ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags34a04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BT008920.1| Triticum aestivum clone wyr1c.pk001.j6:fis, full ... 496 e-137
2ref|XM_476736.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
3dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
4dbj|AP005840.4| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
5dbj|AK065622.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
6emb|AL022154.2|HS249C1 Human DNA sequence from clone RP1-249C1 o... 48 0.036
7gb|AC150774.2| Xenopus tropicalis clone CH216-82E5, complete seq... 42 2.2
8gb|AC100491.9| Mus musculus chromosome 9, clone RP23-142M14, com... 42 2.2
9ref|XM_968049.1| PREDICTED: Tribolium castaneum similar to CG852... 42 2.2
10dbj|AP006127.1| Lotus japonicus genomic DNA, chromosome 5, clone... 42 2.2
11gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 8.8
12gb|AC160845.1| Homo sapiens chromosome 2 clone fa0885, complete ... 40 8.8
13gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome 40 8.8
14ref|XM_414496.1| PREDICTED: Gallus gallus similar to Methionine ... 40 8.8
15gb|AC129581.7| Mus musculus chromosome 9, clone RP24-259A3, comp... 40 8.8
16gb|AY339245.1| Malacocottus zonurus isolate Malzon ATPase 8 gene... 40 8.8
17gb|AY339243.1| Myoxocephalus sp. M_sp207 ATPase 8 gene, complete... 40 8.8
18gb|AY339241.1| Myoxocephalus octodecemspinosus isolate Moct2179 ... 40 8.8
19gb|AY339240.1| Myoxocephalus aenaeus isolate Maen2128 ATPase 8 g... 40 8.8
20gb|AY339239.1| Myoxocephalus aenaeus isolate Maen2126 ATPase 8 g... 40 8.8
21gb|AY339235.1| Triglopsis quadricornis haplotype Arc2 ATPase 8 g... 40 8.8
22gb|AY339234.1| Triglopsis quadricornis haplotype Arc1 ATPase 8 g... 40 8.8
23gb|AY339233.1| Triglopsis quadricornis haplotype Eur5 ATPase 8 g... 40 8.8
24gb|AY339232.1| Triglopsis quadricornis haplotype Eur4 ATPase 8 g... 40 8.8
25gb|AY339231.1| Triglopsis quadricornis haplotype Eur3 ATPase 8 g... 40 8.8
26gb|AY339230.1| Triglopsis quadricornis haplotype Eur1 ATPase 8 g... 40 8.8
27emb|AL513209.16| Human DNA sequence from clone RP11-177F15 on ch... 40 8.8
28emb|AL359532.26| Human DNA sequence from clone RP11-330O11 on ch... 40 8.8
29emb|AL359195.24| Human DNA sequence from clone RP11-36D19 on chr... 40 8.8
30emb|AL049591.12|HSJ878I13 Human DNA sequence from clone RP5-878I... 40 8.8
31emb|AL109930.8|HSDJ669H2 Human DNA sequence from clone RP4-669H2... 40 8.8
32gb|AC142122.2| Homo sapiens fosmid clone XXFOS-8870E5 from 2, co... 40 8.8
33gb|AC155934.2| Mus musculus BAC clone RP23-58N8 from chromosome ... 40 8.8
34gb|AC021224.7|AC021224 Homo sapiens chromosome 18, clone RP11-15... 40 8.8
35gb|AF312912.1|AF312912 Homo sapiens chromosome 20 P1 clone h12, ... 40 8.8
36ref|NG_001094.1| Homo sapiens carcinoembryonic antigen-related c... 40 8.8
37gb|AY833325.1| Scorpaenichthys marmoratus ATPase 8 (ATP8) gene, ... 40 8.8
38gb|AY116339.1| Triglopsis quadricornis ATPase 8 gene, complete c... 40 8.8
39gb|AY116308.1| Malacocottus zonurus ATPase 8 gene, complete cds;... 40 8.8
40gb|AC019221.4| Homo sapiens BAC clone RP11-534J17 from 2, comple... 40 8.8
41gb|AC092644.3| Homo sapiens BAC clone RP11-394A2 from 2, complet... 40 8.8
42gb|AE001439.1| Helicobacter pylori J99, complete genome 40 8.8
43dbj|AP004449.1| Enedrias crassispina mitochondrial DNA, complete... 40 8.8
44gb|AC005204.1|AC005204 Homo sapiens chromosome 19, cosmid F24083... 40 8.8
45gb|AC004558.1|AC004558 Homo sapiens chromosome 19, overlapping c... 40 8.8
46gb|AC129184.3| Mus musculus BAC clone RP23-358F24 from 5, comple... 40 8.8 
>gb|BT008920.1| Triticum aestivum clone wyr1c.pk001.j6:fis, full insert mRNA
           sequence
          Length = 955

