ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags32m07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK061725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 490 e-135
2gb|AY105417.1| Zea mays PCO109699 mRNA sequence 470 e-129
3ref|XM_481630.1| Oryza sativa (japonica cultivar-group), mRNA 466 e-128
4ref|XM_507578.1| PREDICTED Oryza sativa (japonica cultivar-group... 466 e-128
5ref|XM_507194.2| PREDICTED Oryza sativa (japonica cultivar-group... 466 e-128
6dbj|AK121204.1| Oryza sativa (japonica cultivar-group) cDNA clon... 466 e-128
7dbj|AK062210.1| Oryza sativa (japonica cultivar-group) cDNA clon... 466 e-128
8dbj|D12631.1|RICRPL7AB Oryza sativa (japonica cultivar-group) mR... 466 e-128
9dbj|AK098843.1| Oryza sativa (japonica cultivar-group) cDNA clon... 450 e-123
10gb|BT018084.1| Zea mays clone EL01N0552B03.c mRNA sequence 418 e-114
11gb|AY103834.1| Zea mays PCO109701 mRNA sequence 418 e-114
12gb|BT016736.1| Zea mays clone Contig569 mRNA sequence 387 e-104
13ref|XM_463662.1| Oryza sativa (japonica cultivar-group), predic... 301 1e-78
14gb|AY086353.1| Arabidopsis thaliana clone 24272 mRNA, complete s... 234 2e-58
15emb|BX824662.1|CNS0A4TO Arabidopsis thaliana Full-length cDNA Co... 226 5e-56
16ref|NM_116152.2| Arabidopsis thaliana structural constituent of ... 218 1e-53
17gb|AY114667.1| Arabidopsis thaliana 60S ribosomal protein L7A pr... 218 1e-53
18gb|AY062758.1| Arabidopsis thaliana 60S RIBOSOMAL PROTEIN L7A pr... 218 1e-53
19gb|AY060519.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, co... 218 1e-53
20gb|AY052264.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, co... 218 1e-53
21emb|BX825094.1|CNS0A7RE Arabidopsis thaliana Full-length cDNA Co... 218 1e-53
22emb|BX823982.1|CNS0A6PP Arabidopsis thaliana Full-length cDNA Co... 218 1e-53
23ref|NM_130329.2| Arabidopsis thaliana structural constituent of ... 214 2e-52
24gb|AY052674.1| Arabidopsis thaliana At2g47610/T30B22.8 mRNA, com... 214 2e-52
25gb|AF385719.1|AF385719 Arabidopsis thaliana At2g47610/T30B22.8 m... 214 2e-52
26emb|BX821062.1|CNS0A8OD Arabidopsis thaliana Full-length cDNA Co... 214 2e-52
27gb|AY088386.1| Arabidopsis thaliana clone 6394 mRNA, complete se... 214 2e-52
28gb|BT000500.1| Arabidopsis thaliana 60S ribosomal protein L7A (... 212 8e-52
29emb|BX824178.1|CNS0A6S9 Arabidopsis thaliana Full-length cDNA Co... 210 3e-51
30emb|BX822281.1|CNS0A71I Arabidopsis thaliana Full-length cDNA Co... 210 3e-51
31emb|BX819217.1|CNS0A8T4 Arabidopsis thaliana Full-length cDNA Co... 206 5e-50
32emb|BX824325.1|CNS0A7R8 Arabidopsis thaliana Full-length cDNA Co... 202 8e-49
33emb|BX842094.1|CNS09Y94 Arabidopsis thaliana Full-length cDNA Co... 198 1e-47
34emb|BX842006.1|CNS09Y9Z Arabidopsis thaliana Full-length cDNA Co... 198 1e-47
35gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome ... 167 4e-38
36dbj|AK220651.1| Arabidopsis thaliana mRNA for 60S ribosomal prot... 167 4e-38
37dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 167 4e-38
38dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 147 4e-32
39dbj|AP004637.3| Oryza sativa (japonica cultivar-group) genomic D... 147 4e-32
40dbj|AP003884.2| Oryza sativa (japonica cultivar-group) genomic D... 147 4e-32
41emb|BX821934.1|CNS0A88T Arabidopsis thaliana Full-length cDNA Co... 145 2e-31
42gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 ma... 125 1e-25
43dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 125 1e-25
44dbj|AP004672.3| Oryza sativa (japonica cultivar-group) genomic D... 125 1e-25
45dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic D... 125 1e-25
46emb|AL162651.1|ATF26K9 Arabidopsis thaliana DNA chromosome 3, BA... 117 4e-23
47gb|DQ268850.1| Solanum tuberosum clone 155G10 60S ribosomal prot... 113 6e-22
48gb|BT014547.1| Lycopersicon esculentum clone 133964F, mRNA sequence 103 5e-19
49gb|AC155335.1| Brassica rapa subsp. pekinensis chromosome Cytoge... 94 5e-16
50gb|BC106480.1| Xenopus laevis cDNA clone IMAGE:7211162 90 8e-15
51gb|AY393839.1| Xenopus laevis ribosomal protein L7a mRNA, partia... 90 8e-15
52emb|BX821043.1|CNS0A8L9 Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
53gb|AC155339.1| Brassica rapa subsp. pekinensis chromosome Cytoge... 80 8e-12
54gb|AY496113.1| Capsicum annuum 60S ribosomal protein L7A mRNA, p... 76 1e-10
55gb|DQ241858.1| Solanum tuberosum clone 014F11 60S ribosomal prot... 74 5e-10
56gb|BC072834.1| Xenopus laevis MGC80199 protein, mRNA (cDNA clone... 62 2e-06
57gb|AY769275.1| Bombyx mori ribosomal protein L7A (RpL7A) mRNA, c... 58 3e-05
58ref|XM_846090.1| PREDICTED: Canis familiaris similar to 60S ribo... 54 4e-04
59emb|AM049005.1| Meladema coriacea mRNA for ribosomal protein L7A... 54 4e-04
60emb|BX825080.1|CNS0A6S2 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
61gb|AY924998.1| Seculamonas ecuadoriensis Rpl7A mRNA, partial cds 52 0.002
62gb|AY439881.1| Armigeres subalbatus ASAP ID: 38933 cytosolic lar... 50 0.007
63ref|XM_759559.1| Theileria parva strain Muguga 60S ribosomal pro... 50 0.007
64gb|AY925011.1| Trimastix pyriformis ATCC50562 Rpl7A gene, partia... 48 0.028
65gb|DQ118092.1| Trimastix pyriformis ribosomal protein L7A mRNA, ... 48 0.028
66emb|AL441963.7| Human DNA sequence from clone RP11-280O24 on chr... 48 0.028
67emb|AM049007.1| Scarabaeus laticollis mRNA for ribosomal protein... 48 0.028
68gb|AY924996.1| Malawimonas jakobiformis Rpl7A mRNA, partial cds 48 0.028
69gb|AF401560.1| Ictalurus punctatus ribosomal protein L7a mRNA, c... 48 0.028
70gb|AC022294.15| Homo sapiens 3 BAC RP11-4B14 (Roswell Park Cance... 48 0.028
71gb|AY239295.1| Homo sapiens proliferation-inducing protein 10 mR... 46 0.11
72gb|AY239294.1| Homo sapiens proliferation-inducing protein 9 mRN... 46 0.11
73gb|BC059533.1| Danio rerio ribosomal protein L7a, mRNA (cDNA clo... 46 0.11
74gb|AY389942.1| Protopterus dolloi ribosomal protein L7a-like mRN... 46 0.11
75gb|BC073802.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA cl... 46 0.11
76gb|BC023624.2| Homo sapiens ribosomal protein L7a, mRNA (cDNA cl... 46 0.11
