| Clone Name | rbags32o24 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|AC169376.2| Sorghum bicolor clone SB_BBc0046M17, complete seq... | 38 | 6.2 |
|---|
>gb|AC169376.2| Sorghum bicolor clone SB_BBc0046M17, complete sequence Length = 127914 Score = 38.2 bits (19), Expect = 6.2 Identities = 96/122 (78%), Gaps = 1/122 (0%) Strand = Plus / Minus Query: 10 agtcttgctcagggnaaaaccctctccaggaaactaacgaatcgtttcgaatacaagttc 69 ||||||| |||||| ||||| ||||| ||||| | || |||||||| || ||| | ||| Sbjct: 75257 agtcttgttcaggg-aaaacactctcaaggaactttacaaatcgttttgagtacgaattc 75199 Query: 70 ggatcaacggatgatatngagagagggtcganntttnnagatttgaccgcatgctccacc 129 |||||||| | |||||| || || || |||| || |||||||| |||||||| ||| Sbjct: 75198 ggatcaacagctgatattgaaaggggatcgaacttgagtgatttgactgcatgctcgacc 75139 Query: 130 ct 131 || Sbjct: 75138 ct 75137 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 585,259 Number of Sequences: 3902068 Number of extensions: 585259 Number of successful extensions: 26870 Number of sequences better than 10.0: 1 Number of HSP's better than 10.0 without gapping: 0 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 26870 Number of HSP's gapped (non-prelim): 1 length of query: 132 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 111 effective length of database: 17,151,101,840 effective search space: 1903772304240 effective search space used: 1903772304240 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)