Clone Name	rbags33b15
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein,...	605	e-170
2	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	321	1e-84
3	dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic D...	321	1e-84
4	dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clon...	321	1e-84
5	dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clon...	321	1e-84
6	dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clon...	313	3e-82
7	gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps...	266	6e-68
8	gb|BT016261.1| Zea mays clone Contig94 mRNA sequence	252	9e-64
9	gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA,...	252	9e-64
10	gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds	250	4e-63
11	gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence	242	9e-61
12	emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4	206	5e-50
13	ref|XM_475130.1| Oryza sativa (japonica cultivar-group), predic...	161	3e-36
14	gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome...	161	3e-36
15	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	161	3e-36
16	dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clon...	161	3e-36
17	gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4...	149	1e-32
18	ref|NM_193994.1| Oryza sativa (japonica cultivar-group), predic...	147	4e-32
19	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	147	4e-32
20	dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic D...	147	4e-32
21	dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clon...	147	4e-32
22	gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete s...	119	9e-24
23	emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Co...	111	2e-21
24	ref|NM_001036769.1| Arabidopsis thaliana structural constituent ...	103	5e-19
25	ref|NM_120791.2| Arabidopsis thaliana structural constituent of ...	103	5e-19
26	gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal prote...	103	5e-19
27	gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal prote...	103	5e-19
28	emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, B...	103	5e-19
29	gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co...	103	5e-19
30	gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co...	103	5e-19
31	emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Co...	103	5e-19
32	emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Co...	103	5e-19
33	emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Co...	103	5e-19
34	emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Co...	103	5e-19
35	gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete s...	103	5e-19
36	dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	103	5e-19
37	gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, comple...	94	5e-16
38	dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, com...	94	5e-16
39	emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal pro...	92	2e-15
40	gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal prot...	90	8e-15
41	emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Co...	88	3e-14
42	ref|NM_125228.3| Arabidopsis thaliana structural constituent of ...	82	2e-12
43	gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, comp...	82	2e-12
44	gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, comp...	82	2e-12
45	gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mR...	82	2e-12
46	emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
47	emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
48	emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
49	emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
50	emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
51	emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Co...	82	2e-12
52	gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete s...	82	2e-12
53	dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	82	2e-12
54	emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Co...	80	7e-12
55	emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal prote...	78	3e-11
56	ref|NM_127291.2| Arabidopsis thaliana structural constituent of ...	72	2e-09
57	gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S...	72	2e-09
58	gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S...	72	2e-09
59	gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, comple...	72	2e-09
60	gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA...	72	2e-09
61	emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Co...	72	2e-09
62	emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Co...	72	2e-09
63	gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete s...	72	2e-09
64	gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II sectio...	72	2e-09
65	gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence	64	4e-07
66	emb|BX818793.1|CNS0A8YY Arabidopsis thaliana Full-length cDNA Co...	62	2e-06
67	gb|AY110862.1| Zea mays CL1882_8 mRNA sequence	62	2e-06
68	ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hyp...	58	3e-05
69	ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothe...	56	1e-04
70	gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-lik...	56	1e-04
71	gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA	54	4e-04
72	ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG...	54	4e-04
73	ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG...	54	4e-04
74	gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell ...	54	4e-04
75	dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	54	4e-04
76	gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46...	54	4e-04
77	dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribos...	54	4e-04
78	gb|BT018605.1| Zea mays clone EL01N0450E04.d mRNA sequence	52	0.002
79	ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predi...	50	0.007
80	gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 ...	50	0.007
81	emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1...	50	0.007
82	ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.026
83	gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putat...	48	0.026
84	ref|XM_775416.1| PREDICTED: Strongylocentrotus purpuratus simila...	46	0.10
85	emb|BX067601.1|CNS09OBP Single read from an extremity of a full-...	44	0.41
86	emb|BX067600.1|CNS09OBO Single read from an extremity of a full-...	44	0.41
87	gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gen...	44	0.41
88	gb|AY439895.1| Armigeres subalbatus ASAP ID: 38941 cytosolic sma...	42	1.6
89	gb|AY433736.1| Aedes aegypti ASAP ID: 34407 cytosolic small ribo...	42	1.6
90	gb|DQ440018.1| Aedes aegypti clone AE-221 40S ribosomal protein ...	42	1.6
91	gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosom...	42	1.6
92	ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical prote...	42	1.6
93	ref|XM_749829.1| Aspergillus fumigatus Af293 cytosolic small rib...	42	1.6
94	emb|CR938551.1| Single read from an extremity of a full-length c...	42	1.6
95	emb|CR938407.1| Single read from an extremity of a full-length c...	42	1.6
96	emb|CR938406.1| Single read from an extremity of a full-length c...	42	1.6
97	emb|CR938380.1| Single read from an extremity of a full-length c...	42	1.6
98	emb|CR938366.1| Single read from an extremity of a full-length c...	42	1.6
99	gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete s...	42	1.6
100	dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020	42	1.6
101	gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA ...	40	6.4
102	ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1...	40	6.4
103	gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr...	40	6.4
104	gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, com...	40	6.4
105	gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence	40	6.4
106	gb|AF359361.3| Gibberella zeae strain GZ3639 trichothecene gene ...	40	6.4
107	gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ...	40	6.4
108	ref|XM_383708.1| Gibberella zeae PH-1 chromosome 2 hypothetical ...	40	6.4
109	ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 h...	40	6.4
110	gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome...	40	6.4
111	ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (...	40	6.4
112	gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRN...	40	6.4
113	emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227...	40	6.4
114	emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chrom...	40	6.4
115	ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predi...	40	6.4
116	ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypoth...	40	6.4
117	emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clo...	40	6.4
118	emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 i...	40	6.4
119	gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, com...	40	6.4
120	gb|AF336366.2| Gibberella zeae H-11 trichothecene biosynthesis g...	40	6.4
121	gb|AC007437.16| Homo sapiens 12q22 BAC RPCI11-541G9 (Roswell Par...	40	6.4
122	gb|AC007656.2| Homo sapiens 12q22 BAC RPCI11-534P6 (Rowswell Par...	40	6.4
123	gb|AY857461.1| Suberites domuncula S4 mRNA, complete cds	40	6.4
124	dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21,...	40	6.4
125	emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1...	40	6.4
126	gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein ...	40	6.4
127	gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosom...	40	6.4
128	dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, sectio...	40	6.4
129	gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, comple...	40	6.4
130	gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, com...	40	6.4
131	emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1...	40	6.4
132	emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chr...	40	6.4
133	emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-6...	40	6.4
134	dbj|AP000141.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL...	40	6.4
135	dbj|D87675.1| Homo sapiens DNA for amyloid precursor protein, co...	40	6.4
136	dbj|AP001442.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21...	40	6.4
137	dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related...	40	6.4

---

>dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein, complete cds
          Length = 1053

 Score =  605 bits (305), Expect = e-170
 Identities = 411/445 (92%), Gaps = 2/445 (0%)
 Strand = Plus / Minus

                                                                        
Query: 29   taaacatcc-cattacatctagcagcatccatgggttcgcaaatcaacaaacatcaggca 87
            ||||||||| ||||||||||||||||| |||||||||| ||| |||||||||||||||||
Sbjct: 1036 taaacatccacattacatctagcagcaaccatgggttcacaattcaacaaacatcaggca 977

                                                                        
Query: 88   aaacttaaaaaagatggttccaggaacatagttctatatccttgcagataactggctata 147
            ||| ||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||
Sbjct: 976  aaatttaaaaacgatggttccagaaacatagttctatatcctt-cagataactggctata 918

                                                                        
Query: 148  gcaaaacgactcaatgcctcagaatcaggccttggcagcagcctgagctgcggcatccct 207
            ||||||||| |||| |||||||||||||||||||||||| ||||| || |||||||||||
Sbjct: 917  gcaaaacgaatcaacgcctcagaatcaggccttggcagctgcctgggcagcggcatccct 858

                                                                        
Query: 208  cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 267
            |||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||
Sbjct: 857  cttcctctgctcctcaatgatggtcagcttgatacctttgcccttggggagggtcaccca 798