77gb|BC023594.2| Homo sapiens ribosomal protein L7a, mRNA (cDNA cl... 46 0.11
78gb|BC021979.2| Homo sapiens ribosomal protein L7a, mRNA (cDNA cl... 46 0.11
79gb|BC105290.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA cl... 46 0.11
80ref|XM_535657.2| PREDICTED: Canis familiaris similar to 60S ribo... 46 0.11
81emb|X61923.1|HSSURF3 H.sapiens surf3 gene for ribosomal protein L7a 46 0.11
82gb|BC069215.1| Homo sapiens cDNA clone IMAGE:6375716, **** WARNI... 46 0.11
83gb|BC082978.1| Homo sapiens cDNA clone IMAGE:6579115, **** WARNI... 46 0.11
84gb|BC012174.2| Homo sapiens cDNA clone IMAGE:4643754, **** WARNI... 46 0.11
85ref|NG_000837.1| Homo sapiens surfeit locus (SURF@) on chromosome 9 46 0.11
86ref|NM_000972.2| Homo sapiens ribosomal protein L7a (RPL7A), mRNA 46 0.11
87emb|AL158826.23| Human DNA sequence from clone RP11-244N20 on ch... 46 0.11
88gb|BC005128.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA cl... 46 0.11
89emb|AJ224080.1|HSAJ4080 Homo sapiens rpL7a pseudogene, clone 10 46 0.11
90emb|CR626449.1| full-length cDNA clone CS0DI008YE21 of Placenta ... 46 0.11
91emb|CR626332.1| full-length cDNA clone CS0DI072YC01 of Placenta ... 46 0.11
92emb|CR625438.1| full-length cDNA clone CS0DF028YK01 of Fetal bra... 46 0.11
93emb|CR624133.1| full-length cDNA clone CS0DJ002YP23 of T cells (... 46 0.11
94emb|CR624123.1| full-length cDNA clone CS0DI068YF02 of Placenta ... 46 0.11
95emb|CR623324.1| full-length cDNA clone CL0BB020ZB03 of Neuroblas... 46 0.11
96emb|CR622399.1| full-length cDNA clone CS0DK005YH12 of HeLa cell... 46 0.11
97emb|CR621543.1| full-length cDNA clone CS0DF006YL14 of Fetal bra... 46 0.11
98emb|CR620132.1| full-length cDNA clone CS0DA002YB17 of Neuroblas... 46 0.11
99emb|CR620003.1| full-length cDNA clone CS0DI019YE20 of Placenta ... 46 0.11
100emb|CR619456.1| full-length cDNA clone CS0DJ008YK12 of T cells (... 46 0.11
101emb|CR618604.1| full-length cDNA clone CS0DC017YJ22 of Neuroblas... 46 0.11
102emb|CR618555.1| full-length cDNA clone CS0DI032YH07 of Placenta ... 46 0.11
103emb|CR618005.1| full-length cDNA clone CS0DJ012YM08 of T cells (... 46 0.11
104emb|CR617703.1| full-length cDNA clone CS0DC023YL20 of Neuroblas... 46 0.11
105emb|CR616252.1| full-length cDNA clone CS0DH002YO03 of T cells (... 46 0.11
106emb|CR612749.1| full-length cDNA clone CS0DI008YF18 of Placenta ... 46 0.11
107emb|CR612394.1| full-length cDNA clone CS0DA004YP13 of Neuroblas... 46 0.11
108emb|CR611385.1| full-length cDNA clone CS0DA004YA15 of Neuroblas... 46 0.11
109emb|CR611037.1| full-length cDNA clone CS0DF026YB01 of Fetal bra... 46 0.11
110emb|CR609256.1| full-length cDNA clone CS0DD001YK02 of Neuroblas... 46 0.11
111emb|CR608942.1| full-length cDNA clone CS0DA004YF01 of Neuroblas... 46 0.11
112emb|CR608873.1| full-length cDNA clone CS0DA002YH20 of Neuroblas... 46 0.11
113emb|CR608089.1| full-length cDNA clone CS0DI040YM16 of Placenta ... 46 0.11
114emb|CR607087.1| full-length cDNA clone CS0DE002YC01 of Placenta ... 46 0.11
115emb|CR605545.1| full-length cDNA clone CS0DE005YD07 of Placenta ... 46 0.11
116emb|CR605232.1| full-length cDNA clone CS0DI042YI01 of Placenta ... 46 0.11
117emb|CR602650.1| full-length cDNA clone CS0DF020YM12 of Fetal bra... 46 0.11
118emb|CR601819.1| full-length cDNA clone CS0DF011YI01 of Fetal bra... 46 0.11
119emb|CR601499.1| full-length cDNA clone CS0DI063YH20 of Placenta ... 46 0.11
120emb|CR600454.1| full-length cDNA clone CS0DH003YI02 of T cells (... 46 0.11
121emb|CR599403.1| full-length cDNA clone CL0BB016ZC01 of Neuroblas... 46 0.11
122emb|CR598739.1| full-length cDNA clone CS0DA006YH23 of Neuroblas... 46 0.11
123emb|CR596222.1| full-length cDNA clone CS0DK006YL18 of HeLa cell... 46 0.11
124emb|CR595948.1| full-length cDNA clone CS0DI064YJ09 of Placenta ... 46 0.11
125emb|CR594094.1| full-length cDNA clone CL0BB027ZC11 of Neuroblas... 46 0.11
126emb|CR593347.1| full-length cDNA clone CS0DI039YP05 of Placenta ... 46 0.11
127emb|CR593208.1| full-length cDNA clone CS0DE003YC07 of Placenta ... 46 0.11
128emb|CR592716.1| full-length cDNA clone CS0DI042YK12 of Placenta ... 46 0.11
129emb|CR592304.1| full-length cDNA clone CS0DA005YN22 of Neuroblas... 46 0.11
130emb|CR590883.1| full-length cDNA clone CS0DC024YJ24 of Neuroblas... 46 0.11
131emb|CR590295.1| full-length cDNA clone CS0DF023YB23 of Fetal bra... 46 0.11
132gb|AC044782.6| Homo sapiens chromosome 10 clone RP11-170M17, com... 46 0.11
133gb|AC069543.5| Homo sapiens chromosome 10 clone RP11-393H5, comp... 46 0.11
134ref|NG_003062.1| Homo sapiens ribosomal protein L7a pseudogene 1... 46 0.11
135dbj|AK222534.1| Homo sapiens mRNA for ribosomal protein L7a vari... 46 0.11
136ref|NM_200047.1| Danio rerio ribosomal protein L7a (rpl7a), mRNA 46 0.11
137gb|AY892190.1| Synthetic construct Homo sapiens clone FLH029846.... 46 0.11
138gb|AY889730.1| Synthetic construct Homo sapiens clone FLH029850.... 46 0.11
139emb|BX641050.1|HSM806744 Homo sapiens mRNA; cDNA DKFZp686J0697 (... 46 0.11
140gb|BC071900.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA cl... 46 0.11
141gb|BC071901.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA cl... 46 0.11
142gb|BC071352.1| Danio rerio ribosomal protein L7a, mRNA (cDNA clo... 46 0.11
143gb|BC021052.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA cl... 46 0.11
144gb|AC002107.1|AC002107 Genomic sequence from Human 9q34, complet... 46 0.11
145gb|M36072.1|HUMRPL7A Human ribosomal protein L7a (surf 3) large ... 46 0.11
146emb|X06705.1|HSPLAX Human PLA-X mRNA 46 0.11
147emb|X52138.1|HSL7A Human L7a gene for large ribosomal subunit co... 46 0.11
148dbj|AB056665.1| Homo sapiens RP-L7a mRNA for ribosomal protein L... 46 0.11
149gb|AY389941.1| Latimeria chalumnae ribosomal protein L7a-like mR... 44 0.43
150ref|XM_962142.1| PREDICTED: Tribolium castaneum similar to CG331... 44 0.43
151ref|XM_523914.1| PREDICTED: Pan troglodytes similar to ribosomal... 42 1.7
152ref|NM_196995.1| Oryza sativa (japonica cultivar-group) putative... 42 1.7
