||||||||| || ||||| |||||
Sbjct: 13194522 cgctcctcaacttgctcacgaagctt 13194547



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 281      cggttcttctttttcttcttcttggg 306
                ||||||||||| ||||||||||||||
Sbjct: 13194087 cggttcttcttcttcttcttcttggg 13194112



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 284      ttcttctttttcttcttctt 303
                ||||||||||||||||||||
Sbjct: 25794297 ttcttctttttcttcttctt 25794316



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 284      ttcttctttttcttcttctt 303
                ||||||||||||||||||||
Sbjct: 14207685 ttcttctttttcttcttctt 14207666

to top

>dbj|AK069305.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023012D01, full
            insert sequence
          Length = 1835

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                        
Query: 536  gcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagt 595
            ||||||||||||||||||||||| || || ||||||||||||||||| || |||||||  
Sbjct: 1367 gcagctttcatcacatcaaggtttttacgaggtgcaacacccttgtcatagaagtctaac 1308

                                      
Query: 596  ctctcctcaacctgttcacgcagctt 621
            | ||||||||| || ||||| |||||
Sbjct: 1307 cgctcctcaacttgctcacgaagctt 1282



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 281  cggttcttctttttcttcttcttggg 306
            ||||||||||| ||||||||||||||
Sbjct: 1660 cggttcttcttcttcttcttcttggg 1635

to top

>dbj|AK059432.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-F04, full
           insert sequence
          Length = 910

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                       
Query: 536 gcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagt 595
           ||||||||||||||||||||||| || || ||||||||||||||||| || |||||||  
Sbjct: 295 gcagctttcatcacatcaaggtttttacgaggtgcaacacccttgtcatagaagtctaac 236

                                     
Query: 596 ctctcctcaacctgttcacgcagctt 621
           | ||||||||| || ||||| |||||
Sbjct: 235 cgctcctcaacttgctcacgaagctt 210



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 281 cggttcttctttttcttcttcttggg 306
           ||||||||||| ||||||||||||||
Sbjct: 589 cggttcttcttcttcttcttcttggg 564

to top

>gb|AC136284.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1739D07,
              from chromosome 3, complete sequence
          Length = 149539

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                          
Query: 536    gcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagt 595
              ||||||||||||||||||||||| || || ||||||||||||||||| || |||||||  
Sbjct: 122154 gcagctttcatcacatcaaggtttttacgaggtgcaacacccttgtcatagaagtctaac 122095

                                        
Query: 596    ctctcctcaacctgttcacgcagctt 621
              | ||||||||| || ||||| |||||
Sbjct: 122094 cgctcctcaacttgctcacgaagctt 122069



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 281    cggttcttctttttcttcttcttggg 306
              ||||||||||| ||||||||||||||
Sbjct: 122529 cggttcttcttcttcttcttcttggg 122504

to top

>gb|AY106286.1| Zea mays PCO078601 mRNA sequence
          Length = 913

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 64/72 (88%)
 Strand = Plus / Minus

                                                                       
Query: 529 gtcaatagcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaa 588
           |||||||||||||||||||||||||||||| || || || |||||||||||||| || ||
Sbjct: 89  gtcaatagcagctttcatcacatcaaggtttttacgaggcgcaacacccttgtcatagaa 30

                       
Query: 589 gtctagtctctc 600
            || ||||||||
Sbjct: 29  ttccagtctctc 18



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 285 tcttctttttcttcttcttgggggtct 311
           |||||||||||||||||||||| ||||
Sbjct: 375 tcttctttttcttcttcttgggagtct 349

to top

>ref|NM_104489.2| Arabidopsis thaliana NOP56 AT1G56110 (NOP56) mRNA, complete cds
          Length = 1779

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                        
Query: 542  ttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagtctctcc 601
            ||||| ||||| | ||||||||| || |||||||| ||||| ||||| ||||| || |||
Sbjct: 1330 ttcattacatccacgttcttgcgtggggcaacacctttgtcataaaattctagcctttcc 1271

                                          
Query: 602  tcaacctgttcacgcagcttctcaccaaaa 631
            ||||| ||||| || |||||||||||||||
Sbjct: 1270 tcaacttgttcgcgaagcttctcaccaaaa 1241



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 454  cttcttctttttgcttttcttcacggatgcatca 487
            ||||||||| |||||||||||||| || ||||||
Sbjct: 1412 cttcttcttcttgcttttcttcaccgaggcatca 1379

to top

>gb|AC009894.2| Arabidopsis thaliana chromosome I BAC T6H22 genomic sequence, complete
             sequence
          Length = 96489

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                         
Query: 542   ttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagtctctcc 601
             ||||| ||||| | ||||||||| || |||||||| ||||| ||||| ||||| || |||
Sbjct: 44847 ttcattacatccacgttcttgcgtggggcaacacctttgtcataaaattctagcctttcc 44788

                                           
Query: 602   tcaacctgttcacgcagcttctcaccaaaa 631
             ||||| ||||| || |||||||||||||||
Sbjct: 44787 tcaacttgttcgcgaagcttctcaccaaaa 44758



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 454   cttcttctttttgcttttcttcacggatgcatca 487
             ||||||||| |||||||||||||| || ||||||
Sbjct: 45018 cttcttcttcttgcttttcttcaccgaggcatca 44985

to top

>gb|AY102151.1| Arabidopsis thaliana At1g56110/T6H22_9 mRNA, complete cds
          Length = 1569

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                        
Query: 542  ttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagtctctcc 601
            ||||| ||||| | ||||||||| || |||||||| ||||| ||||| ||||| || |||
Sbjct: 1274 ttcattacatccacgttcttgcgtggggcaacacctttgtcataaaattctagcctttcc 1215

                                          
Query: 602  tcaacctgttcacgcagcttctcaccaaaa 631
            ||||| ||||| || |||||||||||||||
Sbjct: 1214 tcaacttgttcgcgaagcttctcaccaaaa 1185



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 454  cttcttctttttgcttttcttcacggatgcatca 487
            ||||||||| |||||||||||||| || ||||||
Sbjct: 1356 cttcttcttcttgcttttcttcaccgaggcatca 1323

to top

>gb|AY052337.1| Arabidopsis thaliana At1g56110/T6H22_9 mRNA sequence
          Length = 1398

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                        
Query: 542  ttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagtctctcc 601
            ||||| ||||| | ||||||||| || |||||||| ||||| ||||| ||||| || |||
Sbjct: 1263 ttcattacatccacgttcttgcgtggggcaacacctttgtcataaaattctagcctttcc 1204

                                          
Query: 602  tcaacctgttcacgcagcttctcaccaaaa 631
            ||||| ||||| || |||||||||||||||
Sbjct: 1203 tcaacttgttcgcgaagcttctcaccaaaa 1174



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 454  cttcttctttttgcttttcttcacggatgcatca 487
            ||||||||| |||||||||||||| || ||||||
Sbjct: 1345 cttcttcttcttgcttttcttcaccgaggcatca 1312

to top

>gb|AY039541.1| Arabidopsis thaliana At1g56110/T6H22_9 mRNA, complete cds
          Length = 1777

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                        
Query: 542  ttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagtctctcc 601
            ||||| ||||| | ||||||||| || |||||||| ||||| ||||| ||||| || |||
Sbjct: 1328 ttcattacatccacgttcttgcgtggggcaacacctttgtcataaaattctagcctttcc 1269

                                          
Query: 602  tcaacctgttcacgcagcttctcaccaaaa 631
            ||||| ||||| || |||||||||||||||
Sbjct: 1268 tcaacttgttcgcgaagcttctcaccaaaa 1239



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 454  cttcttctttttgcttttcttcacggatgcatca 487
            ||||||||| |||||||||||||| || ||||||
Sbjct: 1410 cttcttcttcttgcttttcttcaccgaggcatca 1377

to top

>gb|AF302492.1|AF302492 Arabidopsis thaliana NOP56-like protein mRNA, complete cds
          Length = 1569

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                        
Query: 542  ttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagtctctcc 601
            ||||| ||||| | ||||||||| || |||||||| ||||| ||||| ||||| || |||
Sbjct: 1274 ttcattacatccacgttcttgcgtggggcaacacctttgtcataaaattctagcctttcc 1215

                                          
Query: 602  tcaacctgttcacgcagcttctcaccaaaa 631
            ||||| ||||| || |||||||||||||||
Sbjct: 1214 tcaacttgttcgcgaagcttctcaccaaaa 1185



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 454  cttcttctttttgcttttcttcacggatgcatca 487
            ||||||||| |||||||||||||| || ||||||
Sbjct: 1356 cttcttcttcttgcttttcttcaccgaggcatca 1323

to top

>gb|AY087080.1| Arabidopsis thaliana clone 31447 mRNA, complete sequence
          Length = 1752

