ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags33e17 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9 Length = 704 Score = 617 bits (311), Expect = e-173 Identities = 398/427 (93%) Strand = Plus / Minus Query: 180 ccttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgcctccttctcgg 239 ||||||||||||| ||||||||| || |||||||||||||||||| ||||||||||||| Sbjct: 486 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttggcctccttctcgg 427 Query: 240 ccgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgccgt 299 | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 426 cggcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccaccgt 367 Query: 300 gagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaa 359 | || ||||||||||| ||||||||| ||||||| ||||||||||||||||| ||||| | Sbjct: 366 gggcgatggtgacgccagcgagcagcctgccgagctcctggtcgttgcggacagcgagca 307 Query: 360 gaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagct 419 | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 306 gcaggtggcgcgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcaagct 247 Query: 420 ctaggagctcagcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagc 479 | || | ||| |||||||||||||||||||||||||| |||||||| ||||||||||||| Sbjct: 246 ccagcacctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagc 187 Query: 480 cgacgcgctgcgcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaact 539 |||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||| Sbjct: 186 cgacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaact 127 Query: 540 ggagcccggccttcacggacctggtcaccgacttcttcctgtcgcctcccttccttccgg 599 ||||||||||||||||||| | |||||||| ||||||||||||||| ||||||||||||| Sbjct: 126 ggagcccggccttcacggagcgggtcaccgccttcttcctgtcgccgcccttccttccgg 67 Query: 600 ccatctt 606 ||||||| Sbjct: 66 ccatctt 60 Score = 87.7 bits (44), Expect = 4e-14 Identities = 63/68 (92%), Gaps = 1/68 (1%) Strand = Plus / Minus Query: 49 ggcttgttcatcgaactaatgaaacagccactacagac-tatgcaattacacaaaggacc 107 ||||||||||||||||||||| |||||||||||||||| || ||||||||||| |||| | Sbjct: 636 ggcttgttcatcgaactaatgtaacagccactacagacttaggcaattacacacaggatc 577 Query: 108 caaccaac 115 |||||||| Sbjct: 576 caaccaac 569
>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2 Length = 717 Score = 571 bits (288), Expect = e-159 Identities = 444/495 (89%), Gaps = 12/495 (2%) Strand = Plus / Minus Query: 181 cttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgcctccttctcggc 240 |||||||||||| ||||||| | ||||||||| ||||||| |||||||||||||| Sbjct: 502 cttcttcttgggggacttggcggcggccttct------gcgacttggcctccttctcggc 449 Query: 241 cgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtg 300 || |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 448 ggctgcgggggacttcttggggagcagcacggagttgatgttggggatgacgccgccgtg 389 Query: 301 agcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaag 360 || ||||||||||||||||||||| ||||||| |||||||||||||||||||| || || Sbjct: 388 ggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggccagcag 329 Query: 361 aaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| Sbjct: 328 caggtggcgcgggatgatgcgcgtcttcttgttgtccttggccgcgttgccggcaagctc 269 Query: 421 taggagctcagcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagcc 480 |||| ||| |||||||||||||||||||||||||| |||||||| |||||||||||||| Sbjct: 268 caggacctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagcc 209 Query: 481 gacgcgctgcgcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactg 540 ||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||| Sbjct: 208 gacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactg 149 Query: 541 gagcccggccttcacggacctggtcaccgacttcttcctgtcgcctcccttccttccggc 600 ||||||||||| ||||| | |||||||| ||||||||||||||| |||||||||||||| Sbjct: 148 cagcccggccttgacggagcgggtcaccgccttcttcctgtcgccgcccttccttccggc 89 Query: 601 catct--tgcgtgctacttctccggcgacgagg----gctcacgacgtgtggtgttggcg 654 ||||| | | |||| ||||||||||||||||| ||| ||| |||||| | ||||| Sbjct: 88 catcttcttcttgctgcttctccggcgacgaggtgtccctctcgaggtgtggagctggcg 29 Query: 655 ccggtggtgctggat 669 |||||||||||||| Sbjct: 28 gcggtggtgctggat 14
>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3 Length = 1153 Score = 557 bits (281), Expect = e-155 Identities = 444/496 (89%), Gaps = 8/496 (1%) Strand = Plus / Minus Query: 181 cttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgc---ctccttctc 237 |||||||||||| ||||||||| |||||||||||||||||||||| | ||||||||| Sbjct: 509 cttcttcttgggggacttggtggcggccttcttcttgggcgacttggtggactccttctc 450 Query: 238 ggccgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgcc 297 ||| ||| ||| || |||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 449 ggcggcgccggcggccttcttggggagcagcacggagttgatgttggggatgacgccgcc 390 Query: 298 gtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgag 357 ||| || ||||||||||||||||||||| |||| || |||||||||||||||||||| || Sbjct: 389 gtgggcgatggtgacgccggcgagcagcctgcccagctcctggtcgttgcggacggccag 330 Query: 358 aagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaag 417 || |||||||||||||||||||| ||||||||||||||||| |||||||||||||| || Sbjct: 329 cagcaggtggcgcgggatgatgcgcgtcttcttgttgtccttggccgcgttgccggcgag 270 Query: 418 ctctaggagctcagcggcgaggtactcgaggacggcggcaaggtagactggggcgccgga 477 ||| |||| ||| |||||||||||||||||||||||||| |||||||| ||||||||||| Sbjct: 269 ctccaggacctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccgga 210 Query: 478 gccgacgcgctgcgcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaa 537 ||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||| Sbjct: 209 gccgacggcctgcgcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaa 150 Query: 538 ctggagcccggccttcacggacctggtcaccgacttcttcctgtcgcctcccttccttcc 597 ||||||||||||||||||||| | |||||||| ||||||||| ||||| ||||||||||| Sbjct: 149 ctggagcccggccttcacggagcgggtcaccgccttcttcctctcgccgcccttccttcc 90 Query: 598 ggccatcttgcgtgctacttctccggcgacgagg----gctcacgacgtgtggtgttggc 653 ||||||||| | | | ||||||||||||||||| ||| ||| |||||| | |||| Sbjct: 89 ggccatctt-cttcttgcttctccggcgacgaggtgtccctctcgaggtgtggagctggc 31 Query: 654 gccggtggtgctggat 669 | |||||||||||||| Sbjct: 30 ggcggtggtgctggat 15 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 178 ggccttcttcttgggagacttggtg 202 ||||||||||||||| ||||||||| Sbjct: 485 ggccttcttcttgggcgacttggtg 461
>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence Length = 719 Score = 347 bits (175), Expect = 3e-92 Identities = 289/327 (88%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| || ||||| | |||||||||||||| ||||||||||| || |||||||| Sbjct: 492 cttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatggtgac 433 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 ||||| |||||||||||||| |||| ||||||||||| ||| || || | ||||||||| Sbjct: 432 gccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtggcgcgg 373 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||||||||||||||||||||| || ||||||||||| ||||| || | ||| || Sbjct: 372 gatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagcacctcggc 313 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 ||| |||||||||||||||||||| |||||||| |||||||| | ||||||||||||||| Sbjct: 312 ggccaggtactcgaggacggcggccaggtagacgggggcgcccgtgccgacgcgctgcgc 253 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||| ||||| ||||| ||||| ||||| |||||||||||||| ||||| ||||||||||| Sbjct: 252 gtaccggcccttcttcaggtaccgcccgatgcggccgacgggaaactgcagcccggcctt 193 Query: 553 cacggacctggtcaccgacttcttcct 579 |||||||| ||||||||||||||||| Sbjct: 192 gacggacctcgtcaccgacttcttcct 166
>gb|AY103710.1| Zea mays PCO123562 mRNA sequence Length = 770 Score = 347 bits (175), Expect = 3e-92 Identities = 289/327 (88%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| || ||||| | |||||||||||||| ||||||||||| || |||||||| Sbjct: 492 cttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatggtgac 433 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 ||||| |||||||||||||| |||| ||||||||||| ||| || || | ||||||||| Sbjct: 432 gccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtggcgcgg 373 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||||||||||||||||||||| || ||||||||||| ||||| || | ||| || Sbjct: 372 gatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagcacctcggc 313 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 ||| |||||||||||||||||||| |||||||| |||||||| | ||||||||||||||| Sbjct: 312 ggccaggtactcgaggacggcggccaggtagacgggggcgcccgtgccgacgcgctgcgc 253 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||| ||||| ||||| ||||| ||||| |||||||||||||| ||||| ||||||||||| Sbjct: 252 gtaccggcccttcttcaggtaccgcccgatgcggccgacgggaaactgcagcccggcctt 193 Query: 553 cacggacctggtcaccgacttcttcct 579 |||||||| ||||||||||||||||| Sbjct: 192 gacggacctcgtcaccgacttcttcct 166
>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence Length = 674 Score = 341 bits (172), Expect = 2e-90 Identities = 290/328 (88%), Gaps = 1/328 (0%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| ||||| || | |||||||||||| | |||||||||||| || ||||| || Sbjct: 450 cttcttgggcagcaggaccgggttgatgttgggcaacacgccgccgtgggcgatggtcac 391 Query: 313 gccggcgagcagc-ttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcg 371 ||||| |||||| || ||||| |||| ||||||||||| || || || | |||||||| Sbjct: 390 gccggtcagcagccttcccgagctcctcgtcgttgcggatcgccagcagcacgtggcgcg 331 Query: 372 ggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcag 431 ||| |||||| ||||||||||||||||| || ||||||||||| ||||| |||| ||||| Sbjct: 330 ggacgatgcgcgtcttcttgttgtccttggcagcgttgccggcgagctccaggacctcag 271 Query: 432 cggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcg 491 ||||||||||||| |||||||| || |||||||| ||||| ||| |||||||||||||| Sbjct: 270 cggcgaggtactccaggacggccgcgaggtagacgggggcaccgctgccgacgcgctgcg 211 Query: 492 cgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcct 551 |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 210 cgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcct 151 Query: 552 tcacggacctggtcaccgacttcttcct 579 |||||||||| ||||||||||||||||| Sbjct: 150 tcacggacctcgtcaccgacttcttcct 123 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 211 cttcttgggcgacttcgcctcctt 234 ||||||||||||||| |||||||| Sbjct: 504 cttcttgggcgacttggcctcctt 481
>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274) Length = 2546 Score = 327 bits (165), Expect = 3e-86 Identities = 222/241 (92%) Strand = Plus / Minus Query: 180 ccttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgcctccttctcgg 239 ||||||||||||| ||||||||| || |||||||||||||||||| ||||||||||||| Sbjct: 2308 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttggcctccttctcgg 2249 Query: 240 ccgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgccgt 299 | |||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||| Sbjct: 2248 cggcggcgggggacttcttgggcagcagcacggagttgattgtggggatgacgccgccgt 2189 Query: 300 gagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaa 359 | || |||||||||||||| |||||| ||||||| ||||||||||||||||||||||| | Sbjct: 2188 gggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcggacggcgagca 2129 Query: 360 gaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagct 419 | |||||||||||||||||||||||||||||||||||||| || |||||||||||||||| Sbjct: 2128 gcaggtggcgcgggatgatgcgggtcttcttgttgtccttggctgcgttgccggcaagct 2069 Query: 420 c 420 | Sbjct: 2068 c 2068 Score = 327 bits (165), Expect = 3e-86 Identities = 224/243 (92%), Gaps = 3/243 (1%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||||||||| |||||| Sbjct: 1962 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatgcgctgg 1903 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 1902 gcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcc 1843 Query: 551 ttcacggacctggtcaccgacttcttcctgtcgcctcccttccttccggccatcttgcgt 610 ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| | Sbjct: 1842 ttcacggacctggtcaccgccttcttcctgtcgccgcccttccttccggccatcttgctt 1783 Query: 611 g---ctacttctccggcgacgagggctcacgacgtgtggtgttggcgccggtggtgctgg 667 | |||||||||||||||||||| ||| ||| |||||||||| ||| ||| |||||| | Sbjct: 1782 gctactacttctccggcgacgaggactctcgaggtgtggtgtttgcggcggcggtgctag 1723 Query: 668 atc 670 ||| Sbjct: 1722 atc 1720
>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds Length = 2546 Score = 327 bits (165), Expect = 3e-86 Identities = 222/241 (92%) Strand = Plus / Minus Query: 180 ccttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgcctccttctcgg 239 ||||||||||||| ||||||||| || |||||||||||||||||| ||||||||||||| Sbjct: 2308 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttggcctccttctcgg 2249 Query: 240 ccgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgccgt 299 | |||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||| Sbjct: 2248 cggcggcgggggacttcttgggcagcagcacggagttgattgtggggatgacgccgccgt 2189 Query: 300 gagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaa 359 | || |||||||||||||| |||||| ||||||| ||||||||||||||||||||||| | Sbjct: 2188 gggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcggacggcgagca 2129 Query: 360 gaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagct 419 | |||||||||||||||||||||||||||||||||||||| || |||||||||||||||| Sbjct: 2128 gcaggtggcgcgggatgatgcgggtcttcttgttgtccttggctgcgttgccggcaagct 2069 Query: 420 c 420 | Sbjct: 2068 c 2068 Score = 327 bits (165), Expect = 3e-86 Identities = 224/243 (92%), Gaps = 3/243 (1%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||||||||| |||||| Sbjct: 1962 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatgcgctgg 1903 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 1902 gcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcc 1843 Query: 551 ttcacggacctggtcaccgacttcttcctgtcgcctcccttccttccggccatcttgcgt 610 ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| | Sbjct: 1842 ttcacggacctggtcaccgccttcttcctgtcgccgcccttccttccggccatcttgctt 1783 Query: 611 g---ctacttctccggcgacgagggctcacgacgtgtggtgttggcgccggtggtgctgg 667 | |||||||||||||||||||| ||| ||| |||||||||| ||| ||| |||||| | Sbjct: 1782 gctactacttctccggcgacgaggactctcgaggtgtggtgtttgcggcggcggtgctag 1723 Query: 668 atc 670 ||| Sbjct: 1722 atc 1720
>gb|AY103585.1| Zea mays PCO123564 mRNA sequence Length = 1953 Score = 325 bits (164), Expect = 1e-85 Identities = 287/328 (87%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| || |||||||||| ||||||||||| ||||||||||| || |||||||| Sbjct: 610 cttcttgggcaggagcacggagtggatgttggggaggacgccgccgtgcgcgatggtgac 551 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||| ||||| |||| ||||||||||| || || || | ||||||||| Sbjct: 550 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 491 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || || | ||| || | ||| || Sbjct: 490 gatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaactccagaacctcggc 431 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 |||||||||||| ||||||||||| |||||||| |||||||| | ||| ||||||||||| Sbjct: 430 ggcgaggtactccaggacggcggcgaggtagacgggggcgccagtgcccacgcgctgcgc 371 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||| ||||| ||||||||||||||||| || ||||||||||||||||| ||||||||||| Sbjct: 370 gtaccggcccttcttgaggtagcgcccgatccggccgacggggaactgcagcccggcctt 311 Query: 553 cacggacctggtcaccgacttcttcctg 580 ||||||| |||||||||||||||||| Sbjct: 310 gacggaccgcgtcaccgacttcttcctg 283
>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence Length = 699 Score = 309 bits (156), Expect = 6e-81 Identities = 285/328 (86%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| || |||||||||| ||||||||||| ||||| ||||| || |||||||| Sbjct: 461 cttcttgggcaggagcacggagtggatgttggggaggacgccaccgtgcgcgatggtgac 402 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||| ||||| |||| ||||||||||| || || || | ||||||||| Sbjct: 401 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 342 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || || | ||| || | ||| || Sbjct: 341 gatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaactccagaacctcggc 282 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 |||||||||||| || |||||||| |||||||| |||||||| | ||| ||||||||||| Sbjct: 281 ggcgaggtactccagaacggcggcgaggtagacgggggcgccagtgcccacgcgctgcgc 222 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||| ||||| ||||||||||||||||| || ||||||||||||||||| ||||||||||| Sbjct: 221 gtaccggcccttcttgaggtagcgcccgatccggccgacggggaactgcagcccggcctt 162 Query: 553 cacggacctggtcaccgacttcttcctg 580 ||||||| |||||||||||||||||| Sbjct: 161 gacggaccgcgtcaccgacttcttcctg 134
>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full insert sequence Length = 797 Score = 305 bits (154), Expect = 1e-79 Identities = 268/306 (87%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||| ||||||||||| | ||||||||| || | |||||||||||| || |||||||| Sbjct: 467 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 408 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||||||||||| ||||| |||| ||||||||||| || || || | ||| | ||| Sbjct: 407 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 348 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| ||| |||||||||||||| ||||||||| ||||| ||||| || | ||| || Sbjct: 347 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacctctgc 288 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 |||||||||||||||||||||||| |||||||| |||||||||| |||||||||||| || Sbjct: 287 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgctgggc 228 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||| Sbjct: 227 gtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcccggcctt 168 Query: 553 cacgga 558 ||||| Sbjct: 167 gacgga 162
>ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 492 Score = 303 bits (153), Expect = 4e-79 Identities = 282/325 (86%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||||||||||||||| | |||||||||||| | ||| |||||||| || |||||||| Sbjct: 393 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 334 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||| ||||| |||| ||||||||||| || || || | ||| ||||| Sbjct: 333 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 274 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| ||| |||||||||||||| ||||||||| || |||||||| || | ||| || Sbjct: 273 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 214 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 |||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||| | Sbjct: 213 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 154 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||||||||||| |||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 153 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 94 Query: 553 cacggacctggtcaccgacttcttc 577 ||||| | || ||||| ||||||| Sbjct: 93 gacggagcgggacaccggcttcttc 69
>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full insert sequence Length = 1097 Score = 303 bits (153), Expect = 4e-79 Identities = 282/325 (86%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||||||||||||||| | |||||||||||| | ||| |||||||| || |||||||| Sbjct: 464 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 405 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||| ||||| |||| ||||||||||| || || || | ||| ||||| Sbjct: 404 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 345 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| ||| |||||||||||||| ||||||||| || |||||||| || | ||| || Sbjct: 344 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 285 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 |||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||| | Sbjct: 284 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 225 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||||||||||| |||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 224 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 165 Query: 553 cacggacctggtcaccgacttcttc 577 ||||| | || ||||| ||||||| Sbjct: 164 gacggagcgggacaccggcttcttc 140
>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full insert sequence Length = 912 Score = 297 bits (150), Expect = 2e-77 Identities = 267/306 (87%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||||||||||||||| | |||||||||||| | ||| |||||||| || |||||||| Sbjct: 463 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 404 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||| ||||| |||| ||||||||||| || || || | ||| ||||| Sbjct: 403 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 344 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| ||| |||||||||||||| ||||||||| || |||||||| || | ||| || Sbjct: 343 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 284 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 |||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||| | Sbjct: 283 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 224 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||||||||||| |||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 223 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 164 Query: 553 cacgga 558 ||||| Sbjct: 163 gacgga 158
>ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 480 Score = 291 bits (147), Expect = 2e-75 Identities = 282/327 (86%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| || Sbjct: 399 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 340 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||||||||| |||| |||||| | || || || || | ||||||||| Sbjct: 339 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 280 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| | | |||||||||||||| | |||||||| ||||| ||||| || | ||| || Sbjct: 279 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggc 220 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 |||||||||||||||||||||||| |||||||| |||||||||| ||||| ||||||||| Sbjct: 219 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgcgc 160 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||||||||| |||||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 159 gtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 100 Query: 553 cacggacctggtcaccgacttcttcct 579 ||||| | | ||||| ||||||||| Sbjct: 99 gacggagcgcgacaccgccttcttcct 73 Score = 44.1 bits (22), Expect = 0.59 Identities = 34/38 (89%) Strand = Plus / Minus Query: 211 cttcttgggcgacttcgcctccttctcggccgcggcgg 248 ||||||||||||||| |||||||| |||| ||||||| Sbjct: 450 cttcttgggcgacttggcctccttgccggcggcggcgg 413
>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full insert sequence Length = 754 Score = 276 bits (139), Expect = 9e-71 Identities = 280/327 (85%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| || Sbjct: 489 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 430 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||||||||| |||| |||||| | || || || || | ||||||||| Sbjct: 429 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 370 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| | | |||||||||||||| | |||||||| ||||| ||||| || | ||| || Sbjct: 369 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggc 310 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 ||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||| || Sbjct: 309 agcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgggc 250 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||||||||| |||||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 249 gtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 190 Query: 553 cacggacctggtcaccgacttcttcct 579 ||||| | | ||||| ||||||||| Sbjct: 189 gacggagcgcgacaccgccttcttcct 163 Score = 44.1 bits (22), Expect = 0.59 Identities = 34/38 (89%) Strand = Plus / Minus Query: 211 cttcttgggcgacttcgcctccttctcggccgcggcgg 248 ||||||||||||||| |||||||| |||| ||||||| Sbjct: 540 cttcttgggcgacttggcctccttgccggcggcggcgg 503
>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds Length = 714 Score = 266 bits (134), Expect = 9e-68 Identities = 278/327 (85%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| ||||| || | |||||| ||||||| ||| ||||||||||| ||||| || Sbjct: 467 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 408 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | | |||||| || || |||| |||||| |||| || ||||| | ||||||||| Sbjct: 407 gccgcccaacagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 348 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 || ||||| ||||||||||||||| | || || || ||||| ||||| || | |||||| Sbjct: 347 aataatgcgagtcttcttgttgtccctggcagcattaccggcgagctccagaacctcagc 288 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 ||||||||| |||||||| ||||| |||||||| |||||||||| |||||| |||||| Sbjct: 287 ggcgaggtattcgaggacagcggcgaggtagacgggggcgccggtgccgacrrnctgcgc 228 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||||||||| ||||| | ||||||||| ||||||||||||||||||||||| |||||||| Sbjct: 227 gtagcggcccttcttcaagtagcgcccgatgcggccgacggggaactggagaccggcctt 168 Query: 553 cacggacctggtcaccgacttcttcct 579 ||||||||| | ||||||||||||||| Sbjct: 167 cacggacctcgacaccgacttcttcct 141 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 211 cttcttgggcgacttcgcctcctt 234 ||||||||||||||| |||||||| Sbjct: 521 cttcttgggcgactttgcctcctt 498
>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence Length = 1051 Score = 262 bits (132), Expect = 1e-66 Identities = 277/327 (84%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| ||||| || | |||||| ||||||| ||| ||||||||||| ||||| || Sbjct: 486 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 427 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | |||||||| || || |||| |||||| |||| || ||||| | ||||||||| Sbjct: 426 gccgcccagcagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 367 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 || ||||| ||||||||||||||| | || || || || || ||||| || | |||||| Sbjct: 366 aataatgcgagtcttcttgttgtccctggcagcattaccagcgagctccagaacctcagc 307 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 ||||||||| |||||||| ||||| |||||||| |||||| |||||| |||||||| Sbjct: 306 ggcgaggtattcgaggacagcggcgaggtagacnnnnncgccggtgccgacacgctgcgc 247 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||||||||| ||||| | ||||||||| |||||||||||||||||||||||||||||||| Sbjct: 246 gtagcggcccttcttcaagtagcgcccgatgcggccgacggggaactggagcccggcctt 187 Query: 553 cacggacctggtcaccgacttcttcct 579 ||||||||| | ||||||||||||||| Sbjct: 186 cacggacctcgacaccgacttcttcct 160 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 211 cttcttgggcgacttcgcctcctt 234 ||||||||||||||| |||||||| Sbjct: 540 cttcttgggcgactttgcctcctt 517