153ref|XM_848911.1| PREDICTED: Canis familiaris similar to 60S ribo... 42 1.7
154ref|XM_537800.2| PREDICTED: Canis familiaris Ribosomal protein L... 42 1.7
155gb|AC078893.10| Oryza sativa chromosome 10 BAC OSJNBb0044B19 gen... 42 1.7
156gb|AY857419.1| Suberites domuncula L7a mRNA, complete cds 42 1.7
157ref|XM_393034.2| PREDICTED: Apis mellifera similar to ribosomal ... 42 1.7
158dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
159gb|AY130409.1| Scyliorhinus canicula ribosomal protein L7A-like ... 42 1.7
160gb|AY130406.1| Branchiostoma lanceolatum ribosomal protein L7A-l... 42 1.7
161dbj|AK101853.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
162emb|AL138499.4|CNS01DWU Human chromosome 14 DNA sequence BAC R-1... 42 1.7
163gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.7
164gb|AC119240.11| Mus musculus chromosome 3, clone RP24-228K15, co... 40 6.7
165ref|XM_510379.1| PREDICTED: Pan troglodytes LOC453407 (LOC453407... 40 6.7
166ref|XM_507735.1| PREDICTED: Pan troglodytes similar to hypotheti... 40 6.7
167ref|XM_528454.1| PREDICTED: Pan troglodytes similar to ribosomal... 40 6.7
168ref|XM_517569.1| PREDICTED: Pan troglodytes similar to 60S ribos... 40 6.7
169gb|CP000114.1| Streptococcus agalactiae A909, complete genome 40 6.7
170gb|AC113454.8| Mus musculus chromosome 3, clone RP24-176I19, com... 40 6.7
171ref|XM_445858.1| Candida glabrata CBS138, CAGL0E03938g partial mRNA 40 6.7
172gb|AC127349.3| Mus musculus BAC clone RP23-62M5 from chromosome ... 40 6.7
173gb|AC124525.3| Mus musculus BAC clone RP23-406I17 from chromosom... 40 6.7
174ref|XM_644983.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal p... 40 6.7
175ref|XM_850046.1| PREDICTED: Canis familiaris similar to cAMP res... 40 6.7
176ref|XM_850043.1| PREDICTED: Canis familiaris similar to jumping ... 40 6.7
177emb|CR648468.2|CNS0EZBU Tetraodon nigroviridis full-length cDNA 40 6.7
178emb|AL604028.15| Human DNA sequence from clone RP11-767N6 on chr... 40 6.7
179emb|AL591623.15| Human DNA sequence from clone RP11-1086F11 on c... 40 6.7
180emb|AL590077.19| Human DNA sequence from clone RP11-35F15 on chr... 40 6.7
181emb|AL356378.17| Human DNA sequence from clone RP11-337C18 on ch... 40 6.7
182emb|AL162853.17| Human DNA sequence from clone RP11-363G2 on chr... 40 6.7
183emb|AL354681.8| Human DNA sequence from clone RP11-534L20 on chr... 40 6.7
184emb|AL135933.11| Human DNA sequence from clone RP4-774E4 on chro... 40 6.7
185emb|AL136226.9| Human DNA sequence from clone RP3-486D24 on chro... 40 6.7
186emb|AL133333.15| Human DNA sequence from clone RP11-462L8 on chr... 40 6.7
187emb|CR936627.1| Homo sapiens mRNA; cDNA DKFZp781A0112 (from clon... 40 6.7
188emb|CR380951.1| Candida glabrata strain CBS138 chromosome E comp... 40 6.7
189gb|AC079841.10| Homo sapiens 3 BAC RP11-10G15 (Roswell Park Canc... 40 6.7
190emb|AJ224081.1|HSAJ4081 Homo sapiens rpL7a pseudogene, clone 34 40 6.7
191dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 40 6.7
192dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, compl... 40 6.7
193gb|AC093789.3| Homo sapiens BAC clone RP11-219G10 from 4, comple... 40 6.7
194gb|AC011139.8| Homo sapiens chromosome 18, clone RP11-1I2, compl... 40 6.7
195gb|AC068388.7| Homo sapiens chromosome 3, clone RP11-296M9, comp... 40 6.7
196gb|AC093657.4| Homo sapiens BAC clone RP11-447B21 from 4, comple... 40 6.7
197gb|AC016764.8| Homo sapiens BAC clone RP11-549G13 from 2, comple... 40 6.7
198ref|XM_938181.1| PREDICTED: Homo sapiens similar to 60S ribosoma... 40 6.7
199ref|XM_371115.4| PREDICTED: Homo sapiens similar to 60S ribosoma... 40 6.7
200ref|XM_944890.1| PREDICTED: Homo sapiens similar to 60S ribosoma... 40 6.7
201ref|XM_940934.1| PREDICTED: Homo sapiens similar to 60S ribosoma... 40 6.7
202ref|XM_933879.1| PREDICTED: Homo sapiens similar to 60S ribosoma... 40 6.7
203ref|XM_929689.1| PREDICTED: Homo sapiens similar to 60S ribosoma... 40 6.7
204ref|XM_940836.1| PREDICTED: Homo sapiens similar to 60S ribosoma... 40 6.7
205ref|XM_087499.9| PREDICTED: Homo sapiens similar to 60S ribosoma... 40 6.7
206gb|AC148828.2| Pan troglodytes BAC clone CH251-136M2 from chromo... 40 6.7
207emb|BX901884.7| Zebrafish DNA sequence from clone DKEY-89E13 in ... 40 6.7
208emb|BX530060.6| Zebrafish DNA sequence from clone DKEY-283F16 in... 40 6.7
209dbj|AB169622.1| Macaca fascicularis brain cDNA, clone: QtrA-1194... 40 6.7
210dbj|AK077886.1| Mus musculus 13 days embryo male testis cDNA, RI... 40 6.7
211gb|AC000089.1| Homo sapiens Chromosome 22q11.2 Cosmid Clone 89h ... 40 6.7
212ref|NG_001316.1| Homo sapiens ribosomal protein L7a pseudogene 9... 40 6.7
213ref|NG_002562.1| Homo sapiens ribosomal protein L7a pseudogene 6... 40 6.7
214gb|AC018900.8|AC018900 Homo sapiens chromosome 15 clone RP11-198... 40 6.7
215gb|AC083863.2|AC083863 Homo sapiens chromosome 7 clone RP11-162O... 40 6.7
216gb|AC044787.6|AC044787 Homo sapiens chromosome 15 clone CTD-2270... 40 6.7
217ref|XM_575193.1| PREDICTED: Rattus norvegicus similar to 60S rib... 40 6.7
218gb|AY961486.1| Lysiphlebus testaceipes ribosomal protein L7a (Rp... 40 6.7
219emb|X17204.1|SCRPL4A Yeast RPL4A gene for ribosomal protein L4 40 6.7
220emb|X56836.1|SCL42 S.cerevisiae L4-2 gene for ribosomal protein ... 40 6.7
221emb|AL157789.6|CNS01RG6 Human chromosome 14 DNA sequence BAC R-8... 40 6.7
222emb|AL121594.6|CNS01DRY Human chromosome 14 DNA sequence BAC R-1... 40 6.7
223gb|AY902236.1| Homo sapiens flavin containing monooxygenase 5 (F... 40 6.7
224gb|AC140446.5| Mus musculus BAC clone RP24-114J11 from chromosom... 40 6.7
225emb|BX890608.15| Zebrafish DNA sequence from clone CH211-195J11 ... 40 6.7
226dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 40 6.7
227gb|U17361.1|SCU17361 Saccharomyces cerevisiae ribosomal protein ... 40 6.7
228emb|AL844569.4| Mouse DNA sequence from clone RP23-230H3 on chro... 40 6.7
229gb|U11583.2|YSCH9196 Saccharomyces cerevisiae chromosome VIII co... 40 6.7
230dbj|AP003112.1| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 6.7