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                        
Query: 542  ttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagtctctcc 601
            ||||| ||||| | ||||||||| || |||||||| ||||| ||||| ||||| || |||
Sbjct: 1330 ttcattacatccacgttcttgcgtggggcaacacctttgtcataaaattctagcctttcc 1271

                                          
Query: 602  tcaacctgttcacgcagcttctcaccaaaa 631
            ||||| ||||| || |||||||||||||||
Sbjct: 1270 tcaacttgttcgcgaagcttctcaccaaaa 1241



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 454  cttcttctttttgcttttcttcacggatgcatca 487
            ||||||||| |||||||||||||| || ||||||
Sbjct: 1412 cttcttcttcttgcttttcttcaccgaggcatca 1379

to top

>gb|AC135505.15| Medicago truncatula clone mth2-24j8, complete sequence
          Length = 124563

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                         
Query: 530   tcaatagcagctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaag 589
             |||||||||| |||||||||||||| |||||| || || ||||| ||||| || ||||||
Sbjct: 57154 tcaatagcagatttcatcacatcaatgttcttacgaggggcaactcccttatcataaaag 57095

                                                      
Query: 590   tctagtctctcctcaacctgttcacgcagcttctcaccaaa 630
             || |||| ||| ||||| || ||||| || ||||| |||||
Sbjct: 57094 tcaagtcgctcttcaacttgctcacggagtttctccccaaa 57054

to top

>gb|AY553910.1| Brassica juncea putative preRNA processing ribonucleoprotein (Nop1)
           mRNA, partial cds
          Length = 414

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 542 ttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagtctctcc 601
           ||||| ||||| | |||||| || || |||||||| ||||| |||||||| || || |||
Sbjct: 329 ttcatgacatccacgttcttacgtggggcaacacctttgtcataaaagtccagcctttcc 270

                                        
Query: 602 tcaacctgttcacgcagcttctcaccaaa 630
           || || ||||| || ||||||||||||||
Sbjct: 269 tctacttgttcccgaagcttctcaccaaa 241

to top

>dbj|AK116079.1| Ciona intestinalis cDNA, clone:citb007m06, full insert sequence
          Length = 1979

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 654  agcagtcaatacgtgaagcaatggaacatttgtttgccag 693
            ||||||| ||||||||||||||||| |||||||| |||||
Sbjct: 1224 agcagtcgatacgtgaagcaatggagcatttgttagccag 1185

to top

>gb|AC138199.22| Medicago truncatula clone mth2-15g10, complete sequence
          Length = 109479

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                  
Query: 654   agcagtcaatacgtgaagcaatggaacatttgtttgc 690
             |||||||||| ||||| ||||| ||||||||||||||
Sbjct: 62910 agcagtcaattcgtgatgcaattgaacatttgtttgc 62874

to top

>ref|NM_112122.2| Arabidopsis thaliana unknown protein AT3G12860 mRNA, complete cds
          Length = 1500

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 122/152 (80%), Gaps = 2/152 (1%)
 Strand = Plus / Minus

                                                                        
Query: 540  ctttcatcacatcaaggttcttgcggggtgcaacacccttgtcgtaaaagtctagtctct 599
            ||||||| |||||||  ||||| || || |||||||| ||||| |||||||| ||||| |
Sbjct: 1276 ctttcattacatcaacattcttacgtggggcaacacctttgtcataaaagtcaagtcttt 1217

                                                                        
Query: 600  cctcaacctgttcacgcagcttctcaccaaaaa-tggagctgctcatatctgaatagcag 658
            |||| || ||||| |  || |||||||| |||  || || ||||  |||||||  | || 
Sbjct: 1216 cctctacttgttcccttagtttctcaccgaaagctgtag-tgctgttatctgagaaacaa 1158

                                            
Query: 659  tcaatacgtgaagcaatggaacatttgtttgc 690
            ||||| || |||||||||||||| ||||||||
Sbjct: 1157 tcaatccgggaagcaatggaacacttgtttgc 1126

to top

>ref|XM_449423.1| Candida glabrata CBS138 hypothetical protein (CAGL0M01804g) partial
           mRNA
          Length = 2856

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 453 acttcttctttttgcttttcttca 476
           ||||||||||||||||||||||||
Sbjct: 356 acttcttctttttgcttttcttca 333

to top

>emb|CR380959.1| Candida glabrata strain CBS138 chromosome M complete sequence
          Length = 1400893

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 453    acttcttctttttgcttttcttca 476
              ||||||||||||||||||||||||
Sbjct: 211794 acttcttctttttgcttttcttca 211771



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    ttcttctttttcttcttctt 303
              ||||||||||||||||||||
Sbjct: 503168 ttcttctttttcttcttctt 503149

to top

>ref|NM_213223.1| Danio rerio zgc:85717 (zgc:85717), mRNA
          Length = 1696

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 286 cttctttttcttcttcttgggggtctc 312
           |||||| ||||||||||||||||||||
Sbjct: 466 cttcttcttcttcttcttgggggtctc 440

to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 50      cgccgcttcagtccatgccatgc 72
               |||||||||||||||||||||||
Sbjct: 1645621 cgccgcttcagtccatgccatgc 1645643

to top

>ref|XM_418351.1| PREDICTED: Gallus gallus similar to LYRIC (LOC420239), mRNA
          Length = 2667

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 217  tttcttcttctttttcttggatttccc 243
            ||||||||||||||||||||| |||||
Sbjct: 1164 tttcttcttctttttcttggacttccc 1138



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 284  ttcttctttttcttcttctt 303
            ||||||||||||||||||||
Sbjct: 1172 ttcttctttttcttcttctt 1153

to top

>gb|BC067590.1| Danio rerio zgc:85717, mRNA (cDNA clone MGC:85717 IMAGE:6966984),
           complete cds
          Length = 1696

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 286 cttctttttcttcttcttgggggtctc 312
           |||||| ||||||||||||||||||||
Sbjct: 466 cttcttcttcttcttcttgggggtctc 440

to top

>ref|XM_954128.1| Neurospora crassa OR74A hypothetical protein (NCU06874.1) partial
            mRNA
          Length = 3039

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 282  ggttcttctttttcttcttcttggggg 308
            |||||||||| ||||||||||||||||
Sbjct: 1777 ggttcttcttcttcttcttcttggggg 1751

to top

>ref|XM_327159.1| Neurospora crassa OR74A hypothetical protein (NCU06874.1) partial
            mRNA
          Length = 3039

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 282  ggttcttctttttcttcttcttggggg 308
            |||||||||| ||||||||||||||||
Sbjct: 1777 ggttcttcttcttcttcttcttggggg 1751

to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 50      cgccgcttcagtccatgccatgc 72
               |||||||||||||||||||||||
Sbjct: 2892542 cgccgcttcagtccatgccatgc 2892564

to top

>ref|XM_800517.1| Trypanosoma cruzi strain CL Brener nucleolar protein
           (Tc00.1047053503773.50) partial mRNA
          Length = 633

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 600 cctcaacctgttcacgcagcttctcaccaaa 630
           |||| |||||||| |||||||||||||||||
Sbjct: 427 cctccacctgttcccgcagcttctcaccaaa 397

to top

>ref|XM_789685.1| PREDICTED: Strongylocentrotus purpuratus similar to nucleolar protein
            5A (LOC590067), mRNA
          Length = 1959

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 284  ttcttctttttcttcttcttggg 306
            |||||||||||||||||||||||
Sbjct: 1778 ttcttctttttcttcttcttggg 1756



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 284  ttcttctttttcttcttctt 303
            ||||||||||||||||||||
Sbjct: 1916 ttcttctttttcttcttctt 1897



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 284  ttcttctttttcttcttctt 303
            ||||||||||||||||||||
Sbjct: 1853 ttcttctttttcttcttctt 1834

to top

>ref|XM_783146.1| PREDICTED: Strongylocentrotus purpuratus similar to CG32466-PA,
            isoform A (LOC583226), mRNA
          Length = 1746

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 284  ttcttctttttcttcttcttggg 306
            |||||||||||||||||||||||
Sbjct: 1355 ttcttctttttcttcttcttggg 1333

to top

>emb|X83872.1|HVDNACREB H.vulgaris mRNA for cAMP response element binding protein
          Length = 1483

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 217  tttcttcttctttttcttggatt 239
            |||||||||||||||||||||||
Sbjct: 1445 tttcttcttctttttcttggatt 1423

to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 50      cgccgcttcagtccatgccatgc 72
               |||||||||||||||||||||||
Sbjct: 2622577 cgccgcttcagtccatgccatgc 2622599

to top

>emb|CR376754.6| Zebrafish DNA sequence from clone CH211-254O14 in linkage group 2,
             complete sequence
          Length = 84275