>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence Length = 772 Score = 254 bits (128), Expect = 3e-64 Identities = 257/300 (85%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||||||||| || |||| ||| |||||||| | ||| |||||||| || |||||||| Sbjct: 449 cttcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcgatggtgac 390 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | |||||||||||||| |||| ||||||||||| |||||| || ||||||||||| Sbjct: 389 cccacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggtggcgcgg 330 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||||||||| ||||||||||| |||||||||||| || ||||| |||| |||||| Sbjct: 329 gatgatgcgggttttcttgttgtcgcgcgccgcgttgccagccagctccaggacctcagc 270 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 |||||||||||||||||||||||| ||| | || || ||||| | ||| ||||||||||| Sbjct: 269 ggcgaggtactcgaggacggcggccaggaacacgggagcgcccgtgcccacgcgctgcgc 210 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||| || |||||||| ||||| || || |||||||| |||||||| ||||||||||||| Sbjct: 209 gtaccgccctttcttcaggtaccgtccgatgcggcccacggggaaaaggagcccggcctt 150
>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence Length = 846 Score = 240 bits (121), Expect = 5e-60 Identities = 259/305 (84%) Strand = Plus / Minus Query: 254 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgacg 313 ||||||||||||||||| | |||||||||||| | || |||||||| || ||||||||| Sbjct: 396 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 337 Query: 314 ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcggg 373 ||||| || ||||| ||||| |||| ||||||||||| || || || | ||| |||||| Sbjct: 336 ccggccagtagcttcccgagctcctcgtcgttgcggatcgccagcagtacgtgccgcggg 277 Query: 374 atgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcg 433 ||||| ||| |||||||||||||| ||| ||||| || || | ||| |||||||| ||| Sbjct: 276 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 217 Query: 434 gcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcg 493 |||||||||||||||||||| || |||||||| |||||||||| |||||| ||||| | | Sbjct: 216 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 157 Query: 494 tagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttc 553 ||||| || | |||||||||||| || || ||||| |||||||||||||| ||||||||| Sbjct: 156 tagcgaccctgcttgaggtagcggccgatacggcctacggggaactggaggccggccttc 97 Query: 554 acgga 558 ||||| Sbjct: 96 acgga 92
>gb|AY104486.1| Zea mays PCO109435 mRNA sequence Length = 992 Score = 232 bits (117), Expect = 1e-57 Identities = 258/305 (84%) Strand = Plus / Minus Query: 254 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgacg 313 ||||||||||||||||| | |||||||||||| | || |||||||| || ||||||||| Sbjct: 467 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 408 Query: 314 ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcggg 373 ||||| || ||||| ||||| |||| |||||||||| || || || | ||| |||||| Sbjct: 407 ccggccagtagcttcccgagctcctcatcgttgcggatcgccagcagtacgtgtcgcggg 348 Query: 374 atgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcg 433 ||||| ||| |||||||||||||| ||| ||||| || || | ||| |||||||| ||| Sbjct: 347 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 288 Query: 434 gcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcg 493 |||||||||||||||||||| || |||||||| |||||||||| |||||| ||||| | | Sbjct: 287 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 228 Query: 494 tagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttc 553 ||||| || | |||||||||||| || || ||||| |||||||||||||| ||||||||| Sbjct: 227 tagcgaccctgcttgaggtagcggccgatacggcctacggggaactggaggccggccttc 168 Query: 554 acgga 558 ||||| Sbjct: 167 acgga 163
>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence Length = 538 Score = 214 bits (108), Expect = 3e-52 Identities = 141/152 (92%) Strand = Plus / Plus Query: 181 cttcttcttgggagacttggtgtcggccttcttcttgggcgacttcgcctccttctcggc 240 |||||||||||| ||||||| | | | |||||||||||||||||| |||||||||||||| Sbjct: 192 cttcttcttgggggacttggcggccgtcttcttcttgggcgacttggcctccttctcggc 251 Query: 241 cgcggcgggggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtg 300 ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 252 ggcggcaggggacttcttggggagcagcacggagttgatgttggggatcacaccgccgtg 311 Query: 301 agcaatggtgacgccggcgagcagcttgccga 332 || |||||||||||||||||||||||||||| Sbjct: 312 ggcgatggtgacgccggcgagcagcttgccga 343
>ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 522 Score = 190 bits (96), Expect = 4e-45 Identities = 120/128 (93%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||| Sbjct: 212 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgctgg 153 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||| Sbjct: 152 gcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcccggcc 93 Query: 551 ttcacgga 558 || ||||| Sbjct: 92 ttgacgga 85 Score = 127 bits (64), Expect = 5e-26 Identities = 142/168 (84%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||| ||||||||||| | ||||||||| || | |||||||||||| || |||||||| Sbjct: 441 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 382 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||||||||||| ||||| |||| ||||||||||| || || || | ||| | ||| Sbjct: 381 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 322 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||| ||| |||||||||||||| ||||||||| ||||| ||||| Sbjct: 321 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctc 274
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 190 bits (96), Expect = 4e-45 Identities = 120/128 (93%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||| Sbjct: 707147 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgctgg 707088 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||| Sbjct: 707087 gcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcccggcc 707028 Query: 551 ttcacgga 558 || ||||| Sbjct: 707027 ttgacgga 707020 Score = 172 bits (87), Expect = 1e-39 Identities = 132/147 (89%) Strand = Plus / Plus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||| Sbjct: 22512581 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgg 22512640 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 | ||||||||||| |||||||||||| || || ||||||||||||||||||||||||||| Sbjct: 22512641 gagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcc 22512700 Query: 551 ttcacggacctggtcaccgacttcttc 577 || ||||| | || ||||| ||||||| Sbjct: 22512701 ttgacggagcgggacaccggcttcttc 22512727 Score = 143 bits (72), Expect = 9e-31 Identities = 144/168 (85%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||||||||||||||| | |||||||||||| | ||| |||||||| || |||||||| Sbjct: 22512327 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 22512386 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||| ||||| |||| ||||||||||| || || || | ||| ||||| Sbjct: 22512387 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 22512446 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||| ||| |||||||||||||| ||||||||| || |||||||| Sbjct: 22512447 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctc 22512494 Score = 127 bits (64), Expect = 5e-26 Identities = 142/168 (84%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||| ||||||||||| | ||||||||| || | |||||||||||| || |||||||| Sbjct: 707404 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 707345 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||||||||||| ||||| |||| ||||||||||| || || || | ||| | ||| Sbjct: 707344 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 707285 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||| ||| |||||||||||||| ||||||||| ||||| ||||| Sbjct: 707284 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctc 707237 Score = 40.1 bits (20), Expect = 9.2 Identities = 32/36 (88%) Strand = Plus / Minus Query: 207 ccttcttcttgggcgacttcgcctccttctcggccg 242 |||||||||||| ||||||||| |||||| ||||| Sbjct: 25633578 ccttcttcttggcggacttcgccgccttcttggccg 25633543
>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0041A22, complete sequence Length = 117919 Score = 190 bits (96), Expect = 4e-45 Identities = 120/128 (93%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||| Sbjct: 52346 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgctgg 52287 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||| Sbjct: 52286 gcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcccggcc 52227 Query: 551 ttcacgga 558 || ||||| Sbjct: 52226 ttgacgga 52219 Score = 127 bits (64), Expect = 5e-26 Identities = 142/168 (84%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||| ||||||||||| | ||||||||| || | |||||||||||| || |||||||| Sbjct: 52603 cttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatggtgac 52544 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||||||||||| ||||| |||| ||||||||||| || || || | ||| | ||| Sbjct: 52543 cccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcctcgg 52484 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||| ||| |||||||||||||| ||||||||| ||||| ||||| Sbjct: 52483 gatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctc 52436
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 184 bits (93), Expect = 3e-43 Identities = 135/149 (90%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||| ||||| ||||||| Sbjct: 17416860 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgc 17416801 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||||||||| |||||||||||||| || || ||||||||||||||||||||||||||| Sbjct: 17416800 gcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggcc 17416741 Query: 551 ttcacggacctggtcaccgacttcttcct 579 || ||||| | | ||||| ||||||||| Sbjct: 17416740 ttgacggagcgcgacaccgccttcttcct 17416712 Score = 119 bits (60), Expect = 1e-23 Identities = 141/168 (83%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| || Sbjct: 17417149 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 17417090 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||||||||| |||| |||||| | || || || || | ||||||||| Sbjct: 17417089 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 17417030 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||| | | |||||||||||||| | |||||||| ||||| ||||| Sbjct: 17417029 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctc 17416982 Score = 44.1 bits (22), Expect = 0.59 Identities = 34/38 (89%) Strand = Plus / Minus Query: 211 cttcttgggcgacttcgcctccttctcggccgcggcgg 248 ||||||||||||||| |||||||| |||| ||||||| Sbjct: 17417200 cttcttgggcgacttggcctccttgccggcggcggcgg 17417163
>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0507H06 Length = 136351 Score = 184 bits (93), Expect = 3e-43 Identities = 135/149 (90%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||| ||||| ||||||| Sbjct: 70252 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgc 70193 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||||||||| |||||||||||||| || || ||||||||||||||||||||||||||| Sbjct: 70192 gcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggcc 70133 Query: 551 ttcacggacctggtcaccgacttcttcct 579 || ||||| | | ||||| ||||||||| Sbjct: 70132 ttgacggagcgcgacaccgccttcttcct 70104 Score = 119 bits (60), Expect = 1e-23 Identities = 141/168 (83%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| || Sbjct: 70541 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 70482 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||||||||| |||| |||||| | || || || || | ||||||||| Sbjct: 70481 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 70422 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||| | | |||||||||||||| | |||||||| ||||| ||||| Sbjct: 70421 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctc 70374 Score = 44.1 bits (22), Expect = 0.59 Identities = 34/38 (89%) Strand = Plus / Minus Query: 211 cttcttgggcgacttcgcctccttctcggccgcggcgg 248 ||||||||||||||| |||||||| |||| ||||||| Sbjct: 70592 cttcttgggcgacttggcctccttgccggcggcggcgg 70555
>ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA Length = 823 Score = 174 bits (88), Expect = 2e-40 Identities = 181/212 (85%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| |||||||||||| || |||||| ||||| ||||||||||| | || Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || ||||| | | ||||||||| | ||||||||||||||||||||| Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 | |||||||||| ||||| ||||| || | |||||||||||||||||||||||||||||| Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309 Query: 457 aaggtagactggggcgccggagccgacgcgct 488 |||||||| ||||| |||| ||||||||||| Sbjct: 308 gaggtagacgggggccccggcgccgacgcgct 277
>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full insert sequence Length = 823 Score = 174 bits (88), Expect = 2e-40 Identities = 181/212 (85%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| |||||||||||| || |||||| ||||| ||||||||||| | || Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || ||||| | | ||||||||| | ||||||||||||||||||||| Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 | |||||||||| ||||| ||||| || | |||||||||||||||||||||||||||||| Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309 Query: 457 aaggtagactggggcgccggagccgacgcgct 488 |||||||| ||||| |||| ||||||||||| Sbjct: 308 gaggtagacgggggccccggcgccgacgcgct 277
>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full insert sequence Length = 1718 Score = 174 bits (88), Expect = 2e-40 Identities = 181/212 (85%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| |||||||||||| || |||||| ||||| ||||||||||| | || Sbjct: 489 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 430 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || ||||| | | ||||||||| | ||||||||||||||||||||| Sbjct: 429 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 370 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 | |||||||||| ||||| ||||| || | |||||||||||||||||||||||||||||| Sbjct: 369 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 310 Query: 457 aaggtagactggggcgccggagccgacgcgct 488 |||||||| ||||| |||| ||||||||||| Sbjct: 309 gaggtagacgggggccccggcgccgacgcgct 278
>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete sequence Length = 93826 Score = 172 bits (87), Expect = 1e-39 Identities = 132/147 (89%) Strand = Plus / Plus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||| Sbjct: 7631 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgg 7690 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 | ||||||||||| |||||||||||| || || ||||||||||||||||||||||||||| Sbjct: 7691 gagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcc 7750 Query: 551 ttcacggacctggtcaccgacttcttc 577 || ||||| | || ||||| ||||||| Sbjct: 7751 ttgacggagcgggacaccggcttcttc 7777 Score = 143 bits (72), Expect = 9e-31 Identities = 144/168 (85%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||||||||||||||| | |||||||||||| | ||| |||||||| || |||||||| Sbjct: 7377 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 7436 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||| ||||| |||| ||||||||||| || || || | ||| ||||| Sbjct: 7437 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 7496 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||| ||| |||||||||||||| ||||||||| || |||||||| Sbjct: 7497 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctc 7544
>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05, complete sequence Length = 163130 Score = 172 bits (87), Expect = 1e-39 Identities = 132/147 (89%) Strand = Plus / Plus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||| Sbjct: 101988 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgg 102047 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 | ||||||||||| |||||||||||| || || ||||||||||||||||||||||||||| Sbjct: 102048 gagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcc 102107 Query: 551 ttcacggacctggtcaccgacttcttc 577 || ||||| | || ||||| ||||||| Sbjct: 102108 ttgacggagcgggacaccggcttcttc 102134 Score = 143 bits (72), Expect = 9e-31 Identities = 144/168 (85%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||||||||||||||| | |||||||||||| | ||| |||||||| || |||||||| Sbjct: 101734 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 101793 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||| ||||| |||| ||||||||||| || || || | ||| ||||| Sbjct: 101794 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 101853 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||| ||| |||||||||||||| ||||||||| || |||||||| Sbjct: 101854 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctc 101901
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 170 bits (86), Expect = 4e-39 Identities = 131/146 (89%) Strand = Plus / Plus Query: 434 gcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcg 493 ||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||| ||| Sbjct: 9471505 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgggcg 9471564 Query: 494 tagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttc 553 |||||||| |||||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 9471565 tagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggccttg 9471624 Query: 554 acggacctggtcaccgacttcttcct 579 ||||| | | ||||| ||||||||| Sbjct: 9471625 acggagcgcgacaccgccttcttcct 9471650 Score = 131 bits (66), Expect = 3e-27 Identities = 108/122 (88%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 ||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| | Sbjct: 28998061 gcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcgctcc 28998002 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| |||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 28998001 gcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagcccggcc 28997942 Query: 551 tt 552 || Sbjct: 28997941 tt 28997940 Score = 119 bits (60), Expect = 1e-23 Identities = 141/168 (83%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| || Sbjct: 9471223 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9471282 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||||||||| |||| |||||| | || || || || | ||||||||| Sbjct: 9471283 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9471342 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||| | | |||||||||||||| | |||||||| ||||| ||||| Sbjct: 9471343 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctc 9471390 Score = 93.7 bits (47), Expect = 7e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 497 cggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttcacg 556 |||| |||||||||||||||||| || |||||||||||||| |||||||||||||| ||| Sbjct: 2464027 cggcttttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacg 2463968 Query: 557 gacctggtcaccgacttcttcct 579 || | ||||||| ||||||||| Sbjct: 2463967 gagcgcgtcaccgccttcttcct 2463945 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 384 tcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||||||||||| |||||||||| ||||| ||||| Sbjct: 28998212 tcttcttgttgtccctcgccgcgttcccggccagctc 28998176 Score = 44.1 bits (22), Expect = 0.59 Identities = 34/38 (89%) Strand = Plus / Plus Query: 211 cttcttgggcgacttcgcctccttctcggccgcggcgg 248 ||||||||||||||| |||||||| |||| ||||||| Sbjct: 9471172 cttcttgggcgacttggcctccttgccggcggcggcgg 9471209 Score = 42.1 bits (21), Expect = 2.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 403 cgcgttgccggcaagctctaggagctcagcggcgaggtactcgag 447 |||||||||||| ||||| |||| ||| |||| ||||||||||| Sbjct: 3353558 cgcgttgccggccagctccaggacctcggcggttaggtactcgag 3353514 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 cttcgcctccttctcggccgcggc 246 ||||||||||||||| |||||||| Sbjct: 9599696 cttcgcctccttctccgccgcggc 9599719
>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0002D01, from chromosome 3, complete sequence Length = 187589 Score = 170 bits (86), Expect = 4e-39 Identities = 131/146 (89%) Strand = Plus / Plus Query: 434 gcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcg 493 ||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||| ||| Sbjct: 168905 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgggcg 168964 Query: 494 tagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttc 553 |||||||| |||||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 168965 tagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggccttg 169024 Query: 554 acggacctggtcaccgacttcttcct 579 ||||| | | ||||| ||||||||| Sbjct: 169025 acggagcgcgacaccgccttcttcct 169050 Score = 119 bits (60), Expect = 1e-23 Identities = 141/168 (83%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| || Sbjct: 168623 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 168682 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||||||||| |||| |||||| | || || || || | ||||||||| Sbjct: 168683 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 168742 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||| | | |||||||||||||| | |||||||| ||||| ||||| Sbjct: 168743 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctc 168790 Score = 44.1 bits (22), Expect = 0.59 Identities = 34/38 (89%) Strand = Plus / Plus Query: 211 cttcttgggcgacttcgcctccttctcggccgcggcgg 248 ||||||||||||||| |||||||| |||| ||||||| Sbjct: 168572 cttcttgggcgacttggcctccttgccggcggcggcgg 168609
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 170 bits (86), Expect = 4e-39 Identities = 131/146 (89%) Strand = Plus / Plus Query: 434 gcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcg 493 ||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||| ||| Sbjct: 9469626 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgggcg 9469685 Query: 494 tagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttc 553 |||||||| |||||||||||||| || || ||||||||||||||||||||||||||||| Sbjct: 9469686 tagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggccttg 9469745 Query: 554 acggacctggtcaccgacttcttcct 579 ||||| | | ||||| ||||||||| Sbjct: 9469746 acggagcgcgacaccgccttcttcct 9469771 Score = 131 bits (66), Expect = 3e-27 Identities = 108/122 (88%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 ||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| | Sbjct: 29089483 gcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcgctcc 29089424 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| |||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 29089423 gcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagcccggcc 29089364 Query: 551 tt 552 || Sbjct: 29089363 tt 29089362 Score = 119 bits (60), Expect = 1e-23 Identities = 141/168 (83%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | |||||||||||| | |||||| ||||| || ||||| || Sbjct: 9469344 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9469403 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||||| |||||||||||||| |||| |||||| | || || || || | ||||||||| Sbjct: 9469404 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9469463 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||| | | |||||||||||||| | |||||||| ||||| ||||| Sbjct: 9469464 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctc 9469511 Score = 93.7 bits (47), Expect = 7e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 497 cggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttcacg 556 |||| |||||||||||||||||| || |||||||||||||| |||||||||||||| ||| Sbjct: 2464137 cggcttttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacg 2464078 Query: 557 gacctggtcaccgacttcttcct 579 || | ||||||| ||||||||| Sbjct: 2464077 gagcgcgtcaccgccttcttcct 2464055 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 384 tcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||||||||||| |||||||||| ||||| ||||| Sbjct: 29089634 tcttcttgttgtccctcgccgcgttcccggccagctc 29089598 Score = 44.1 bits (22), Expect = 0.59 Identities = 34/38 (89%) Strand = Plus / Plus Query: 211 cttcttgggcgacttcgcctccttctcggccgcggcgg 248 ||||||||||||||| |||||||| |||| ||||||| Sbjct: 9469293 cttcttgggcgacttggcctccttgccggcggcggcgg 9469330 Score = 42.1 bits (21), Expect = 2.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 403 cgcgttgccggcaagctctaggagctcagcggcgaggtactcgag 447 |||||||||||| ||||| |||| ||| |||| ||||||||||| Sbjct: 3353669 cgcgttgccggccagctccaggacctcggcggttaggtactcgag 3353625 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 223 cttcgcctccttctcggccgcggc 246 ||||||||||||||| |||||||| Sbjct: 9597817 cttcgcctccttctccgccgcggc 9597840
>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full insert sequence Length = 724 Score = 170 bits (86), Expect = 4e-39 Identities = 149/170 (87%) Strand = Plus / Minus Query: 384 tcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtact 443 |||||||||||||| |||||||||| ||||| ||||| || | ||| ||||||||||||| Sbjct: 345 tcttcttgttgtccctcgccgcgttcccggccagctccagcacctcggcggcgaggtact 286 Query: 444 cgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtagcggcctt 503 |||||||||||| |||||||| |||||||||| ||||||||||| |||||| ||| Sbjct: 285 cgaggacggcggagaggtagacgggggcgccggcgccgacgcgctccgcgtacttgccgg 226 Query: 504 tcttgaggtagcgccctatgcggccgacggggaactggagcccggccttc 553 |||||||||||| | ||||||||||||||||||||||||||||||||| Sbjct: 225 ccttgaggtagcgggcgatgcggccgacggggaactggagcccggccttc 176