>dbj|AK061725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B03, full
           insert sequence
          Length = 1055

 Score =  490 bits (247), Expect = e-135
 Identities = 394/443 (88%)
 Strand = Plus / Minus

                                                                       
Query: 55  ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
           |||| |||||||||| || |||||||| |||| |||| ||||||||||||||||||||||
Sbjct: 855 ttaggtcatccgctgggcggcctccttagcgagaagcttttccctggccttggtcttcgc 796

                                                                       
Query: 115 ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
            |||||||| ||||||||||| || || |||||||||||||| || || ||||| |||||
Sbjct: 795 ctgcgacttggagcccatgacgccgcctccccacttcttcctgacctcgtcgaacttgtc 736

                                                                       
Query: 175 attgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattctt 234
            |||||||| |||||||| ||||| | ||||||||||||||||||||| ||||| |||||
Sbjct: 735 gttgaagttcgccttgatggcctccaagatcttgctgaactcaagcttgtcctcgttctt 676

                                                                       
Query: 235 cactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgaga 294
            || ||||||| |||||||||||| |||||||||||||||||||||||||||||||||| 
Sbjct: 675 gacagtggtcaagcacagaacagatgcagtcttcttgtgaacaatcgatccaaggcgagc 616

                                                                       
Query: 295 ttttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacac 354
           ||| |||||||| |||||||||||||||||||| ||||| || ||||| || ||||||||
Sbjct: 615 tttgcccttaacgatgcagtaagggacctccatcttcctacacagggctggaagccacac 556

                                                                       
Query: 355 aaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttc 414
           |||||||||||| ||||||||||||||||| ||||||||||||||||| || ||||| ||
Sbjct: 555 aaccagctcaattggatcaacatcatgagcgatgacaaccagctgggccttgctctgctc 496

                                                                       
Query: 415 aattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaac 474
           ||| ||||| || || |||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 495 aatgaggtaagtcacgtggttaagaccatacttcacaacaattggcttcttggcctcaac 436

                                  
Query: 475 agttttcccttcggcttcagcct 497
            ||||||||||| || |||||||
Sbjct: 435 ggttttcccttcagcctcagcct 413



to top

>gb|AY105417.1| Zea mays PCO109699 mRNA sequence
          Length = 1103

 Score =  470 bits (237), Expect = e-129
 Identities = 393/445 (88%)
 Strand = Plus / Minus

                                                                       
Query: 53  acttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttc 112
           |||||| |||||||||| ||||| ||||| || |  ||| |||||||||||||||| |||
Sbjct: 845 acttaggtcatccgctgggcagcttccttggcaagcagcttttccctggccttggttttc 786

                                                                       
Query: 113 gcttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttg 172
           || || || || |||||||||| ||||||||||||||||||||| || ||||| || |||
Sbjct: 785 gcctgtgatttggagcccatgataccaccaccccacttcttcctgacctcatcaaacttg 726

                                                                       
Query: 173 tcattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattc 232
           || |||||||| |||||||||||||| ||||| ||||||||||||||||| ||||| |||
Sbjct: 725 tcgttgaagttagccttgatagcctccaggattttgctgaactcaagcttgtcctcgttc 666

                                                                       
Query: 233 ttcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcga 292
           || || ||||||| ||| |||||||| ||||||||||||||||| |||||||||||||| 
Sbjct: 665 ttgacggtggtcaagcaaagaacagatgcagtcttcttgtgaacgatcgatccaaggcgt 606

                                                                       
Query: 293 gattttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccac 352
           | ||||||||| ||||||||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 605 gcttttcccttgacaatgcagtatggaacctccattttcctgcaaagggccgggagccac 546

                                                                       
Query: 353 acaaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgt 412
           || |||||||| |||||||||||||||||||||||||||||||||||||| || ||||| 
Sbjct: 545 acgaccagctcgatcggatcaacatcatgagctatgacaaccagctgggccttgctctgc 486

                                                                       
Query: 413 tcaattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctca 472
           || || ||||| || |||||||||||||| || |||||||||||||| ||||||| ||||
Sbjct: 485 tcgatgaggtaagtcacatggttaaggccgtacttcacaacaattggtttctttgactca 426

                                    
Query: 473 acagttttcccttcggcttcagcct 497
           ||||||||||| |||  ||||||||
Sbjct: 425 acagttttcccctcgttttcagcct 401



to top

>ref|XM_481630.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1023

 Score =  466 bits (235), Expect = e-128
 Identities = 391/443 (88%)
 Strand = Plus / Minus

                                                                       
Query: 55  ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
           |||| |||||||||| ||||||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 866 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 807

                                                                       
Query: 115 ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
            |||||||| || |||||||| || || ||||||||||||||||| ||||||||||||||
Sbjct: 806 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 747

                                                                       
Query: 175 attgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattctt 234
            |||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |||||
Sbjct: 746 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 687