 Score =  496 bits (250), Expect = e-137
 Identities = 359/393 (91%), Gaps = 13/393 (3%)
 Strand = Plus / Minus

                                                                       
Query: 259 ttctgtaggggtccaatctcgagggggcaagtgggcaatctgggcagccagccatgtcat 318
           |||||||||||||||||||| |||||||||||||||||| |||||||| |||||||||||
Sbjct: 694 ttctgtaggggtccaatctcaagggggcaagtgggcaatttgggcagcgagccatgtcat 635

                                                                       
Query: 319 gtagttccggtagtaccgtccgtggatgttgtagttgcaatcctagtcttttcaggcaat 378
           |||||||| ||| | | ||| |||||||||||||||||||||||||         |||||
Sbjct: 634 gtagttccagtaatgcagtcagtggatgttgtagttgcaatcctag---------gcaat 584

                                                                       
Query: 379 cagtgtgatgaagcggcatgttgcttgtgtcaccctgtttctttca--gtctt-gtgagt 435
            |||||||||||||||||||||||||||||||||||||||||||||  ||||| ||||||
Sbjct: 583 tagtgtgatgaagcggcatgttgcttgtgtcaccctgtttctttcactgtctttgtgagt 524

                                                                       
Query: 436 ccaaatgc-ttaagcactgtcagctgtgctgttttcaagggtctttggtgtggcattctc 494
           |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 523 ccaaatgccttaaggactgtcagctgtgctgttttcaagggtctttggtgtggcattttc 464

                                                                       
Query: 495 agctgcagacggttcaacttctttcttacgtctggatcttctagttgtcatcttaataat 554
           |||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct: 463 agctgcaggcggctcaacttctttcttacgtctggaccttctagttgtcatcttaatgat 404

                                                                       
Query: 555 atcatctttgtacactaccttttctttcactgaactgcttgtttgctgcttgatgctgct 614
           |||||||||||| ||||||||||||||||||||||||||  |||||||||||||||||| 
Sbjct: 403 atcatctttgtatactaccttttctttcactgaactgctcatttgctgcttgatgctgcc 344

                                            
Query: 615 aggttcttggtttgaatcagggagcaacgcttt 647
           |||||||||||||| |||||| |||||||||||
Sbjct: 343 aggttcttggtttgcatcaggaagcaacgcttt 311



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 110/131 (83%), Gaps = 11/131 (8%)
 Strand = Plus / Minus

                                                                       
Query: 102 aagccacattaggcactccttgccgcactaggacaaaatgcgggatgtg--------aac 153
           |||||||| |||||||||||||  ||||||| ||||||||| |||||||        |||
Sbjct: 854 aagccacagtaggcactccttgttgcactag-acaaaatgcaggatgtgcctatgggaac 796

                                                                       
Query: 154 acacccaaaatcgttgtgcatgctaaagcggcaacataagccaggtgagatttcacatct 213
           |||||||| || ||||  ||||| ||||||||||||||| |||||||||||||| |||||
Sbjct: 795 acacccaacatagttg--catgccaaagcggcaacataaaccaggtgagatttcgcatct 738