>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full insert sequence Length = 824 Score = 167 bits (84), Expect = 6e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| || ||||||||| || |||||| ||||| ||||||||||| ||| || Sbjct: 454 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 395 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || ||||| | | ||||||||| | |||||||||||||||||||| Sbjct: 394 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 335 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 | |||||||||| ||||| ||||| || | ||| |||||||||||||||||||||||||| Sbjct: 334 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 275 Query: 457 aaggtagactggggcgccggagccgacgcgct 488 |||||||| || ||||||| ||||||||||| Sbjct: 274 gaggtagacgggagcgccggcgccgacgcgct 243 Score = 44.1 bits (22), Expect = 0.59 Identities = 25/26 (96%) Strand = Plus / Minus Query: 527 ccgacggggaactggagcccggcctt 552 |||||||||||||| ||||||||||| Sbjct: 204 ccgacggggaactgcagcccggcctt 179
>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full insert sequence Length = 733 Score = 167 bits (84), Expect = 6e-38 Identities = 180/212 (84%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| || ||||||||| || |||||| ||||| ||||||||||| ||| || Sbjct: 453 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 394 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || ||||| | | ||||||||| | |||||||||||||||||||| Sbjct: 393 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 334 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 | |||||||||| ||||| ||||| || | ||| |||||||||||||||||||||||||| Sbjct: 333 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 274 Query: 457 aaggtagactggggcgccggagccgacgcgct 488 |||||||| || ||||||| ||||||||||| Sbjct: 273 gaggtagacgggagcgccggcgccgacgcgct 242 Score = 44.1 bits (22), Expect = 0.59 Identities = 25/26 (96%) Strand = Plus / Minus Query: 527 ccgacggggaactggagcccggcctt 552 |||||||||||||| ||||||||||| Sbjct: 203 ccgacggggaactgcagcccggcctt 178
>ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA Length = 830 Score = 153 bits (77), Expect = 9e-34 Identities = 131/149 (87%) Strand = Plus / Minus Query: 335 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 394 |||| |||||||||||||||||| | | |||||| || | |||||||||||||||||| Sbjct: 436 tcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttgttg 377 Query: 395 tccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcg 454 ||| |||||||||| ||||| ||||| || | |||||||||||||||||||||||||||| Sbjct: 376 tccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacggcg 317 Query: 455 gcaaggtagactggggcgccggagccgac 483 || |||||||| |||||||||| |||||| Sbjct: 316 gcgaggtagaccggggcgccggcgccgac 288 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 530 acggggaactggagcccggcctt 552 ||||||||||||||||||||||| Sbjct: 241 acggggaactggagcccggcctt 219
>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full insert sequence Length = 830 Score = 153 bits (77), Expect = 9e-34 Identities = 131/149 (87%) Strand = Plus / Minus Query: 335 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 394 |||| |||||||||||||||||| | | |||||| || | |||||||||||||||||| Sbjct: 436 tcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttgttg 377 Query: 395 tccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcg 454 ||| |||||||||| ||||| ||||| || | |||||||||||||||||||||||||||| Sbjct: 376 tccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacggcg 317 Query: 455 gcaaggtagactggggcgccggagccgac 483 || |||||||| |||||||||| |||||| Sbjct: 316 gcgaggtagaccggggcgccggcgccgac 288 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 530 acggggaactggagcccggcctt 552 ||||||||||||||||||||||| Sbjct: 241 acggggaactggagcccggcctt 219
>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-10 Length = 691 Score = 147 bits (74), Expect = 6e-32 Identities = 182/218 (83%) Strand = Plus / Minus Query: 335 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 394 |||| |||||||||||||||||| | | ||||||||| | ||||||||||||||||||| Sbjct: 365 tcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttcttgttg 306 Query: 395 tccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcg 454 ||| |||||||||| ||||| | ||| || | |||||||||||| ||||| || |||||| Sbjct: 305 tccctcgccgcgttcccggccaactccagaacctcagcggcgagatactccagcacggcg 246 Query: 455 gcaaggtagactggggcgccggagccgacgcgctgcgcgtagcggcctttcttgaggtag 514 || |||||||| |||||||||| |||||| | || ||||| ||| ||||||| | Sbjct: 245 gcgaggtagacgggggcgccggcgccgaccctctcggcgtacttgccggccttgaggaac 186 Query: 515 cgccctatgcggccgacggggaactggagcccggcctt 552 ||| | || | ||||||||||||||||||||||||||| Sbjct: 185 cgcgcgatcctgccgacggggaactggagcccggcctt 148
>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4 Length = 725 Score = 147 bits (74), Expect = 6e-32 Identities = 182/218 (83%) Strand = Plus / Minus Query: 335 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 394 |||| |||||||||||||||||| | | ||||||||| | ||||||||||||||||||| Sbjct: 363 tcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttcttgttg 304 Query: 395 tccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcg 454 ||| |||||||||| ||||| | ||| || | |||||||||||| ||||| || |||||| Sbjct: 303 tccctcgccgcgttcccggccaactccagaacctcagcggcgagatactccagcacggcg 244 Query: 455 gcaaggtagactggggcgccggagccgacgcgctgcgcgtagcggcctttcttgaggtag 514 || |||||||| |||||||||| |||||| | || ||||| ||| ||||||| | Sbjct: 243 gcgaggtagacgggggcgccggcgccgaccctctcggcgtacttgccggccttgaggaac 184 Query: 515 cgccctatgcggccgacggggaactggagcccggcctt 552 ||| | || | ||||||||||||||||||||||||||| Sbjct: 183 cgcgcgatcctgccgacggggaactggagcccggcctt 146
>ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA Length = 405 Score = 145 bits (73), Expect = 2e-31 Identities = 246/301 (81%), Gaps = 2/301 (0%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||||||||| |||| | || ||||||||| || |||||||||| || |||||||| Sbjct: 363 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 304 Query: 313 gccggcgagcag-cttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcg 371 | || ||||||| | | | || |||| ||||||||| |||||||| | | ||| | || Sbjct: 303 ggcgccgagcaggcgcgac-agctcctcgtcgttgcgcacggcgagctggatgtgcctcg 245 Query: 372 ggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcag 431 | | ||| || ||||||||||||||| ||||||||| ||||| ||||| || | ||| | Sbjct: 244 gcacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctcaagaacctcgg 185 Query: 432 cggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcg 491 ||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| | Sbjct: 184 cggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacgcgctcgg 125 Query: 492 cgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcct 551 |||| ||| ||||||| |||| | || | |||||||||||||||||||||||||| Sbjct: 124 cgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagcccggcct 65 Query: 552 t 552 | Sbjct: 64 t 64
>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700), mRNA Length = 393 Score = 135 bits (68), Expect = 2e-28 Identities = 194/236 (82%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| ||||| |||| | ||||||||| | ||||| || || || ||||| || Sbjct: 360 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||||||||||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | ||||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 180 agtcaggtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 125
>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full insert sequence Length = 747 Score = 135 bits (68), Expect = 2e-28 Identities = 224/276 (81%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| | |||||||||| || ||||||||| || |||||||| ||| || || Sbjct: 455 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 396 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || || || | | ||| | ||| | ||| ||| ||||||||||||| Sbjct: 395 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 336 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 | |||||||||| || || ||||| || | ||| ||||||||||||||||||||||||| Sbjct: 335 cctcgccgcgttccccgccagctccagcacctcggcggcgaggtactcgaggacggcgga 276 Query: 457 aaggtagactggggcgccggagccgacgcgctgcgcgtagcggcctttcttgaggtagcg 516 |||||||| |||||||||| ||||||||||| ||||| ||| ||||||||| | Sbjct: 275 gaggtagacgggggcgccggcgccgacgcgctcggcgtacttgccggccttgaggtacct 216 Query: 517 ccctatgcggccgacggggaactggagcccggcctt 552 | ||||||||||||||||||||||| |||||||| Sbjct: 215 ggcgatgcggccgacggggaactggaggccggcctt 180
>gb|AY104828.1| Zea mays PCO072413 mRNA sequence Length = 741 Score = 135 bits (68), Expect = 2e-28 Identities = 116/132 (87%) Strand = Plus / Minus Query: 364 gtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctag 423 ||||||||| | ||||||||||||||||||||| |||| ||||| |||||||| || || Sbjct: 309 gtggcgcggcacaatgcgggtcttcttgttgtccctcgcggcgttcccggcaagttcgag 250 Query: 424 gagctcagcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgac 483 | |||||| ||||||||||||||||||||||| ||||| || |||||||||| |||||| Sbjct: 249 aacctcagccgcgaggtactcgaggacggcggcgaggtacacgggggcgccggcgccgac 190 Query: 484 gcgctgcgcgta 495 ||||| |||||| Sbjct: 189 gcgctccgcgta 178 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 526 gccgacggggaactggagcccggcctt 552 |||||||||||||||||| |||||||| Sbjct: 147 gccgacggggaactggagtccggcctt 121
>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0031O09, complete sequence Length = 161339 Score = 131 bits (66), Expect = 3e-27 Identities = 108/122 (88%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 ||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| | Sbjct: 38202 gcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcgctcc 38143 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| |||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 38142 gcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagcccggcc 38083 Query: 551 tt 552 || Sbjct: 38082 tt 38081 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 384 tcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||||||||||| |||||||||| ||||| ||||| Sbjct: 38353 tcttcttgttgtccctcgccgcgttcccggccagctc 38317
>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map near C10769, complete sequence Length = 194856 Score = 131 bits (66), Expect = 3e-27 Identities = 108/122 (88%) Strand = Plus / Plus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 ||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| | Sbjct: 141230 gcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcgctcc 141289 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| |||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 141290 gcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagcccggcc 141349 Query: 551 tt 552 || Sbjct: 141350 tt 141351 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Plus Query: 384 tcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||||||||||| |||||||||| ||||| ||||| Sbjct: 141079 tcttcttgttgtccctcgccgcgttcccggccagctc 141115
>gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic sequence, complete sequence Length = 184366 Score = 131 bits (66), Expect = 3e-27 Identities = 108/122 (88%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 ||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| | Sbjct: 181356 gcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcgctcc 181297 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| |||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 181296 gcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagcccggcc 181237 Query: 551 tt 552 || Sbjct: 181236 tt 181235 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 384 tcttcttgttgtccttcgccgcgttgccggcaagctc 420 |||||||||||||| |||||||||| ||||| ||||| Sbjct: 181507 tcttcttgttgtccctcgccgcgttcccggccagctc 181471
>gb|AY104826.1| Zea mays PCO099353 mRNA sequence Length = 793 Score = 131 bits (66), Expect = 3e-27 Identities = 132/154 (85%) Strand = Plus / Minus Query: 335 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 394 |||| ||||||||| |||||||| | | ||| ||||| | |||||||||||||||||| Sbjct: 380 tcctcgtcgttgcgcacggcgagctggatgtgacgcggcacgatgcgggtcttcttgtta 321 Query: 395 tccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcg 454 ||| |||| ||||| || |||||||| |||| |||||||||||||||||||||||| || Sbjct: 320 tccctcgctgcgttcccagcaagctccaggacctcagcggcgaggtactcgaggacagct 261 Query: 455 gcaaggtagactggggcgccggagccgacgcgct 488 || |||||||| |||||||||| ||| ||||||| Sbjct: 260 gcgaggtagacaggggcgccggcgcccacgcgct 227
>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone MGC:11561 IMAGE:3156946), complete cds Length = 1414 Score = 129 bits (65), Expect = 1e-26 Identities = 206/253 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 228 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| || Sbjct: 227 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 168 Query: 493 gtagcggcctttc 505 |||| |||||||| Sbjct: 167 gtagtggcctttc 155
>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence Length = 185902 Score = 129 bits (65), Expect = 1e-26 Identities = 206/253 (81%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 149654 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 149713 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 149714 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 149773 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 149774 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 149833 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| || Sbjct: 149834 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 149893 Query: 493 gtagcggcctttc 505 |||| |||||||| Sbjct: 149894 gtagtggcctttc 149906
>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA Length = 1414 Score = 129 bits (65), Expect = 1e-26 Identities = 206/253 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 228 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| || Sbjct: 227 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 168 Query: 493 gtagcggcctttc 505 |||| |||||||| Sbjct: 167 gtagtggcctttc 155
>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X Length = 2166 Score = 129 bits (65), Expect = 1e-26 Identities = 206/253 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 986 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 927 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 926 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 867 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 866 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 807 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| || Sbjct: 806 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 747 Query: 493 gtagcggcctttc 505 |||| |||||||| Sbjct: 746 gtagtggcctttc 734
>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone MGC:6616 IMAGE:3490058), complete cds Length = 1367 Score = 129 bits (65), Expect = 1e-26 Identities = 206/253 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 401 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 342 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 341 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 282 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 281 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 222 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| || Sbjct: 221 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 162 Query: 493 gtagcggcctttc 505 |||| |||||||| Sbjct: 161 gtagtggcctttc 149
>gb|AY108339.1| Zea mays PCO070432 mRNA sequence Length = 811 Score = 129 bits (65), Expect = 1e-26 Identities = 128/149 (85%) Strand = Plus / Minus Query: 335 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 394 |||| |||||||||||||||||| | | ||||||||||| ||||||||||||||||||| Sbjct: 391 tcctcgtcgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttcttgttg 332 Query: 395 tccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcg 454 ||| |||||||| ||||||||||| || | |||||| || || |||||||| ||||| Sbjct: 331 tcccgagccgcgttcccggcaagctcgagaacctcagcagcaagatactcgagcacggca 272 Query: 455 gcaaggtagactggggcgccggagccgac 483 || |||||||| |||||||||| |||||| Sbjct: 271 gcgaggtagacgggggcgccggcgccgac 243 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 533 gggaactggagcccggcctt 552 |||||||||||||||||||| Sbjct: 193 gggaactggagcccggcctt 174
>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165 IMAGE:3355200), complete cds Length = 897 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| ||||| |||| | ||||||||| | ||||| || || || ||||| || Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||||||||||||| |||| ||| || Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 223 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | | ||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 222 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 167
>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456 IMAGE:6671338), complete cds Length = 889 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| ||||| |||| | ||||||||| | ||||| || || || ||||| || Sbjct: 392 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 333 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||||||||||||| |||| ||| || Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 213 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | | ||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 212 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 157
>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA Length = 393 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 125
>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA Length = 496 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| ||||| |||| | ||||||||| | ||||| || || || ||||| || Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||||||||||||| |||| ||| || Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 223 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | | ||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 222 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 167
>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2 (LOC665433), mRNA Length = 465 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 392 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 333 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 213 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 212 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 157
>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1 (LOC665433), mRNA Length = 467 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 394 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 335 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 334 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 275 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 274 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 215 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 214 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 159
>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3, complete sequence Length = 151563 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| ||||| |||| | ||||||||| | ||||| || || || ||||| || Sbjct: 100907 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 100848 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 100847 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 100788 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||||||||||||| |||| ||| || Sbjct: 100787 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 100728 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | | ||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 100727 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 100672
>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a novel gene, the genes for three H1, four H2a, five H2b, four H3 and four H4 histone family members, the 3' end of a variant of the Hfe gene for hemochromatosis protein (Mr2) and ten CpG islands, complete sequence Length = 184730 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 163973 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 164032 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 164033 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 164092 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 164093 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 164152 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 164153 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 164208 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 55436 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 55377 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 55376 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 55317 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 55316 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 55257 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 55256 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 55201 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 51355 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 51414 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 51415 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 51474 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 51475 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 51534 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 51535 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 51590 Score = 111 bits (56), Expect = 3e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 14872 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 14813 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | | ||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 14812 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 14753 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 14752 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 14693 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 14692 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 14637
>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA Length = 2493 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 225 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 224 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 169
>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the genes for H2b histone family member A, two H2a, two H4 and an H2b histone family member, a serine/threonine protein kinase pseudogene, a novel pseudogene, a novel gene (4930500C15Rik), the gene for a novel KRAB box and C2H2 Zinc Finger containing protein, a ribosomal protein L21 (RPL21) pseudogene, a TU mitochondrial translation elongation factor (tufa) pseudogene, the 5' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121 and four CpG islands, complete sequence Length = 182817 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 33283 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 33342 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 33343 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 33402 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 33403 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 33462 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 33463 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 33518 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 10993 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 10934 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 10933 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 10874 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 10873 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 10814 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 10813 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 10758
>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the 3' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121, the Prss16 gene for thymus serine protease16, three novel genes, the genes for two H2a, two H2b and one H4 histone family members, a ribosomal protein L37A (Rpl37a) pseudogene, a novel pseudogene, three genes for novel vomeronasal 1 receptor H (V1rh) family members, the gene for a novel vomeronasal 1 receptor I (V1ri) family member, six V1ri pseudogenes, a V1rh pseudogene and six CpG islands, complete sequence Length = 210845 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 59924 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 59983 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 59984 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60043 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 60044 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 60103 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 60104 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 60159 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 52549 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 52608 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 52609 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 52668 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 52669 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 52728 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 52729 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 52784
>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771 IMAGE:1263745), complete cds Length = 527 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 203 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 202 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 147
>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length enriched library, clone:I0C0045N09 product:histone 1, H2ad, full insert sequence Length = 446 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 393 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 334 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 333 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 274 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 273 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 214 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 213 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 158