                                                                        
Query: 268  aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngacc 327
             ||||||||||||||||| ||||||||||| ||||| ||||||||||| |||||| ||||
Sbjct: 797  cggcttggtgcccttgccgatggtgaacacattgcctagacgggtggcgaactggtgacc 738

                                                                        
Query: 328  ctgggcatnctcaacgnggatggtctcaaaggttcccttatgcttctccctgttcttgat 387
            ||| |||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 737  ctgagcatcctcaacgtggatggtctcgaaggttcccttatgcttctccctgttcttgat 678

                                                                        
Query: 388  cacaccaacacgcccagtgttgcgcccaccantcaccatgacgacgttgccgacgtcaaa 447
            |||||||||||| |||||||| ||||||||| | |||||||| || ||||| || |||||
Sbjct: 677  cacaccaacacggccagtgttacgcccaccagtaaccatgacaacattgccaacatcaaa 618

                                     
Query: 448  cttgatgaagtcaacaatcttgttg 472
            |||||||||||||||||||||||||
Sbjct: 617  cttgatgaagtcaacaatcttgttg 593

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score =  321 bits (162), Expect = 1e-84
 Identities = 260/294 (88%)
 Strand = Plus / Plus

                                                                          
Query: 179    ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
              |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 316967 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 317026

                                                                          
Query: 239    atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
              || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 317027 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 317086

                                                                          
Query: 299    ttgcccagacgggtggcaaactggngaccctgggcatnctcaacgnggatggtctcaaag 358
              ||||||||||||||||| || ||| | ||| |||||| ||||||| |||||||||| |||
Sbjct: 317087 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 317146

                                                                          
Query: 359    gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 418
               | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 317147 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 317206

                                                                    
Query: 419    ntcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttg 472
               |||||||||| || ||||| || ||||||||||||||||| ||||||||||||
Sbjct: 317207 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttg 317260



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                      
Query: 115    atagttctatatccttgcagataactggctatagcaaaac 154
              ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 316896 atagttctatatccttgcaaacaactcgctatagcaaaac 316935

---

>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1359_D06
          Length = 146805

 Score =  321 bits (162), Expect = 1e-84
 Identities = 260/294 (88%)
 Strand = Plus / Plus

                                                                         
Query: 179   ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
             |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 45751 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 45810

                                                                         
Query: 239   atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
             || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 45811 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 45870

                                                                         
Query: 299   ttgcccagacgggtggcaaactggngaccctgggcatnctcaacgnggatggtctcaaag 358
             ||||||||||||||||| || ||| | ||| |||||| ||||||| |||||||||| |||
Sbjct: 45871 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 45930

                                                                         
Query: 359   gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 418
              | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 45931 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 45990

                                                                   
Query: 419   ntcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttg 472
              |||||||||| || ||||| || ||||||||||||||||| ||||||||||||
Sbjct: 45991 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttg 46044



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 115   atagttctatatccttgcagataactggctatagcaaaac 154
             ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 45680 atagttctatatccttgcaaacaactcgctatagcaaaac 45719

---

>dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B09, full
           insert sequence
          Length = 1016

 Score =  321 bits (162), Expect = 1e-84
 Identities = 260/294 (88%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 886 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 827

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 826 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 767

                                                                       
Query: 299 ttgcccagacgggtggcaaactggngaccctgggcatnctcaacgnggatggtctcaaag 358
           ||||||||||||||||| || ||| | ||| |||||| ||||||| |||||||||| |||
Sbjct: 766 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 707

                                                                       
Query: 359 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 418
            | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 706 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 647

                                                                 
Query: 419 ntcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttg 472
            |||||||||| || ||||| || ||||||||||||||||| ||||||||||||
Sbjct: 646 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttg 593



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 115 atagttctatatccttgcagataactggctatagcaaaac 154
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 957 atagttctatatccttgcaaacaactcgctatagcaaaac 918

---

>dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093E13, full
           insert sequence
          Length = 1157

 Score =  321 bits (162), Expect = 1e-84
 Identities = 260/294 (88%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 890 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 831

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 830 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 771

                                                                       
Query: 299 ttgcccagacgggtggcaaactggngaccctgggcatnctcaacgnggatggtctcaaag 358
           ||||||||||||||||| || ||| | ||| |||||| ||||||| |||||||||| |||
Sbjct: 770 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 711

                                                                       
Query: 359 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 418
            | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 710 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 651

                                                                 
Query: 419 ntcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttg 472
            |||||||||| || ||||| || ||||||||||||||||| ||||||||||||
Sbjct: 650 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttg 597



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 115 atagttctatatccttgcagataactggctatagcaaaac 154
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 961 atagttctatatccttgcaaacaactcgctatagcaaaac 922

---

>dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D06, full
           insert sequence
          Length = 1079

 Score =  313 bits (158), Expect = 3e-82
 Identities = 259/294 (88%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 882 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 823

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||  
Sbjct: 822 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaaa 763

                                                                       
Query: 299 ttgcccagacgggtggcaaactggngaccctgggcatnctcaacgnggatggtctcaaag 358
           ||||||||||||||||| || ||| | ||| |||||| ||||||| |||||||||| |||
Sbjct: 762 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 703

                                                                       
Query: 359 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 418
            | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 702 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 643

                                                                 
Query: 419 ntcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttg 472
            |||||||||| || ||||| || ||||||||||||||||| ||||||||||||
Sbjct: 642 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttg 589



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 115 atagttctatatccttgcagataactggctatagcaaaac 154
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 953 atagttctatatccttgcaaacaactcgctatagcaaaac 914

---

>gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps4) mRNA, complete cds
          Length = 1013

 Score =  266 bits (134), Expect = 6e-68
 Identities = 253/294 (86%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || |||||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 864 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 805

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || |||||||||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 804 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 745

                                                                       
Query: 299 ttgcccagacgggtggcaaactggngaccctgggcatnctcaacgnggatggtctcaaag 358
           ||||||| ||||||||| |||||| | ||| |||  | ||| ||| | ||||||||||||
Sbjct: 744 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaaag 685

                                                                       
Query: 359 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 418
            | ||||| |||||||||||||||||||| ||||| || || |||||||| |  || |||
Sbjct: 684 ctgcccttgtgcttctccctgttcttgataacacccacgcggccagtgttccttccgcca 625

                                                                 
Query: 419 ntcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttg 472
            ||||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 624 gtcaccatgacgacgttgccaacatcaaacttgatgaagtccacaatcttgttg 571



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 111 gaacatagttctatatccttgcaga 135
           |||||| ||||||||||||||||||
Sbjct: 936 gaacattgttctatatccttgcaga 912

---

>gb|BT016261.1| Zea mays clone Contig94 mRNA sequence
          Length = 1116

 Score =  252 bits (127), Expect = 9e-64
 Identities = 228/263 (86%)
 Strand = Plus / Minus

                                                                       
Query: 210 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 269
           ||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| |
Sbjct: 865 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 806

                                                                       
Query: 270 gcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngaccct 329
           ||||| |||||||||| |||||||||||||||||||  |||||||| |||||| | ||| 
Sbjct: 805 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 746

                                                                       
Query: 330 gggcatnctcaacgnggatggtctcaaaggttcccttatgcttctccctgttcttgatca 389
            ||  | ||| ||| ||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 745 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 686

                                                                       
Query: 390 caccaacacgcccagtgttgcgcccaccantcaccatgacgacgttgccgacgtcaaact 449
           |||| |||||||| ||||| | ||| ||  |||||||||| |||||||||||||||||||
Sbjct: 685 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttgccgacgtcaaact 626

                                  
Query: 450 tgatgaagtcaacaatcttgttg 472
           |||||||||| |  |||||||||
Sbjct: 625 tgatgaagtccatgatcttgttg 603

---

>gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA, complete cds
          Length = 1090

 Score =  252 bits (127), Expect = 9e-64
 Identities = 228/263 (86%)
 Strand = Plus / Minus