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 453   acttcttctttttgcttttcttc 475
             |||||||||||||||||||||||
Sbjct: 62819 acttcttctttttgcttttcttc 62841

to top

>emb|BX957352.9| Zebrafish DNA sequence from clone CH211-114O15 in linkage group 23,
              complete sequence
          Length = 180880

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 284    ttcttctttttcttcttcttggg 306
              |||||||||||||||||||||||
Sbjct: 132620 ttcttctttttcttcttcttggg 132598

to top

>emb|CR381694.8| Zebrafish DNA sequence from clone CH211-55I2 in linkage group 10,
              complete sequence
          Length = 178736

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 284    ttcttctttttcttcttcttggg 306
              |||||||||||||||||||||||
Sbjct: 168382 ttcttctttttcttcttcttggg 168360

to top

>gb|AY680460.1| Macaca mulatta clone ds1_j02_t7_068 succinate dehydrogenase complex
           subunit C 15 kDa integral membrane protein (SDHC) mRNA,
           3' UTR
          Length = 453

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 216 atttcttcttctttttcttggatttcc 242
           ||||||| |||||||||||||||||||
Sbjct: 386 atttctttttctttttcttggatttcc 412

to top

>ref|XM_683055.1| PREDICTED: Danio rerio similar to myristoylated alanine-rich C
           kinase substrate 2 (LOC572949), mRNA
          Length = 1587

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 286 cttctttttcttcttcttgggggtctc 312
           |||||| ||||||||||||||||||||
Sbjct: 493 cttcttcttcttcttcttgggggtctc 467

to top

>emb|BX000467.10| Zebrafish DNA sequence from clone CH211-1K7 in linkage group 19, complete
              sequence
          Length = 120440

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 277    atcgcggttcttctttttcttcttctt 303
              ||||||||||||||| |||||||||||
Sbjct: 100455 atcgcggttcttcttcttcttcttctt 100481

to top

>gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome
          Length = 2427734

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 213     tggatttcttcttctttttctt 234
               ||||||||||||||||||||||
Sbjct: 2061403 tggatttcttcttctttttctt 2061382

to top

>ref|XM_476021.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 3621

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 203 ttcttctttttcttcttcttgg 182

to top

>ref|NM_212675.1| Danio rerio eukaryotic translation initiation factor 2, subunit 2
           beta (eif2s2), mRNA
          Length = 1317

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 122 ttcttctttttcttcttcttgg 101

to top

>ref|XM_479549.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1271

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 266 ttcttctttttcttcttcttgg 245

to top

>gb|BC106256.1| Xenopus laevis cDNA clone MGC:130708 IMAGE:7979589, complete cds
          Length = 1473

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 503 ttcttctttttcttcttcttgg 482

to top

>ref|XM_361116.1| Magnaporthe grisea 70-15 hypothetical protein (MG03659.4) partial
           mRNA
          Length = 1251

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 tcttggatttcttcttcttttt 231
           ||||||||||||||||||||||
Sbjct: 724 tcttggatttcttcttcttttt 703

to top

>gb|BC071085.1| Xenopus laevis cDNA clone IMAGE:6631258, partial cds
          Length = 1248

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 149 ttcttctttttcttcttcttgg 128

to top

>gb|AC130728.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0663C08,
             complete sequence
          Length = 142196

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 284   ttcttctttttcttcttcttgg 305
             ||||||||||||||||||||||
Sbjct: 92411 ttcttctttttcttcttcttgg 92432

to top

>gb|AC148920.1| Mus musculus BAC clone RP23-273O10 from chromosome 19, complete sequence
          Length = 224526

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 283    gttcttctttttcttcttcttg 304
              ||||||||||||||||||||||
Sbjct: 218533 gttcttctttttcttcttcttg 218554

to top

>ref|XM_658363.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5851.2), mRNA
          Length = 16920

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 284  ttcttctttttcttcttcttgg 305
            ||||||||||||||||||||||
Sbjct: 9950 ttcttctttttcttcttcttgg 9929

to top

>ref|XM_534598.2| PREDICTED: Canis familiaris similar to Nuclear autoantigen Sp-100
            (Speckled 100 kDa) (Nuclear dot-associated Sp100 protein)
            (Lysp100b) (LOC477402), mRNA
          Length = 2591

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 284  ttcttctttttcttcttcttgg 305
            ||||||||||||||||||||||
Sbjct: 1869 ttcttctttttcttcttcttgg 1848

to top

>ref|XM_533935.2| PREDICTED: Canis familiaris similar to Transcription initiation
            factor IIF alpha subunit (TFIIF-alpha) (Transcription
            initiation factor RAP74) (General transcription factor
            IIF polypeptide 1 74 kDa subunit protein) (LOC476731),
            mRNA
          Length = 1896

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 284  ttcttctttttcttcttcttgg 305
            ||||||||||||||||||||||
Sbjct: 1055 ttcttctttttcttcttcttgg 1034

to top

>ref|XM_847563.1| PREDICTED: Canis familiaris similar to lung cancer
           metastasis-related protein 1 homolog (LOC612925), mRNA
          Length = 761

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 281 cggttcttctttttcttcttct 302
           ||||||||||||||||||||||
Sbjct: 697 cggttcttctttttcttcttct 676

to top

>ref|XM_387134.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG06958.1)
           partial mRNA
          Length = 1992

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 286 cttctttttcttcttcttgggg 307
           ||||||||||||||||||||||
Sbjct: 432 cttctttttcttcttcttgggg 411

to top

>emb|BX629346.17| Zebrafish DNA sequence from clone DKEY-16N21 in linkage group 6, complete
              sequence
          Length = 214213

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 284    ttcttctttttcttcttcttgg 305
              ||||||||||||||||||||||
Sbjct: 101599 ttcttctttttcttcttcttgg 101578

to top

>ref|XM_792617.1| PREDICTED: Strongylocentrotus purpuratus similar to CG3335-PA
           (LOC593127), partial mRNA
          Length = 927

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 374 ttcttctttttcttcttcttgg 353

to top

>emb|BX050957.1|CNS09BHD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 87  ttcttctttttcttcttcttgg 108

to top

>emb|BX021535.1|CNS08OS3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 543 ttcttctttttcttcttcttgg 522

to top

>emb|BX276106.6| Zebrafish DNA sequence from clone DKEY-1N18 in linkage group 6,
             complete sequence
          Length = 220671

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 284   ttcttctttttcttcttcttgg 305
             ||||||||||||||||||||||
Sbjct: 23834 ttcttctttttcttcttcttgg 23813

to top

>emb|AL929183.14| Zebrafish DNA sequence from clone CH211-142M8 in linkage group 25,
              complete sequence
          Length = 180603

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 61     tccatgccatgctacattacag 82
              ||||||||||||||||||||||
Sbjct: 157287 tccatgccatgctacattacag 157266

to top

>gb|BC066706.1| Danio rerio eukaryotic translation initiation factor 2, subunit 2
           beta, mRNA (cDNA clone MGC:77084 IMAGE:6960321),
           complete cds
          Length = 1317

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 122 ttcttctttttcttcttcttgg 101

to top

>gb|AC153131.5| Mus musculus BAC clone RP24-356O12 from chromosome 19, complete sequence
          Length = 184864

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 283    gttcttctttttcttcttcttg 304
              ||||||||||||||||||||||
Sbjct: 112032 gttcttctttttcttcttcttg 112053

to top

>ref|XM_692813.1| PREDICTED: Danio rerio similar to Eukaryotic translation initiation
           factor 2, subunit 2 beta (LOC569429), mRNA
          Length = 1332

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 167 ttcttctttttcttcttcttgg 146

to top

>ref|XM_625921.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd4_3450),
            partial mRNA
          Length = 8790

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 285  tcttctttttcttcttcttggg 306
            ||||||||||||||||||||||
Sbjct: 1491 tcttctttttcttcttcttggg 1470

to top

>gb|BC097508.1| Xenopus laevis cDNA clone IMAGE:5048572, partial cds
          Length = 1111

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 120 ttcttctttttcttcttcttgg 99

to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 284      ttcttctttttcttcttcttgg 305
                ||||||||||||||||||||||
Sbjct: 29313754 ttcttctttttcttcttcttgg 29313775



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 284     ttcttctttttcttcttctt 303
               ||||||||||||||||||||
Sbjct: 2755819 ttcttctttttcttcttctt 2755800



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 284     ttcttctttttcttcttctt 303
               ||||||||||||||||||||
Sbjct: 2164529 ttcttctttttcttcttctt 2164548

to top

>gb|AY737016.1| Oreochromis mossambicus clone Contig11 XNop56 mRNA, partial cds
          Length = 350

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 605 acctgttcacgcagcttctcaccaaa 630
           ||||||||||||||||| ||||||||
Sbjct: 154 acctgttcacgcagcttgtcaccaaa 129

to top

>gb|AC084533.1|CBRG22N08 Caenorhabditis briggsae cosmid G22N08, complete sequence
          Length = 27488