>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched library, clone:I920064A15 product:histone 1, H2ad, full insert sequence Length = 445 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 212 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 211 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 156
>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds Length = 444 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 192 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 137
>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA Length = 527 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 203 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 202 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 147
>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched library, clone:9030420B16 product:histone 1, H2ac, full insert sequence Length = 2493 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 225 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 224 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 169
>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds Length = 1390 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 680 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 625
>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds Length = 1392 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 859 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 800 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 799 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 740 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 739 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 680 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 679 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 624
>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds Length = 1390 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || |||||||| |||||||||| ||| ||||||| Sbjct: 680 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 625
>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds Length = 1173 Score = 127 bits (64), Expect = 5e-26 Identities = 193/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| ||||| |||| | ||||||||| | ||||| || || || ||||| || Sbjct: 752 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 693 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 692 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 633 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||||||||||||| |||| ||| || Sbjct: 632 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 573 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | | ||||||||| || ||||| || ||||| |||||||||| ||| ||||||| Sbjct: 572 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 517
>gb|AY110108.1| Zea mays CL14299_1 mRNA sequence Length = 712 Score = 125 bits (63), Expect = 2e-25 Identities = 192/235 (81%) Strand = Plus / Plus Query: 318 cgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatga 377 |||||||||||| |||||||| ||||||||| |||||||| | | ||| ||||| | || Sbjct: 337 cgagcagcttgctgagttcctcgtcgttgcgcacggcgagctggatgtgacgcggcacga 396 Query: 378 tgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcga 437 ||||| ||||||||||||| |||||||||||| || || || | | ||| || |||| Sbjct: 397 tgcggttcttcttgttgtcgcgcgccgcgttgcccgccagttccaacacctctgccgcga 456 Query: 438 ggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtagc 497 | |||||||||||||||| |||||||| || || || ||||||||||| ||||| Sbjct: 457 gatactcgaggacggcggagaggtagacgggcgcaccaccgccgacgcgctcggcgtact 516 Query: 498 ggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||| ||||||||||||| | |||||||||||||||||||| ||||||||||| Sbjct: 517 tgccggccttgaggtagcgcgcgatgcggccgacggggaactgcagcccggcctt 571
>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X Length = 1359 Score = 121 bits (61), Expect = 3e-24 Identities = 205/253 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 411 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 352 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 351 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 292 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 291 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 232 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| || Sbjct: 231 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 172 Query: 493 gtagcggcctttc 505 |||| |||||||| Sbjct: 171 gtagtggcctttc 159
>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010005I09 product:H2A histone family, member X, full insert sequence Length = 564 Score = 121 bits (61), Expect = 3e-24 Identities = 206/253 (81%), Gaps = 1/253 (0%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 427 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 368 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 367 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 308 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 307 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 248 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| || Sbjct: 247 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctg-gcccacgcgctcggc 189 Query: 493 gtagcggcctttc 505 |||| |||||||| Sbjct: 188 gtagtggcctttc 176
>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence Length = 209720 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 64629 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 64570 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 64569 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 64510 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 64509 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 64450 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 64449 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 64394 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 60548 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 60607 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 60608 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60667 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 60668 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 60727 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 60728 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 60783 Score = 111 bits (56), Expect = 3e-21 Identities = 191/236 (80%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 101108 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 101167 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | | ||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 101168 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 101227 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 101228 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 101287 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 101288 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 101343
>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome 13 Length = 1357 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 663 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 662 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 607
>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA Length = 547 Score = 119 bits (60), Expect = 1e-23 Identities = 198/244 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | | ||||||||| | ||||||||| || || ||||| || Sbjct: 389 cttcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgggcgatggtcac 330 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 ||| | ||||||||| || |||| ||||||||| ||||| || | ||||| ||||| Sbjct: 329 tccgcccagcagcttgttcagctcctcgtcgttgcgcacggccagctgcaggtgccgcgg 270 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| | ||||||||||||||| || ||||| ||||| ||||| |||| |||||| Sbjct: 269 gatgatcctggtcttcttgttgtcgcgggcggcgttcccggccagctccaggatctcagc 210 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || |||||||| || ||||| || |||||||| |||||||||| |||||| ||||| || Sbjct: 209 ggtcaggtactccagcacggccgccaggtagaccggggcgccggcgccgacacgctgggc 150 Query: 493 gtag 496 |||| Sbjct: 149 gtag 146
>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained intron Length = 497 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 212 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 211 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 156
>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) Length = 1826 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 1308 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1249 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 1248 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1189 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 1188 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1129 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 1128 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1073
>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) Length = 1797 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 1309 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1250 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 1249 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1190 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 1189 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1130 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 1129 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1074
>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571 IMAGE:30789778), complete cds Length = 1075 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 370 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 311 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 310 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 251 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 250 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 191 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 190 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 135
>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five genes for olfactory receptors, a novel gene, the H1f5 gene for H1 histone family member 5, three genes and one pseudogene for H2a histone family members, four genes for H2b, two genes for H4, and two genes for H3 histone family members and seven CpG islands, complete sequence Length = 222823 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 142450 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142509 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 142510 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142569 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 142570 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 142629 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 142630 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 142685 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 137771 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 137712 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 137711 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137652 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 137651 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 137592 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 137591 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137536 Score = 111 bits (56), Expect = 3e-21 Identities = 191/236 (80%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 174458 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 174517 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 174518 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 174577 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||| ||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 174578 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 174637 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 174638 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 174693 Score = 103 bits (52), Expect = 7e-19 Identities = 172/212 (81%) Strand = Plus / Plus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| | |||||||| || || ||||| |||| | | ||||||||| ||| || Sbjct: 207873 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 207932 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||||| ||| || | |||||||||||||||||||| |||||||||||||| Sbjct: 207933 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 207992 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 ||||||||||| || ||||| |||| ||| || | |||||||| || ||||| || Sbjct: 207993 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 208052 Query: 457 aaggtagactggggcgccggagccgacgcgct 488 ||||| || |||||||||| ||| ||||||| Sbjct: 208053 caggtacaccggggcgccggcgcccacgcgct 208084
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 136886 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 136945 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 136946 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137005 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 137006 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 137065 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 137066 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137121 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 142180 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142121 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 142120 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142061 Query: 373 gatgatgcgggtcttcttgttgtc 396 ||||||||| |||||||||||||| Sbjct: 142060 gatgatgcgcgtcttcttgttgtc 142037
>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847 IMAGE:5713252), complete cds Length = 492 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 390 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 331 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 330 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 271 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 270 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 211 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 210 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 155
>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730004H15 product:histone 1, H2ai, full insert sequence Length = 1396 Score = 119 bits (60), Expect = 1e-23 Identities = 193/236 (81%), Gaps = 1/236 (0%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 371 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 312 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || ||| ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 311 gc-ggccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 192 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137
>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA Length = 506 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 405 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 346 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 345 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 286 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 285 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 226 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 225 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 170
>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds Length = 447 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 192 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137
>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 Length = 2110 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 630 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 571 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 570 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 511 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 510 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 451 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 450 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 395
>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 Length = 2221 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 628 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 569 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 568 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 509 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 508 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 449 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 448 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 393
>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA Length = 705 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 294 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 293 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 238
>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA Length = 393 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125
>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone H2b-F (H2b-F) genes, complete cds Length = 2822 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 1469 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1528 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 1529 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1588 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 1589 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1648 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 1649 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1704
>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1190022L06 product:HISTONE H2A homolog [Homo sapiens], full insert sequence Length = 705 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 294 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 293 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 238
>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA Length = 393 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125
>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted) (Hist1h2an_predicted), mRNA Length = 546 Score = 119 bits (60), Expect = 1e-23 Identities = 183/224 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgtgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| ||||||||||||||| |||| |||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtccctcgctgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccgg 476 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137
>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds Length = 1390 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625
>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds Length = 1390 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625
>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds Length = 1390 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625
>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds Length = 1381 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 677 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 622
>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence Length = 1357 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 663 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 662 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 607
>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds Length = 1387 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 677 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 622
>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA Length = 387 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125
>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene Length = 668 Score = 119 bits (60), Expect = 1e-23 Identities = 192/236 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 483 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 424 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 423 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 364 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 363 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 304 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 303 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 248
>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430002L09 product:H2A histone family, member X, full insert sequence Length = 1379 Score = 117 bits (59), Expect = 5e-23 Identities = 161/195 (82%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 430 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 371 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 370 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 311 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 310 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 251 Query: 433 ggcgaggtactcgag 447 | |||||||||||| Sbjct: 250 agtgaggtactcgag 236
>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962), mRNA Length = 437 Score = 113 bits (57), Expect = 8e-22 Identities = 132/157 (84%) Strand = Plus / Minus Query: 320 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 379 ||||||||| ||| |||| ||||||||||| ||| || | |||||||||||||||||| Sbjct: 307 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 248 Query: 380 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgagg 439 || ||||||||||||||| ||||||||||||| || ||||| |||| ||| || | ||| Sbjct: 247 cgcgtcttcttgttgtccctcgccgcgttgcccgccagctccaggatctcggccgtcagg 188 Query: 440 tactcgaggacggcggcaaggtagactggggcgccgg 476 ||||| || ||||| || || || ||||||||||||| Sbjct: 187 tactccagcacggccgccagatacactggggcgccgg 151
>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds Length = 2132 Score = 113 bits (57), Expect = 8e-22 Identities = 183/225 (81%) Strand = Plus / Plus Query: 250 ggacttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggt 309 |||||||||||| ||||| |||| || |||||||| | ||| |||||| |||||||| Sbjct: 468 ggacttcttgggcagcagaacggcgtgaatgttgggcagcacaccgccggacgcaatggt 527 Query: 310 gacgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcg 369 ||| || | ||||||||||| || |||| ||||||||||| |||||| | | |||||| Sbjct: 528 cacgtcgcccagcagcttgcccagctcctcgtcgttgcggatggcgagctggatgtggcg 587 Query: 370 cgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctc 429 ||||| ||||||| ||||||||||||| ||||||||||| || ||||| || | ||| Sbjct: 588 cgggacgatgcggttcttcttgttgtcgcgggccgcgttgccagccagctccagaacctc 647 Query: 430 agcggcgaggtactcgaggacggcggcaaggtagactggggcgcc 474 ||| | |||||||| || || ||||| |||||||| |||||||| Sbjct: 648 agcagtcaggtactccagcacagcggccaggtagacgggggcgcc 692
>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete cds Length = 2120 Score = 111 bits (56), Expect = 3e-21 Identities = 182/224 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || |||||||| Sbjct: 1165 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatggtgac 1106 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||| ||||| || | ||||| || || Sbjct: 1105 gccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacgggg 1046 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||||||||||||||||||||| || || |||||||| ||||| |||| ||| || Sbjct: 1045 gatgatgcgggtcttcttgttgtcgcgggcggcattgccggccagctccaggatctcggc 986 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccgg 476 || ||| |||||||| || ||||| | |||||| || ||||||| Sbjct: 985 ggtgagatactcgagcacagcggccaagtagacgggagcgccgg 942
>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA Length = 393 Score = 111 bits (56), Expect = 3e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||| ||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 125
>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129), mRNA Length = 393 Score = 111 bits (56), Expect = 3e-21 Identities = 182/224 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | | |||||| || | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcaccgcctggatgtttggcagaacgccgccctgtgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| ||||||||||||||| |||| |||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtccctcgctgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccgg 476 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137
>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds Length = 1390 Score = 111 bits (56), Expect = 3e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 884 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 825 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | | ||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 824 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 765 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 764 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 705 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 704 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 649
>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds Length = 1201 Score = 111 bits (56), Expect = 3e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 894 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 835 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 834 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 775 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||| ||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 774 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 715 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 714 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 659
>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA Length = 393 Score = 111 bits (56), Expect = 3e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | | ||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125