                                                                       
Query: 210 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 269
           ||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| |
Sbjct: 844 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 785

                                                                       
Query: 270 gcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngaccct 329
           ||||| |||||||||| |||||||||||||||||||  |||||||| |||||| | ||| 
Sbjct: 784 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 725

                                                                       
Query: 330 gggcatnctcaacgnggatggtctcaaaggttcccttatgcttctccctgttcttgatca 389
            ||  | ||| ||| ||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 724 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 665

                                                                       
Query: 390 caccaacacgcccagtgttgcgcccaccantcaccatgacgacgttgccgacgtcaaact 449
           |||| |||||||| ||||| | ||| ||  |||||||||| |||||||||||||||||||
Sbjct: 664 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttgccgacgtcaaact 605

                                  
Query: 450 tgatgaagtcaacaatcttgttg 472
           |||||||||| |  |||||||||
Sbjct: 604 tgatgaagtccatgatcttgttg 582

---

>gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds
          Length = 1037

 Score =  250 bits (126), Expect = 4e-63
 Identities = 251/294 (85%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || |||||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 862 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 803

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || |||||||||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 802 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 743

                                                                       
Query: 299 ttgcccagacgggtggcaaactggngaccctgggcatnctcaacgnggatggtctcaaag 358
           ||||||| ||||||||| |||||| | ||| |||  | ||| ||| | |||||||||| |
Sbjct: 742 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaagg 683

                                                                       
Query: 359 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 418
            | ||||| |||||||||||||||||||| ||||| ||||| |||||||| |  || |||
Sbjct: 682 ctgcccttgtgcttctccctgttcttgataacacccacacggccagtgttccttccgcca 623

                                                                 
Query: 419 ntcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttg 472
            |||||||||| |||||||| || ||||||||||||||||| ||||| ||||||
Sbjct: 622 gtcaccatgacaacgttgccaacatcaaacttgatgaagtccacaattttgttg 569



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 111 gaacatagttctatatccttgcaga 135
           |||||| ||||||||||||||||||
Sbjct: 934 gaacattgttctatatccttgcaga 910

---

>gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence
          Length = 1145

 Score =  242 bits (122), Expect = 9e-61
 Identities = 250/294 (85%)
 Strand = Plus / Plus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 238
           |||||||||||||| || || ||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 178 ttggcagcagcctgggcagcagcatcccgcttcctttgctcttctatgatgctcagcttg 237

                                                                       
Query: 239 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 298
           || ||||| |||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 238 attcccttacccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 297

                                                                       
Query: 299 ttgcccagacgggtggcaaactggngaccctgggcatnctcaacgnggatggtctcaaag 358
           ||||||| ||||||||| |||||| | ||| |||  | ||| ||| | || |||||||||
Sbjct: 298 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatagtctcaaag 357

                                                                       
Query: 359 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 418
            | ||||| |||||||||||||||||||| ||||| |||||  ||||||| |  || |||
Sbjct: 358 ctgcccttgtgcttctccctgttcttgataacacccacacgggcagtgttccttccccca 417

                                                                 
Query: 419 ntcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttg 472
            ||||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 418 gtcaccatgacgacgttgccaacatcaaacttgatgaagtccacaatcttgttg 471



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 110 ggaacatagttctatatccttgcaga 135
           ||||||| ||||||||||||||||||
Sbjct: 105 ggaacattgttctatatccttgcaga 130

---

>emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4
          Length = 1148

 Score =  206 bits (104), Expect = 5e-50
 Identities = 191/217 (88%), Gaps = 3/217 (1%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttggcagcagcctgagctgcggcatccctcttcctctgctcct-caatgatggtgagctt 237
           |||||||||||||| || || || |||| |||||| ||||||| | |||||| |||||||
Sbjct: 865 ttggcagcagcctgggcggccgc-tcccgcttcctttgctccttcgatgatgctgagctt 807

                                                                       
Query: 238 gatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacac 297
           ||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||
Sbjct: 806 gatgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacac 747

                                                                       
Query: 298 gttgcccagacgggtggcaaactggngaccctgggcatnctcaacgnggatggtctcaaa 357
            ||||||||||||||||| || ||| | ||| |||||| ||||||| |||||||||| ||
Sbjct: 746 attgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaa 687

                                                
Query: 358 ggttcccttatgcttctccctgttcttgatcacacca 394
            | | |||| |||||||||||||| ||||||||||||
Sbjct: 686 -gctgccttttgcttctccctgttgttgatcacacca 651



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 115 atagttctatatcc-ttgcagataactggctatagcaaaac 154
           |||||||||||||| ||||| | |||| |||||||||||||
Sbjct: 937 atagttctatatcctttgcaaacaactcgctatagcaaaac 897

---

>ref|XM_475130.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 738

 Score =  161 bits (81), Expect = 3e-36
 Identities = 218/265 (82%)
 Strand = Plus / Minus

                                                                       
Query: 208 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 267
           |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 708 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 649

                                                                       
Query: 268 aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngacc 327
            |||||  |  ||||||| |||||||| ||||||||||  || || || |||||| | ||
Sbjct: 648 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 589

                                                                       
Query: 328 ctgggcatnctcaacgnggatggtctcaaaggttcccttatgcttctccctgttcttgat 387
             |||||| ||| ||  |||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 588 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 529

                                                                       
Query: 388 cacaccaacacgcccagtgttgcgcccaccantcaccatgacgacgttgccgacgtcaaa 447
           ||| || || ||||| ||||| | ||||||  ||||||| |||| ||| || || |||||
Sbjct: 528 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 469

                                    
Query: 448 cttgatgaagtcaacaatcttgttg 472
           |||||||||||| || |||||||||
Sbjct: 468 cttgatgaagtccacgatcttgttg 444

---

>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07,
             complete sequence
          Length = 159932

 Score =  161 bits (81), Expect = 3e-36
 Identities = 218/265 (82%)
 Strand = Plus / Minus

                                                                         
Query: 208   cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 267
             |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 81033 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 80974

                                                                         
Query: 268   aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngacc 327
              |||||  |  ||||||| |||||||| ||||||||||  || || || |||||| | ||
Sbjct: 80973 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 80914

                                                                         
Query: 328   ctgggcatnctcaacgnggatggtctcaaaggttcccttatgcttctccctgttcttgat 387
               |||||| ||| ||  |||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 80913 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 80854

                                                                         
Query: 388   cacaccaacacgcccagtgttgcgcccaccantcaccatgacgacgttgccgacgtcaaa 447
             ||| || || ||||| ||||| | ||||||  ||||||| |||| ||| || || |||||
Sbjct: 80853 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 80794

                                      
Query: 448   cttgatgaagtcaacaatcttgttg 472
             |||||||||||| || |||||||||
Sbjct: 80793 cttgatgaagtccacgatcttgttg 80769

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  161 bits (81), Expect = 3e-36
 Identities = 218/265 (82%)
 Strand = Plus / Minus

                                                                            
Query: 208      cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 267
                |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 17551228 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 17551169

                                                                            
Query: 268      aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngacc 327
                 |||||  |  ||||||| |||||||| ||||||||||  || || || |||||| | ||
Sbjct: 17551168 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 17551109

                                                                            
Query: 328      ctgggcatnctcaacgnggatggtctcaaaggttcccttatgcttctccctgttcttgat 387
                  |||||| ||| ||  |||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 17551108 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 17551049

                                                                            
Query: 388      cacaccaacacgcccagtgttgcgcccaccantcaccatgacgacgttgccgacgtcaaa 447
                ||| || || ||||| ||||| | ||||||  ||||||| |||| ||| || || |||||
Sbjct: 17551048 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 17550989

                                         
Query: 448      cttgatgaagtcaacaatcttgttg 472
                |||||||||||| || |||||||||
Sbjct: 17550988 cttgatgaagtccacgatcttgttg 17550964

---

>dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123J20, full
           insert sequence
          Length = 1162

 Score =  161 bits (81), Expect = 3e-36
 Identities = 218/265 (82%)
 Strand = Plus / Minus

                                                                       
Query: 208 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 267
           |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 860 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 801