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 284   ttcttctttttcttcttcttgg 305
             ||||||||||||||||||||||
Sbjct: 25171 ttcttctttttcttcttcttgg 25150

to top

>dbj|AP005099.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0008J01
          Length = 159900

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 284   ttcttctttttcttcttcttgg 305
             ||||||||||||||||||||||
Sbjct: 66367 ttcttctttttcttcttcttgg 66388

to top

>emb|AJ277097.1|HVU277097 Hordeum vulgare mRNA for putative kinetochore protein (cbf5 gene)
          Length = 1265

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 211 cttggatttcttcttctttttcttggattt 240
           |||||||||  |||||||||||||||||||
Sbjct: 113 cttggatttgctcttctttttcttggattt 84

to top

>dbj|AK099632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013058P09, full
           insert sequence
          Length = 1017

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 542 ttcttctttttcttcttcttgg 521

to top

>dbj|AK073484.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042B06, full
           insert sequence
          Length = 4187

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 358 ttcttctttttcttcttcttgg 337

to top

>dbj|AK066982.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013093I07, full
           insert sequence
          Length = 1270

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 265 ttcttctttttcttcttcttgg 244

to top

>gb|AC154719.2| Mus musculus BAC clone RP24-370O15 from 16, complete sequence
          Length = 163408

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 282   ggttcttctttttcttcttctt 303
             ||||||||||||||||||||||
Sbjct: 55133 ggttcttctttttcttcttctt 55154

to top

>dbj|AK059026.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-B10, full
           insert sequence
          Length = 471

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 281 cggttcttctttttcttcttcttggg 306
           ||||||||||| ||||||||||||||
Sbjct: 259 cggttcttcttcttcttcttcttggg 234

to top

>gb|AY103698.1| Zea mays PCO083605 mRNA sequence
          Length = 1319

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 284 ttcttctttttcttcttcttgg 305
           ||||||||||||||||||||||
Sbjct: 197 ttcttctttttcttcttcttgg 176

to top

>emb|AL837525.5| Mouse DNA sequence from clone RP23-233N12 on chromosome 4, complete
            sequence
          Length = 15812

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 282  ggttcttctttttcttcttctt 303
            ||||||||||||||||||||||
Sbjct: 4177 ggttcttctttttcttcttctt 4198

to top

>gb|AC166253.18| Mus musculus  BAC RP23-231M6 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 207999

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 19033 gttcttctttttcttcttctt 19053

to top

>gb|BC087358.1| Xenopus laevis cDNA clone IMAGE:7205191
          Length = 1136

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 945 ttcttctttttcttcttcttg 925

to top

>gb|AC161382.4| Mus musculus BAC clone RP23-25A17 from chromosome 9, complete sequence
          Length = 169123

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 47656 ttcttctttttcttcttcttg 47636

to top

>gb|AC163390.2| Mus musculus chromosome 1, clone RP24-300C19, complete sequence
          Length = 180465

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    ttcttctttttcttcttcttg 304
              |||||||||||||||||||||
Sbjct: 134773 ttcttctttttcttcttcttg 134793

to top

>gb|BC082559.1| Mus musculus mediator of RNA polymerase II transcription, subunit
           19 homolog (yeast), mRNA (cDNA clone MGC:100327
           IMAGE:30606373), complete cds
          Length = 1893

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 622 ttcttctttttcttcttcttg 602

to top

>gb|BC044302.1| Mus musculus mediator of RNA polymerase II transcription, subunit
           19 homolog (yeast), mRNA (cDNA clone IMAGE:5137182)
          Length = 1789

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 519 ttcttctttttcttcttcttg 499

to top

>gb|BC044207.1| Mus musculus mediator of RNA polymerase II transcription, subunit
           19 homolog (yeast), mRNA (cDNA clone IMAGE:5136341),
           partial cds
          Length = 1789

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 519 ttcttctttttcttcttcttg 499

to top

>gb|BC025475.1| Mus musculus mediator of RNA polymerase II transcription, subunit
           19 homolog (yeast), mRNA (cDNA clone IMAGE:5352943),
           partial cds
          Length = 1622

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 231 ttcttctttttcttcttcttg 211

to top

>gb|AC102219.11| Mus musculus chromosome 15, clone RP24-96K14, complete sequence
          Length = 194425

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 174986 gttcttctttttcttcttctt 175006



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 174956 gttcttctttttcttcttctt 174976

to top

>ref|XM_641690.1| Dictyostelium discoideum hypothetical protein (DDB0191041), partial
           mRNA
          Length = 1983

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 480 ttcttctttttcttcttcttg 460

to top

>ref|XM_636133.1| Dictyostelium discoideum hypothetical protein (DDB0206358), partial
           mRNA
          Length = 2457

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 574 gttcttctttttcttcttctt 554

to top

>ref|XM_635401.1| Dictyostelium discoideum hypothetical protein (DDB0204282), partial
            mRNA
          Length = 1836

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 284  ttcttctttttcttcttcttg 304
            |||||||||||||||||||||
Sbjct: 1506 ttcttctttttcttcttcttg 1486

to top

>ref|XM_467583.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 737

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 248 ttcttctttttcttcttcttg 228

to top

>gb|AC151804.1| Solanum demissum chromosome 5 BAC PGEC475B22 genomic sequence, complete
             sequence
          Length = 104138

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 20671 gttcttctttttcttcttctt 20651

to top

>gb|AE017356.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 14, complete
             sequence
          Length = 762694

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 27225 ttcttctttttcttcttcttg 27205

to top

>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete
              sequence
          Length = 1178688

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    ttcttctttttcttcttcttg 304
              |||||||||||||||||||||
Sbjct: 539568 ttcttctttttcttcttcttg 539548

to top

>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete
              sequence
          Length = 2105742

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    ttcttctttttcttcttcttg 304
              |||||||||||||||||||||
Sbjct: 966408 ttcttctttttcttcttcttg 966388

to top

>gb|AC008196.8| Drosophila melanogaster clone BACR30J14, complete sequence
          Length = 179562

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 48083 gttcttctttttcttcttctt 48103

to top

>ref|XM_366910.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
            (MG02986.4) partial mRNA
          Length = 5349

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 282  ggttcttctttttcttcttcttggg 306
            |||||||||| ||||||||||||||
Sbjct: 5038 ggttcttcttcttcttcttcttggg 5014

to top

>ref|XM_957409.1| Neurospora crassa OR74A hypothetical protein (NCU08289.1) partial
            mRNA
          Length = 3402

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  gttcttctttttcttcttctt 303
            |||||||||||||||||||||
Sbjct: 1332 gttcttctttttcttcttctt 1312

to top

>ref|XM_328994.1| Neurospora crassa OR74A hypothetical protein (NCU08289.1) partial
            mRNA
          Length = 3402

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  gttcttctttttcttcttctt 303
            |||||||||||||||||||||
Sbjct: 1332 gttcttctttttcttcttctt 1312

to top

>gb|AY614011.1| Pelmatohydra robusta mRNA 5' cap-methyltransferase (CnCMT) mRNA,
           complete cds
          Length = 2164

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 209 gttcttctttttcttcttctt 189

to top

>gb|BC068393.1| Danio rerio cDNA clone IMAGE:6961702, partial cds
          Length = 2411

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 123 ttcttctttttcttcttcttg 103



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 ttcttctttttcttcttctt 303
           ||||||||||||||||||||
Sbjct: 297 ttcttctttttcttcttctt 278

to top

>gb|AC133089.4| Mus musculus BAC clone RP24-165M3 from chromosome 19, complete sequence
          Length = 149637

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 285   tcttctttttcttcttcttgg 305
             |||||||||||||||||||||
Sbjct: 61154 tcttctttttcttcttcttgg 61134

to top

>ref|XM_980768.1| PREDICTED: Mus musculus neuron navigator 3 (Nav3), mRNA
          Length = 7713

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  tttcttcttctttttcttgga 237
            |||||||||||||||||||||
Sbjct: 5037 tttcttcttctttttcttgga 5017

to top

>ref|XM_001003696.1| PREDICTED: Mus musculus similar to neuron navigator 3, transcript
           variant 3 (LOC676640), mRNA
          Length = 4331

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 217 tttcttcttctttttcttgga 237
           |||||||||||||||||||||
Sbjct: 221 tttcttcttctttttcttgga 201

to top

>ref|XM_001003704.1| PREDICTED: Mus musculus similar to neuron navigator 3, transcript
            variant 4 (LOC676640), mRNA
          Length = 9133

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  tttcttcttctttttcttgga 237
            |||||||||||||||||||||
Sbjct: 5023 tttcttcttctttttcttgga 5003

to top

>ref|XM_001003712.1| PREDICTED: Mus musculus similar to neuron navigator 3, transcript
            variant 5 (LOC676640), mRNA
          Length = 9857