>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence Length = 567 Score = 111 bits (56), Expect = 3e-21 Identities = 191/236 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| ||| ||||||||||| ||| || | ||||||||||| Sbjct: 363 gcggcccagcagcttgttgagctccacgtcgttgcggatggccagctgcaggtggcgcgg 304 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 303 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 244 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 243 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 188
>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and histone H2A genes, complete cds Length = 4358 Score = 111 bits (56), Expect = 3e-21 Identities = 239/300 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | || ||||||||| | ||| ||||| ||||||||| || Sbjct: 4160 cttcttgggcagcagcaccgcgtggatgttgggcagcacaccgcccgaagcaatggtcac 4101 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | ||||||||||| || |||| ||||||||||| ||| || | | |||||| || Sbjct: 4100 ctcgcccagcagcttgcccagctcctcgtcgttgcggatggccagctggatgtggcgggg 4041 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 | ||||||| ||||||||||||| || ||||||||||| ||||| || | |||||| Sbjct: 4040 cacgatgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagc 3981 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || |||||||| || || ||||| ||||| || || ||||||| |||| ||||| || Sbjct: 3980 ggtcaggtactccagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3921 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||| ||| ||||| ||||||||| | |||||||| ||||||||||| || |||||||| Sbjct: 3920 gtacttgcccttcttcaggtagcgcgcaatgcggccaacggggaactgcaggccggcctt 3861
>emb|X14730.1|CMHIST2A Duck H2A histone gene Length = 845 Score = 109 bits (55), Expect = 1e-20 Identities = 196/243 (80%) Strand = Plus / Minus Query: 254 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgacg 313 |||||||| |||||||||| | ||||||||| | ||| ||||| || || |||||||| Sbjct: 509 ttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtgacc 450 Query: 314 ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcggg 373 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| ||| Sbjct: 449 ttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcggggg 390 Query: 374 atgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcg 433 |||||||| |||||||||||||| ||||||||||| || |||||||||| ||| || Sbjct: 389 atgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctctaggatctcggcc 330 Query: 434 gcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcg 493 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| |||| Sbjct: 329 gttaggtactccagtacggccgccaggtacaccggggcgccggcgcccacccgctccgcg 270 Query: 494 tag 496 ||| Sbjct: 269 tag 267 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 240 gcggcccacggggaactgcagcccggcc 213
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 107 bits (54), Expect = 5e-20 Identities = 105/122 (86%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| Sbjct: 20566244 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacgcgctcg 20566185 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| ||||||| |||| | || | ||||||||||||||||||||||||| Sbjct: 20566184 gcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagcccggcc 20566125 Query: 551 tt 552 || Sbjct: 20566124 tt 20566123 Score = 56.0 bits (28), Expect = 2e-04 Identities = 102/128 (79%), Gaps = 9/128 (7%) Strand = Plus / Plus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 ||||| |||||| |||||||||| || |||||||| |||| ||| | ||||||||| ||| Sbjct: 11503417 gcggcaaggtacccgaggacggcagcgaggtagacgggggtgccagtgccgacgcgttgc 11503476 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 |||| ||||| |||| ||||||| |||| ||| ||||||||||||||||| Sbjct: 11503477 gcgtgccggccgttctcgaggtag---------cggcttacgaggaactggagcccggcc 11503527 Query: 551 ttcacgga 558 || ||||| Sbjct: 11503528 ttgacgga 11503535 Score = 50.1 bits (25), Expect = 0.010 Identities = 135/169 (79%), Gaps = 2/169 (1%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||||||||| |||| | || ||||||||| || |||||||||| || |||||||| Sbjct: 20566519 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 20566460 Query: 313 gccggcgagca-gcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcg 371 | || |||||| || | | || |||| ||||||||| |||||||| | | ||| | || Sbjct: 20566459 ggcgccgagcaggcgcgac-agctcctcgtcgttgcgcacggcgagctggatgtgcctcg 20566401 Query: 372 ggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 | | ||| || ||||||||||||||| ||||||||| ||||| ||||| Sbjct: 20566400 gcacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctc 20566352
>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0032E15 Length = 120419 Score = 107 bits (54), Expect = 5e-20 Identities = 105/122 (86%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| Sbjct: 70205 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacgcgctcg 70146 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| ||||||| |||| | || | ||||||||||||||||||||||||| Sbjct: 70145 gcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagcccggcc 70086 Query: 551 tt 552 || Sbjct: 70085 tt 70084 Score = 50.1 bits (25), Expect = 0.010 Identities = 135/169 (79%), Gaps = 2/169 (1%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||||||||| |||| | || ||||||||| || |||||||||| || |||||||| Sbjct: 70480 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 70421 Query: 313 gccggcgagca-gcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcg 371 | || |||||| || | | || |||| ||||||||| |||||||| | | ||| | || Sbjct: 70420 ggcgccgagcaggcgcgac-agctcctcgtcgttgcgcacggcgagctggatgtgcctcg 70362 Query: 372 ggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 | | ||| || ||||||||||||||| ||||||||| ||||| ||||| Sbjct: 70361 gcacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctc 70313
>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1663_D06 Length = 139103 Score = 107 bits (54), Expect = 5e-20 Identities = 105/122 (86%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 |||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| Sbjct: 40616 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacgcgctcg 40557 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| ||||||| |||| | || | ||||||||||||||||||||||||| Sbjct: 40556 gcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagcccggcc 40497 Query: 551 tt 552 || Sbjct: 40496 tt 40495 Score = 50.1 bits (25), Expect = 0.010 Identities = 135/169 (79%), Gaps = 2/169 (1%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||||||||| |||| | || ||||||||| || |||||||||| || |||||||| Sbjct: 40891 cttcttggggaggagcaggttgtggatgttgggcatgacgccgccgttggcgatggtgac 40832 Query: 313 gccggcgagca-gcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcg 371 | || |||||| || | | || |||| ||||||||| |||||||| | | ||| | || Sbjct: 40831 ggcgccgagcaggcgcgac-agctcctcgtcgttgcgcacggcgagctggatgtgcctcg 40773 Query: 372 ggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctc 420 | | ||| || ||||||||||||||| ||||||||| ||||| ||||| Sbjct: 40772 gcacgatccgcgtcttcttgttgtcccgcgccgcgttcccggcgagctc 40724
>ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H2A.x (H2a/x) (LOC466864), mRNA Length = 432 Score = 105 bits (53), Expect = 2e-19 Identities = 200/249 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 300 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| || |||||||||||||| ||||| ||||| || ||||| |||| |||||| Sbjct: 240 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || ||||||||| || || || || ||||| ||||| ||||||| ||| ||||||| || Sbjct: 180 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 121 Query: 493 gtagcggcc 501 |||| |||| Sbjct: 120 gtagtggcc 112
>gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone MGC:4759 IMAGE:3537648), complete cds Length = 1580 Score = 105 bits (53), Expect = 2e-19 Identities = 200/249 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 403 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 344 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 343 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 284 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| || |||||||||||||| ||||| ||||| || ||||| |||| |||||| Sbjct: 283 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 224 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || ||||||||| || || || || ||||| ||||| ||||||| ||| ||||||| || Sbjct: 223 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 164 Query: 493 gtagcggcc 501 |||| |||| Sbjct: 163 gtagtggcc 155
>ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AFX), mRNA Length = 1651 Score = 105 bits (53), Expect = 2e-19 Identities = 200/249 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 433 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 374 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 373 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 314 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| || |||||||||||||| ||||| ||||| || ||||| |||| |||||| Sbjct: 313 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 254 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || ||||||||| || || || || ||||| ||||| ||||||| ||| ||||||| || Sbjct: 253 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 194 Query: 493 gtagcggcc 501 |||| |||| Sbjct: 193 gtagtggcc 185
>emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X Length = 1585 Score = 105 bits (53), Expect = 2e-19 Identities = 200/249 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 433 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 374 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 373 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 314 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| || |||||||||||||| ||||| ||||| || ||||| |||| |||||| Sbjct: 313 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 254 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || ||||||||| || || || || ||||| ||||| ||||||| ||| ||||||| || Sbjct: 253 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 194 Query: 493 gtagcggcc 501 |||| |||| Sbjct: 193 gtagtggcc 185
>gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone MGC:4703 IMAGE:3534359), complete cds Length = 1616 Score = 105 bits (53), Expect = 2e-19 Identities = 200/249 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 398 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 339 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 338 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 279 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| || |||||||||||||| ||||| ||||| || ||||| |||| |||||| Sbjct: 278 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 219 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || ||||||||| || || || || ||||| ||||| ||||||| ||| ||||||| || Sbjct: 218 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 159 Query: 493 gtagcggcc 501 |||| |||| Sbjct: 158 gtagtggcc 150
>emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 1373 Score = 105 bits (53), Expect = 2e-19 Identities = 200/249 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 415 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 356 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 355 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 296 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| || |||||||||||||| ||||| ||||| || ||||| |||| |||||| Sbjct: 295 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 236 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || ||||||||| || || || || ||||| ||||| ||||||| ||| ||||||| || Sbjct: 235 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 176 Query: 493 gtagcggcc 501 |||| |||| Sbjct: 175 gtagtggcc 167
>gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX) gene, complete cds Length = 5462 Score = 105 bits (53), Expect = 2e-19 Identities = 200/249 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 2431 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 2372 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 2371 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 2312 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| || |||||||||||||| ||||| ||||| || ||||| |||| |||||| Sbjct: 2311 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 2252 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || ||||||||| || || || || ||||| ||||| ||||||| ||| ||||||| || Sbjct: 2251 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 2192 Query: 493 gtagcggcc 501 |||| |||| Sbjct: 2191 gtagtggcc 2183
>ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone H2A.x (H2a/x) (LOC500987), mRNA Length = 1569 Score = 105 bits (53), Expect = 2e-19 Identities = 203/253 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || || || || Sbjct: 639 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatagtcac 580 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| || || | ||||||||||| Sbjct: 579 gccgcccagcagcttgttgagctcctcgtcgttgcggatagccagctgcaggtggcgcgg 520 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||| ||||| ||||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 519 gataatgcgcgtcttcttgttgtcccgagccgcgttgcccgccagctccaggatctcggc 460 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| || Sbjct: 459 agtgaggtactcgagcaccgccgccaggtacacgggcgcgcctgcgcccacgcgctcggc 400 Query: 493 gtagcggcctttc 505 ||| |||||||| Sbjct: 399 gtaatggcctttc 387
>gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone MGC:19656 IMAGE:3139343), complete cds Length = 1589 Score = 105 bits (53), Expect = 2e-19 Identities = 200/249 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 413 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 354 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 353 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 294 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| || |||||||||||||| ||||| ||||| || ||||| |||| |||||| Sbjct: 293 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 234 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || ||||||||| || || || || ||||| ||||| ||||||| ||| ||||||| || Sbjct: 233 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 174 Query: 493 gtagcggcc 501 |||| |||| Sbjct: 173 gtagtggcc 165
>dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:CTD-2589C9, complete sequences Length = 46239 Score = 105 bits (53), Expect = 2e-19 Identities = 200/249 (80%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 9807 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 9866 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 9867 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 9926 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| || |||||||||||||| ||||| ||||| || ||||| |||| |||||| Sbjct: 9927 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 9986 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || ||||||||| || || || || ||||| ||||| ||||||| ||| ||||||| || Sbjct: 9987 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 10046 Query: 493 gtagcggcc 501 |||| |||| Sbjct: 10047 gtagtggcc 10055
>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA, complete sequence Length = 786 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||||||| || || || || || Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| |||||| | |||||||| || Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 264 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 263 cgtcaggtactccagcacggccgccaggtacaccggcgcgccggcgcccacgcgctccgc 204 Query: 493 gtag 496 |||| Sbjct: 203 gtag 200 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 173 gcggcccacggggaactgcagcccggcc 146
>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA, complete sequence Length = 786 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||||||| || || || || || Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| |||||| | |||||||| || Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 264 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||||| ||| ||||||| ||| Sbjct: 263 cgtcaggtactccagcacggccgccaggtacaccggcgcgccggcgcccacgcgctccgc 204 Query: 493 gtag 496 |||| Sbjct: 203 gtag 200 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 173 gcggcccacggggaactgcagcccggcc 146
>gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds Length = 643 Score = 103 bits (52), Expect = 7e-19 Identities = 160/196 (81%) Strand = Plus / Minus Query: 384 tcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtact 443 ||||||| |||||| |||||||||| ||||| | ||| | | |||||| |||||||||| Sbjct: 283 tcttcttattgtccctcgccgcgtttccggccaactccaatacctcagcagcgaggtact 224 Query: 444 cgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtagcggcctt 503 | | ||||||||| |||||||| || || |||| |||||| ||||| ||||| | ||| | Sbjct: 223 ccaagacggcggcgaggtagaccggagctccggtgccgacacgctgagcgtacctgccct 164 Query: 504 tcttgaggtagcgccctatgcggccgacggggaactggagcccggccttcacggacctgg 563 |||| | ||| || || | ||||| ||||||||||||||||||||||| ||||| | | Sbjct: 163 tcttcaagtatcggccgagacggccaacggggaactggagcccggccttgacggatcgag 104 Query: 564 tcaccgacttcttcct 579 |||||| |||||||| Sbjct: 103 acaccgatttcttcct 88
>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488308), mRNA Length = 456 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 363 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 304 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 303 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 244 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 243 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 184 Query: 493 gtag 496 |||| Sbjct: 183 gtag 180 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| || |||||||||||||||||| Sbjct: 153 gcggcccaccgggaactggagcccggcc 126
>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC611496), mRNA Length = 393 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488291), mRNA Length = 387 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117
>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488278), mRNA Length = 576 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488272), mRNA Length = 393 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488270), mRNA Length = 462 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 429 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 370 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 369 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 310 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 309 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 250 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 249 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 190 Query: 493 gtag 496 |||| Sbjct: 189 gtag 186 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| || |||||||||||||||||| Sbjct: 159 gcggcccaccgggaactggagcccggcc 132
>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488262), mRNA Length = 393 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488254), mRNA Length = 417 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 384 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 325 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 324 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 265 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 264 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 205 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 204 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 145 Query: 493 gtag 496 |||| Sbjct: 144 gtag 141 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| || |||||||||||||||||| Sbjct: 114 gcggcccaccgggaactggagcccggcc 87
>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251), mRNA Length = 396 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117
>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l), transcript variant 2 (LOC488268), mRNA Length = 402 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117
>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l), transcript variant 1 (LOC488268), mRNA Length = 393 Score = 103 bits (52), Expect = 7e-19 Identities = 196/244 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117
>dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-14092, similar to human histone 2, H2aa (HIST2H2AA), mRNA, RefSeq: NM_003516.2 Length = 778 Score = 103 bits (52), Expect = 7e-19 Identities = 181/224 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||| ||||||||||||| | |||||| || | |||||||| || || |||||||| Sbjct: 559 cttcttagggagcagcacggcctggatgttaggcaggacgccgccctgggcgatggtgac 500 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||||||| ||||||||||| ||| || | ||||| || || Sbjct: 499 tttgcccagcagcttgttcagttcctcgtcgttgcggatggccagctggaggtgacgagg 440 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| ||||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 439 gatgatgcgcgtcttcttgttgtcccgagccgcgttgcccgccagctccaggatctcggc 380 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccgg 476 || |||||||||||||| || || | ||||||||| ||||||| Sbjct: 379 ggtcaggtactcgaggaccgccgccatgtagactggcgcgccgg 336
>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA Length = 393 Score = 103 bits (52), Expect = 7e-19 Identities = 172/212 (81%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| | |||||||| || || ||||| |||| | | ||||||||| ||| || Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||||| ||| || | |||||||||||||||||||| |||||||||||||| Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 ||||||||||| || ||||| |||| ||| || | |||||||| || ||||| || Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157 Query: 457 aaggtagactggggcgccggagccgacgcgct 488 ||||| || |||||||||| ||| ||||||| Sbjct: 156 caggtacaccggggcgccggcgcccacgcgct 125
>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds Length = 1390 Score = 103 bits (52), Expect = 7e-19 Identities = 172/212 (81%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| | |||||||| || || ||||| |||| | | ||||||||| ||| || Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||||| ||| || | |||||||||||||||||||| |||||||||||||| Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 ||||||||||| || ||||| |||| ||| || | |||||||| || ||||| || Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 657 Query: 457 aaggtagactggggcgccggagccgacgcgct 488 ||||| || |||||||||| ||| ||||||| Sbjct: 656 caggtacaccggggcgccggcgcccacgcgct 625
>gb|AY104637.1| Zea mays PCO070433 mRNA sequence Length = 767 Score = 103 bits (52), Expect = 7e-19 Identities = 121/144 (84%) Strand = Plus / Minus Query: 340 gtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtcctt 399 |||||||||||||||||| | | ||||||||| | ||||||||||||||||||||| Sbjct: 386 gtcgttgcggacggcgagctggatgtggcgcggtacgatgcgggtcttcttgttgtcacg 327 Query: 400 cgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggcaag 459 ||||| |||||||| ||||| || | |||||| || || |||||||| ||||| || || Sbjct: 326 tgccgcattgccggccagctcaagaacctcagcagcaagatactcgagcacggcagcgag 267 Query: 460 gtagactggggcgccggagccgac 483 |||||| |||||||||| |||||| Sbjct: 266 gtagacaggggcgccggcgccgac 243
>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence Length = 531 Score = 103 bits (52), Expect = 7e-19 Identities = 181/224 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 387 cttcttgggcagcagcacggcctggatgttgggcacgacgccgccctgcgcgatggtcac 328 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 327 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 268 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| | ||||| |||| ||| || Sbjct: 267 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgccctccagctccaggatctcggc 208 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccgg 476 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 207 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 164
>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds Length = 929 Score = 103 bits (52), Expect = 7e-19 Identities = 190/236 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 523 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 464 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 463 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 404 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||| ||||| || ||||| |||| ||| || Sbjct: 403 gatgatgcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcggc 344 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || || || || ||||| || |||||||||| ||| ||||||| Sbjct: 343 cgtcaggtactccagcacagccgccaggtacaccggggcgccggcgcccacgcgct 288
>gb|M14140.1|SUPH2B2 P.miliaris histone H2A-2.1 gene, complete cds Length = 375 Score = 101 bits (51), Expect = 3e-18 Identities = 159/195 (81%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||||| || || || ||||| |||||||| || |||| |||||| |||||| Sbjct: 333 gatgttggggaggacaccaccctgagcgatggtgactcctccgagaagcttgttgagttc 274 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || |||||||||||| || | |||| || || |||||||| | | ||||||||||||| Sbjct: 273 ctcgtcgttgcggacagccaactgaagatgacgggggatgatcctgctcttcttgttgtc 214 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 || ||||||||||| ||||| |||| |||||||| |||||||||||||||||| || Sbjct: 213 gcgggcggcgttgccggcgagctcgaggatctcagcggtgaggtactcgaggacggctgc 154 Query: 457 aaggtagactggggc 471 ||||| |||||||| Sbjct: 153 gaggtacactggggc 139
>gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds Length = 375 Score = 101 bits (51), Expect = 3e-18 Identities = 159/195 (81%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||||| || || || ||||| |||||||| || | || |||||| ||| || Sbjct: 333 gatgttggggaggacaccaccctgagcgatggtgactcctcctagaagcttgttgagctc 274 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || |||||||||||| || || |||| ||||| |||||||| | | ||||||||||||| Sbjct: 273 ctcgtcgttgcggacagccagctgaagatggcgggggatgatcctgctcttcttgttgtc 214 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 || ||||||||||| ||||| |||| |||||||| |||||||||||||||||| || Sbjct: 213 gcgggcggcgttgccggcgagctcgaggatctcagcggtgaggtactcgaggacggctgc 154 Query: 457 aaggtagactggggc 471 ||||| |||||||| Sbjct: 153 gaggtacactggggc 139