                                                                       
Query: 268 aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngacc 327
            |||||  |  ||||||| |||||||| ||||||||||  || || || |||||| | ||
Sbjct: 800 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 741

                                                                       
Query: 328 ctgggcatnctcaacgnggatggtctcaaaggttcccttatgcttctccctgttcttgat 387
             |||||| ||| ||  |||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 740 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 681

                                                                       
Query: 388 cacaccaacacgcccagtgttgcgcccaccantcaccatgacgacgttgccgacgtcaaa 447
           ||| || || ||||| ||||| | ||||||  ||||||| |||| ||| || || |||||
Sbjct: 680 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 621

                                    
Query: 448 cttgatgaagtcaacaatcttgttg 472
           |||||||||||| || |||||||||
Sbjct: 620 cttgatgaagtccacgatcttgttg 596

---

>gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4 (RPS4) mRNA, complete cds
          Length = 1086

 Score =  149 bits (75), Expect = 1e-32
 Identities = 197/239 (82%)
 Strand = Plus / Minus

                                                                       
Query: 221 tcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggtgccc 280
           |||| |||||| ||||||||||| || |||||||| ||   ||||||||| || || |||
Sbjct: 783 tcaaggatggttagcttgatacctttccccttgggaagagacacccaaggttttgtaccc 724

                                                                       
Query: 281 ttgccaatggtgaacacgttgcccagacgggtggcaaactggngaccctgggcatnctca 340
           ||||||||||||||||| || || || || || ||||||| | ||||   ||||| || |
Sbjct: 723 ttgccaatggtgaacacattaccaagccgagtagcaaactcgtgaccagtggcatcctga 664

                                                                       
Query: 341 acgnggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 400
           ||| |||||||||||||| ||||||||||||||||||||||||| || || |||||||| 
Sbjct: 663 acgtggatggtctcaaagcttcccttatgcttctccctgttcttaatgactccaacacga 604

                                                                      
Query: 401 ccagtgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtc 459
           ||  |||| |  |||||| |||||||||| || || || || |||||||| ||||||||
Sbjct: 603 cctctgtttcttccaccagtcaccatgacaacatttccaacatcaaacttaatgaagtc 545

---

>ref|NM_193994.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 768

 Score =  147 bits (74), Expect = 4e-32
 Identities = 119/134 (88%)
 Strand = Plus / Minus

                                                                       
Query: 182 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 241
           |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 758 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 699

                                                                       
Query: 242 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 301
           ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 698 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 639

                         
Query: 302 cccagacgggtggc 315
           ||||||||||||||
Sbjct: 638 cccagacgggtggc 625



 Score =  113 bits (57), Expect = 5e-22
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||||||||||||  | ||||| ||||||||||||||||| || || |||||||| ||||
Sbjct: 595 ggatggtctcaaaactgcccttgtgcttctccctgttcttaattactccaacacgaccag 536

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| | ||| ||  | ||||| ||||| ||||| || ||||||||||||||||||||||
Sbjct: 535 tgttcctccctcctgtgaccataacgacattgcccacatcaaacttgatgaagtcaacaa 476

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 475 tcttgttg 468

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  147 bits (74), Expect = 4e-32
 Identities = 119/134 (88%)
 Strand = Plus / Minus

                                                                            
Query: 182      gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 241
                |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 14497969 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 14497910

                                                                            
Query: 242      cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 301
                ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 14497909 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 14497850

                              
Query: 302      cccagacgggtggc 315
                ||||||||||||||
Sbjct: 14497849 cccagacgggtggc 14497836



 Score =  113 bits (57), Expect = 5e-22
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                            
Query: 345      ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
                |||||||||||||  | ||||| ||||||||||||||||| || || |||||||| ||||
Sbjct: 14497806 ggatggtctcaaaactgcccttgtgcttctccctgttcttaattactccaacacgaccag 14497747

                                                                            
Query: 405      tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
                |||| | ||| ||  | ||||| ||||| ||||| || ||||||||||||||||||||||
Sbjct: 14497746 tgttcctccctcctgtgaccataacgacattgcccacatcaaacttgatgaagtcaacaa 14497687

                        
Query: 465      tcttgttg 472
                ||||||||
Sbjct: 14497686 tcttgttg 14497679

---

>dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0514H03
          Length = 167230

 Score =  147 bits (74), Expect = 4e-32
 Identities = 119/134 (88%)
 Strand = Plus / Minus

                                                                         
Query: 182   gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 241
             |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 57282 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 57223

                                                                         
Query: 242   cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 301
             ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 57222 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 57163

                           
Query: 302   cccagacgggtggc 315
             ||||||||||||||
Sbjct: 57162 cccagacgggtggc 57149



 Score =  113 bits (57), Expect = 5e-22
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                         
Query: 345   ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
             |||||||||||||  | ||||| ||||||||||||||||| || || |||||||| ||||
Sbjct: 57119 ggatggtctcaaaactgcccttgtgcttctccctgttcttaattactccaacacgaccag 57060

                                                                         
Query: 405   tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
             |||| | ||| ||  | ||||| ||||| ||||| || ||||||||||||||||||||||
Sbjct: 57059 tgttcctccctcctgtgaccataacgacattgcccacatcaaacttgatgaagtcaacaa 57000

                     
Query: 465   tcttgttg 472
             ||||||||
Sbjct: 56999 tcttgttg 56992

---

>dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C06, full
           insert sequence
          Length = 1035

 Score =  147 bits (74), Expect = 4e-32
 Identities = 119/134 (88%)
 Strand = Plus / Minus

                                                                       
Query: 182 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 241
           |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 875 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 816

                                                                       
Query: 242 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 301
           ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 815 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 756

                         
Query: 302 cccagacgggtggc 315
           ||||||||||||||
Sbjct: 755 cccagacgggtggc 742



 Score =  113 bits (57), Expect = 5e-22
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||||||||||||  | ||||| ||||||||||||||||| || || |||||||| ||||
Sbjct: 712 ggatggtctcaaaactgcccttgtgcttctccctgttcttaattactccaacacgaccag 653

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| | ||| ||  | ||||| ||||| ||||| || ||||||||||||||||||||||
Sbjct: 652 tgttcctccctcctgtgaccataacgacattgcccacatcaaacttgatgaagtcaacaa 593

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 592 tcttgttg 585

---

>gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete sequence
          Length = 128856

 Score =  119 bits (60), Expect = 9e-24
 Identities = 174/213 (81%)
 Strand = Plus / Minus

                                                                         
Query: 190   ctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgatacccttgcc 249
             ||||||||| ||| ||||||||||    ||||||||||  || |  || |||||||| ||
Sbjct: 83725 ctgagctgcagcagccctcttcctagcttcctcaatgacagttaatttaatacccttacc 83666

                                                                         
Query: 250   cttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttgcccagacg 309
             |||||| ||    ||||| ||||| || ||||||||||| |||||||| ||| |||||||
Sbjct: 83665 cttgggaagagatacccatggctttgtccccttgccaatagtgaacacattgaccagacg 83606

                                                                         
Query: 310   ggtggcaaactggngaccctgggcatnctcaacgnggatggtctcaaaggttcccttatg 369
              || |||||||   ||||   ||||| || |||| |||| ||||||||||||||||||||
Sbjct: 83605 agttgcaaactcatgaccagtggcatcctgaacgtggattgtctcaaaggttcccttatg 83546

                                              
Query: 370   cttctccctgttcttgatcacaccaacacgccc 402
             ||| || |||||||||||||| |||||||||||
Sbjct: 83545 cttttctctgttcttgatcactccaacacgccc 83513

---

>emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZB04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score =  111 bits (56), Expect = 2e-21
 Identities = 109/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||||||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 623 ggattgtctcaaaggttcccttatgcttttcacggttcttaatcacacccacacgccctc 564

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 563 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 504

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 503 tcttgtt 497

---

>ref|NM_001036769.1| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.2 mRNA, complete cds
          Length = 1174

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 737 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 678

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 677 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 618

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 617 tcttgtt 611



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 864 tcctcaatgatggtcagcttaatacctttgccctt 830