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  tttcttcttctttttcttgga 237
            |||||||||||||||||||||
Sbjct: 5023 tttcttcttctttttcttgga 5003

to top

>ref|XM_001003689.1| PREDICTED: Mus musculus similar to neuron navigator 3, transcript
            variant 2 (LOC676640), mRNA
          Length = 7782

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  tttcttcttctttttcttgga 237
            |||||||||||||||||||||
Sbjct: 5106 tttcttcttctttttcttgga 5086

to top

>ref|XM_001004140.1| PREDICTED: Mus musculus RIKEN cDNA 9630020C08 gene, transcript
           variant 3 (9630020C08Rik), mRNA
          Length = 4331

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 217 tttcttcttctttttcttgga 237
           |||||||||||||||||||||
Sbjct: 221 tttcttcttctttttcttgga 201

to top

>ref|XM_001004137.1| PREDICTED: Mus musculus RIKEN cDNA 9630020C08 gene, transcript
            variant 2 (9630020C08Rik), mRNA
          Length = 7782

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  tttcttcttctttttcttgga 237
            |||||||||||||||||||||
Sbjct: 5106 tttcttcttctttttcttgga 5086

to top

>ref|XM_745341.1| Aspergillus fumigatus Af293 hypothetical protein (Afu1g06850)
           partial mRNA
          Length = 2187

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 285 gttcttctttttcttcttctt 265

to top

>ref|XM_389573.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09397.1)
           partial mRNA
          Length = 1695

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 182 ttcttctttttcttcttcttg 162

to top

>ref|XM_389429.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09253.1)
           partial mRNA
          Length = 1572

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 281 cggttcttctttttcttcttc 301
           |||||||||||||||||||||
Sbjct: 584 cggttcttctttttcttcttc 564

to top

>ref|XM_569941.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNC03030) partial mRNA
          Length = 1830

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 284  ttcttctttttcttcttcttg 304
            |||||||||||||||||||||
Sbjct: 1404 ttcttctttttcttcttcttg 1384

to top

>ref|XM_572993.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNI01950) partial mRNA
          Length = 1116

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 152 ttcttctttttcttcttcttg 132

to top

>ref|XM_568517.1| Cryptococcus neoformans var. neoformans JEC21 glycylpeptide
           N-tetradecanoyltransferase (CNN00080) partial mRNA
          Length = 1876

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 230 ttcttctttttcttcttcttg 210

to top

>gb|AC121786.3| Mus musculus BAC clone RP23-387F9 from chromosome 2, complete sequence
          Length = 208632

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 87587 ttcttctttttcttcttcttg 87607

to top

>gb|AY142087.1| Borrelia burgdorferi strain N40 plasmid group cp32-10 Erp26 protein
           (erp26) gene, complete cds
          Length = 1290

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 341 ttcttctttttcttcttcttg 321

to top

>gb|AC121871.3| Mus musculus BAC clone RP24-121J1 from chromosome 10, complete sequence
          Length = 214405

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 15701 gttcttctttttcttcttctt 15681

to top

>gb|AC100752.10| Mus musculus chromosome 3, clone RP23-2A4, complete sequence
          Length = 208757

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 114736 gttcttctttttcttcttctt 114756

to top

>emb|CR720005.2|CNS0GII3 Tetraodon nigroviridis full-length cDNA
          Length = 1764

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 210 tcttggatttcttcttctttttctt 234
           ||||||||||||| |||||||||||
Sbjct: 374 tcttggatttctttttctttttctt 350

to top

>emb|CR716569.2|CNS0GFUQ Tetraodon nigroviridis full-length cDNA
          Length = 351

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 139 gttcttctttttcttcttctt 119

to top

>emb|CR697488.2|CNS0G14S Tetraodon nigroviridis full-length cDNA
          Length = 1645

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 210 tcttggatttcttcttctttttctt 234
           ||||||||||||| |||||||||||
Sbjct: 253 tcttggatttctttttctttttctt 229

to top

>emb|CR696725.2|CNS0G0JL Tetraodon nigroviridis full-length cDNA
          Length = 1766

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 210 tcttggatttcttcttctttttctt 234
           ||||||||||||| |||||||||||
Sbjct: 372 tcttggatttctttttctttttctt 348

to top

>gb|AC100120.9| Mus musculus chromosome 10, clone RP23-40I1, complete sequence
          Length = 236895

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 217    tttcttcttctttttcttgga 237
              |||||||||||||||||||||
Sbjct: 147077 tttcttcttctttttcttgga 147057

to top

>emb|AL353742.23| Human DNA sequence from clone RP11-505C13 on chromosome 9q31.1-32
             Contains part of a novel gene, complete sequence
          Length = 157657

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 439   agcctcagctttggacttcttcttt 463
             ||||||||||||||||||| |||||
Sbjct: 75487 agcctcagctttggacttcctcttt 75463

to top

>ref|XM_788664.1| PREDICTED: Strongylocentrotus purpuratus similar to activating
            transcription factor 6 (LOC589006), mRNA
          Length = 1869

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 279  cgcggttcttctttttcttcttctt 303
            |||| ||||||||||||||||||||
Sbjct: 1342 cgcgcttcttctttttcttcttctt 1318

to top

>ref|XM_788091.1| PREDICTED: Strongylocentrotus purpuratus similar to mediator of RNA
           polymerase II transcription, subunit 19 homolog
           (LOC588405), mRNA
          Length = 1143

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 656 ttcttctttttcttcttcttg 636

to top

>emb|BX011696.1|CNS08H6S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 106

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 284 ttcttctttttcttcttcttggggg 308
           |||||||| ||||||||||||||||
Sbjct: 15  ttcttcttcttcttcttcttggggg 39

to top

>ref|XM_778473.1| PREDICTED: Strongylocentrotus purpuratus similar to CG6066-PA
           (LOC578296), mRNA
          Length = 971

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 210 tcttggatttcttcttctttttctt 234
           |||| ||||||||||||||||||||
Sbjct: 318 tctttgatttcttcttctttttctt 294

to top

>ref|NM_001011242.1| Xenopus tropicalis retinitis pigmentosa 9 (autosomal dominant)
           (rp9), mRNA
          Length = 1107

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 678 ttcttctttttcttcttcttg 658

to top

>emb|BX294012.1|NC80A10 Neurospora crassa DNA linkage group V Cosmid contig 80A10
          Length = 161126

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 27714 gttcttctttttcttcttctt 27734

to top

>emb|AL161518.2|ATCHRIV30 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 30
          Length = 198136

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 127009 gttcttctttttcttcttctt 126989

to top

>emb|AL049525.1|ATF25I24 Arabidopsis thaliana DNA chromosome 4, BAC clone F25I24 (ESSA project)
          Length = 95799

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 45985 gttcttctttttcttcttctt 45965

to top

>emb|AJ294815.1|MYA294815 Tapesia yallundae tyg1 gene for G protein alpha subunit, exons 1-4
          Length = 3733

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 284  ttcttctttttcttcttcttg 304
            |||||||||||||||||||||
Sbjct: 2337 ttcttctttttcttcttcttg 2317

to top

>emb|AL606522.6| Mouse DNA sequence from clone RP23-19L22 on chromosome 11 Contains the
              Actr2 gene for ARP2 actin-related protein 2 homolog
              (yeast), a small nuclear ribonucleoprotein polypeptide G
              (Snrpg) pseudogene, two novel genes, the Rab1 gene for
              RAB1, member RAS oncogene family and three CpG islands,
              complete sequence
          Length = 203071

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 155058 gttcttctttttcttcttctt 155038

to top

>emb|BX004866.22| Mouse DNA sequence from clone RP23-360A7 on chromosome 4 Contains a
             ribosomal protein 7a (Rpl7a) pseudogene, complete sequence
          Length = 161600

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 210   tcttggatttcttcttctttttcttggatttcc 242
             ||||| ||||||||||||| |||||| ||||||
Sbjct: 59235 tcttgcatttcttcttcttcttcttgcatttcc 59267

to top

>emb|CR376729.7| Zebrafish DNA sequence from clone CH211-282K21 in linkage group 8,
            complete sequence
          Length = 39033

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  gttcttctttttcttcttctt 303
            |||||||||||||||||||||
Sbjct: 9856 gttcttctttttcttcttctt 9836

to top

>gb|AC023712.5| Drosophila melanogaster X BAC RP98-1M22 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 170129

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 11846 ttcttctttttcttcttcttg 11866

to top

>dbj|AK222455.1| Ciona intestinalis mRNA for translation initiation factor, complete
           cds, clone: cicl002k15
          Length = 1538

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 158 ttcttctttttcttcttcttg 138

to top

>ref|NM_199640.1| Danio rerio methionyl aminopeptidase 2 (metap2), mRNA
          Length = 2462