>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289), mRNA Length = 393 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggta 462 | |||||||| || ||||| || ||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggta 151 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccactgggaactggagcccggcc 63
>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132), mRNA Length = 393 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggta 462 | |||||||| || ||||| || ||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggta 151
>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082), mRNA Length = 393 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggta 462 | |||||||| || ||||| || ||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggta 151
>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203), mRNA Length = 393 Score = 99.6 bits (50), Expect = 1e-17 Identities = 170/210 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggta 462 | |||||||| || ||||| || ||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggta 151
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Plus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 ||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| Sbjct: 20924709 gcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcgctcg 20924768 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| ||||||||| | | ||||||||||||||||||||||| |||||| Sbjct: 20924769 gcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggaggccggcc 20924828 Query: 551 tt 552 || Sbjct: 20924829 tt 20924830 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Plus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| || ||||||||| || |||||| ||||| ||||||||||| ||| || Sbjct: 14468549 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14468608 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || ||||| | | ||||||||| | |||||||||||||||||||| Sbjct: 14468609 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14468668 Query: 397 cttcgccgcgttgccggcaagctc 420 | |||||||||| ||||| ||||| Sbjct: 14468669 cctcgccgcgttcccggcgagctc 14468692 Score = 83.8 bits (42), Expect = 7e-13 Identities = 54/58 (93%) Strand = Plus / Plus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 |||||||||||||||||||||||||| |||||||| || ||||||| ||||||||||| Sbjct: 14468906 gcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacgcgct 14468963 Score = 48.1 bits (24), Expect = 0.038 Identities = 105/132 (79%) Strand = Plus / Plus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| | |||||||||| || ||||||||| || |||||||| ||| || || Sbjct: 20924457 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20924516 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || || || | | ||| | ||| | ||| ||| ||||||||||||| Sbjct: 20924517 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 20924576 Query: 397 cttcgccgcgtt 408 | |||||||||| Sbjct: 20924577 cctcgccgcgtt 20924588 Score = 44.1 bits (22), Expect = 0.59 Identities = 25/26 (96%) Strand = Plus / Plus Query: 527 ccgacggggaactggagcccggcctt 552 |||||||||||||| ||||||||||| Sbjct: 14469002 ccgacggggaactgcagcccggcctt 14469027
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Plus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 ||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| Sbjct: 20850923 gcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcgctcg 20850982 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| ||||||||| | | ||||||||||||||||||||||| |||||| Sbjct: 20850983 gcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggaggccggcc 20851042 Query: 551 tt 552 || Sbjct: 20851043 tt 20851044 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Plus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| || ||||||||| || |||||| ||||| ||||||||||| ||| || Sbjct: 14422833 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14422892 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || ||||| | | ||||||||| | |||||||||||||||||||| Sbjct: 14422893 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14422952 Query: 397 cttcgccgcgttgccggcaagctc 420 | |||||||||| ||||| ||||| Sbjct: 14422953 cctcgccgcgttcccggcgagctc 14422976 Score = 83.8 bits (42), Expect = 7e-13 Identities = 54/58 (93%) Strand = Plus / Plus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 |||||||||||||||||||||||||| |||||||| || ||||||| ||||||||||| Sbjct: 14423190 gcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacgcgct 14423247 Score = 48.1 bits (24), Expect = 0.038 Identities = 105/132 (79%) Strand = Plus / Plus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| | |||||||||| || ||||||||| || |||||||| ||| || || Sbjct: 20850671 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20850730 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || || || | | ||| | ||| | ||| ||| ||||||||||||| Sbjct: 20850731 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 20850790 Query: 397 cttcgccgcgtt 408 | |||||||||| Sbjct: 20850791 cctcgccgcgtt 20850802 Score = 44.1 bits (22), Expect = 0.59 Identities = 25/26 (96%) Strand = Plus / Plus Query: 527 ccgacggggaactggagcccggcctt 552 |||||||||||||| ||||||||||| Sbjct: 14423286 ccgacggggaactgcagcccggcctt 14423311
>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 182172 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Plus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 ||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| Sbjct: 10199 gcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcgctcg 10258 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| ||||||||| | | ||||||||||||||||||||||| |||||| Sbjct: 10259 gcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggaggccggcc 10318 Query: 551 tt 552 || Sbjct: 10319 tt 10320 Score = 48.1 bits (24), Expect = 0.038 Identities = 105/132 (79%) Strand = Plus / Plus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| | |||||||||| || ||||||||| || |||||||| ||| || || Sbjct: 9947 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 10006 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || || || | | ||| | ||| | ||| ||| ||||||||||||| Sbjct: 10007 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 10066 Query: 397 cttcgccgcgtt 408 | |||||||||| Sbjct: 10067 cctcgccgcgtt 10078
>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 107819 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgc 490 ||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||| Sbjct: 34286 gcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcgctcg 34227 Query: 491 gcgtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcc 550 ||||| ||| ||||||||| | | ||||||||||||||||||||||| |||||| Sbjct: 34226 gcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggaggccggcc 34167 Query: 551 tt 552 || Sbjct: 34166 tt 34165 Score = 48.1 bits (24), Expect = 0.038 Identities = 105/132 (79%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| | |||||||||| || ||||||||| || |||||||| ||| || || Sbjct: 34538 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 34479 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || || || | | ||| | ||| | ||| ||| ||||||||||||| Sbjct: 34478 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 34419 Query: 397 cttcgccgcgtt 408 | |||||||||| Sbjct: 34418 cctcgccgcgtt 34407
>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA Length = 393 Score = 97.6 bits (49), Expect = 5e-17 Identities = 142/173 (82%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||| ||||||||||||| | ||||||||| | |||||||| ||||| |||||||| Sbjct: 360 cttcttagggagcagcacggcctggatgttgggcaggacgccgccctgagcgatggtgac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | | ||| ||||| Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaagtgacgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 425 ||||||||||||||||||||||||| ||||||||||| || ||||| |||| Sbjct: 240 gatgatgcgggtcttcttgttgtcccgggccgcgttgcccgccagctccagga 188
>gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds Length = 635 Score = 97.6 bits (49), Expect = 5e-17 Identities = 139/169 (82%) Strand = Plus / Minus Query: 384 tcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtact 443 ||||||||||||| |||||||||| ||||| | ||| | | ||| ||||| ||||||| Sbjct: 268 tcttcttgttgtctctcgccgcgtttccggccaactccaatacctctgcggctaggtact 209 Query: 444 cgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtagcggcctt 503 |||||||||||||||||||||| || || |||| ||||| ||||| ||||| | ||| | Sbjct: 208 cgaggacggcggcaaggtagaccggagctccggtaccgacacgctgagcgtacctgccct 149 Query: 504 tcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 |||| | ||| || || | || ||||||||||||||||| |||||||| Sbjct: 148 tcttcaagtatcggccgagacgaccgacggggaactggaggccggcctt 100
>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J (LOC632401), mRNA Length = 1833 Score = 97.6 bits (49), Expect = 5e-17 Identities = 142/173 (82%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||| ||||| | |||||||| || || ||||| || Sbjct: 456 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 397 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 396 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 337 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 425 ||||||||| ||||||||||||||| ||||||||||||| || ||||| |||| Sbjct: 336 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 284
>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x) (LOC489372), mRNA Length = 841 Score = 97.6 bits (49), Expect = 5e-17 Identities = 199/249 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 657 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgcgcgatcgtcac 598 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 597 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 538 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 537 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 478 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | ||||||||||| ||||| || ||||| || || ||||||| ||| || |||| || Sbjct: 477 cgtcaggtactcgagcacggccgccaggtacaccggcgcgccggcgcccacccgctcggc 418 Query: 493 gtagcggcc 501 |||| |||| Sbjct: 417 gtagtggcc 409
>emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA Length = 775 Score = 97.6 bits (49), Expect = 5e-17 Identities = 173/213 (81%), Gaps = 1/213 (0%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | | ||||||||| | ||||||||| ||||| ||||| || Sbjct: 398 cttcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgagcgatggtcac 339 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | ||||||||| ||| |||| ||||||||| || || || | |||||||| || Sbjct: 338 tcctcccagcagcttgttgagctcctcgtcgttgcgcaccgccagctgcaggtggcgggg 279 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||||||||| ||||||||||| || ||||||||||| ||||| |||| ||| || Sbjct: 278 gatgatgcgggt-ttcttgttgtcgcgggcagcgttgccggccagctccaggatctcggc 220 Query: 433 ggcgaggtactcgaggacggcggcaaggtagac 465 || |||||||| || |||||||| |||||||| Sbjct: 219 ggtcaggtactccagcacggcggccaggtagac 187 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 524 cggccgacggggaactggagcccggcc 550 ||||||||||||||||||||||||||| Sbjct: 128 cggccgacggggaactggagcccggcc 102
>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2 Length = 2927 Score = 97.6 bits (49), Expect = 5e-17 Identities = 145/177 (81%) Strand = Plus / Minus Query: 320 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 379 ||||||||| |||||| | ||||||||||| ||| || | |||||||||||||||||| Sbjct: 1293 agcagcttgttgagttcttcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 1234 Query: 380 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgagg 439 ||||||||||||||||| ||||||||||| || ||||| |||| ||| |||| ||| Sbjct: 1233 cgggtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggcggtcagg 1174 Query: 440 tactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtag 496 ||||| || || || || | ||| || || ||||||| ||| ||||||| ||||||| Sbjct: 1173 tactccagcaccgccgccatgtataccggcgcgccggcgcccacgcgctccgcgtag 1117
>emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones Length = 1653 Score = 97.6 bits (49), Expect = 5e-17 Identities = 163/201 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 1496 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1437 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | |||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 1436 gcggcccagcagcttattgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1377 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||| ||||| ||||||||||| ||| ||||||| ||||| || ||||| |||| |||||| Sbjct: 1376 gataatgcgcgtcttcttgttatccctcgccgcattgcccgccagctccaggatctcagc 1317 Query: 433 ggcgaggtactcgaggacggc 453 | |||||||| || ||||| Sbjct: 1316 cgtcaggtactccagcacggc 1296
>emb|CR457079.1| Homo sapiens full open reading frame cDNA clone RZPDo834A117D for gene H2AFX, H2A histone family, member X; complete cds, incl. stopcodon Length = 432 Score = 97.6 bits (49), Expect = 5e-17 Identities = 199/249 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 300 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| | |||||||||||||| ||||| ||||| || ||||| |||| |||||| Sbjct: 240 gatgattagcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || ||||||||| || || || || ||||| ||||| ||||||| ||| ||||||| || Sbjct: 180 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 121 Query: 493 gtagcggcc 501 |||| |||| Sbjct: 120 gtagtggcc 112
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 97.6 bits (49), Expect = 5e-17 Identities = 70/77 (90%) Strand = Plus / Minus Query: 503 ttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttcacggacctg 562 ||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| | Sbjct: 7800552 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 7800493 Query: 563 gtcaccgacttcttcct 579 ||||||| ||||||||| Sbjct: 7800492 gtcaccgccttcttcct 7800476
>ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (Hist1h2aa), mRNA Length = 393 Score = 97.6 bits (49), Expect = 5e-17 Identities = 163/201 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | |||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 gcggcccagcagcttattgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||| ||||| ||||||||||| ||| ||||||| ||||| || ||||| |||| |||||| Sbjct: 240 gataatgcgcgtcttcttgttatccctcgccgcattgcccgccagctccaggatctcagc 181 Query: 433 ggcgaggtactcgaggacggc 453 | |||||||| || ||||| Sbjct: 180 cgtcaggtactccagcacggc 160
>ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (predicted) (Hist2h2aa_predicted), mRNA Length = 591 Score = 97.6 bits (49), Expect = 5e-17 Identities = 145/177 (81%) Strand = Plus / Minus Query: 320 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 379 ||||||||| |||||| | ||||||||||| ||| || | |||||||||||||||||| Sbjct: 491 agcagcttgttgagttcttcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 432 Query: 380 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgagg 439 ||||||||||||||||| ||||||||||| || ||||| |||| ||| |||| ||| Sbjct: 431 cgggtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggcggtcagg 372 Query: 440 tactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtag 496 ||||| || || || || | ||| || || ||||||| ||| ||||||| ||||||| Sbjct: 371 tactccagcaccgccgccatgtataccggcgcgccggcgcccacgcgctccgcgtag 315
>ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2aa1 protein (LOC499676), mRNA Length = 675 Score = 97.6 bits (49), Expect = 5e-17 Identities = 145/177 (81%) Strand = Plus / Minus Query: 320 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 379 ||||||||| |||||| | ||||||||||| ||| || | |||||||||||||||||| Sbjct: 566 agcagcttgttgagttcttcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 507 Query: 380 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgagg 439 ||||||||||||||||| ||||||||||| || ||||| |||| ||| |||| ||| Sbjct: 506 cgggtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggcggtcagg 447 Query: 440 tactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtag 496 ||||| || || || || | ||| || || ||||||| ||| ||||||| ||||||| Sbjct: 446 tactccagcaccgccgccatgtataccggcgcgccggcgcccacgcgctccgcgtag 390
>ref|XM_574997.1| PREDICTED: Rattus norvegicus similar to histone H2a(A)-613 (LOC499675), mRNA Length = 510 Score = 97.6 bits (49), Expect = 5e-17 Identities = 145/177 (81%) Strand = Plus / Minus Query: 320 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 379 ||||||||| |||||| | ||||||||||| ||| || | |||||||||||||||||| Sbjct: 407 agcagcttgttgagttcttcgtcgttgcggatggccagctgcaggtggcgcgggatgatg 348 Query: 380 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgagg 439 ||||||||||||||||| ||||||||||| || ||||| |||| ||| |||| ||| Sbjct: 347 cgggtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggcggtcagg 288 Query: 440 tactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtag 496 ||||| || || || || | ||| || || ||||||| ||| ||||||| ||||||| Sbjct: 287 tactccagcaccgctgccatgtataccggcgcgccggcgcccacgcgctccgcgtag 231
>dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0431E05 Length = 146091 Score = 97.6 bits (49), Expect = 5e-17 Identities = 70/77 (90%) Strand = Plus / Minus Query: 503 ttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttcacggacctg 562 ||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| | Sbjct: 14934 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 14875 Query: 563 gtcaccgacttcttcct 579 ||||||| ||||||||| Sbjct: 14874 gtcaccgccttcttcct 14858
>dbj|AP004651.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0091G06 Length = 161851 Score = 97.6 bits (49), Expect = 5e-17 Identities = 70/77 (90%) Strand = Plus / Minus Query: 503 ttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttcacggacctg 562 ||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| | Sbjct: 113050 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 112991 Query: 563 gtcaccgacttcttcct 579 ||||||| ||||||||| Sbjct: 112990 gtcaccgccttcttcct 112974
>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone MGC:36202 IMAGE:5055276), complete cds Length = 550 Score = 97.6 bits (49), Expect = 5e-17 Identities = 142/173 (82%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||| ||||| | |||||||| || || ||||| || Sbjct: 412 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 353 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 352 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 293 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 425 ||||||||| ||||||||||||||| ||||||||||||| || ||||| |||| Sbjct: 292 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 240
>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895), mRNA Length = 390 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891), mRNA Length = 390 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427885), mRNA Length = 918 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427881), mRNA Length = 534 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 504 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 445 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 444 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 385 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 384 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 325 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| ||| Sbjct: 324 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgc 265 Query: 493 gtag 496 |||| Sbjct: 264 gtag 261 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 234 gcggcccacggggaactgcagcccggcc 207
>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA Length = 1220 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 1190 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 1131 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 1130 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 1071 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 1070 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1011 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| ||| Sbjct: 1010 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgc 951 Query: 493 gtag 496 |||| Sbjct: 950 gtag 947 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 920 gcggcccacggggaactgcagcccggcc 893
>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene (LOC417952), mRNA Length = 1374 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 730 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 789 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 790 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 849 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 850 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 909 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| ||| Sbjct: 910 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgc 969 Query: 493 gtag 496 |||| Sbjct: 970 gtag 973 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 1000 gcggcccacggggaactgcagcccggcc 1027
>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299), mRNA Length = 387 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || |||||||| Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| || |||||||||||||||||| Sbjct: 90 gcggcccaccgggaactggagcccggcc 63
>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297), mRNA Length = 393 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || |||||||| Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || || ||||| | ||||| |||| ||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggcgcgcccgccccgacccgctccgc 121 Query: 493 gtag 496 |||| Sbjct: 120 gtag 117
>emb|BX063165.1|CNS09KWH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||||||| || || ||||| || Sbjct: 524 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 583 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| ||||||||| || |||| ||||||||||| ||| || | ||||||||||| Sbjct: 584 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 643 Query: 373 gatgatgcgggtcttcttgttgtc 396 ||||||||| |||||||||||||| Sbjct: 644 gatgatgcgcgtcttcttgttgtc 667
>emb|BX063164.1|CNS09KWG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 924 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||||||| || || ||||| || Sbjct: 477 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 418 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| ||||||||| || |||| ||||||||||| ||| || | ||||||||||| Sbjct: 417 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 358 Query: 373 gatgatgcgggtcttcttgttgtc 396 ||||||||| |||||||||||||| Sbjct: 357 gatgatgcgcgtcttcttgttgtc 334
>emb|BX040864.1|CNS093P0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC11DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||||||| || || ||||| || Sbjct: 470 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 411 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| ||||||||| || |||| ||||||||||| ||| || | ||||||||||| Sbjct: 410 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 351 Query: 373 gatgatgcgggtcttcttgttgtc 396 ||||||||| |||||||||||||| Sbjct: 350 gatgatgcgcgtcttcttgttgtc 327
>emb|BX019683.1|CNS08NCN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA3AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||||||| || || ||||| || Sbjct: 481 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 422 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| ||||||||| || |||| ||||||||||| ||| || | ||||||||||| Sbjct: 421 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 362 Query: 373 gatgatgcgggtcttcttgttgtc 396 ||||||||| |||||||||||||| Sbjct: 361 gatgatgcgcgtcttcttgttgtc 338
>emb|BX016451.1|CNS08KUV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 556 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||||||| || || ||||| || Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 345 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| ||||||||| || |||| ||||||||||| ||| || | ||||||||||| Sbjct: 344 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285 Query: 373 gatgatgcgggtcttcttgttgtc 396 ||||||||| |||||||||||||| Sbjct: 284 gatgatgcgcgtcttcttgttgtc 261
>emb|BX009846.1|CNS08FRE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 357 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||||||| || || ||||| || Sbjct: 117 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 176 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| ||||||||| || |||| ||||||||||| ||| || | ||||||||||| Sbjct: 177 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 236 Query: 373 gatgatgcgggtcttcttgttgtc 396 ||||||||| |||||||||||||| Sbjct: 237 gatgatgcgcgtcttcttgttgtc 260
>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 Length = 3210 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 1933 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1874 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||||||| Sbjct: 1873 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1814 Query: 373 gatgatgcgggtcttcttgttgtc 396 ||||||||| |||||||||||||| Sbjct: 1813 gatgatgcgcgtcttcttgttgtc 1790