---

>ref|NM_120791.2| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.1 mRNA, complete cds
          Length = 1088

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 652 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 593

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 592 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 533

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 532 tcttgtt 526



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745

---

>gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 820

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 625 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 566

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 565 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 506

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 505 tcttgtt 499



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718

---

>gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 1059

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 649 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 590

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 589 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 530

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 529 tcttgtt 523



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742

---

>emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, BAC clone T28J14 (ESSA
            project)
          Length = 104607

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                        
Query: 345  ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
            |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 7894 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 7835

                                                                        
Query: 405  tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
            |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 7834 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 7775

                   
Query: 465  tcttgtt 471
            |||||||
Sbjct: 7774 tcttgtt 7768



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 218  tcctcaatgatggtgagcttgatacccttgccctt 252
            |||||||||||||| ||||| ||||| ||||||||
Sbjct: 8021 tcctcaatgatggtcagcttaatacctttgccctt 7987

---

>gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 789

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 625 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 566

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 565 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 506

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 505 tcttgtt 499



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718

---

>gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 1008

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 649 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 590

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 589 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 530

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 529 tcttgtt 523



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742

---

>emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH32ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1168

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Plus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 356 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 415

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 416 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 475

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 476 tcttgtt 482



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 229 tcctcaatgatggtcagcttaatacctttgccctt 263

---

>emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZG07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 976

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 619 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 560

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 559 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 500

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 499 tcttgtt 493



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 746 tcctcaatgatggtcagcttaatacctttgccctt 712

---

>emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZD04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 942

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 623 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 564

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 563 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 504

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 503 tcttgtt 497



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 750 tcctcaatgatggtcagcttaatacctttgccctt 716

---

>emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZC05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 952

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 612 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 553

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 552 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 493

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 492 tcttgtt 486



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 739 tcctcaatgatggtcagcttaatacctttgccctt 705

---

>gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete sequence
          Length = 1011

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 652 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 593

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 592 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 533

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 532 tcttgtt 526



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 218 tcctcaatgatggtgagcttgatacccttgccctt 252
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745

---

>dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9
          Length = 86380

 Score =  103 bits (52), Expect = 5e-19
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                         
Query: 345   ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
             |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 82617 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccctc 82558

                                                                         
Query: 405   tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
             |||| |  || ||| ||||||| || ||||| || ||||||||||||||||| |||||||
Sbjct: 82557 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaacaa 82498

                    
Query: 465   tcttgtt 471
             |||||||
Sbjct: 82497 tcttgtt 82491



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 218   tcctcaatgatggtgagcttgatacccttgccctt 252
             |||||||||||||| ||||| ||||| ||||||||
Sbjct: 82744 tcctcaatgatggtcagcttaatacctttgccctt 82710

---

>gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, complete cds
          Length = 1054

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 350 gtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttg 409
           ||||||||| | ||||||||||||||||||||||||||||| |||||||||||  |||| 
Sbjct: 717 gtctcaaagctacccttatgcttctccctgttcttgatcactccaacacgccccctgttt 658

                                                                       
Query: 410 cgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttg 469
           | ||||||  | ||||| || || || || || ||||| ||||| || ||||||||||||
Sbjct: 657 ctcccacctgttaccataactacattcccaacatcaaatttgataaaatcaacaatcttg 598

             
Query: 470 tt 471
           ||
Sbjct: 597 tt 596



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 269 ggcttggtgcccttgccaatggtgaacacgttgccca 305
           ||||| |||||||||||||| |||||||| |||||||
Sbjct: 798 ggctttgtgcccttgccaatagtgaacacattgccca 762

---

>dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, complete cds
          Length = 1105

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 202/255 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           ||||||||||||||| |  |||||||||||||||||||| ||   |||||| ||||| ||
Sbjct: 840 ctcctcaatgatggttaatttgatacccttgcccttgggaagagacacccatggctttgt 781

                                                                       
Query: 277 gcccttgccaatggtgaacacgttgcccagacgggtggcaaactggngaccctgggcatn 336
            || || || ||||| || || ||||| ||||| || ||||||| | ||||  ||| || 
Sbjct: 780 accttttccgatggtaaaaacattgcctagacgagtagcaaactcgtgaccaagggaatc 721

                                                                       
Query: 337 ctcaacgnggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaac 396
           || || | | |  ||||| ||| | |||||||| ||||||||||||||||| || |||||
Sbjct: 720 ctgaatgtgaacagtctcgaagctccccttatgtttctccctgttcttgataactccaac 661

                                                                       
Query: 397 acgcccagtgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaa 456
            |||||||| || | ||| ||| |||||||||| || || || || || ||||| |||||
Sbjct: 660 tcgcccagtattcctccccccagtcaccatgacaacatttccaacatcgaacttaatgaa 601

                          
Query: 457 gtcaacaatcttgtt 471
            ||| | ||||||||
Sbjct: 600 atcagctatcttgtt 586

---

>emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal protein S4
          Length = 966

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 165/206 (80%)
 Strand = Plus / Minus

                                                                       
Query: 263 acccaaggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactgg 322
           ||||| ||||| || ||||| ||||  |||||||| || |||| ||| || ||||| |  
Sbjct: 756 acccacggcttagtacccttaccaagagtgaacacatttcccaaacgtgtagcaaattca 697

                                                                       
Query: 323 ngaccctgggcatnctcaacgnggatggtctcaaaggttcccttatgcttctccctgttc 382
            ||||||| | || || || | ||| |||||||||| | |||||||||||||||||||||
Sbjct: 696 tgaccctgtgaatcctgaatgtggagggtctcaaagctacccttatgcttctccctgttc 637

                                                                       
Query: 383 ttgatcacaccaacacgcccagtgttgcgcccaccantcaccatgacgacgttgccgacg 442
           || || |||||||| || ||  |||| |  || ||| ||||||| || || || || |||
Sbjct: 636 ttaataacaccaactcgtcccctgtttctacctccagtcaccatcacaacattcccaacg 577

                                     
Query: 443 tcaaacttgatgaagtcaacaatctt 468
           |||||||||||||| |||||||||||
Sbjct: 576 tcaaacttgatgaaatcaacaatctt 551

---

>gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal protein S4-like
           protein mRNA, complete cds
          Length = 1052

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 349 ggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgtt 408
           |||||||||| | ||||||||||||||||||||||| || |||||||| || ||  ||||
Sbjct: 653 ggtctcaaagctacccttatgcttctccctgttcttaataacaccaactcgtcccctgtt 594

                                                                       
Query: 409 gcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatctt 468
            |  || ||| ||||||| || || || || ||||||||||||||||| |||||||||||
Sbjct: 593 tctacctccagtcaccatcacaacattcccaacgtcaaacttgatgaaatcaacaatctt 534

---

>emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 934

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||| | |||||||||||||||| | |||||  |||||||| ||||||||  
Sbjct: 623 ggattgtctcaacgcttcccttatgcttctcacggttctgaatcacacccacacgcccgc 564

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| ||||||| || ||||| || ||||||||||| ||||| |||||||
Sbjct: 563 tgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttcatgaactcaacaa 504

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 503 tcttgtt 497

---

>ref|NM_125228.3| Arabidopsis thaliana structural constituent of ribosome AT5G58420
           mRNA, complete cds
          Length = 1080

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 718 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 659

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 658 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgacaa 599

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 598 tcttgttg 591



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 846 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 787

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 786 tcctttgccaatggtgtacac 766

---

>gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, complete cds
          Length = 789

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 625 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 566

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 565 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgacaa 506

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 505 tcttgttg 498



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 753 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 694

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 693 tcctttgccaatggtgtacac 673

---

>gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 995

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 698 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 639

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 638 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgacaa 579

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 578 tcttgttg 571



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 766 tcctttgccaatggtgtacac 746

---

>gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 1005

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 709 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 650

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 649 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgacaa 590

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 589 tcttgttg 582



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 837 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 778

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 777 tcctttgccaatggtgtacac 757

---

>emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 978

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 719 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 660

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 659 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgacaa 600