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 161 ttcttctttttcttcttcttg 141

to top

>emb|X60437.2|DSPTEH2 Drosophila subobscura Dnop56 gene and P transposable element (pDsG22)
          Length = 4881

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  gttcttctttttcttcttctt 303
            |||||||||||||||||||||
Sbjct: 2279 gttcttctttttcttcttctt 2259

to top

>gb|AC023720.4| Drosophila melanogaster X BAC RP98-7F15 (Roswell Park Cancer
            Institute Drosophila BAC Library) complete sequence
          Length = 179205

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 286  cttctttttcttcttcttggg 306
            |||||||||||||||||||||
Sbjct: 5047 cttctttttcttcttcttggg 5027

to top

>gb|AC023692.5| Drosophila melanogaster X BAC RP98-15B10 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 163090

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 39103 ttcttctttttcttcttcttg 39083

to top

>emb|BX088710.15| Zebrafish DNA sequence from clone DKEY-3L5 in linkage group 18,
             complete sequence
          Length = 101016

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 92734 gttcttctttttcttcttctt 92714

to top

>gb|AC023682.4| Drosophila melanogaster X BAC RP98-7F10 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 179236

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 286    cttctttttcttcttcttggg 306
              |||||||||||||||||||||
Sbjct: 142430 cttctttttcttcttcttggg 142410

to top

>gb|BC055563.1| Danio rerio methionyl aminopeptidase 2, mRNA (cDNA clone MGC:66250
           IMAGE:3819580), complete cds
          Length = 2462

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 161 ttcttctttttcttcttcttg 141

to top

>ref|NM_166094.1| Drosophila melanogaster SRPK CG8174-RC, transcript variant C (SRPK),
            mRNA
          Length = 4483

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  gttcttctttttcttcttctt 303
            |||||||||||||||||||||
Sbjct: 1123 gttcttctttttcttcttctt 1103

to top

>ref|NM_166093.1| Drosophila melanogaster SRPK CG8174-RA, transcript variant A (SRPK),
            mRNA
          Length = 5137

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  gttcttctttttcttcttctt 303
            |||||||||||||||||||||
Sbjct: 1771 gttcttctttttcttcttctt 1751

to top

>ref|NM_142783.2| Drosophila melanogaster Nop56 CG13849-RA (Nop56), mRNA
          Length = 1746

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  gttcttctttttcttcttctt 303
            |||||||||||||||||||||
Sbjct: 1576 gttcttctttttcttcttctt 1556

to top

>ref|NM_137190.2| Drosophila melanogaster SRPK CG8174-RB, transcript variant B (SRPK),
            mRNA
          Length = 4977

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  gttcttctttttcttcttctt 303
            |||||||||||||||||||||
Sbjct: 1611 gttcttctttttcttcttctt 1591

to top

>dbj|AB128125.1| Vigna angularis DNA, microsatellite locus CEDG029, cultivar:ACC1645
          Length = 163

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 117 gttcttctttttcttcttctt 97

to top

>dbj|AB128124.1| Vigna angularis DNA, microsatellite locus CEDG029, cultivar:Tochigi
           enba No.1
          Length = 165

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 119 gttcttctttttcttcttctt 99

to top

>dbj|AB128123.1| Vigna angularis DNA, microsatellite locus CEDG029, cultivar:ACC2331
          Length = 167

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 121 gttcttctttttcttcttctt 101

to top

>dbj|AB128122.1| Vigna angularis DNA, microsatellite locus CEDG029, isolate:Bato08
          Length = 169

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 123 gttcttctttttcttcttctt 103

to top

>dbj|AB128121.1| Vigna angularis DNA, microsatellite locus CEDG029, isolate:Bato06
          Length = 183

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 137 gttcttctttttcttcttctt 117

to top

>dbj|AB128120.1| Vigna angularis DNA, microsatellite locus CEDG029,
           cultivar:Erimoshouzu
          Length = 189

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 143 gttcttctttttcttcttctt 123

to top

>dbj|AB128119.1| Vigna angularis DNA, microsatellite locus CEDG029, isolate:Bato04
          Length = 191

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 145 gttcttctttttcttcttctt 125

to top

>dbj|AB128118.1| Vigna angularis DNA, microsatellite locus CEDG029, cultivar:ACC2334
          Length = 193

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 147 gttcttctttttcttcttctt 127

to top

>ref|NM_079319.2| Drosophila melanogaster Eukaryotic initiation factor 2 CG4153-RA
           (eIF-2beta), mRNA
          Length = 1136

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 340 ttcttctttttcttcttcttg 320

to top

>gb|AC024600.5| Homo sapiens chromosome 10 clone RP11-179K3, complete sequence
          Length = 147878

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 210    tcttggatttcttcttctttt 230
              |||||||||||||||||||||
Sbjct: 128950 tcttggatttcttcttctttt 128970

to top

>gb|AC098487.1| Homo sapiens BAC clone RP11-499E18 from 4, complete sequence
          Length = 163914

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 159633 gttcttctttttcttcttctt 159613

to top

>gb|AE010192.1| Pyrococcus furiosus DSM 3638, section 67 of 173 of the complete
            genome
          Length = 11947

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 91   aagggctaaaagaggctcacagagt 115
            ||||||||||||||||| |||||||
Sbjct: 6734 aagggctaaaagaggcttacagagt 6710

to top

>ref|XM_704119.1| PREDICTED: Danio rerio similar to Heat shock protein HSP 90-alpha
           (HSP 86), transcript variant 3 (LOC565155), mRNA
          Length = 2520

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 973 ttcttctttttcttcttcttg 953

to top

>ref|XM_683871.1| PREDICTED: Danio rerio similar to Heat shock protein HSP 90-alpha
           (HSP 86), transcript variant 1 (LOC565155), mRNA
          Length = 2562

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 934 ttcttctttttcttcttcttg 914

to top

>ref|XM_704118.1| PREDICTED: Danio rerio similar to Heat shock protein HSP 90-alpha
           (HSP 86), transcript variant 2 (LOC565155), mRNA
          Length = 2601

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 973 ttcttctttttcttcttcttg 953

to top

>dbj|AK168787.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920055E05 product:Hypothetical
           proline-rich region/Bipartite nuclear localization
           signal containing protein, full insert sequence
          Length = 1873

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 625 ttcttctttttcttcttcttg 605

to top

>ref|XM_682791.1| PREDICTED: Danio rerio similar to heat shock protein 90-alpha
            (LOC559452), mRNA
          Length = 2930

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 284  ttcttctttttcttcttcttg 304
            |||||||||||||||||||||
Sbjct: 2608 ttcttctttttcttcttcttg 2588

to top

>ref|XM_696969.1| PREDICTED: Danio rerio hypothetical protein LOC554501 (LOC554501),
           mRNA
          Length = 2426

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 163 ttcttctttttcttcttcttg 143



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 ttcttctttttcttcttctt 303
           ||||||||||||||||||||
Sbjct: 337 ttcttctttttcttcttctt 318

to top

>dbj|AK160579.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410170P04 product:Hypothetical proline-rich
           region/Bipartite nuclear localization signal containing
           protein, full insert sequence
          Length = 1544

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 623 ttcttctttttcttcttcttg 603

to top

>gb|AF223353.1|AF223353 Drosophila melanogaster nucleolar KKE/D repeat protein (Nop56) mRNA,
            complete cds
          Length = 1756

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  gttcttctttttcttcttctt 303
            |||||||||||||||||||||
Sbjct: 1564 gttcttctttttcttcttctt 1544

to top

>gb|AC091223.2| Drosophila melanogaster 3L BAC RP98-48G6 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 170988

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 94963 ttcttctttttcttcttcttg 94983

to top

>dbj|AK010552.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410018M14 product:hypothetical Proline-rich
           region/Bipartite nuclear localization signal containing
           protein, full insert sequence
          Length = 2036

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 635 ttcttctttttcttcttcttg 615

to top

>gb|AY051644.1| Drosophila melanogaster GM14238 full length cDNA
          Length = 914

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 722 gttcttctttttcttcttctt 702

to top

>gb|AF047663.3| Caenorhabditis elegans cosmid W09G12, complete sequence
          Length = 32179

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 454   cttcttctttttgcttttctt 474
             |||||||||||||||||||||
Sbjct: 27335 cttcttctttttgcttttctt 27315

to top

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 486     caccattctctttgccgtcatcatc 510
               ||||||||||||||||| |||||||
Sbjct: 2881626 caccattctctttgccgccatcatc 2881650

to top

>dbj|AK005399.1| Mus musculus adult female placenta cDNA, RIKEN full-length enriched
           library, clone:1600002M17 product:RIKEN cDNA 2410018M14
           gene, full insert sequence
          Length = 1209

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 625 ttcttctttttcttcttcttg 605

to top

>ref|NM_067656.1| Caenorhabditis elegans W09G12.7 (W09G12.7) mRNA, complete cds
          Length = 1107