>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene Length = 8384 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 5291 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 5232 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 5231 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 5172 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 5171 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 5112 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| ||| Sbjct: 5111 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgc 5052 Query: 493 gtag 496 |||| Sbjct: 5051 gtag 5048 Score = 89.7 bits (45), Expect = 1e-14 Identities = 144/177 (81%) Strand = Plus / Plus Query: 320 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 379 ||||||||| ||| |||| ||||||||||| ||| || | |||||||| ||||||||| Sbjct: 2220 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatg 2279 Query: 380 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgagg 439 || |||||||||||||| ||||||||||| || ||||| |||| ||| || | ||| Sbjct: 2280 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcagg 2339 Query: 440 tactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtag 496 ||||| || ||||| || ||||| || |||||||||| ||| || |||| ||||||| Sbjct: 2340 tactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgcgtag 2396 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 5021 gcggcccacggggaactgcagcccggcc 4994 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 2423 gcggcccacggggaactgcagcccggcc 2450
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| |||||||||||| || |||||| ||||| ||||||||||| | || Sbjct: 21537003 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 21536944 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || ||||| | | ||||||||| | ||||||||||||||||||||| Sbjct: 21536943 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 21536884 Query: 397 cttcgccgcgttgccggcaagctc 420 | |||||||||| ||||| ||||| Sbjct: 21536883 cctcgccgcgttcccggcgagctc 21536860 Score = 91.7 bits (46), Expect = 3e-15 Identities = 58/62 (93%) Strand = Plus / Minus Query: 427 ctcagcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcg 486 |||||||||||||||||||||||||||||| |||||||| ||||| |||| ||||||||| Sbjct: 21536577 ctcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacgcg 21536518 Query: 487 ct 488 || Sbjct: 21536517 ct 21536516 Score = 89.7 bits (45), Expect = 1e-14 Identities = 54/57 (94%) Strand = Plus / Minus Query: 427 ctcagcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgac 483 |||||||||||||||||||||||||||||| |||||||| |||||||||| |||||| Sbjct: 21539257 ctcagcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 21539201 Score = 85.7 bits (43), Expect = 2e-13 Identities = 73/83 (87%) Strand = Plus / Plus Query: 497 cggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttcacg 556 |||| |||||||||||||||||| || |||| |||||| ||||||||||||||||| ||| Sbjct: 22313880 cggcttttcttgaggtagcgcccgatacggctgacgggcaactggagcccggccttgacg 22313939 Query: 557 gacctggtcaccgacttcttcct 579 || | ||||||| ||||||||| Sbjct: 22313940 gagcgcgtcaccgccttcttcct 22313962 Score = 75.8 bits (38), Expect = 2e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 335 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 394 |||| |||||||||||||||||| | | |||||| || | |||||||||||||||||| Sbjct: 21539584 tcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttgttg 21539525 Query: 395 tccttcgccgcgttgccggcaagctc 420 ||| |||||||||| ||||| ||||| Sbjct: 21539524 tccctcgccgcgttcccggcgagctc 21539499 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 530 acggggaactggagcccggcctt 552 ||||||||||||||||||||||| Sbjct: 21539154 acggggaactggagcccggcctt 21539132
>ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone H2A.l (H2A/l) (LOC502125), mRNA Length = 393 Score = 95.6 bits (48), Expect = 2e-16 Identities = 180/224 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | | ||||||||| | |||||||| || || ||||| || Sbjct: 360 cttcttgggcagcagcaccgcttggatgttgggcagaacgccgccctgggcgatggtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | | ||||||||| |||||||| ||||| || | ||| || | ||||||||||| Sbjct: 300 acggcccagcagcttgttgagttcctcatcgttccgaatggccagctgtaggtggcgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| ||||||||||||||| ||||||||||||| || ||||| |||| ||| || Sbjct: 240 gatgatgcgtgtcttcttgttgtccctcgccgcgttgcccgccagctccaggatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccgg 476 | |||||||| || || || || ||||| || |||||||||| Sbjct: 180 cgtcaggtactccagcacagccgccaggtacaccggggcgccgg 137
>ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (predicted) (Hist1h2ao_predicted), mRNA Length = 483 Score = 95.6 bits (48), Expect = 2e-16 Identities = 180/224 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||| || || ||||| || || Sbjct: 360 cttcttgggcagcagcacggcttggatgttgggcaggacgccaccctgcgcaatagtcac 301 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||| ||||| Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgcgg 241 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||||| ||||| ||||||||| ||||||||||||| || ||||| | || ||| || Sbjct: 240 aatgatgcgtgtctttttgttgtccctcgccgcgttgcctgcgagctccaagatctcggc 181 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccgg 476 | |||||||| || ||||| || ||||| || |||||||||| Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137
>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1582_D10 Length = 103475 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| |||||||||||| || |||||| ||||| ||||||||||| | || Sbjct: 74787 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 74728 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || ||||| | | ||||||||| | ||||||||||||||||||||| Sbjct: 74727 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 74668 Query: 397 cttcgccgcgttgccggcaagctc 420 | |||||||||| ||||| ||||| Sbjct: 74667 cctcgccgcgttcccggcgagctc 74644 Score = 91.7 bits (46), Expect = 3e-15 Identities = 58/62 (93%) Strand = Plus / Minus Query: 427 ctcagcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcg 486 |||||||||||||||||||||||||||||| |||||||| ||||| |||| ||||||||| Sbjct: 74361 ctcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacgcg 74302 Query: 487 ct 488 || Sbjct: 74301 ct 74300 Score = 89.7 bits (45), Expect = 1e-14 Identities = 54/57 (94%) Strand = Plus / Minus Query: 427 ctcagcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgac 483 |||||||||||||||||||||||||||||| |||||||| |||||||||| |||||| Sbjct: 77041 ctcagcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 76985 Score = 75.8 bits (38), Expect = 2e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 335 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 394 |||| |||||||||||||||||| | | |||||| || | |||||||||||||||||| Sbjct: 77368 tcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttgttg 77309 Query: 395 tccttcgccgcgttgccggcaagctc 420 ||| |||||||||| ||||| ||||| Sbjct: 77308 tccctcgccgcgttcccggcgagctc 77283 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 530 acggggaactggagcccggcctt 552 ||||||||||||||||||||||| Sbjct: 76938 acggggaactggagcccggcctt 76916
>dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, complete cds Length = 1028 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 691 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 632 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 631 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 572 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 571 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 512 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| ||| Sbjct: 511 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgc 452 Query: 493 gtag 496 |||| Sbjct: 451 gtag 448 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 421 gcggcccacggggaactgcagcccggcc 394
>gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, complete cds Length = 740 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 538 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 479 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 478 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 419 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 418 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 359 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| ||| Sbjct: 358 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgc 299 Query: 493 gtag 496 |||| Sbjct: 298 gtag 295 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 268 gcggcccacggggaactgcagcccggcc 241
>gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, complete cds Length = 743 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 383 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 324 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 323 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 264 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 263 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 204 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| ||| Sbjct: 203 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgc 144 Query: 493 gtag 496 |||| Sbjct: 143 gtag 140 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 113 gcggcccacggggaactgcagcccggcc 86
>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118101 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||| || ||||||||| || |||||| ||||| ||||||||||| ||| || Sbjct: 48743 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 48684 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || ||||||||| || ||||| | | ||||||||| | |||||||||||||||||||| Sbjct: 48683 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 48624 Query: 397 cttcgccgcgttgccggcaagctc 420 | |||||||||| ||||| ||||| Sbjct: 48623 cctcgccgcgttcccggcgagctc 48600 Score = 83.8 bits (42), Expect = 7e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 |||||||||||||||||||||||||| |||||||| || ||||||| ||||||||||| Sbjct: 48386 gcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacgcgct 48329 Score = 44.1 bits (22), Expect = 0.59 Identities = 25/26 (96%) Strand = Plus / Minus Query: 527 ccgacggggaactggagcccggcctt 552 |||||||||||||| ||||||||||| Sbjct: 48290 ccgacggggaactgcagcccggcctt 48265
>gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, complete sequence Length = 571 Score = 95.6 bits (48), Expect = 2e-16 Identities = 189/236 (80%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||| | |||||||||| | ||||||||| | |||||||| || || ||||| || Sbjct: 427 cttcttgagcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 368 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| ||||||||||| ||| || | ||||||| ||| Sbjct: 367 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcacgg 308 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| || ||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 307 gatgatgcgcgttttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 248 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||||| ||| ||||||| Sbjct: 247 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 192
>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks Length = 1564 Score = 95.6 bits (48), Expect = 2e-16 Identities = 195/244 (79%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 286 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 345 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 346 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 405 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 406 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctccaggatctcggc 465 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| || |||||||||| ||| || |||| ||| Sbjct: 466 cgtcaggtactccagcacggccgctaggtacaccggggcgccggcgcccacccgctccgc 525 Query: 493 gtag 496 |||| Sbjct: 526 gtag 529
>gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:7205580, complete cds Length = 799 Score = 93.7 bits (47), Expect = 7e-16 Identities = 173/215 (80%) Strand = Plus / Minus Query: 254 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgacg 313 ||||||||||||||||| || | ||||||||| | || ||||| || || |||||||| Sbjct: 371 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 312 Query: 314 ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcggg 373 || ||||||| ||| ||| |||| ||||||||| |||||||| | ||||| | ||| Sbjct: 311 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 252 Query: 374 atgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcg 433 ||||| || ||||||||||| ||| || ||||||||||| | ||| |||| ||| ||| Sbjct: 251 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 192 Query: 434 gcgaggtactcgaggacggcggcaaggtagactgg 468 | || |||||||| || ||||||||||||||||| Sbjct: 191 gtcagatactcgagcaccgcggcaaggtagactgg 157
>gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds Length = 763 Score = 93.7 bits (47), Expect = 7e-16 Identities = 173/215 (80%) Strand = Plus / Plus Query: 254 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgacg 313 ||||||||||||||||| || | ||||||||| | || ||||| || || |||||||| Sbjct: 290 ttcttggggagcagcacagactggatgttgggcagaaccccgccctgggcgatggtgacc 349 Query: 314 ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcggg 373 || ||||||| ||| ||| |||| ||||||||| |||||||| | ||||| | ||| Sbjct: 350 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 409 Query: 374 atgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcg 433 |||||||| ||||||||||| ||| || ||||||||||| | ||| |||| ||| ||| Sbjct: 410 atgatgcgagtcttcttgttatcccgggcagcgttgccggccaactccaggatctcggcg 469 Query: 434 gcgaggtactcgaggacggcggcaaggtagactgg 468 | || |||||||| || ||||| ||||||||||| Sbjct: 470 gtcagatactcgagcaccgcggccaggtagactgg 504
>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3 and H4 Length = 8592 Score = 93.7 bits (47), Expect = 7e-16 Identities = 173/215 (80%) Strand = Plus / Minus Query: 254 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgacg 313 ||||||||||||||||| || | ||||||||| | || ||||| || || |||||||| Sbjct: 4730 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 4671 Query: 314 ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcggg 373 || ||||||| ||| ||| |||| ||||||||| |||||||| | ||||| | ||| Sbjct: 4670 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 4611 Query: 374 atgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcg 433 ||||| || ||||||||||| ||| || ||||||||||| | ||| |||| ||| ||| Sbjct: 4610 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 4551 Query: 434 gcgaggtactcgaggacggcggcaaggtagactgg 468 | || |||||||| || ||||||||||||||||| Sbjct: 4550 gtcagatactcgagcaccgcggcaaggtagactgg 4516
>gb|AC119796.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1172F09, complete sequence Length = 106057 Score = 93.7 bits (47), Expect = 7e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 497 cggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggccttcacg 556 |||| |||||||||||||||||| || |||||||||||||| |||||||||||||| ||| Sbjct: 36523 cggcttttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacg 36464 Query: 557 gacctggtcaccgacttcttcct 579 || | ||||||| ||||||||| Sbjct: 36463 gagcgcgtcaccgccttcttcct 36441
>gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, complete cds Length = 1401 Score = 93.7 bits (47), Expect = 7e-16 Identities = 107/127 (84%) Strand = Plus / Plus Query: 362 aggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctct 421 |||||||||||||||||||| |||||||||||||| ||||||||||| || ||||| Sbjct: 19 aggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctcc 78 Query: 422 aggagctcagcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccg 481 |||| ||| || | |||||||| || ||||| || |||||||| |||||||||| ||| Sbjct: 79 aggatctcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgccc 138 Query: 482 acgcgct 488 ||||||| Sbjct: 139 acgcgct 145
>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and histone H3 gene, 3' end, gene cluster X1h3 Length = 8608 Score = 93.7 bits (47), Expect = 7e-16 Identities = 173/215 (80%) Strand = Plus / Minus Query: 254 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgacg 313 ||||||||||||||||| || | ||||||||| | || ||||| || || |||||||| Sbjct: 4747 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 4688 Query: 314 ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcggg 373 || ||||||| ||| ||| |||| ||||||||| |||||||| | ||||| | ||| Sbjct: 4687 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 4628 Query: 374 atgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcg 433 ||||| || ||||||||||| ||| || ||||||||||| | ||| |||| ||| ||| Sbjct: 4627 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 4568 Query: 434 gcgaggtactcgaggacggcggcaaggtagactgg 468 | || |||||||| || ||||||||||||||||| Sbjct: 4567 gtcagatactcgagcaccgcggcaaggtagactgg 4533
>gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2 late mRNA, complete cds Length = 430 Score = 93.7 bits (47), Expect = 7e-16 Identities = 158/195 (81%) Strand = Plus / Minus Query: 277 gatgttggggatcacgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttc 336 ||||||||||| || || || ||||| |||||||| || |||| |||||| ||| || Sbjct: 348 gatgttggggaggacaccaccctgagcgatggtgactcctccgagaagcttgttgagctc 289 Query: 337 ctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtc 396 || |||||||||||| || | |||| || || |||||||| | | ||||||||||||| Sbjct: 288 ctcgtcgttgcggacagccaactgaagatgacgggggatgatcctgctcttcttgttgtc 229 Query: 397 cttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacggcggc 456 || ||||||||||| ||||| |||| |||||||| |||||||||||||||||| || Sbjct: 228 gcgggcggcgttgccggcgagctcgaggatctcagcggtgaggtactcgaggacggctgc 169 Query: 457 aaggtagactggggc 471 ||||| |||||||| Sbjct: 168 gaggtacactggggc 154
>gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family member X (H2AX) mRNA, partial cds Length = 300 Score = 91.7 bits (46), Expect = 3e-15 Identities = 136/166 (81%) Strand = Plus / Minus Query: 311 acgccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgc 370 |||||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| Sbjct: 263 acgccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgg 204 Query: 371 gggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctca 430 ||||| || || |||||||||||||| ||||||||||| || ||||| |||| |||| Sbjct: 203 gggattatccgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctca 144 Query: 431 gcggcgaggtactcgaggacggcggcaaggtagactggggcgccgg 476 |||| |||||||||||| || || || |||||||| || ||||||| Sbjct: 143 gcggtgaggtactcgagtaccgccgccaggtagaccggcgcgccgg 98
>gb|BC060324.1| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MGC:74460 IMAGE:3892650), complete cds Length = 446 Score = 89.7 bits (45), Expect = 1e-14 Identities = 120/145 (82%) Strand = Plus / Minus Query: 332 agttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttg 391 ||||||| ||||||||||| ||| || | ||||| || ||||||||||| ||||||||| Sbjct: 316 agttcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttg 257 Query: 392 ttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacg 451 |||||| ||||||||||| || ||||| |||| ||| |||| |||||||||||||| Sbjct: 256 ttgtcccgagccgcgttgcccgccagctccaggatctcggcggtcaggtactcgaggacc 197 Query: 452 gcggcaaggtagactggggcgccgg 476 || || | |||||| || ||||||| Sbjct: 196 gccgccatgtagacgggcgcgccgg 172
>ref|NM_003517.2| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA Length = 437 Score = 89.7 bits (45), Expect = 1e-14 Identities = 120/145 (82%) Strand = Plus / Minus Query: 332 agttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttg 391 ||||||| ||||||||||| ||| || | ||||| || ||||||||||| ||||||||| Sbjct: 281 agttcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttg 222 Query: 392 ttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacg 451 |||||| ||||||||||| || ||||| |||| ||| |||| |||||||||||||| Sbjct: 221 ttgtcccgagccgcgttgcccgccagctccaggatctcggcggtcaggtactcgaggacc 162 Query: 452 gcggcaaggtagactggggcgccgg 476 || || | |||||| || ||||||| Sbjct: 161 gccgccatgtagacgggcgcgccgg 137
>gb|AY648852.1| Homo sapiens histone H2A/r gene, complete cds Length = 1119 Score = 89.7 bits (45), Expect = 1e-14 Identities = 120/145 (82%) Strand = Plus / Minus Query: 332 agttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttg 391 ||||||| ||||||||||| ||| || | ||||| || ||||||||||| ||||||||| Sbjct: 654 agttcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttg 595 Query: 392 ttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacg 451 |||||| ||||||||||| || ||||| |||| ||| |||| |||||||||||||| Sbjct: 594 ttgtcccgagccgcgttgcccgccagctccaggatctcggcggtcaggtactcgaggacc 535 Query: 452 gcggcaaggtagactggggcgccgg 476 || || | |||||| || ||||||| Sbjct: 534 gccgccatgtagacgggcgcgccgg 510 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 365 tggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgcc 411 ||||| ||||||||||| ||||||||||||||| ||||||||||| Sbjct: 1068 tggcgagggatgatgcgcgtcttcttgttgtcccgagccgcgttgcc 1114
>ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427893), mRNA Length = 390 Score = 89.7 bits (45), Expect = 1e-14 Identities = 144/177 (81%) Strand = Plus / Minus Query: 320 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 379 ||||||||| ||| |||| ||||||||||| ||| || | |||||||| ||||||||| Sbjct: 293 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatg 234 Query: 380 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgagg 439 || |||||||||||||| ||||||||||| || ||||| |||| ||| || | ||| Sbjct: 233 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcagg 174 Query: 440 tactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtag 496 ||||| || ||||| || ||||| || |||||||||| ||| || |||| ||||||| Sbjct: 173 tactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgcgtag 117 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 90 gcggcccacggggaactgcagcccggcc 63
>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1 (LOC417953), mRNA Length = 2271 Score = 89.7 bits (45), Expect = 1e-14 Identities = 144/177 (81%) Strand = Plus / Plus Query: 320 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 379 ||||||||| ||| |||| ||||||||||| ||| || | |||||||| ||||||||| Sbjct: 1238 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatg 1297 Query: 380 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgagg 439 || |||||||||||||| ||||||||||| || ||||| |||| ||| || | ||| Sbjct: 1298 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcagg 1357 Query: 440 tactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtag 496 ||||| || ||||| || ||||| || |||||||||| ||| || |||| ||||||| Sbjct: 1358 tactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgcgtag 1414 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 1441 gcggcccacggggaactgcagcccggcc 1468
>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA Length = 1754 Score = 89.7 bits (45), Expect = 1e-14 Identities = 141/173 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||| ||||| | |||||||| || || ||||| || Sbjct: 377 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 318 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | | ||||||||| ||| |||| ||||||||||| ||| || | ||||| || || Sbjct: 317 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 258 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 425 ||||||||| ||||||||||||||| ||||||||||||| || ||||| |||| Sbjct: 257 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 205
>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence Length = 205659 Score = 89.7 bits (45), Expect = 1e-14 Identities = 141/173 (81%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||| ||||| | |||||||| || || ||||| || Sbjct: 108584 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 108643 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | | ||||||||| ||| |||| ||||||||||| ||| || | ||||| || || Sbjct: 108644 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 108703 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 425 ||||||||| ||||||||||||||| ||||||||||||| || ||||| |||| Sbjct: 108704 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 108756
>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of IgG, high affinity Ia, receptor for (CD64), a novel gene similar to histone 2, H2be (HIST2H2BE), a novel gene similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for histone 2, H4, the HIST2H3C gene for histone 2, H3c, the HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene (HIST2H2BC), a novel gene similar to histone 2, H2aa (HIST2H2AA), a novel gene similar to histone 2, H3c (HIST2H3C), a novel gene similar to histone 1, H4 (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for histone 2, H2ab, a novel protein similar to histone 2, a novel gene, the SV2A gene for synaptic vesicle glycoprotein 2A, the 3' end of the SF3B4 gene for splicing factor 3b, subunit 4, 49kDa and five CpG islands, complete sequence Length = 188956 Score = 89.7 bits (45), Expect = 1e-14 Identities = 120/145 (82%) Strand = Plus / Minus Query: 332 agttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttg 391 ||||||| ||||||||||| ||| || | ||||| || ||||||||||| ||||||||| Sbjct: 148965 agttcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttg 148906 Query: 392 ttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacg 451 |||||| ||||||||||| || ||||| |||| ||| |||| |||||||||||||| Sbjct: 148905 ttgtcccgagccgcgttgcccgccagctccaggatctcggcggtcaggtactcgaggacc 148846 Query: 452 gcggcaaggtagactggggcgccgg 476 || || | |||||| || ||||||| Sbjct: 148845 gccgccatgtagacgggcgcgccgg 148821 Score = 81.8 bits (41), Expect = 3e-12 Identities = 119/145 (82%) Strand = Plus / Minus Query: 332 agttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttg 391 ||||||| ||||||||||| ||| || | ||||| || ||||||||||| ||||||||| Sbjct: 113121 agttcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttg 113062 Query: 392 ttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacg 451 |||||| ||||||||||| || ||||| |||| ||| |||| || ||||||||||| Sbjct: 113061 ttgtcccgagccgcgttgcccgccagctccaggatctcggcggtcagatactcgaggacc 113002 Query: 452 gcggcaaggtagactggggcgccgg 476 || || | |||||| || ||||||| Sbjct: 113001 gcagccatgtagacgggcgcgccgg 112977 Score = 81.8 bits (41), Expect = 3e-12 Identities = 119/145 (82%) Strand = Plus / Plus Query: 332 agttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttg 391 ||||||| ||||||||||| ||| || | ||||| || ||||||||||| ||||||||| Sbjct: 104145 agttcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttg 104204 Query: 392 ttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacg 451 |||||| ||||||||||| || ||||| |||| ||| |||| || ||||||||||| Sbjct: 104205 ttgtcccgagccgcgttgcccgccagctccaggatctcggcggtcagatactcgaggacc 104264 Query: 452 gcggcaaggtagactggggcgccgg 476 || || | |||||| || ||||||| Sbjct: 104265 gcagccatgtagacgggcgcgccgg 104289 Score = 71.9 bits (36), Expect = 3e-09 Identities = 108/132 (81%) Strand = Plus / Plus Query: 365 tggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagg 424 ||||| ||||||||||| ||||||||||||||| ||||||||||| || ||||| || Sbjct: 149379 tggcgagggatgatgcgcgtcttcttgttgtcccgagccgcgttgcccgccagctccaga 149438 Query: 425 agctcagcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacg 484 | || |||| |||||||||||||| || || ||||| || |||||||| | ||||| Sbjct: 149439 atttccgcggtcaggtactcgaggaccgccgccaggtacaccggggcgcctgccccgacc 149498 Query: 485 cgctgcgcgtag 496 |||| ||||||| Sbjct: 149499 cgctccgcgtag 149510
>emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B sequence Length = 1017 Score = 89.7 bits (45), Expect = 1e-14 Identities = 144/177 (81%) Strand = Plus / Plus Query: 320 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 379 ||||||||| ||| |||| ||||||||||| ||| || | |||||||| ||||||||| Sbjct: 14 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatg 73 Query: 380 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgagg 439 || |||||||||||||| ||||||||||| || ||||| |||| ||| || | ||| Sbjct: 74 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcagg 133 Query: 440 tactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtag 496 ||||| || ||||| || ||||| || |||||||||| ||| || |||| ||||||| Sbjct: 134 tactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgcgtag 190 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 217 gcggcccacggggaactgcagcccggcc 244
>dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130307C13 product:HISTONE H2A homolog [Gallus gallus], full insert sequence Length = 1754 Score = 89.7 bits (45), Expect = 1e-14 Identities = 141/173 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||| ||||| | |||||||| || || ||||| || Sbjct: 377 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 318 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | | ||||||||| ||| |||| ||||||||||| ||| || | ||||| || || Sbjct: 317 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 258 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 425 ||||||||| ||||||||||||||| ||||||||||||| || ||||| |||| Sbjct: 257 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 205
>gb|BC096705.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MGC:120083 IMAGE:40021705), complete cds Length = 480 Score = 89.7 bits (45), Expect = 1e-14 Identities = 120/145 (82%) Strand = Plus / Minus Query: 332 agttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttg 391 ||||||| ||||||||||| ||| || | ||||| || ||||||||||| ||||||||| Sbjct: 281 agttcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttg 222 Query: 392 ttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacg 451 |||||| ||||||||||| || ||||| |||| |||||||| || ||||||||||| Sbjct: 221 ttgtcccgagccgcgttgcccgccagctccaggatctcagcggtcagatactcgaggacc 162 Query: 452 gcggcaaggtagactggggcgccgg 476 || || | |||||| || ||||||| Sbjct: 161 gcagccatgtagacgggcgcgccgg 137
>gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone MGC:118637 IMAGE:1383389), complete cds Length = 587 Score = 89.7 bits (45), Expect = 1e-14 Identities = 141/173 (81%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||| ||||| | |||||||| || || ||||| || Sbjct: 434 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 375 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | | ||||||||| ||| |||| ||||||||||| ||| || | ||||| || || Sbjct: 374 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgagg 315 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagga 425 ||||||||| ||||||||||||||| ||||||||||||| || ||||| |||| Sbjct: 314 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctccagga 262
>gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, complete cds Length = 827 Score = 89.7 bits (45), Expect = 1e-14 Identities = 144/177 (81%) Strand = Plus / Minus Query: 320 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 379 ||||||||| ||| |||| ||||||||||| ||| || | |||||||| ||||||||| Sbjct: 454 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatg 395 Query: 380 cgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgagg 439 || |||||||||||||| ||||||||||| || ||||| |||| ||| || | ||| Sbjct: 394 cgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcagg 335 Query: 440 tactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgcgtag 496 ||||| || ||||| || ||||| || |||||||||| ||| || |||| ||||||| Sbjct: 334 tactccagcacggccgccaggtacaccggggcgccggcgcccacccgctccgcgtag 278 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 251 gcggcccacggggaactgcagcccggcc 224
>gb|AY131973.1| Homo sapiens histone H2A (HIST2H2AC) gene, complete cds Length = 1119 Score = 89.7 bits (45), Expect = 1e-14 Identities = 120/145 (82%) Strand = Plus / Minus Query: 332 agttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttg 391 ||||||| ||||||||||| ||| || | ||||| || ||||||||||| ||||||||| Sbjct: 654 agttcctcgtcgttgcggatggccagctggaggtgacgagggatgatgcgcgtcttcttg 595 Query: 392 ttgtccttcgccgcgttgccggcaagctctaggagctcagcggcgaggtactcgaggacg 451 |||||| ||||||||||| || ||||| |||| ||| |||| |||||||||||||| Sbjct: 594 ttgtcccgagccgcgttgcccgccagctccaggatctcggcggtcaggtactcgaggacc 535 Query: 452 gcggcaaggtagactggggcgccgg 476 || || | |||||| || ||||||| Sbjct: 534 gccgccatgtagacgggcgcgccgg 510 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 365 tggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgcc 411 ||||| ||||||||||| ||||||||||||||| ||||||||||| Sbjct: 1068 tggcgagggatgatgcgcgtcttcttgttgtcccgagccgcgttgcc 1114
>gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone MGC:82198 IMAGE:3402168), complete cds Length = 1591 Score = 87.7 bits (44), Expect = 4e-14 Identities = 170/212 (80%) Strand = Plus / Minus Query: 254 ttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgacg 313 |||||||| ||||||||||| | ||||||||| | || ||||| ||||| || ||||| Sbjct: 367 ttcttgggcagcagcacggactggatgttgggcaggaccccgccctgagcgatagtgact 308 Query: 314 ccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcggg 373 || ||||||| ||| ||| |||| |||||||| || ||||| | ||||| | ||| Sbjct: 307 cctccgagcagtttgttgagctcctcatcgttgcgcacagcgagctgcaggtgcctgggg 248 Query: 374 atgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagcg 433 |||||||||||||||||||| ||| || ||||||||||| | ||| |||| ||||||| Sbjct: 247 atgatgcgggtcttcttgttatcccgggcagcgttgccggccaactccaggatctcagcg 188 Query: 434 gcgaggtactcgaggacggcggcaaggtagac 465 | ||||||||||| || ||||| || ||||| Sbjct: 187 gtcaggtactcgagcactgcggcgagatagac 156
>ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX (Histone H2A.X) (H2a/x) (LOC531733), mRNA Length = 1724 Score = 87.7 bits (44), Expect = 4e-14 Identities = 179/224 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 |||||| || |||||||||| | ||||||||| | ||||| || || || || || || Sbjct: 849 cttcttaggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 790 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 789 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 730 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||| || || |||||||||||||| ||||| ||||| || ||||| |||| |||||| Sbjct: 729 gattatccgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 670 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccgg 476 || |||||||||||| || || || |||||||| || ||||||| Sbjct: 669 ggtgaggtactcgagtaccgccgccaggtagaccggcgcgccgg 626
>emb|CR709561.2|CNS0GAG5 Tetraodon nigroviridis full-length cDNA Length = 613 Score = 87.7 bits (44), Expect = 4e-14 Identities = 110/132 (83%) Strand = Plus / Minus Query: 365 tggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctagg 424 ||||| |||||||||||||||||||||||||| | || ||||||||||| | ||| ||| Sbjct: 301 tggcgagggatgatgcgggtcttcttgttgtctcttgcggcgttgccggccaactccagg 242 Query: 425 agctcagcggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacg 484 | ||| |||| || ||||| |||||||| || |||||||| || || |||| |||||| Sbjct: 241 atctcggcggtcagatactccaggacggcagccaggtagacgggcgccccggcgccgact 182 Query: 485 cgctgcgcgtag 496 |||| ||||||| Sbjct: 181 cgctccgcgtag 170
>emb|BX016452.1|CNS08KUW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 594 Score = 87.7 bits (44), Expect = 4e-14 Identities = 119/144 (82%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||||||| || || ||||| || Sbjct: 74 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 133 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| ||||||||| || |||| ||||||||||| ||| | | ||||||||||| Sbjct: 134 cccggacagcagcttgttcagctcctcgtcgttgcggatggccaactgcaggtggcgcgg 193 Query: 373 gatgatgcgggtcttcttgttgtc 396 ||||||||| |||||||||||||| Sbjct: 194 gatgatgcgcgtcttcttgttgtc 217
>emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones Length = 1635 Score = 87.7 bits (44), Expect = 4e-14 Identities = 188/236 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||| | | ||||||||| | |||||||| || || ||||| || Sbjct: 1242 cttcttgggcagcagcacagcctggatgttgggcagaacgccgccctgcgcgatggtcac 1183 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | | ||||||||| ||| |||| |||||||||| ||| || | ||||||||||| Sbjct: 1182 gcggcccagcagcttgttgagctcctcatcgttgcggatggccagctgcaggtggcgcgg 1123 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 |||||| || ||||||||||||||| ||||||| || | |||||||| |||| || || Sbjct: 1122 gatgatccgcgtcttcttgttgtccctcgccgcattagccgcaagctccaggatttcggc 1063 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgct 488 | |||||||| || ||||| || ||||| || |||||||| | ||| ||||||| Sbjct: 1062 cgtcaggtactccagtacggccgccaggtacaccggggcgcccgcgcccacgcgct 1007
>emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking regions Length = 843 Score = 87.7 bits (44), Expect = 4e-14 Identities = 194/244 (79%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||| ||||| || || ||||| || Sbjct: 693 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 634 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 | | ||||||||| ||| |||| ||||||||||| ||| || | |||||||| || Sbjct: 633 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 574 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 ||||||||| |||||||||||||| ||||||||||| || ||||| |||| ||| || Sbjct: 573 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctccaggatctcggc 514 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 | |||||||| || ||||| || ||||| | |||||||||| ||| || |||| ||| Sbjct: 513 cgtcaggtactccagcacggccgctaggtacagcggggcgccggcgcccacccgctccgc 454 Query: 493 gtag 496 |||| Sbjct: 453 gtag 450 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| ||||||||||| ||||||||| Sbjct: 423 gcggcccacggggaactgcagcccggcc 396
>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 (ENSANGG00000013551), partial mRNA Length = 375 Score = 87.7 bits (44), Expect = 4e-14 Identities = 119/144 (82%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||||||| || || ||||| || Sbjct: 357 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 298 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| ||||||||| || |||| ||||||||||| ||| || | || |||||||| Sbjct: 297 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 238 Query: 373 gatgatgcgggtcttcttgttgtc 396 ||||||||| |||||||||||||| Sbjct: 237 gatgatgcgcgtcttcttgttgtc 214
>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 (ENSANGG00000000004), mRNA Length = 630 Score = 87.7 bits (44), Expect = 4e-14 Identities = 119/144 (82%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| | ||||||||| | ||||||||| || || ||||| || Sbjct: 471 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 412 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 |||| ||||||||| || |||| ||||||||||| ||| || | || |||||||| Sbjct: 411 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 352 Query: 373 gatgatgcgggtcttcttgttgtc 396 ||||||||| |||||||||||||| Sbjct: 351 gatgatgcgcgtcttcttgttgtc 328
>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV), and histone H2B (ch2b-IV) genes, complete cds Length = 4502 Score = 87.7 bits (44), Expect = 4e-14 Identities = 236/300 (78%) Strand = Plus / Plus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| || ||||||||| | ||| ||||| || ||||| || Sbjct: 3115 cttcttgggcagcagcacggcgtggatgttgggcagcacaccgcccgaggcgatggtcac 3174 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | ||||||||||| || |||| |||||||||| ||| || | | |||||| || Sbjct: 3175 ctcgcccagcagcttgcccagctcctcatcgttgcggatggccagctggatgtggcgagg 3234 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 | |||||| ||||||||||||| || ||||||||||| ||||| || | |||||| Sbjct: 3235 cacaatgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagc 3294 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || |||||||| || |||||||| ||||| || || ||||||| |||| ||||| || Sbjct: 3295 ggtcaggtactccagcacggcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3354 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||| ||| ||||| ||||||||| | |||||||| || |||||||| || |||||||| Sbjct: 3355 gtacttgcccttcttcaggtagcgcgcaatgcggcccacagggaactgcaggccggcctt 3414
>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II), histone H2B (ch2b-II) and histone H2A (ch2a-II) genes, complete cds Length = 3777 Score = 87.7 bits (44), Expect = 4e-14 Identities = 236/300 (78%) Strand = Plus / Minus Query: 253 cttcttggggagcagcacggagttgatgttggggatcacgccgccgtgagcaatggtgac 312 ||||||||| |||||||||| || ||||||||| | ||| ||||| || ||||| || Sbjct: 3579 cttcttgggcagcagcacggcgtggatgttgggcagcacaccgcccgaggcgatggtcac 3520 Query: 313 gccggcgagcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgg 372 || | ||||||||||| || |||| |||||||||| ||| || | | |||||| || Sbjct: 3519 ctcgcccagcagcttgcccagctcctcatcgttgcggatggccagctggatgtggcgggg 3460 Query: 373 gatgatgcgggtcttcttgttgtccttcgccgcgttgccggcaagctctaggagctcagc 432 | ||||||| ||||||||||||| || ||||||||||| ||||| || | |||||| Sbjct: 3459 cacgatgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagc 3400 Query: 433 ggcgaggtactcgaggacggcggcaaggtagactggggcgccggagccgacgcgctgcgc 492 || ||||||||||| || ||||| ||||| || || ||||||| |||| ||||| || Sbjct: 3399 ggtcaggtactcgagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3340 Query: 493 gtagcggcctttcttgaggtagcgccctatgcggccgacggggaactggagcccggcctt 552 ||| ||| ||||| |||||||| | |||||||| || |||||||| || |||||||| Sbjct: 3339 gtacttgcccttcttcaggtagcgtgcaatgcggcccacagggaactgcaggccggcctt 3280
>ref|XM_518286.1| PREDICTED: Pan troglodytes similar to Histone H2A.l (H2A/l) (LOC462490), mRNA Length = 565 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 290 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 349 |||||||| ||||||||||| || | | | ||||| ||| ||| |||| |||||||||| Sbjct: 365 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 306 Query: 350 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 409 | ||| || | | |||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 305 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 246 Query: 410 ccggcaagctctaggagctcagcggcgaggtactc 444 ||||| ||||| |||| ||| |||| |||||||| Sbjct: 245 ccggccagctccaggatctcggcggtcaggtactc 211
>ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616790), mRNA Length = 413 Score = 85.7 bits (43), Expect = 2e-13 Identities = 88/103 (85%) Strand = Plus / Minus Query: 320 agcagcttgccgagttcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatg 379 ||||||||| ||| |||| ||||||||||| ||| || | ||||| |||||||||||| Sbjct: 313 agcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatg 254 Query: 380 cgggtcttcttgttgtccttcgccgcgttgccggcaagctcta 422 |||||||||||||||||| ||||||||||| || ||||||| Sbjct: 253 cgggtcttcttgttgtcccgggccgcgttgcccgccagctcta 211 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 524 cggccgacggggaactggagcccggcc 550 ||||| ||||||||||||||||||||| Sbjct: 109 cggcctacggggaactggagcccggcc 83
>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6 Length = 269712 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 290 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 349 |||||||| ||||||||||| || | | | ||||| ||| ||| |||| |||||||||| Sbjct: 108497 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 108438 Query: 350 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 409 | ||| || | | |||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 108437 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 108378 Query: 410 ccggcaagctctaggagctcagcggcgaggtactc 444 ||||| ||||| |||| ||| |||| |||||||| Sbjct: 108377 ccggccagctccaggatctcggcggtcaggtactc 108343 Score = 71.9 bits (36), Expect = 3e-09 Identities = 75/88 (85%) Strand = Plus / Minus Query: 335 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 394 |||| ||||||||||| ||| || | ||||||||||||||||||||||||||||| ||| Sbjct: 201252 tcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttcttattg 201193 Query: 395 tccttcgccgcgttgccggcaagctcta 422 || ||||||||||| || ||||||| Sbjct: 201192 tcgcgagccgcgttgccagctagctcta 201165 Score = 69.9 bits (35), Expect = 1e-08 Identities = 35/35 (100%) Strand = Plus / Plus Query: 362 aggtggcgcgggatgatgcgggtcttcttgttgtc 396 ||||||||||||||||||||||||||||||||||| Sbjct: 17260 aggtggcgcgggatgatgcgggtcttcttgttgtc 17294 Score = 60.0 bits (30), Expect = 1e-05 Identities = 54/62 (87%) Strand = Plus / Plus Query: 335 tcctggtcgttgcggacggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttg 394 |||| ||||||||||| ||| || | ||||| || |||||||||||||||||||||||| Sbjct: 182966 tcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttgttg 183025 Query: 395 tc 396 || Sbjct: 183026 tc 183027
>ref|NM_003512.3| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA Length = 546 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 290 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 349 |||||||| ||||||||||| || | | | ||||| ||| ||| |||| |||||||||| Sbjct: 411 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 352 Query: 350 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 409 | ||| || | | |||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 351 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 292 Query: 410 ccggcaagctctaggagctcagcggcgaggtactc 444 ||||| ||||| |||| ||| |||| |||||||| Sbjct: 291 ccggccagctccaggatctcggcggtcaggtactc 257
>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488304), mRNA Length = 588 Score = 85.7 bits (43), Expect = 2e-13 Identities = 166/207 (80%) Strand = Plus / Minus Query: 290 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 349 |||||||| || || ||||| |||| | | ||||||||| ||| |||| |||||||||| Sbjct: 470 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 411 Query: 350 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 409 | ||| || | |||||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 410 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 351 Query: 410 ccggcaagctctaggagctcagcggcgaggtactcgaggacggcggcaaggtagactggg 469 || || ||||| |||| ||| || | |||||||| || ||||| || ||||| || || Sbjct: 350 cccgccagctccaggatctcggccgtcaggtactccagcacggccgccaggtacaccggc 291 Query: 470 gcgccggagccgacgcgctgcgcgtag 496 ||||| | ||||| |||| ||||||| Sbjct: 290 gcgcccgccccgacccgctccgcgtag 264 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 523 gcggccgacggggaactggagcccggcc 550 |||||| || |||||||||||||||||| Sbjct: 237 gcggcccaccgggaactggagcccggcc 210
>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the 3' part of the HFE gene for haemochromatosis protein, two genes for novel histone 4 family members, two genes for novel histone 1 family members, three genes for novel histone 2B family members, a gene for a novel histone 2A family member, a novel pseudogene, STSs, GSSs, ESTs and CpG islands, complete sequence Length = 101099 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 290 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 349 |||||||| ||||||||||| || | | | ||||| ||| ||| |||| |||||||||| Sbjct: 30878 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 30819 Query: 350 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 409 | ||| || | | |||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 30818 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 30759 Query: 410 ccggcaagctctaggagctcagcggcgaggtactc 444 ||||| ||||| |||| ||| |||| |||||||| Sbjct: 30758 ccggccagctccaggatctcggcggtcaggtactc 30724
>emb|Z80778.1|HSH2AL H.sapiens H2A/l gene Length = 601 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 290 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 349 |||||||| ||||||||||| || | | | ||||| ||| ||| |||| |||||||||| Sbjct: 462 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 403 Query: 350 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 409 | ||| || | | |||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 402 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 343 Query: 410 ccggcaagctctaggagctcagcggcgaggtactc 444 ||||| ||||| |||| ||| |||| |||||||| Sbjct: 342 ccggccagctccaggatctcggcggtcaggtactc 308
>emb|CR624886.1| full-length cDNA clone CS0DK009YH13 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1446 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 290 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 349 |||||||| ||||||||||| || | | | ||||| ||| ||| |||| |||||||||| Sbjct: 353 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 294 Query: 350 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 409 | ||| || | | |||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 293 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 234 Query: 410 ccggcaagctctaggagctcagcggcgaggtactc 444 ||||| ||||| |||| ||| |||| |||||||| Sbjct: 233 ccggccagctccaggatctcggcggtcaggtactc 199
>emb|CR621753.1| full-length cDNA clone CS0DI059YA15 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1462 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 290 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 349 |||||||| ||||||||||| || | | | ||||| ||| ||| |||| |||||||||| Sbjct: 353 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 294 Query: 350 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 409 | ||| || | | |||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 293 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 234 Query: 410 ccggcaagctctaggagctcagcggcgaggtactc 444 ||||| ||||| |||| ||| |||| |||||||| Sbjct: 233 ccggccagctccaggatctcggcggtcaggtactc 199
>emb|CR608156.1| full-length cDNA clone CS0DI013YB19 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1620 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 290 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 349 |||||||| ||||||||||| || | | | ||||| ||| ||| |||| |||||||||| Sbjct: 339 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 280 Query: 350 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 409 | ||| || | | |||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 279 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 220 Query: 410 ccggcaagctctaggagctcagcggcgaggtactc 444 ||||| ||||| |||| ||| |||| |||||||| Sbjct: 219 ccggccagctccaggatctcggcggtcaggtactc 185
>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene, hereditary haemochromatosis (HLA-H) gene, RoRet gene, and sodium phosphate transporter (NPT3) gene, complete cds Length = 246282 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Plus Query: 290 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 349 |||||||| ||||||||||| || | | | ||||| ||| ||| |||| |||||||||| Sbjct: 16504 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 16563 Query: 350 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 409 | ||| || | | |||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 16564 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 16623 Query: 410 ccggcaagctctaggagctcagcggcgaggtactc 444 ||||| ||||| |||| ||| |||| |||||||| Sbjct: 16624 ccggccagctccaggatctcggcggtcaggtactc 16658 Score = 69.9 bits (35), Expect = 1e-08 Identities = 35/35 (100%) Strand = Plus / Minus Query: 362 aggtggcgcgggatgatgcgggtcttcttgttgtc 396 ||||||||||||||||||||||||||||||||||| Sbjct: 107741 aggtggcgcgggatgatgcgggtcttcttgttgtc 107707
>gb|U90551.1|HSU90551 Human histone 2A-like protein (H2A/l) mRNA, complete cds Length = 1666 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 290 acgccgccgtgagcaatggtgacgccggcgagcagcttgccgagttcctggtcgttgcgg 349 |||||||| ||||||||||| || | | | ||||| ||| ||| |||| |||||||||| Sbjct: 420 acgccgccctgagcaatggtcacccggcctagcagtttgttgagctcctcgtcgttgcgg 361 Query: 350 acggcgagaagaaggtggcgcgggatgatgcgggtcttcttgttgtccttcgccgcgttg 409 | ||| || | | |||||||||||||||||| |||||||||||||| ||||||||| Sbjct: 360 atggccagctgcaagtggcgcgggatgatgcgagtcttcttgttgtcgcgagccgcgttg 301 Query: 410 ccggcaagctctaggagctcagcggcgaggtactc 444 ||||| ||||| |||| ||| |||| |||||||| Sbjct: 300 ccggccagctccaggatctcggcggtcaggtactc 266 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,677,562 Number of Sequences: 3902068 Number of extensions: 4677562 Number of successful extensions: 109638 Number of sequences better than 10.0: 766 Number of HSP's better than 10.0 without gapping: 771 Number of HSP's successfully gapped in prelim test: 5 Number of HSP's that attempted gapping in prelim test: 106196 Number of HSP's gapped (non-prelim): 3166 length of query: 675 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 652 effective length of database: 17,143,297,704 effective search space: 11177430103008 effective search space used: 11177430103008 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