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 599 tcttgttg 592



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 847 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 788

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 787 tcctttgccaatggtgtacac 767

---

>emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZH10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 537

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 238 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 179

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 178 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgacaa 119

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 118 tcttgttg 111



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 366 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 307

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 306 tcctttgccaatggtgtacac 286

---

>emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZD03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 988

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 689 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 630

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 629 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgacaa 570

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 569 tcttgttg 562



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 817 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 758

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 757 tcctttgccaatggtgtacac 737

---

>emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB61ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 737

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 438 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 379

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 378 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgacaa 319

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 318 tcttgttg 311



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 566 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 507

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 506 tcctttgccaatggtgtacac 486

---

>emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB12ZD07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 566

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 267 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 208

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 207 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgacaa 148

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 147 tcttgttg 140



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 395 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 336

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 335 tcctttgccaatggtgtacac 315

---

>emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZG11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 997

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 698 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 639

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 638 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgacaa 579

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 578 tcttgttg 571



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 766 tcctttgccaatggtgtacac 746

---

>gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete sequence
          Length = 1010

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 713 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 654

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 653 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactccacaa 594

                   
Query: 465 tcttgttg 472
           ||||||||
Sbjct: 593 tcttgttg 586



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 841 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 782

                                
Query: 277 gcccttgccaatggtgaacac 297
            || |||||||||||| ||||
Sbjct: 781 tcctttgccaatggtgtacac 761

---

>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2
          Length = 51440

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                        
Query: 345  ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
            |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||  
Sbjct: 6770 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccctc 6711

                                                                        
Query: 405  tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
            |||| |  || ||  | ||||| || || ||||| || |||||||||||||| || ||||
Sbjct: 6710 tgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgacaa 6651

                    
Query: 465  tcttgttg 472
            ||||||||
Sbjct: 6650 tcttgttg 6643



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                        
Query: 217  ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 276
            |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 6898 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 6839

                                 
Query: 277  gcccttgccaatggtgaacac 297
             || |||||||||||| ||||
Sbjct: 6838 tcctttgccaatggtgtacac 6818

---

>emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL68ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 984

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           |||| ||||||| | ||||||||||||| || | |||||| |||||||| ||||||||  
Sbjct: 623 ggattgtctcaaggcttcccttatgcttttcacggttcttaatcacacccacacgccctc 564

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||  ||||||| || ||||| || ||||||||||||||||| || ||||
Sbjct: 563 tgtttctgcctccggtcaccatcacaacgttacccacgtcaaacttgatgaactcgacaa 504

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 503 tcttgtt 497

---

>emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal protein small subunit 4e
          Length = 1090

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 104/126 (82%)
 Strand = Plus / Minus

                                                                       
Query: 347 atggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagtg 406
           |||||||||||| | |||||||||||||||||||| || || || |||||||| ||  ||
Sbjct: 678 atggtctcaaagctacccttatgcttctccctgtttttaattactccaacacgacctctg 619

                                                                       
Query: 407 ttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatc 466
           || |  || ||  | |||||||| || || || ||||||||||||||||| || ||||||
Sbjct: 618 ttccttcctccggtgaccatgacaacattcccaacgtcaaacttgatgaaatcgacaatc 559

                 
Query: 467 ttgttg 472
           ||||||
Sbjct: 558 ttgttg 553

---

>ref|NM_127291.2| Arabidopsis thaliana structural constituent of ribosome AT2G17360
           mRNA, complete cds
          Length = 1074

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||  
Sbjct: 738 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccctc 679

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| | ||||| || |||||||| || |||||||| ||||| || ||||
Sbjct: 678 tgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccacaa 619

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 618 tcttgtt 612

---

>gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360)
           mRNA, complete cds
          Length = 817

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||  
Sbjct: 625 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccctc 566

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| | ||||| || |||||||| || |||||||| ||||| || ||||
Sbjct: 565 tgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccacaa 506

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 505 tcttgtt 499

---

>gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360)
           mRNA, complete cds
          Length = 1032

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||  
Sbjct: 697 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccctc 638

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| | ||||| || |||||||| || |||||||| ||||| || ||||
Sbjct: 637 tgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccacaa 578

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 577 tcttgtt 571

---

>gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 813

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||  
Sbjct: 625 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccctc 566

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| | ||||| || |||||||| || |||||||| ||||| || ||||
Sbjct: 565 tgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccacaa 506

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 505 tcttgtt 499

---

>gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 1034

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||  
Sbjct: 698 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccctc 639

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| | ||||| || |||||||| || |||||||| ||||| || ||||
Sbjct: 638 tgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccacaa 579

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 578 tcttgtt 572

---

>emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH41ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1000

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||  
Sbjct: 683 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccctc 624

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| | ||||| || |||||||| || |||||||| ||||| || ||||
Sbjct: 623 tgtttcttcctccagttaccataactacgttgcccacatcaaacttaatgaactccacaa 564

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 563 tcttgtt 557

---

>emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZB04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1007

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||  
Sbjct: 690 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccctc 631

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| | ||||| || |||||||| || |||||||| ||||| || ||||
Sbjct: 630 tgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccacaa 571

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 570 tcttgtt 564

---

>gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete sequence
          Length = 1023

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 345 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||  
Sbjct: 738 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccctc 679

                                                                       
Query: 405 tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
           |||| |  || ||| | ||||| || |||||||| || |||||||| ||||| || ||||
Sbjct: 678 tgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccacaa 619

                  
Query: 465 tcttgtt 471
           |||||||
Sbjct: 618 tcttgtt 612

---

>gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II section 100 of 255 of the complete
             sequence. Sequence from clones T23A1, F5J6, MJB20
          Length = 76170

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                         
Query: 345   ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccag 404
             ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||  
Sbjct: 48794 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccctc 48735

                                                                         
Query: 405   tgttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaa 464
             |||| |  || ||| | ||||| || |||||||| || |||||||| ||||| || ||||
Sbjct: 48734 tgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccacaa 48675

                    
Query: 465   tcttgtt 471
             |||||||
Sbjct: 48674 tcttgtt 48668

---

>gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence
          Length = 1292

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 97/119 (81%)
 Strand = Plus / Minus

                                                                       
Query: 350 gtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttg 409
           ||||||||| | ||||| ||||||||||||||||| |  |  |||||||| ||  |||| 
Sbjct: 700 gtctcaaagctacccttgtgcttctccctgttcttaagaattccaacacgtcccctgttt 641

                                                                      
Query: 410 cgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatctt 468
           |  |||||| ||| ||| || || || || || ||||||||||||||||||||||||||
Sbjct: 640 ctaccaccagtcaacataaccacattaccaacatcaaacttgatgaagtcaacaatctt 582

---

>emb|BX818793.1|CNS0A8YY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 966

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 102/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 346 gatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagt 405
           |||||| |||||| | ||||| |  ||||| | |||||| |||||||||||||||||  |
Sbjct: 689 gatggtttcaaagctacccttgtttttctcacggttcttaatcacaccaacacgccctct 630

                                                                       
Query: 406 gttgcgcccaccantcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaat 465
           ||| |  || ||| | ||||| || |||||||| || |||||||| ||||| || |||||
Sbjct: 629 gtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccacaat 570

                 
Query: 466 cttgtt 471
           ||||||
Sbjct: 569 cttgtt 564

---

>gb|AY110862.1| Zea mays CL1882_8 mRNA sequence
          Length = 728

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 341 acgnggatggtctcaaaggttcccttatgcttctccctgttcttgatcac 390
           ||| |||||||||| ||| | ||||| |||||||||||||||||||||||
Sbjct: 491 acgtggatggtctcgaagctgcccttgtgcttctccctgttcttgatcac 442



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 370 cttctccctgttcttgatcacaccaacacgcccagtgtt 408
           ||||||||||||||||||||| || |||||||| |||||
Sbjct: 429 cttctccctgttcttgatcactcctacacgcccggtgtt 391

---

>ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein
           (FG08714.1) partial mRNA
          Length = 732