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 454 cttcttctttttgcttttctt 474
           |||||||||||||||||||||
Sbjct: 306 cttcttctttttgcttttctt 286

to top

>gb|AE003738.3| Drosophila melanogaster chromosome 3R, section 76 of 118 of the complete
              sequence
          Length = 287397

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 285508 gttcttctttttcttcttctt 285528

to top

>gb|BC055404.1| Mus musculus mediator of RNA polymerase II transcription, subunit
           19 homolog (yeast), mRNA (cDNA clone IMAGE:5009533)
          Length = 660

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 612 ttcttctttttcttcttcttg 592

to top

>gb|AC115748.8| Mus musculus chromosome 1, clone RP23-13N24, complete sequence
          Length = 202092

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    ttcttctttttcttcttcttg 304
              |||||||||||||||||||||
Sbjct: 199708 ttcttctttttcttcttcttg 199688

to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 62       ccatgccatgctacattacag 82
                |||||||||||||||||||||
Sbjct: 15950929 ccatgccatgctacattacag 15950949

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 284      ttcttctttttcttcttcttg 304
                |||||||||||||||||||||
Sbjct: 30296890 ttcttctttttcttcttcttg 30296910

to top

>gb|AC008343.4|AC008343 Drosophila melanogaster, chromosome 2R, region 51F-52A, BAC clone
             BACR03D24, complete sequence
          Length = 158402

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 34896 gttcttctttttcttcttctt 34876

to top

>gb|AF024682.1| Drosophila guanche P element cluster, partial sequence
          Length = 1732

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 553 gttcttctttttcttcttctt 533

to top

>gb|AF301149.1|AF301149 Drosophila melanogaster SR protein kinase 1 mRNA, complete cds
          Length = 2368

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  gttcttctttttcttcttctt 303
            |||||||||||||||||||||
Sbjct: 1395 gttcttctttttcttcttctt 1375

to top

>gb|AC092672.3| Homo sapiens BAC clone RP11-603F24 from 2, complete sequence
          Length = 80521

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 34169 gttcttctttttcttcttctt 34149

to top

>gb|AC009236.4| Homo sapiens BAC clone RP11-421J10 from 2, complete sequence
          Length = 178911

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 284    ttcttctttttcttcttcttg 304
              |||||||||||||||||||||
Sbjct: 113294 ttcttctttttcttcttcttg 113274

to top

>gb|AC084645.1|CBRG45L11 Caenorhabditis briggsae cosmid G45L11, complete sequence
          Length = 41337

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 26778 ttcttctttttcttcttcttg 26758

to top

>gb|AC069120.9| Homo sapiens chromosome 8, clone RP11-675F6, complete sequence
          Length = 161198

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   cttggatttcttcttcttttt 231
             |||||||||||||||||||||
Sbjct: 39676 cttggatttcttcttcttttt 39696

to top

>gb|AE014845.1| Plasmodium falciparum 3D7 chromosome 12, section 2 of 9 of the complete
              sequence
          Length = 250531

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 233098 gttcttctttttcttcttctt 233118

to top

>ref|NM_025885.1| Mus musculus mediator of RNA polymerase II transcription, subunit
           19 homolog (yeast) (Med19), mRNA
          Length = 2036

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 635 ttcttctttttcttcttcttg 615

to top

>gb|AY060459.1| Drosophila melanogaster SD03158 full insert cDNA
          Length = 3428

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 283 gttcttctttttcttcttctt 303
           |||||||||||||||||||||
Sbjct: 48  gttcttctttttcttcttctt 28

to top

>gb|AE001581.1| Borrelia burgdorferi B31 plasmid cp32-9, complete sequence
          Length = 30651

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 27010 ttcttctttttcttcttcttg 26990

to top

>gb|AC016813.20| Homo sapiens chromosome 8, clone RP11-495O10, complete sequence
          Length = 183568

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    cttggatttcttcttcttttt 231
              |||||||||||||||||||||
Sbjct: 138442 cttggatttcttcttcttttt 138462

to top

>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome
          Length = 5277274

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 448    tttggacttcttctttttgcttttc 472
              |||||||||||||||||| ||||||
Sbjct: 761587 tttggacttcttcttttttcttttc 761611

to top

>gb|AC153890.8| Mus musculus  BAC RP23-403C13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 202932

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    ttcttctttttcttcttcttg 304
              |||||||||||||||||||||
Sbjct: 146358 ttcttctttttcttcttcttg 146378

to top

>dbj|AP005284.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1121A12
          Length = 138796

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 97807 ttcttctttttcttcttcttg 97827

to top

>dbj|AK121427.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023136B21, full
           insert sequence
          Length = 737

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 248 ttcttctttttcttcttcttg 228

to top

>gb|AC153978.5| Mus musculus 10 BAC RP24-217I1 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 172497

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 129625 gttcttctttttcttcttctt 129645

to top

>gb|AF156667.1|AF156667 Vigna radiata RNA helicase (VRH1) mRNA, complete cds
          Length = 2340

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 314 ttcttctttttcttcttcttg 294

to top

>gb|AF213884.1|AF213884S1 Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in
             B-cells 1 (NFKB1) gene, complete cds
          Length = 190000

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 18882 gttcttctttttcttcttctt 18862

to top

>dbj|AK110375.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-C04, full
            insert sequence
          Length = 3312

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 284  ttcttctttttcttcttcttg 304
            |||||||||||||||||||||
Sbjct: 3162 ttcttctttttcttcttcttg 3142

to top

>gb|AC174163.2| Gallus gallus BAC clone CH261-69O1 from chromosome ul, complete
            sequence
          Length = 178322

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 284  ttcttctttttcttcttcttg 304
            |||||||||||||||||||||
Sbjct: 7743 ttcttctttttcttcttcttg 7763

to top

>emb|CT030184.14| Mouse DNA sequence from clone RP23-9C19 on chromosome 13, complete
             sequence
          Length = 201341

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 286   cttctttttcttcttcttggg 306
             |||||||||||||||||||||
Sbjct: 67396 cttctttttcttcttcttggg 67376

to top

>emb|CR381646.8| Zebrafish DNA sequence from clone DKEY-241L7 in linkage group 20,
             complete sequence
          Length = 183151

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 71411 ttcttctttttcttcttcttg 71391

to top

>gb|AC007967.3|AC007967 Homo sapiens clone NH0373F14, complete sequence
          Length = 187547

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 86629 ttcttctttttcttcttcttg 86609

to top

>emb|CR761073.2| Xenopus tropicalis finished cDNA, clone TEgg032c10
          Length = 990

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 665 ttcttctttttcttcttcttg 645

to top

>gb|AE003811.3| Drosophila melanogaster chromosome 2R, section 39 of 73 of the complete
              sequence
          Length = 255652

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 230740 gttcttctttttcttcttctt 230720

to top

>gb|AE003541.3| Drosophila melanogaster chromosome 3L, section 44 of 83 of the complete
              sequence
          Length = 265524

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    ttcttctttttcttcttcttg 304
              |||||||||||||||||||||
Sbjct: 215115 ttcttctttttcttcttcttg 215135

to top

>gb|AE003436.3| Drosophila melanogaster chromosome X, section 20 of 74 of the complete
              sequence
          Length = 317322

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 286    cttctttttcttcttcttggg 306
              |||||||||||||||||||||
Sbjct: 134203 cttctttttcttcttcttggg 134223

to top

>gb|AE003433.3| Drosophila melanogaster chromosome X, section 17 of 74 of the complete
              sequence
          Length = 303602

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    ttcttctttttcttcttcttg 304
              |||||||||||||||||||||
Sbjct: 172547 ttcttctttttcttcttcttg 172567

to top

>emb|CT486003.10| Mouse DNA sequence from clone RP23-415F11 on chromosome 14, complete
              sequence
          Length = 181037

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 143523 gttcttctttttcttcttctt 143543



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   ttcttctttttcttcttctt 303
             ||||||||||||||||||||
Sbjct: 18603 ttcttctttttcttcttctt 18584

to top

>dbj|AK122404.1| Mus musculus mRNA for mKIAA0938 protein
          Length = 6371

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 217  tttcttcttctttttcttgga 237
            |||||||||||||||||||||
Sbjct: 2937 tttcttcttctttttcttgga 2917

to top

>gb|BT001613.1| Drosophila melanogaster RE33426 full insert cDNA
          Length = 1767

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  gttcttctttttcttcttctt 303
            |||||||||||||||||||||
Sbjct: 1576 gttcttctttttcttcttctt 1556

to top

>emb|BX072581.5| Zebrafish DNA sequence from clone DKEY-14K7 in linkage group 7,
             complete sequence
          Length = 239497

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 29421 gttcttctttttcttcttctt 29441

to top

>emb|CT033751.4| Mouse DNA sequence from clone RP24-236O3 on chromosome 17, complete
             sequence
          Length = 171391

