>emb|CT009510.7| Mouse DNA sequence from clone RP23-47H16 on chromosome 14, complete
             sequence
          Length = 209623

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 218   acaaccacaaagcaagatccag 239
             ||||||||||||||||||||||
Sbjct: 94199 acaaccacaaagcaagatccag 94220

>gb|AC129471.1| Homo sapiens chromosome 5 clone RP11-352J21, complete sequence
          Length = 180334

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 212    tgcaaaacaaccacaaagcaa 232
              |||||||||||||||||||||
Sbjct: 120810 tgcaaaacaaccacaaagcaa 120830

>gb|AC016617.6| Homo sapiens chromosome 5 clone CTD-2239O16, complete sequence
          Length = 114972

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 212   tgcaaaacaaccacaaagcaa 232
             |||||||||||||||||||||
Sbjct: 68576 tgcaaaacaaccacaaagcaa 68596

>gb|AC012506.9| Homo sapiens BAC clone RP11-498O22 from 2, complete sequence
          Length = 197303

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 463    acaaagcccagggatttcagg 483
              |||||||||||||||||||||
Sbjct: 163067 acaaagcccagggatttcagg 163087

>gb|AC124337.15| Mus musculus chromosome 6, clone RP24-199P17, complete sequence
          Length = 171534

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 617   agatgtgggaattgtgcaac 636
             ||||||||||||||||||||
Sbjct: 19865 agatgtgggaattgtgcaac 19846

>gb|AC123874.4| Mus musculus BAC clone RP23-265M17 from 6, complete sequence
          Length = 193712

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 617   agatgtgggaattgtgcaac 636
             ||||||||||||||||||||
Sbjct: 96407 agatgtgggaattgtgcaac 96426

>emb|AL136172.16| Human DNA sequence from clone RP4-621N11 on chromosome 20 Contains the
             5' end of the RBL1 gene for retinoblastoma-like protein 1,
             the 3' end of the C20orf132 gene and three CpG islands,
             complete sequence
          Length = 69413

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 289   tacaaaatttacccccgggc 308
             ||||||||||||||||||||
Sbjct: 46838 tacaaaatttacccccgggc 46819

>gb|AC093010.7| Homo sapiens 3 BAC RP11-553L6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 161077

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 604   aagaactaatagaagatgtgggaa 627
             ||||||||| ||||||||||||||
Sbjct: 12655 aagaactaaaagaagatgtgggaa 12632

>gb|AC095058.3| Homo sapiens BAC clone RP11-416A5 from 4, complete sequence
          Length = 172472

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   ttgctgcaaagagatggttt 189
             ||||||||||||||||||||
Sbjct: 36125 ttgctgcaaagagatggttt 36106

>dbj|AK144629.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
           library, clone:G730014H17 product:unclassifiable, full
           insert sequence
          Length = 982

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 243 acaatgaatttgcttgccgacaca 266
           |||||||||||| |||||||||||
Sbjct: 174 acaatgaatttggttgccgacaca 197

>gb|AC008571.6| Homo sapiens chromosome 5 clone CTC-550M4, complete sequence
          Length = 214267

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 215    aaaacaaccacaaagcaaga 234
              ||||||||||||||||||||
Sbjct: 192973 aaaacaaccacaaagcaaga 192954

>gb|AC129951.9| Mus musculus chromosome 15, clone RP23-127B14, complete sequence
          Length = 211987

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 243    acaatgaatttgcttgccgacaca 266
              |||||||||||| |||||||||||
Sbjct: 188977 acaatgaatttggttgccgacaca 188954

>gb|AC092418.3| Homo sapiens chromosome 3 clone RP11-229A12, complete sequence
          Length = 164500

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 476    atttcagggatttcatgctt 495
              ||||||||||||||||||||
Sbjct: 129770 atttcagggatttcatgctt 129789

>emb|AL929287.5| Zebrafish DNA sequence from clone CH211-67L8, complete sequence
          Length = 193201

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 169    attgctgcaaagagatggtttacc 192
              ||||||| ||||||||||||||||
Sbjct: 133353 attgctgtaaagagatggtttacc 133376

>dbj|AB015475.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MMN10
          Length = 84325

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 577   caaagtattaaccagtgagt 596
             ||||||||||||||||||||
Sbjct: 20166 caaagtattaaccagtgagt 20147

>gb|AC117614.12| Mus musculus chromosome 5, clone RP23-110C17, complete sequence
          Length = 222809

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 243    acaatgaatttgcttgccgacaca 266
              |||||||||||| |||||||||||
Sbjct: 134763 acaatgaatttggttgccgacaca 134740


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,366,733
Number of Sequences: 3902068
Number of extensions: 4366733
Number of successful extensions: 76279
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76249
Number of HSP's gapped (non-prelim): 30
length of query: 680
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 657
effective length of database: 17,143,297,704
effective search space: 11263146591528
effective search space used: 11263146591528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)