                                                                       
Query: 235 cactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgaga 294
            || ||||||| ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 686 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 627

                                                                       
Query: 295 ttttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacac 354
           |||||| || ||||||||||||||||||||||| |||||||| ||||| || ||||||||
Sbjct: 626 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 567

                                                                       
Query: 355 aaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttc 414
           |||||||||||||||||| ||||||||||| ||||| ||||| ||||| || ||||| ||
Sbjct: 566 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 507

                                                                       
Query: 415 aattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaac 474
           ||| ||||| || ||||||||||| ||||| |||||||||||||| ||||||||||||||
Sbjct: 506 aatgaggtatgtgacatggttaagaccatacttcacaacaattggtttctttgcctcaac 447

                                  
Query: 475 agttttcccttcggcttcagcct 497
            ||||| ||||| || |||||||
Sbjct: 446 ggttttaccttcagcctcagcct 424



to top

>ref|XM_507578.1| PREDICTED Oryza sativa (japonica cultivar-group), P0703C03.43 mRNA
          Length = 1041

 Score =  466 bits (235), Expect = e-128
 Identities = 391/443 (88%)
 Strand = Plus / Minus

                                                                       
Query: 55  ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
           |||| |||||||||| ||||||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 867 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 808

                                                                       
Query: 115 ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
            |||||||| || |||||||| || || ||||||||||||||||| ||||||||||||||
Sbjct: 807 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 748

                                                                       
Query: 175 attgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattctt 234
            |||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |||||
Sbjct: 747 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 688

                                                                       
Query: 235 cactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgaga 294
            || ||||||| ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 687 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 628

                                                                       
Query: 295 ttttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacac 354
           |||||| || ||||||||||||||||||||||| |||||||| ||||| || ||||||||
Sbjct: 627 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 568

                                                                       
Query: 355 aaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttc 414
           |||||||||||||||||| ||||||||||| ||||| ||||| ||||| || ||||| ||
Sbjct: 567 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 508

                                                                       
Query: 415 aattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaac 474
           ||| ||||| || ||||||||||| ||||| |||||||||||||| ||||||||||||||
Sbjct: 507 aatgaggtatgtgacatggttaagaccatacttcacaacaattggtttctttgcctcaac 448

                                  
Query: 475 agttttcccttcggcttcagcct 497
            ||||| ||||| || |||||||
Sbjct: 447 ggttttaccttcagcctcagcct 425



to top

>ref|XM_507194.2| PREDICTED Oryza sativa (japonica cultivar-group), P0703C03.43 mRNA
          Length = 1091

 Score =  466 bits (235), Expect = e-128
 Identities = 391/443 (88%)
 Strand = Plus / Minus

                                                                       
Query: 55  ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
           |||| |||||||||| ||||||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 870 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 811

                                                                       
Query: 115 ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
            |||||||| || |||||||| || || ||||||||||||||||| ||||||||||||||
Sbjct: 810 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 751

                                                                       
Query: 175 attgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattctt 234
            |||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |||||
Sbjct: 750 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 691

                                                                       
Query: 235 cactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgaga 294
            || ||||||| ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 690 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 631

                                                                       
Query: 295 ttttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacac 354
           |||||| || ||||||||||||||||||||||| |||||||| ||||| || ||||||||
Sbjct: 630 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 571

                                                                       
Query: 355 aaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttc 414
           |||||||||||||||||| ||||||||||| ||||| ||||| ||||| || ||||| ||
Sbjct: 570 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 511

                                                                       
Query: 415 aattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaac 474
           ||| ||||| || ||||||||||| ||||| |||||||||||||| ||||||||||||||
Sbjct: 510 aatgaggtatgtgacatggttaagaccatacttcacaacaattggtttctttgcctcaac 451

                                  
Query: 475 agttttcccttcggcttcagcct 497
            ||||| ||||| || |||||||
Sbjct: 450 ggttttaccttcagcctcagcct 428



to top

>dbj|AK121204.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023087N22, full
           insert sequence
          Length = 1091

 Score =  466 bits (235), Expect = e-128
 Identities = 391/443 (88%)
 Strand = Plus / Minus

                                                                       
Query: 55  ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
           |||| |||||||||| ||||||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 870 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 811

                                                                       
Query: 115 ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
            |||||||| || |||||||| || || ||||||||||||||||| ||||||||||||||
Sbjct: 810 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 751

                                                                       
Query: 175 attgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattctt 234
            |||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |||||
Sbjct: 750 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 691

                                                                       
Query: 235 cactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgaga 294
            || ||||||| ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 690 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 631

                                                                       
Query: 295 ttttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacac 354
           |||||| || ||||||||||||||||||||||| |||||||| ||||| || ||||||||
Sbjct: 630 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 571

                                                                       
Query: 355 aaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttc 414
           |||||||||||||||||| ||||||||||| ||||| ||||| ||||| || ||||| ||
Sbjct: 570 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 511

                                                                       
Query: 415 aattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaac 474
           ||| ||||| || ||||||||||| ||||| |||||||||||||| ||||||||||||||
Sbjct: 510 aatgaggtatgtgacatggttaagaccatacttcacaacaattggtttctttgcctcaac 451

                                  
Query: 475 agttttcccttcggcttcagcct 497
            ||||| ||||| || |||||||
Sbjct: 450 ggttttaccttcagcctcagcct 428



to top

>dbj|AK062210.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A04, full
           insert sequence
          Length = 1041

 Score =  466 bits (235), Expect = e-128
 Identities = 391/443 (88%)
 Strand = Plus / Minus

                                                                       
Query: 55  ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
           |||| |||||||||| ||||||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 867 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 808

                                                                       
Query: 115 ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
            |||||||| || |||||||| || || ||||||||||||||||| ||||||||||||||
Sbjct: 807 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 748

                                                                       
Query: 175 attgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattctt 234
            |||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |||||
Sbjct: 747 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 688

                                                                       
Query: 235 cactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgaga 294
            || ||||||| ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 687 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 628

                                                                       
Query: 295 ttttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacac 354
           |||||| || ||||||||||||||||||||||| |||||||| ||||| || ||||||||
Sbjct: 627 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 568

                                                                       
Query: 355 aaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttc 414
           |||||||||||||||||| ||||||||||| ||||| ||||| ||||| || ||||| ||
Sbjct: 567 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 508

                                                                       
Query: 415 aattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaac 474
           ||| ||||| || ||||||||||| ||||| |||||||||||||| ||||||||||||||
Sbjct: 507 aatgaggtatgtgacatggttaagaccatacttcacaacaattggtttctttgcctcaac 448

                                  
Query: 475 agttttcccttcggcttcagcct 497
            ||||| ||||| || |||||||
Sbjct: 447 ggttttaccttcagcctcagcct 425



to top

>dbj|D12631.1|RICRPL7AB Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein
           L7A, complete cds
          Length = 954

 Score =  466 bits (235), Expect = e-128
 Identities = 391/443 (88%)
 Strand = Plus / Minus

                                                                       
Query: 55  ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
           |||| |||||||||| ||||||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 797 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 738