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 668   gaagcaatggaacatttgtttgcca 692
             |||| ||||||||||||||||||||
Sbjct: 80209 gaaggaatggaacatttgtttgcca 80185

to top

>gb|AF080118.1|F8M12 Arabidopsis thaliana BAC F8M12
          Length = 103673

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 57739 gttcttctttttcttcttctt 57759

to top

>emb|AL929079.14| Mouse DNA sequence from clone RP23-387F9 on chromosome 2, complete
             sequence
          Length = 120316

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 86902 ttcttctttttcttcttcttg 86882

to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 62       ccatgccatgctacattacag 82
                |||||||||||||||||||||
Sbjct: 15904162 ccatgccatgctacattacag 15904182

to top

>emb|AL772415.6|CNS08C9T Oryza sativa chromosome 12, . BAC OSJNBa0060H23 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 153350

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 62    ccatgccatgctacattacag 82
             |||||||||||||||||||||
Sbjct: 18342 ccatgccatgctacattacag 18362

to top

>emb|CT030166.8| Mouse DNA sequence from clone RP23-320I11 on chromosome 13, complete
              sequence
          Length = 222942

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 286    cttctttttcttcttcttggg 306
              |||||||||||||||||||||
Sbjct: 210618 cttctttttcttcttcttggg 210598

to top

>gb|BC087814.1| Xenopus tropicalis retinitis pigmentosa 9 (autosomal dominant),
           mRNA (cDNA clone MGC:108496 IMAGE:7004979), complete cds
          Length = 1107

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 678 ttcttctttttcttcttcttg 658

to top

>gb|AC140330.3| Mus musculus BAC clone RP23-410I24 from 6, complete sequence
          Length = 185681

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 64864 gttcttctttttcttcttctt 64884

to top

>gb|AC001229.1|F5I14 Sequence of BAC F5I14 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 109560

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 282   ggttcttctttttcttcttct 302
             |||||||||||||||||||||
Sbjct: 18668 ggttcttctttttcttcttct 18688

to top

>emb|Z83316.1|CEB0379 Caenorhabditis elegans Cosmid B0379, complete sequence
          Length = 40339

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 283   gttcttctttttcttcttctt 303
             |||||||||||||||||||||
Sbjct: 28424 gttcttctttttcttcttctt 28404

to top

>gb|AY780259.1| Eucalyptus globulus subsp. globulus chloroplast, complete genome
          Length = 160286

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 284    ttcttctttttcttcttcttg 304
              |||||||||||||||||||||
Sbjct: 128889 ttcttctttttcttcttcttg 128909

to top

>dbj|AP004976.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT09L18, TM0159,
             complete sequence
          Length = 91722

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 27366 ttcttctttttcttcttcttg 27386

to top

>gb|AC171730.1| Lycopersicon esculentum chromosome 01 clone C01HBa0256E08, complete
             sequence
          Length = 147630

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 74682 ttcttctttttcttcttcttg 74662

to top

>emb|AL607030.15| Mouse DNA sequence from clone RP23-304O12 on chromosome 11, complete
              sequence
          Length = 189236

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 142498 gttcttctttttcttcttctt 142518

to top

>emb|AL645930.15| Mouse DNA sequence from clone RP23-434L7 on chromosome 3, complete
              sequence
          Length = 227993

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 284    ttcttctttttcttcttcttggggg 308
              |||||||||||||||||||| ||||
Sbjct: 167786 ttcttctttttcttcttcttcgggg 167810

to top

>emb|AL929066.7| Mouse DNA sequence from clone RP23-68E1 on chromosome 2, complete
              sequence
          Length = 210907

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 283    gttcttctttttcttcttctt 303
              |||||||||||||||||||||
Sbjct: 105053 gttcttctttttcttcttctt 105073

to top

>gb|L19197.1|DROEIF2BET Drosophila melanogaster eIF-2 beta-subunit mRNA, complete cds
          Length = 1099

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 284 ttcttctttttcttcttcttg 304
           |||||||||||||||||||||
Sbjct: 305 ttcttctttttcttcttcttg 285

to top

>dbj|AP003480.1| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1970H2
          Length = 150331

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 455   ttcttctttttgcttttcttc 475
             |||||||||||||||||||||
Sbjct: 27304 ttcttctttttgcttttcttc 27284

to top

>emb|AL596263.8| Mouse DNA sequence from clone RP23-392O2 on chromosome 2, complete
             sequence
          Length = 100060

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 284   ttcttctttttcttcttcttg 304
             |||||||||||||||||||||
Sbjct: 76726 ttcttctttttcttcttcttg 76746

to top

>gb|AC138358.12| Mus musculus chromosome 1, clone RP24-147G10, complete sequence
          Length = 180227

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    ttcttctttttcttcttctt 303
              ||||||||||||||||||||
Sbjct: 135657 ttcttctttttcttcttctt 135676

to top

>gb|AC099576.12| Mus musculus chromosome 3, clone RP23-93G15, complete sequence
          Length = 156835

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   ttcttctttttcttcttctt 303
             ||||||||||||||||||||
Sbjct: 69195 ttcttctttttcttcttctt 69214



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   ttcttctttttcttcttctt 303
             ||||||||||||||||||||
Sbjct: 69183 ttcttctttttcttcttctt 69202



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   ttcttctttttcttcttctt 303
             ||||||||||||||||||||
Sbjct: 69171 ttcttctttttcttcttctt 69190

to top

>gb|AC116384.9| Mus musculus chromosome 3, clone RP23-20L19, complete sequence
          Length = 203580

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   ttcttctttttcttcttctt 303
             ||||||||||||||||||||
Sbjct: 75739 ttcttctttttcttcttctt 75758



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   ttcttctttttcttcttctt 303
             ||||||||||||||||||||
Sbjct: 75709 ttcttctttttcttcttctt 75728

to top

>gb|BC032416.1| Homo sapiens serine/arginine repetitive matrix 2, mRNA (cDNA clone
           IMAGE:5215215), complete cds
          Length = 2267

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 ttcttctttttcttcttctt 303
           ||||||||||||||||||||
Sbjct: 998 ttcttctttttcttcttctt 979

to top

>gb|AC102140.15| Mus musculus chromosome 3, clone RP23-286J21, complete sequence
          Length = 192833

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    ttcttctttttcttcttctt 303
              ||||||||||||||||||||
Sbjct: 145304 ttcttctttttcttcttctt 145285

to top

>gb|AC104554.7| Mus musculus chromosome 5, clone RP24-441E22, complete sequence
          Length = 176408

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    ttcttctttttcttcttctt 303
              ||||||||||||||||||||
Sbjct: 153625 ttcttctttttcttcttctt 153606



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    ttcttctttttcttcttctt 303
              ||||||||||||||||||||
Sbjct: 153524 ttcttctttttcttcttctt 153505

to top

>gb|CP000024.1| Streptococcus thermophilus CNRZ1066, complete genome
          Length = 1796226

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 283   gttcttctttttcttcttct 302
             ||||||||||||||||||||
Sbjct: 13278 gttcttctttttcttcttct 13259

to top

>gb|AC116696.20| Mus musculus chromosome 3, clone RP24-425N23, complete sequence
          Length = 168053

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    ttcttctttttcttcttctt 303
              ||||||||||||||||||||
Sbjct: 122551 ttcttctttttcttcttctt 122570

to top

>gb|AC153879.1| Mus musculus  BAC RP23-264C21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 182252

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   ttcttctttttcttcttctt 303
             ||||||||||||||||||||
Sbjct: 20791 ttcttctttttcttcttctt 20772

to top

>gb|AC119832.9| Mus musculus chromosome 3, clone RP23-471I16, complete sequence
          Length = 178681

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    ttcttctttttcttcttctt 303
              ||||||||||||||||||||
Sbjct: 103712 ttcttctttttcttcttctt 103731

to top

>gb|AC153729.1| Mus musculus  BAC RP23-88C11 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 250801

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 284   ttcttctttttcttcttctt 303
             ||||||||||||||||||||
Sbjct: 34095 ttcttctttttcttcttctt 34114

to top

>ref|NM_053424.1| Rattus norvegicus solute carrier family 4, member 4 (Slc4a4), mRNA
          Length = 3573

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 284  ttcttctttttcttcttctt 303
            ||||||||||||||||||||
Sbjct: 3124 ttcttctttttcttcttctt 3105


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 9,035,946
Number of Sequences: 3902068
Number of extensions: 9035946
Number of successful extensions: 801675
Number of sequences better than 10.0: 2654
Number of HSP's better than 10.0 without gapping: 2665
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 712971
Number of HSP's gapped (non-prelim): 88704
length of query: 702
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 679
effective length of database: 17,143,297,704
effective search space: 11640299141016
effective search space used: 11640299141016
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result