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 384 tgatcacaccaacacgcccagtgttgcgcccaccantcaccatgacgacgttgccgacgt 443
           |||| ||||||||||| ||  ||||||| |||||| | ||||||||||||  ||||  ||
Sbjct: 532 tgatgacaccaacacgacccatgttgcgaccaccagtgaccatgacgacggcgccggtgt 473

                           
Query: 444 caaacttgatgaagtc 459
           | ||||||||||||||
Sbjct: 472 cgaacttgatgaagtc 457



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 216 gctcctcaatgatggtgagcttgatacccttgcccttggg 255
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658

---

>ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
           (MG02747.4) partial mRNA
          Length = 735

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 216 gctcctcaatgatggtgagcttgatacccttgcccttggg 255
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658

---

>gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-like protein mRNA,
           complete cds
          Length = 1024

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 216 gctcctcaatgatggtgagcttgatacccttgcccttggg 255
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 766 gctcctcagcgatggtgagcttgacacccttgcccttggg 727

---

>gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA
          Length = 992

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 269 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 767

---

>ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG11276-RA, transcript
           variant A (RpS4), mRNA
          Length = 983

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 269 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 767

---

>ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG11276-RB, transcript
           variant B (RpS4), mRNA
          Length = 969

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 269 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 799 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 753

---

>gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 207761

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 269    ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
              |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 141932 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 141886

---

>dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJG14
          Length = 86121

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 52/59 (88%), Gaps = 1/59 (1%)
 Strand = Plus / Plus

                                                                        
Query: 345   ggatggtctcaaaggttcccttatgcttctcc-ctgttcttgatcacaccaacacgccc 402
             |||||||||||||| ||||||| || || | | | ||||||||||||||||||||||||
Sbjct: 15625 ggatggtctcaaagcttcccttttgttttttcacggttcttgatcacaccaacacgccc 15683

---

>gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46 of 83 of the complete
              sequence
          Length = 272016

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 269    ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
              |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 169866 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 169820

---

>dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribosomal protein S4,
           complete cds
          Length = 870

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 269 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 713 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 667

---

>gb|BT018605.1| Zea mays clone EL01N0450E04.d mRNA sequence
          Length = 1698

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 420  tcaccatgacgacgttgccgacgtcaaact 449
            |||||||||| |||||||||||||||||||
Sbjct: 1355 tcaccatgaccacgttgccgacgtcaaact 1326

---

>ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predicted mRNA
          Length = 783

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 227 atggtgagcttgatacccttgcccttggg 255
           |||| ||||||||||||||||||||||||
Sbjct: 743 atggagagcttgatacccttgcccttggg 715

---

>gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 (RPS7) mRNA, complete cds
          Length = 852

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 227 atggtgagcttgatacccttgcccttggg 255
           |||| ||||||||||||||||||||||||
Sbjct: 745 atggagagcttgatacccttgcccttggg 717

---

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 227     atggtgagcttgatacccttgcccttggg 255
               |||| ||||||||||||||||||||||||
Sbjct: 1601891 atggagagcttgatacccttgcccttggg 1601919

---

>ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus similar to CG11276-PA,
           isoform A (LOC583495), partial mRNA
          Length = 285

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 293 aacacgttgcccagacgggtggca 316
           ||||||||||||||||||||||||
Sbjct: 179 aacacgttgcccagacgggtggca 156

---

>gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putative ribosomal
           protein S4e mRNA, complete cds
          Length = 792

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 269 ggcttggtgcccttgccaatggtgaacacgtt 300
           ||||||||||||||||||||| |||| |||||
Sbjct: 701 ggcttggtgcccttgccaatgatgaagacgtt 670

---

>ref|XM_775416.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal
           protein S4, X isoform (LOC574997), mRNA
          Length = 825

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 301
           ||||||||||||||||||   ||  | | |||| || ||||||| |||  ||||||||||
Sbjct: 770 cccttgcccttggggagggagacgtaggccttgttggccttgccgatgacgaacacgttg 711

                          
Query: 302 cccagacgggtggca 316
           || ||||||||||||
Sbjct: 710 ccaagacgggtggca 696

---

>emb|BX067601.1|CNS09OBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 271 cttggtgcccttgccaatggtgaacacgtt 300
           |||||||| |||||| ||||||||||||||
Sbjct: 282 cttggtgctcttgccgatggtgaacacgtt 311

---

>emb|BX067600.1|CNS09OBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 271 cttggtgcccttgccaatggtgaacacgtt 300
           |||||||| |||||| ||||||||||||||
Sbjct: 712 cttggtgctcttgccgatggtgaacacgtt 683

---

>gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gene, partial cds
          Length = 416

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 61  ggttcgcaaatcaacaaacatcaggc 86
           |||||||||||| |||||||||||||
Sbjct: 88  ggttcgcaaatcgacaaacatcaggc 113

---

>gb|AY439895.1| Armigeres subalbatus ASAP ID: 38941 cytosolic small ribosomal
           subunit S4 mRNA sequence
          Length = 960

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| ||||||| ||| ||||||||||   ||||||||||||
Sbjct: 729 cttggtggccttgccgatgatgaacacgttagtcagacgggtggc 685

---

>gb|AY433736.1| Aedes aegypti ASAP ID: 34407 cytosolic small ribosomal subunit S4
           mRNA sequence
          Length = 755

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 444 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 400

---

>gb|DQ440018.1| Aedes aegypti clone AE-221 40S ribosomal protein S4 mRNA, complete
           cds
          Length = 789

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 699 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 655

---

>gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosome 13, complete sequence
          Length = 149455

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 249    ccttggggaggctcacccaag 269
              |||||||||||||||||||||
Sbjct: 134897 ccttggggaggctcacccaag 134877

---

>ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4794.2), mRNA
          Length = 720

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 227 atggtgagcttgatacccttgcccttggg 255
           |||| |||||||| |||||||||||||||
Sbjct: 674 atggagagcttgacacccttgcccttggg 646

---

>ref|XM_749829.1| Aspergillus fumigatus Af293 cytosolic small ribosomal subunit S4
           (Afu3g06840) partial mRNA
          Length = 786

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 227 atggtgagcttgatacccttgcccttggg 255
           ||||||||||| | |||||||||||||||
Sbjct: 740 atggtgagcttaacacccttgcccttggg 712

---

>emb|CR938551.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YI07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 747

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 721 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 677

---

>emb|CR938407.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YA05AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 806

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 720 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 676

---

>emb|CR938406.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YA05BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 605

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 296 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 340

---

>emb|CR938380.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YB03AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 808

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 722 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 678

---

>emb|CR938366.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YB15AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 810

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 271 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 315
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 723 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 679

---

>gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete sequence
          Length = 124792

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 371    ttctccctgttcttgatcaca 391
              |||||||||||||||||||||
Sbjct: 120862 ttctccctgttcttgatcaca 120842

---

>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020
          Length = 1824958

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 235    cttgatacccttgcccttggggagg 259
              ||||| |||||||||||||||||||
Sbjct: 775952 cttgacacccttgcccttggggagg 775976

---

>gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:92076 IMAGE:7046733), complete cds
          Length = 888

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 262 cacccaaggcttggtgcccttgccaatg 289
           |||||| |||||| ||||||||||||||
Sbjct: 715 cacccatggcttgttgcccttgccaatg 688

---

>ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1), mRNA
          Length = 2945

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 283  gccaatggtgaacacgttgc 302
            ||||||||||||||||||||
Sbjct: 1770 gccaatggtgaacacgttgc 1789

---

>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
               sequence
          Length = 2300533

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 232     gagcttgatacccttgcccttggg 255
               |||||||| |||||||||||||||
Sbjct: 1677741 gagcttgacacccttgcccttggg 1677718

---

>gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, complete sequence
          Length = 197827

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 208   cttcctctgctcctcaatga 227
             ||||||||||||||||||||
Sbjct: 23788 cttcctctgctcctcaatga 23769

---

>gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence
          Length = 160031

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 203   tccctcttcctctgctcctc 222
             ||||||||||||||||||||
Sbjct: 75373 tccctcttcctctgctcctc 75392