                      
Query: 214 actccgtttgg 224
           ||||| |||||
Sbjct: 737 actccatttgg 727
to top
>ref|XM_476736.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3102

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 517  ttcttacgtctggatcttctagttgtcatcttaa 550
            ||||||||||||| |||||| |||||||||||||
Sbjct: 2683 ttcttacgtctgggtcttcttgttgtcatcttaa 2650
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                                 
Query: 517     ttcttacgtctggatcttctagttgtcatcttaa 550
               ||||||||||||| |||||| |||||||||||||
Sbjct: 3678417 ttcttacgtctgggtcttcttgttgtcatcttaa 3678450
to top
>dbj|AP005840.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0050F10
          Length = 151986

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                               
Query: 517   ttcttacgtctggatcttctagttgtcatcttaa 550
             ||||||||||||| |||||| |||||||||||||
Sbjct: 22768 ttcttacgtctgggtcttcttgttgtcatcttaa 22801
to top
>dbj|AK065622.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013031K22, full
            insert sequence
          Length = 3102

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 517  ttcttacgtctggatcttctagttgtcatcttaa 550
            ||||||||||||| |||||| |||||||||||||
Sbjct: 2683 ttcttacgtctgggtcttcttgttgtcatcttaa 2650
to top
>emb|AL022154.2|HS249C1 Human DNA sequence from clone RP1-249C1 on chromosome Xq21.1-22.2,
             complete sequence
          Length = 118153

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 590   tgcttgtttgctgcttgatgctgctagg 617
             ||||||||||||||||| ||||||||||
Sbjct: 92671 tgcttgtttgctgcttgttgctgctagg 92644
to top
>gb|AC150774.2| Xenopus tropicalis clone CH216-82E5, complete sequence
          Length = 87104

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tttgacaaaatggaacaactg 32
             |||||||||||||||||||||
Sbjct: 14614 tttgacaaaatggaacaactg 14634
to top
>gb|AC100491.9| Mus musculus chromosome 9, clone RP23-142M14, complete sequence
          Length = 222845

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 447   agcactgtcagctgtgctgtt 467
             |||||||||||||||||||||
Sbjct: 55949 agcactgtcagctgtgctgtt 55929
to top
>ref|XM_968049.1| PREDICTED: Tribolium castaneum similar to CG8520-PA (LOC661919), mRNA
          Length = 1317

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 375  caatcagtgtgatgaagcggc 395
            |||||||||||||||||||||
Sbjct: 1057 caatcagtgtgatgaagcggc 1037
to top
>dbj|AP006127.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT48O21, TM0211,
              complete sequence
          Length = 137303

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 138    aatgcgggatgtgaacacacc 158
              |||||||||||||||||||||
Sbjct: 109744 aatgcgggatgtgaacacacc 109764
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 458    ctgtgctgttttcaagggtc 477
              ||||||||||||||||||||
Sbjct: 220963 ctgtgctgttttcaagggtc 220944
to top
>gb|AC160845.1| Homo sapiens chromosome 2 clone fa0885, complete sequence
          Length = 43237

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 615   aggttcttggtttgaatcag 634
             ||||||||||||||||||||
Sbjct: 26495 aggttcttggtttgaatcag 26514
to top
>gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome
          Length = 3481691

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 289     gtgggcaatctgggcagcca 308
               ||||||||||||||||||||
Sbjct: 1903831 gtgggcaatctgggcagcca 1903812
to top
>ref|XM_414496.1| PREDICTED: Gallus gallus similar to Methionine adenosyltransferase
           II, beta (LOC416164), mRNA
          Length = 771

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 16  acaaaatggaacaactgata 35
           ||||||||||||||||||||
Sbjct: 642 acaaaatggaacaactgata 661
to top
>gb|AC129581.7| Mus musculus chromosome 9, clone RP24-259A3, complete sequence
          Length = 209607

