ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags32n01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC101980.8| Mus musculus chromosome 7, clone RP24-339E15, complete sequence Length = 219739 Score = 40.1 bits (20), Expect = 1.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 tgctcttgccaaacattgaa 47 |||||||||||||||||||| Sbjct: 76616 tgctcttgccaaacattgaa 76597
>emb|AL136133.14| Human DNA sequence from clone CTA-253N17 on chromosome 1 Contains the 5' end of the C1orf25 gene for chromosome 1 open reading frame 25, the 5' end of the C1orf26 gene for chromosome 1 open reading frame 26 and a CpG island, complete sequence Length = 85565 Score = 40.1 bits (20), Expect = 1.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 acaaactctttaggagttca 89 |||||||||||||||||||| Sbjct: 47432 acaaactctttaggagttca 47413
>emb|BX950865.11| Zebrafish DNA sequence from clone DKEYP-100E12 in linkage group 6, complete sequence Length = 162517 Score = 40.1 bits (20), Expect = 1.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 catggcaaacaaactcttta 81 |||||||||||||||||||| Sbjct: 136724 catggcaaacaaactcttta 136705
>emb|AL360080.21| Human DNA sequence from clone RP11-483I8 on chromosome 1, complete sequence Length = 202149 Score = 38.2 bits (19), Expect = 4.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 33 ttgccaaacattgaaatga 51 ||||||||||||||||||| Sbjct: 77944 ttgccaaacattgaaatga 77962
>emb|AL035552.9|HS162O13 Human DNA sequence from clone RP6-162O13 on chromosome Xq21.31-21.33 Contains the 3' end of a novel gene (FLJ30678) and a novel pseudogene, complete sequence Length = 149731 Score = 38.2 bits (19), Expect = 4.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 60 cccatggcaaacaaactct 78 ||||||||||||||||||| Sbjct: 21127 cccatggcaaacaaactct 21145
>gb|AC098687.3| Bos taurus clone rp42-194o5, complete sequence Length = 156543 Score = 38.2 bits (19), Expect = 4.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 33 ttgccaaacattgaaatga 51 ||||||||||||||||||| Sbjct: 106310 ttgccaaacattgaaatga 106328 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 767,993 Number of Sequences: 3902068 Number of extensions: 767993 Number of successful extensions: 58037 Number of sequences better than 10.0: 6 Number of HSP's better than 10.0 without gapping: 6 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 58029 Number of HSP's gapped (non-prelim): 8 length of query: 102 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 81 effective length of database: 17,151,101,840 effective search space: 1389239249040 effective search space used: 1389239249040 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