                                                                       
Query: 115 ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
            |||||||| || |||||||| || || ||||||||||||||||| ||||||||||||||
Sbjct: 737 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 678

                                                                       
Query: 175 attgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattctt 234
            |||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |||||
Sbjct: 677 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 618

                                                                       
Query: 235 cactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgaga 294
            || ||||||| ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 617 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 558

                                                                       
Query: 295 ttttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacac 354
           |||||| || ||||||||||||||||||||||| |||||||| ||||| || ||||||||
Sbjct: 557 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 498

                                                                       
Query: 355 aaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttc 414
           |||||||||||||||||| ||||||||||| ||||| ||||| ||||| || ||||| ||
Sbjct: 497 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 438

                                                                       
Query: 415 aattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaac 474
           ||| ||||| || ||||||||||| ||||| |||||||||||||| ||||||||||||||
Sbjct: 437 aatgaggtatgtgacatggttaagaccatacttcacaacaattggtttctttgcctcaac 378

                                  
Query: 475 agttttcccttcggcttcagcct 497
            ||||| ||||| || |||||||
Sbjct: 377 ggttttaccttcagcctcagcct 355



to top

>dbj|AK098843.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000B08, full
           insert sequence
          Length = 1022

 Score =  450 bits (227), Expect = e-123
 Identities = 390/443 (88%), Gaps = 1/443 (0%)
 Strand = Plus / Minus

                                                                       
Query: 55  ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
           |||| |||||||||| ||||||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 865 ttaggtcatccgctgggcagcctcctt-gcgagcagcttttccctggccttggtcttcgc 807

                                                                       
Query: 115 ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
            |||||||| |  |||||||| || || ||||||||||||||||| ||||||||||||||
Sbjct: 806 ctgcgacttggttcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 747

                                                                       
Query: 175 attgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattctt 234
            |||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |||||
Sbjct: 746 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 687

                                                                       
Query: 235 cactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgaga 294
            || ||||||| ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 686 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 627

                                                                       
Query: 295 ttttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacac 354
           |||||| || ||||||||||||||||||||||| |||||||| ||||| || ||||||||
Sbjct: 626 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 567

                                                                       
Query: 355 aaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttc 414
           |||||||||||||||||| ||||||||||| ||||| ||||| ||||| || ||||| ||
Sbjct: 566 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 507

                                                                       
Query: 415 aattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaac 474
           ||| ||||| || ||||||||||| ||||| |||||||||||||| ||||||||||||||
Sbjct: 506 aatgaggtatgtgacatggttaagaccatacttcacaacaattggtttctttgcctcaac 447

                                  
Query: 475 agttttcccttcggcttcagcct 497
            ||||| ||||| || |||||||
Sbjct: 446 ggttttaccttcagcctcagcct 424



to top

>gb|BT018084.1| Zea mays clone EL01N0552B03.c mRNA sequence
          Length = 849

 Score =  418 bits (211), Expect = e-114
 Identities = 373/427 (87%)
 Strand = Plus / Minus

                                                                       
Query: 60  tcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgcttgcg 119
           |||||||||||||||||||||| ||||  ||| |||||| |||||||||||| || ||||
Sbjct: 666 tcatccgctgcgcagcctccttggcgagcagcttttcccgggccttggtcttggcctgcg 607

                                                                       
Query: 120 acttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtcattga 179
           |||| || |||||||  ||||| |||||||||||||| || |||||||| ||||| ||||
Sbjct: 606 acttggatcccatgatgccacctccccacttcttcctgacctcatcgaacttgtcgttga 547

                                                                       
Query: 180 agtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactg 239
           |||||||||| |||||||| | ||||||||||||||||||||||||||| ||||| || |
Sbjct: 546 agtttgccttaatagcctccaagatcttgctgaactcaagcttatcctcgttcttgacag 487

                                                                       
Query: 240 tggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagattttc 299
           |||| || ||||  || || ||| ||||||||||||||||||||||||||||||  ||||
Sbjct: 486 tggtgagacacaagactgatgcattcttcttgtgaacaatcgatccaaggcgagcctttc 427

                                                                       
Query: 300 ccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacacaacca 359
           | |||||||||||||||||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 426 ctttaacaatgcagtaagggacctccatcttcctgcacagggctggaagccacacaacca 367

                                                                       
Query: 360 gctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttcaatta 419
           | ||||||||||| || |||||||| |||||||| ||||| || ||  |||| ||||| |
Sbjct: 366 gttcaatcggatccacgtcatgagcgatgacaacaagctgagccttgttctgctcaatga 307

                                                                       
Query: 420 ggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaacagttt 479
           |||| || ||||||||||||||||| |||||||||||||| ||||| | |||||||||||
Sbjct: 306 ggtaagtcacatggttaaggccatacttcacaacaattggtttcttcgactcaacagttt 247

                  
Query: 480 tcccttc 486
           | |||||
Sbjct: 246 ttccttc 240



to top

>gb|AY103834.1| Zea mays PCO109701 mRNA sequence
          Length = 1105

 Score =  418 bits (211), Expect = e-114
 Identities = 373/427 (87%)
 Strand = Plus / Minus

                                                                       
Query: 60  tcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgcttgcg 119
           |||||||||||||||||||||| ||||  | | |||||| |||||||||||| || ||||
Sbjct: 843 tcatccgctgcgcagcctccttggcgagcaacttttcccgggccttggtcttggcctgcg 784

                                                                       
Query: 120 acttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtcattga 179
           |||| || |||||||  ||||| |||||||||||||| || |||||||| ||||| ||||
Sbjct: 783 acttggatcccatgatgccacctccccacttcttcctgacctcatcgaacttgtcgttga 724

                                                                       
Query: 180 agtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactg 239
           |||||||||| |||||||| | ||||||||||||||||||||||||||| ||||| || |
Sbjct: 723 agtttgccttaatagcctccaagatcttgctgaactcaagcttatcctcgttcttgacag 664

                                                                       
Query: 240 tggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagattttc 299
           ||||||| ||||  || || ||| ||||||||||||||||||||||||||||||  ||||
Sbjct: 663 tggtcagacacaagactgatgcattcttcttgtgaacaatcgatccaaggcgagcctttc 604

                                                                       
Query: 300 ccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacacaacca 359
           | |||||||||||||||||||||||||| |||||||| ||||| || |||||||||||||
Sbjct: 603 ctttaacaatgcagtaagggacctccatcttcctgcacagggctggaagccacacaacca 544

                                                                       
Query: 360 gctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttcaatta 419
           | ||||||||||| || |||||||| |||||||| ||||| || ||  |||| ||||| |
Sbjct: 543 gttcaatcggatccacgtcatgagcgatgacaacaagctgagccttgttctgctcaatga 484

                                                                       
Query: 420 ggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaacagttt 479
           |||| || ||||||||||||||||| |||||||||||||| ||||| | |||||||||||
Sbjct: 483 ggtaagtcacatggttaaggccatacttcacaacaattggtttcttcgactcaacagttt 424

                  
Query: 480 tcccttc 486
           | |||||
Sbjct: 423 ttccttc 417



to top

>gb|BT016736.1| Zea mays clone Contig569 mRNA sequence
          Length = 1092

 Score =  387 bits (195), Expect = e-104
 Identities = 369/427 (86%)
 Strand = Plus / Minus