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 467   tttcaagggtctttggtgtg 486
             ||||||||||||||||||||
Sbjct: 17868 tttcaagggtctttggtgtg 17887
to top
>gb|AY339245.1| Malacocottus zonurus isolate Malzon ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY339243.1| Myoxocephalus sp. M_sp207 ATPase 8 gene, complete cds; and ATPase 6
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 839

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY339241.1| Myoxocephalus octodecemspinosus isolate Moct2179 ATPase 8 gene,
           complete cds; and ATPase 6 gene, partial cds;
           mitochondrial genes for mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY339240.1| Myoxocephalus aenaeus isolate Maen2128 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY339239.1| Myoxocephalus aenaeus isolate Maen2126 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY339235.1| Triglopsis quadricornis haplotype Arc2 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 832

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY339234.1| Triglopsis quadricornis haplotype Arc1 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 837

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY339233.1| Triglopsis quadricornis haplotype Eur5 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 837

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY339232.1| Triglopsis quadricornis haplotype Eur4 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY339231.1| Triglopsis quadricornis haplotype Eur3 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY339230.1| Triglopsis quadricornis haplotype Eur1 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 832

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>emb|AL513209.16| Human DNA sequence from clone RP11-177F15 on chromosome 1 Contains part
             of a novel gene (FLJ33910), complete sequence
          Length = 140169

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 464   tgttttcaagggtctttggt 483
             ||||||||||||||||||||
Sbjct: 29594 tgttttcaagggtctttggt 29575
to top
>emb|AL359532.26| Human DNA sequence from clone RP11-330O11 on chromosome 10 Contains the
             3' end of the gene for a novel protein (LOC220929)
             (FLJ32761), a DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
             10 (RNA helicase) (DDH10) pseudogene and a CpG island,
             complete sequence
          Length = 179798

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 550   ataatatcatctttgtacactaccttttcttt 581
             |||||||||| ||| |||| ||||||||||||
Sbjct: 25953 ataatatcatatttttacagtaccttttcttt 25922
to top
>emb|AL359195.24| Human DNA sequence from clone RP11-36D19 on chromosome 10 Contains part
             of a pseudogene similar to nuclear pore complex
             interacting proteins (NPIP), a eukaryotic translation
             initiation factor 5A (EIF5A) pseudogene, the MAT1A gene
             for methionine adenosyltransferase I alpha, a novel zinc
             finger protein pseudogene, three novel genes, the 5' end
             of the gene for a novel protein (MGC4248) and three CpG
             islands, complete sequence
          Length = 171148

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 552   aatatcatctttgtacacta 571
             ||||||||||||||||||||
Sbjct: 56634 aatatcatctttgtacacta 56653
to top
>emb|AL049591.12|HSJ878I13 Human DNA sequence from clone RP5-878I13 on chromosome Xq23-25 Contains
              an alpha tubulin pseudogene, complete sequence
          Length = 122400

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 18     aaaatggaacaactgatatgcaca 41
              ||||||||||||||||| ||||||
Sbjct: 113972 aaaatggaacaactgatttgcaca 113995
to top
>emb|AL109930.8|HSDJ669H2 Human DNA sequence from clone RP4-669H2 on chromosome 20q13.13-13.2
             Contains the 3' end of a novel gene, complete sequence
          Length = 119820

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 596   tttgctgcttgatgctgctaggtt 619
             |||||||||||| |||||||||||
Sbjct: 29176 tttgctgcttgaagctgctaggtt 29153
to top
>gb|AC142122.2| Homo sapiens fosmid clone XXFOS-8870E5 from 2, complete sequence
          Length = 37069

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 615   aggttcttggtttgaatcag 634
             ||||||||||||||||||||
Sbjct: 20841 aggttcttggtttgaatcag 20860
to top
>gb|AC155934.2| Mus musculus BAC clone RP23-58N8 from chromosome 9, complete sequence
          Length = 198059

