>emb|Z30243.1|SCCLHSP S.cereale (Halo) chloroplast mRNA for heat-shock protein
          Length = 2654

 Score =  159 bits (80), Expect = 3e-36
 Identities = 105/112 (93%), Gaps = 1/112 (0%)
 Strand = Plus / Minus

                                                                        
Query: 31   caaacaagattttggagct-agcgttcttacaaagacagtccattgctcgatgtcttcat 89
            ||||||||||| ||||||| || ||||||||||||||||||||| |||||||||| ||||
Sbjct: 2590 caaacaagattctggagctcagtgttcttacaaagacagtccatcgctcgatgtcatcat 2531

                                                                
Query: 90   cactctggctccagtgatacttctattttttgctcatccacctccagggtat 141
            ||||||||||||||||||||| ||||||||||||| ||||||||||||||||
Sbjct: 2530 cactctggctccagtgatactcctattttttgctcgtccacctccagggtat 2479

>gb|AC116996.3| Mus musculus BAC clone RP23-6B22 from 15, complete sequence
          Length = 229669

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   cagtgatacttctatttttt 120
             ||||||||||||||||||||
Sbjct: 10287 cagtgatacttctatttttt 10268

>gb|AC160934.2| Mus musculus BAC clone RP23-435H22 from chromosome 15, complete sequence
          Length = 183147

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 101    cagtgatacttctatttttt 120
              ||||||||||||||||||||
Sbjct: 128559 cagtgatacttctatttttt 128578

>gb|AC152987.1| Mus musculus 6 BAC RP23-133N21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 196532

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 84    cttcatcactctggctcca 102
             |||||||||||||||||||
Sbjct: 59479 cttcatcactctggctcca 59497

>gb|AY216939.1| Plasmodium vivax strain Belem YAC1H14-like sequence
          Length = 101016

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 12    acaaaatttagccttggcgcaaa 34
             ||||||||||||||| |||||||
Sbjct: 83216 acaaaatttagccttcgcgcaaa 83194

>gb|AY216938.1| Plasmodium vivax strain IndiaVII YAC1H14-like sequence
          Length = 101158

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 12    acaaaatttagccttggcgcaaa 34
             ||||||||||||||| |||||||
Sbjct: 83281 acaaaatttagccttcgcgcaaa 83259

>gb|AY216937.1| Plasmodium vivax strain Salvador I YAC1H14-like sequence
          Length = 101095

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 12    acaaaatttagccttggcgcaaa 34
             ||||||||||||||| |||||||
Sbjct: 83294 acaaaatttagccttcgcgcaaa 83272

>gb|AY216936.1| Plasmodium vivax strain Thai-NYU YAC1H14-like sequence
          Length = 101002

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 12    acaaaatttagccttggcgcaaa 34
             ||||||||||||||| |||||||
Sbjct: 83202 acaaaatttagccttcgcgcaaa 83180

>gb|AC126424.12| Mus musculus chromosome 17, clone RP23-19K10, complete sequence
          Length = 182696

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 94     ctggctccagtgatacttc 112
              |||||||||||||||||||
Sbjct: 168325 ctggctccagtgatacttc 168343

>emb|CR721409.2|CNS0GJL3 Tetraodon nigroviridis full-length cDNA
          Length = 1514

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 108  acttctattttttgctcat 126
            |||||||||||||||||||
Sbjct: 1471 acttctattttttgctcat 1489

>emb|AL158825.12| Human DNA sequence from clone RP11-197P3 on chromosome 9 Contains a
             novel gene (FLJ10110), a novel pseudogene, a novel gene
             (FLJ25795), two novel genes and two CpG islands, complete
             sequence
          Length = 127399

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 98    ctccagtgatacttctatt 116
             |||||||||||||||||||
Sbjct: 79938 ctccagtgatacttctatt 79956

>gb|AC008440.9| Homo sapiens chromosome 19 clone CTC-331H23, complete sequence
          Length = 169997

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 102    agtgatacttctatttttt 120
              |||||||||||||||||||
Sbjct: 148205 agtgatacttctatttttt 148223

>gb|AC163764.4| Pan troglodytes BAC clone CH251-169M18 from chromosome unknown,
             complete sequence
          Length = 195947

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 102   agtgatacttctatttttt 120
             |||||||||||||||||||
Sbjct: 40348 agtgatacttctatttttt 40366

>gb|AY003872.1| Plasmodium vivax YAC 1H14, complete sequence
          Length = 199866

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 12     acaaaatttagccttggcgcaaa 34
              ||||||||||||||| |||||||
Sbjct: 129403 acaaaatttagccttcgcgcaaa 129381

>emb|CR392361.2| Zebrafish DNA sequence from clone DKEY-73H23 in linkage group 9,
             complete sequence
          Length = 163815

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 113   tattttttgctcatccacc 131
             |||||||||||||||||||
Sbjct: 54540 tattttttgctcatccacc 54558

>emb|BX284113.5| Zebrafish DNA sequence from clone CH211-247M3 in linkage group 7,
             complete sequence
          Length = 162808

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 16    aatttagccttggcgcaaa 34
             |||||||||||||||||||
Sbjct: 66509 aatttagccttggcgcaaa 66527

>gb|AC064864.4| Homo sapiens BAC clone RP11-407M6 from 2, complete sequence
          Length = 183687

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 98    ctccagtgatacttctatt 116
             |||||||||||||||||||
Sbjct: 89271 ctccagtgatacttctatt 89289

>emb|BX647386.1|HSM807531 Homo sapiens mRNA; cDNA DKFZp686C13144 (from clone DKFZp686C13144)
          Length = 4081

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 98   ctccagtgatacttctatt 116
            |||||||||||||||||||
Sbjct: 3497 ctccagtgatacttctatt 3479

>emb|CT033750.18| Mouse DNA sequence from clone RP23-263M5 on chromosome 17, complete
              sequence
          Length = 268616

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 94     ctggctccagtgatacttc 112
              |||||||||||||||||||
Sbjct: 253856 ctggctccagtgatacttc 253874

>emb|BX538061.1|HSM806232 Homo sapiens mRNA; cDNA DKFZp686J16172 (from clone DKFZp686J16172)
          Length = 3720

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 98   ctccagtgatacttctatt 116
            |||||||||||||||||||
Sbjct: 3243 ctccagtgatacttctatt 3225


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,404,562
Number of Sequences: 3902068
Number of extensions: 1404562
Number of successful extensions: 100718
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 100671
Number of HSP's gapped (non-prelim): 46
length of query: 178
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 156
effective length of database: 17,147,199,772
effective search space: 2674963164432
effective search space used: 2674963164432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)