                                                                       
Query: 60  tcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgcttgcg 119
           |||||||||| || |||||||| || |  | | ||||||||||||||||||| || ||||
Sbjct: 839 tcatccgctgggcggcctccttggccagcaacttttccctggccttggtcttggcctgcg 780

                                                                       
Query: 120 acttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtcattga 179
           |||| ||||||||||  ||||| |||||||||||||| |||||||| || ||||||||||
Sbjct: 779 acttggagcccatgatgccacctccccacttcttcctgacttcatcaaacttgtcattga 720

                                                                       
Query: 180 agtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactg 239
           |||| ||||| |||||||| | ||||||||||||||||||||| ||||| ||||| || |
Sbjct: 719 agttcgccttaatagcctccaagatcttgctgaactcaagcttgtcctcgttcttgacag 660

                                                                       
Query: 240 tggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagattttc 299
           ||||||| ||||  || || ||||||||||||||||| ||||||||||||||||  ||||
Sbjct: 659 tggtcagacacaagactgatgcagtcttcttgtgaacgatcgatccaaggcgagcctttc 600

                                                                       
Query: 300 ccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacacaacca 359
           | |||||||||||||| ||||||||||| |||||||| ||||| || ||||| |||||||
Sbjct: 599 ctttaacaatgcagtatgggacctccatcttcctgcacagggctggaagccaaacaacca 540

                                                                       
Query: 360 gctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttcaatta 419
           | ||||||||||| ||||||||||| |||||||| ||||| || ||  |||| ||||| |
Sbjct: 539 gttcaatcggatccacatcatgagcgatgacaacgagctgagccttgttctgctcaatga 480

                                                                       
Query: 420 ggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaacagttt 479
           |||| || ||||||||||||||||| |||||||||||||| ||||| |  ||||||||||
Sbjct: 479 ggtaagtcacatggttaaggccatacttcacaacaattggtttcttggattcaacagttt 420

                  
Query: 480 tcccttc 486
           | |||||
Sbjct: 419 ttccttc 413



to top

>ref|XM_463662.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 927

 Score =  301 bits (152), Expect = 1e-78
 Identities = 362/432 (83%)
 Strand = Plus / Minus

                                                                       
Query: 55  ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
           |||| |||||| ||| ||||| ||||| || | |||| |||||||||| |||||||| ||
Sbjct: 927 ttaggtcatcctctgggcagcttccttggctagaagcttttccctggctttggtcttggc 868

                                                                       
Query: 115 ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
           ||| ||||| |||||||||| ||||||||||||||||||||| || |||||||| |||||
Sbjct: 867 ttgtgactttgagcccatgataccaccaccccacttcttcctgacctcatcgaacttgtc 808

                                                                       
Query: 175 attgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattctt 234
            |||||||||| ||| || ||||| | ||| ||||||||||| | ||| || ||||||||
Sbjct: 807 gttgaagtttgacttaatggcctccaagattttgctgaactccaacttgtcttcattctt 748

                                                                       
Query: 235 cactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgaga 294
           ||| || ||||| || || ||||| || ||||||||||| |||||||||||||| |||| 
Sbjct: 747 cacagtcgtcagacaaaggacagatgctgtcttcttgtgcacaatcgatccaagacgagc 688

                                                                       
Query: 295 ttttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacac 354
            |||||||| |||||||| |||||||  ||||| |||||||| | ||| |||||||| ||
Sbjct: 687 ctttcccttcacaatgcaataagggatttccatcttcctgcacaaggctgggagccaaac 628

                                                                       
Query: 355 aaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttc 414
            || || ||||| || || ||||||||||| ||||| || ||||| || || ||||||||
Sbjct: 627 gacgagttcaatggggtcgacatcatgagcaatgaccacaagctgtgccttgctctgttc 568

                                                                       
Query: 415 aattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaac 474
           ||| |  ||||| ||||||| ||| ||||| |||||||||||||| ||||| || |||||
Sbjct: 567 aatcaaataggtcacatggtcaagaccatacttcacaacaattggtttcttggcttcaac 508

                       
Query: 475 agttttcccttc 486
           ||| ||||||||
Sbjct: 507 agtcttcccttc 496



to top

>gb|AY086353.1| Arabidopsis thaliana clone 24272 mRNA, complete sequence
          Length = 1020

 Score =  234 bits (118), Expect = 2e-58
 Identities = 337/410 (82%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 850 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 791

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||||
Sbjct: 790 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtca 731

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||||
Sbjct: 730 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttc 671

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 670 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 611

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           |||||||||||||||||||||||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 610 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 551

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 550 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 491

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| || ||||| || |||||||| ||||||||
Sbjct: 490 atgaggtaagtcacatggttgagaccatacttaacaacaatgggcttctt 441



to top

>emb|BX824662.1|CNS0A4TO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 940

 Score =  226 bits (114), Expect = 5e-56
 Identities = 336/410 (81%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 808 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 749

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 748 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 689

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||||||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 688 ttgaagttagccttgatggcctcaaggattttgctgaactcaagcttgtcctcgttcttg 629

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 628 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 569

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           |||||||||||||||||||||||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 568 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 509

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 508 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 449

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| || ||||| || |||||||| ||||||||
Sbjct: 448 atgaggtaagtcacatggttgagaccatacttaacaacaatgggcttctt 399



to top

>ref|NM_116152.2| Arabidopsis thaliana structural constituent of ribosome AT3G62870
           mRNA, complete cds
          Length = 1048

 Score =  218 bits (110), Expect = 1e-53
 Identities = 335/410 (81%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 850 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 791

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 790 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 731

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 730 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 671

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 670 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 611

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           |||||||||||||||||||||||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 610 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 551

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 550 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 491

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| || ||||| || |||||||| ||||||||
Sbjct: 490 atgaggtaagtcacatggttgagaccatacttaacaacaatgggcttctt 441



to top

>gb|AY114667.1| Arabidopsis thaliana 60S ribosomal protein L7A protein (At3g62870)
           mRNA, complete cds
          Length = 883

 Score =  218 bits (110), Expect = 1e-53
 Identities = 335/410 (81%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 770 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 711

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 710 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 651

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 650 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 591

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 590 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 531

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           |||||||||||||||||||||||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 530 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 471

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 470 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 411

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| || ||||| || |||||||| ||||||||
Sbjct: 410 atgaggtaagtcacatggttgagaccatacttaacaacaatgggcttctt 361



to top

>gb|AY062758.1| Arabidopsis thaliana 60S RIBOSOMAL PROTEIN L7A protein (At3g62870;
           F26K9_300) mRNA, complete cds
          Length = 976

 Score =  218 bits (110), Expect = 1e-53
 Identities = 335/410 (81%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 806 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 747

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 746 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 687

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 686 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 627

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 626 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 567

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           |||||||||||||||||||||||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 566 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 507

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 506 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 447

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| || ||||| || |||||||| ||||||||
Sbjct: 446 atgaggtaagtcacatggttgagaccatacttaacaacaatgggcttctt 397



to top

>gb|AY060519.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, complete cds
          Length = 771