---

>gb|AF359361.3| Gibberella zeae strain GZ3639 trichothecene gene cluster, complete
             sequence
          Length = 57840

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 391   accaacacgcccagtgttgc 410
             ||||||||||||||||||||
Sbjct: 18319 accaacacgcccagtgttgc 18300

---

>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence
          Length = 243671

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    ggttccaggaacatagttct 122
              ||||||||||||||||||||
Sbjct: 192051 ggttccaggaacatagttct 192032

---

>ref|XM_383708.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG03532.1)
           partial mRNA
          Length = 1338

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 accaacacgcccagtgttgc 410
           ||||||||||||||||||||
Sbjct: 574 accaacacgcccagtgttgc 593

---

>ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNA06200) partial mRNA
          Length = 840

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 232 gagcttgatacccttgcccttggg 255
           |||||||| |||||||||||||||
Sbjct: 738 gagcttgacacccttgcccttggg 715

---

>gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome 18, complete sequence
          Length = 156239

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   ctcttcctctgctcctcaat 225
             ||||||||||||||||||||
Sbjct: 47354 ctcttcctctgctcctcaat 47335

---

>ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (rps4x), mRNA
          Length = 888

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 262 cacccaaggcttggtgcccttgccaatg 289
           |||||| |||||| ||||||||||||||
Sbjct: 715 cacccatggcttgttgcccttgccaatg 688

---

>gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRNA (cDNA clone
           MGC:34152 IMAGE:5198480), complete cds
          Length = 1554

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 169 gaatcaggccttggcagcagcctg 192
           |||||||||||||||||| |||||
Sbjct: 421 gaatcaggccttggcagccgcctg 398

---

>emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227D1 on chromosome X Contains
             part of the IL1RAPL2 gene for interleukin 1 receptor
             accessory protein-like 2, complete sequence
          Length = 33667

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 355   aaaggttcccttatgcttct 374
             ||||||||||||||||||||
Sbjct: 13597 aaaggttcccttatgcttct 13578

---

>emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chromosome 10 Contains the
             ALOX5 gene for arachidonate 5-lipoxygenase, a novel gene,
             the 3' end of a gene for cellular modulator of immune
             recognition (c-MIR) and five CpG islands, complete
             sequence
          Length = 129266

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 119   ttctatatccttgcagataactgg 142
             |||||||||||| |||||||||||
Sbjct: 81474 ttctatatccttacagataactgg 81451

---

>ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predicted mRNA
          Length = 1485

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 208  cttcctctgctcctcaatga 227
            ||||||||||||||||||||
Sbjct: 1026 cttcctctgctcctcaatga 1007

---

>ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC581083 (LOC581083), mRNA
          Length = 1197

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 203 tccctcttcctctgctcctc 222
           ||||||||||||||||||||
Sbjct: 764 tccctcttcctctgctcctc 745

---

>emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clone 1a13
          Length = 2945

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 283  gccaatggtgaacacgttgc 302
            ||||||||||||||||||||
Sbjct: 1770 gccaatggtgaacacgttgc 1789

---

>emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 in linkage group 10,
             complete sequence
          Length = 210640

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   tcttcctctgctcctcaatg 226
             ||||||||||||||||||||
Sbjct: 25208 tcttcctctgctcctcaatg 25189

---

>gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, complete sequence
          Length = 175223

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 91     cttaaaaaagatggttccag 110
              ||||||||||||||||||||
Sbjct: 158366 cttaaaaaagatggttccag 158385

---

>gb|AF336366.2| Gibberella zeae H-11 trichothecene biosynthesis gene cluster,
           complete sequence
          Length = 27022

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 accaacacgcccagtgttgc 410
           ||||||||||||||||||||
Sbjct: 772 accaacacgcccagtgttgc 753

---

>gb|AC007437.16| Homo sapiens 12q22 BAC RPCI11-541G9 (Roswell Park Cancer Institute
             Human BAC Library) complete sequence
          Length = 179854

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 254   gggaggctcacccaaggcttggtg 277
             |||||||||||||||| |||||||
Sbjct: 12827 gggaggctcacccaagccttggtg 12850

---

>gb|AC007656.2| Homo sapiens 12q22 BAC RPCI11-534P6 (Rowswell Park Cancer Institute Human
              BAC Library) complete sequence
          Length = 171236

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 254    gggaggctcacccaaggcttggtg 277
              |||||||||||||||| |||||||
Sbjct: 157441 gggaggctcacccaagccttggtg 157464

---

>gb|AY857461.1| Suberites domuncula S4 mRNA, complete cds
          Length = 786

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 422 accatgacgacgttgccgacgtcaaacttgat 453
           |||||||||| ||||||||  |||||||||||
Sbjct: 548 accatgacgaggttgccgatatcaaacttgat 517

---

>dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21, map 22, complete
              sequences
          Length = 203521

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    tagttctatatccttgcaga 135
              ||||||||||||||||||||
Sbjct: 130844 tagttctatatccttgcaga 130825

---

>emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1078H9 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 228097

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   ctcttcctctgctcctcaat 225
             ||||||||||||||||||||
Sbjct: 63018 ctcttcctctgctcctcaat 62999

---

>gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein (protease nexin-II,
              Alzheimer disease) (APP) gene, complete cds
          Length = 293960

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 116    tagttctatatccttgcaga 135
              ||||||||||||||||||||
Sbjct: 254416 tagttctatatccttgcaga 254435

---

>gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosome 18, complete
             sequence
          Length = 205253

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   ctcttcctctgctcctcaat 225
             ||||||||||||||||||||
Sbjct: 62232 ctcttcctctgctcctcaat 62251

---

>dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, section 38/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    tagttctatatccttgcaga 135
              ||||||||||||||||||||
Sbjct: 325187 tagttctatatccttgcaga 325168

---

>gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, complete sequence
          Length = 113482

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   ggttccaggaacatagttct 122
             ||||||||||||||||||||
Sbjct: 64196 ggttccaggaacatagttct 64177

---

>gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, complete sequence
          Length = 150428

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 208    cttcctctgctcctcaatga 227
              ||||||||||||||||||||
Sbjct: 147440 cttcctctgctcctcaatga 147421

---

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 208     cttcctctgctcctcaatga 227
               ||||||||||||||||||||
Sbjct: 2525910 cttcctctgctcctcaatga 2525929

---

>emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chromosome 7, complete
              sequence
          Length = 215366

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 246    tgcccttggggaggctcacc 265
              ||||||||||||||||||||
Sbjct: 213316 tgcccttggggaggctcacc 213297

---

>emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-661G16 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 162691

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   ctcttcctctgctcctcaat 225
             ||||||||||||||||||||
Sbjct: 27574 ctcttcctctgctcctcaat 27593

---

>dbj|AP000141.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL56-APP region, clone
             B2291C14-R44F3, segment 6/10, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   tagttctatatccttgcaga 135
             ||||||||||||||||||||
Sbjct: 24483 tagttctatatccttgcaga 24464

---

>dbj|D87675.1| Homo sapiens DNA for amyloid precursor protein, complete cds
          Length = 301692

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 116    tagttctatatccttgcaga 135
              ||||||||||||||||||||
Sbjct: 258129 tagttctatatccttgcaga 258148

---

>dbj|AP001442.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:T1715,
            LL56-APP region, complete sequence
          Length = 68001

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 116  tagttctatatccttgcaga 135
            ||||||||||||||||||||
Sbjct: 7611 tagttctatatccttgcaga 7592

---

>dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related, B2291C14-T1533 region,
              segment 5/7
          Length = 161014

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    tagttctatatccttgcaga 135
              ||||||||||||||||||||
Sbjct: 124483 tagttctatatccttgcaga 124464


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,901,439
Number of Sequences: 3902068
Number of extensions: 3901439
Number of successful extensions: 81462
Number of sequences better than 10.0: 138
Number of HSP's better than 10.0 without gapping: 138
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81045
Number of HSP's gapped (non-prelim): 396
length of query: 476
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 454
effective length of database: 17,147,199,772
effective search space: 7784828696488
effective search space used: 7784828696488
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---