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 467   tttcaagggtctttggtgtg 486
             ||||||||||||||||||||
Sbjct: 99546 tttcaagggtctttggtgtg 99565
to top
>gb|AC021224.7|AC021224 Homo sapiens chromosome 18, clone RP11-158N19, complete sequence
          Length = 151794

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 192   agccaggtgagatttcacat 211
             ||||||||||||||||||||
Sbjct: 59283 agccaggtgagatttcacat 59302
to top
>gb|AF312912.1|AF312912 Homo sapiens chromosome 20 P1 clone h12, complete sequence
          Length = 83550

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 596   tttgctgcttgatgctgctaggtt 619
             |||||||||||| |||||||||||
Sbjct: 35249 tttgctgcttgaagctgctaggtt 35272
to top
>ref|NG_001094.1| Homo sapiens carcinoembryonic antigen-related cell adhesion
           molecule pseudogene 5 (CEACAMP5) on chromosome 19
          Length = 9066

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 451 ctgtcagctgtgctgttttc 470
           ||||||||||||||||||||
Sbjct: 81  ctgtcagctgtgctgttttc 62
to top
>gb|AY833325.1| Scorpaenichthys marmoratus ATPase 8 (ATP8) gene, complete cds; and
           ATPase 6 (ATP6) gene, partial cds; mitochondrial
          Length = 841

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY116339.1| Triglopsis quadricornis ATPase 8 gene, complete cds; and ATPase 6
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 837

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AY116308.1| Malacocottus zonurus ATPase 8 gene, complete cds; and ATPase 6
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 841

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 ttgcaatcctagtcttttca 372
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48
to top
>gb|AC019221.4| Homo sapiens BAC clone RP11-534J17 from 2, complete sequence
          Length = 107611

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 461  tgctgttttcaagggtcttt 480
            ||||||||||||||||||||
Sbjct: 7088 tgctgttttcaagggtcttt 7107
to top
>gb|AC092644.3| Homo sapiens BAC clone RP11-394A2 from 2, complete sequence
          Length = 171099

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 438    aaatgcttaagcactgtcag 457
              ||||||||||||||||||||
Sbjct: 135595 aaatgcttaagcactgtcag 135614
to top
>gb|AE001439.1| Helicobacter pylori J99, complete genome
          Length = 1643831

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 159    caaaatcgttgtgcatgctaaagc 182
              ||||||| ||||||||||||||||
Sbjct: 992030 caaaatctttgtgcatgctaaagc 992053
to top
>dbj|AP004449.1| Enedrias crassispina mitochondrial DNA, complete genome
          Length = 16522

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 353  ttgcaatcctagtcttttca 372
            ||||||||||||||||||||
Sbjct: 7985 ttgcaatcctagtcttttca 8004
to top
>gb|AC005204.1|AC005204 Homo sapiens chromosome 19, cosmid F24083, complete sequence
          Length = 38449

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 451  ctgtcagctgtgctgttttc 470
            ||||||||||||||||||||
Sbjct: 3105 ctgtcagctgtgctgttttc 3086
to top
>gb|AC004558.1|AC004558 Homo sapiens chromosome 19, overlapping cosmids F20014 and F8998,
             complete sequence
          Length = 82453

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 451   ctgtcagctgtgctgttttc 470
             ||||||||||||||||||||
Sbjct: 77201 ctgtcagctgtgctgttttc 77182
to top
>gb|AC129184.3| Mus musculus BAC clone RP23-358F24 from 5, complete sequence
          Length = 203369

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 539    ttgtcatcttaataatatca 558
              ||||||||||||||||||||
Sbjct: 158795 ttgtcatcttaataatatca 158776


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,673,196
Number of Sequences: 3902068
Number of extensions: 5673196
Number of successful extensions: 112634
Number of sequences better than 10.0: 46
Number of HSP's better than 10.0 without gapping: 46
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 112497
Number of HSP's gapped (non-prelim): 135
length of query: 647
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 624
effective length of database: 17,143,297,704
effective search space: 10697417767296
effective search space used: 10697417767296
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top