 Score =  218 bits (110), Expect = 1e-53
 Identities = 335/410 (81%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 770 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 711

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 710 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 651

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 650 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 591

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 590 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 531

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           |||||||||||||||||||||||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 530 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 471

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 470 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 411

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| || ||||| || |||||||| ||||||||
Sbjct: 410 atgaggtaagtcacatggttgagaccatacttaacaacaatgggcttctt 361



to top

>gb|AY052264.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, complete cds
          Length = 1013

 Score =  218 bits (110), Expect = 1e-53
 Identities = 335/410 (81%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 843 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 784

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 783 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 724

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 723 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 664

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 663 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 604

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           |||||||||||||||||||||||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 603 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 544

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 543 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 484

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| || ||||| || |||||||| ||||||||
Sbjct: 483 atgaggtaagtcacatggttgagaccatacttaacaacaatgggcttctt 434



to top

>emb|BX825094.1|CNS0A7RE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH9ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 835

 Score =  218 bits (110), Expect = 1e-53
 Identities = 335/410 (81%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 726 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 667

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 666 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 607

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 606 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 547

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 546 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 487

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           |||||||||||||||||||||||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 486 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 427

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 426 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 367

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| || ||||| || |||||||| ||||||||
Sbjct: 366 atgaggtaagtcacatggttgagaccatacttaacaacaatgggcttctt 317



to top

>emb|BX823982.1|CNS0A6PP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH12ZB02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score =  218 bits (110), Expect = 1e-53
 Identities = 335/410 (81%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 790 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 731

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 730 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 671

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 670 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 611

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 610 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 551

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           |||||||||||||||||||||||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 550 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 491

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 490 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 431

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| || ||||| || |||||||| ||||||||
Sbjct: 430 atgaggtaagtcacatggttgagaccatacttaacaacaatgggcttctt 381



to top

>ref|NM_130329.2| Arabidopsis thaliana structural constituent of ribosome AT2G47610
           mRNA, complete cds
          Length = 1092

 Score =  214 bits (108), Expect = 2e-52
 Identities = 336/412 (81%)
 Strand = Plus / Minus

                                                                       
Query: 54  cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
           |||| |||||||  || |||||||||||||| ||||  |||||| | ||||||||||| |
Sbjct: 839 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 780

                                                                       
Query: 114 cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
           | || ||||| || ||||| |  || || ||||| ||||||||    || ||| | ||||
Sbjct: 779 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 720

                                                                       
Query: 174 cattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattct 233
           |||||||||| ||||||||||| || ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 719 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 660

                                                                       
Query: 234 tcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgag 293
           | || |||||||  ||||    ||| |||||||||| |||||||| || |||||| ||||
Sbjct: 659 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 600

                                                                       
Query: 294 attttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccaca 353
           |||| ||||| ||||||||||| ||||| ||||| |||||||| || ||||| | ||| |
Sbjct: 599 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 540

                                                                       
Query: 354 caaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgtt 413
           |||||| |||||| || || ||||||||||| || ||||| || ||||| ||  |||| |
Sbjct: 539 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 480

                                                               
Query: 414 caattaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           |||| |||||||| |||||||| ||||| ||||| || ||||| ||||||||
Sbjct: 479 caatgaggtaggtcacatggttgaggccgtatttgactacaatgggcttctt 428



to top

>gb|AY052674.1| Arabidopsis thaliana At2g47610/T30B22.8 mRNA, complete cds
          Length = 984

 Score =  214 bits (108), Expect = 2e-52
 Identities = 336/412 (81%)
 Strand = Plus / Minus

                                                                       
Query: 54  cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
           |||| |||||||  || |||||||||||||| ||||  |||||| | ||||||||||| |
Sbjct: 837 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 778

                                                                       
Query: 114 cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
           | || ||||| || ||||| |  || || ||||| ||||||||    || ||| | ||||
Sbjct: 777 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 718

                                                                       
Query: 174 cattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattct 233
           |||||||||| ||||||||||| || ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 717 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 658

                                                                       
Query: 234 tcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgag 293
           | || |||||||  ||||    ||| |||||||||| |||||||| || |||||| ||||
Sbjct: 657 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 598

                                                                       
Query: 294 attttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccaca 353
           |||| ||||| ||||||||||| ||||| ||||| |||||||| || ||||| | ||| |
Sbjct: 597 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 538

                                                                       
Query: 354 caaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgtt 413
           |||||| |||||| || || ||||||||||| || ||||| || ||||| ||  |||| |
Sbjct: 537 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 478

                                                               
Query: 414 caattaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           |||| |||||||| |||||||| ||||| ||||| || ||||| ||||||||
Sbjct: 477 caatgaggtaggtcacatggttgaggccgtatttgactacaatgggcttctt 426



to top

>gb|AF385719.1|AF385719 Arabidopsis thaliana At2g47610/T30B22.8 mRNA, complete cds
          Length = 999

 Score =  214 bits (108), Expect = 2e-52
 Identities = 336/412 (81%)
 Strand = Plus / Minus

                                                                       
Query: 54  cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
           |||| |||||||  || |||||||||||||| ||||  |||||| | ||||||||||| |
Sbjct: 837 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 778

                                                                       
Query: 114 cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
           | || ||||| || ||||| |  || || ||||| ||||||||    || ||| | ||||
Sbjct: 777 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 718

                                                                       
Query: 174 cattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattct 233
           |||||||||| ||||||||||| || ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 717 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 658

                                                                       
Query: 234 tcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgag 293
           | || |||||||  ||||    ||| |||||||||| |||||||| || |||||| ||||
Sbjct: 657 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 598

                                                                       
Query: 294 attttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccaca 353
           |||| ||||| ||||||||||| ||||| ||||| |||||||| || ||||| | ||| |
Sbjct: 597 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 538

                                                                       
Query: 354 caaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgtt 413
           |||||| |||||| || || ||||||||||| || ||||| || ||||| ||  |||| |
Sbjct: 537 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 478

                                                               
Query: 414 caattaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           |||| |||||||| |||||||| ||||| ||||| || ||||| ||||||||
Sbjct: 477 caatgaggtaggtcacatggttgaggccgtatttgactacaatgggcttctt 426



to top

>emb|BX821062.1|CNS0A8OD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH9ZF10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 897

 Score =  214 bits (108), Expect = 2e-52
 Identities = 336/412 (81%)
 Strand = Plus / Minus

                                                                       
Query: 54  cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
           |||| |||||||  || |||||||||||||| ||||  |||||| | ||||||||||| |
Sbjct: 773 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 714

                                                                       
Query: 114 cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
           | || ||||| || ||||| |  || || ||||| ||||||||    || ||| | ||||
Sbjct: 713 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 654

                                                                       
Query: 174 cattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattct 233
           |||||||||| ||||||||||| || ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 653 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 594

                                                                       
Query: 234 tcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgag 293
           | || |||||||  ||||    ||| |||||||||| |||||||| || |||||| ||||
Sbjct: 593 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 534

                                                                       
Query: 294 attttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccaca 353
           |||| ||||| ||||||||||| ||||| ||||| |||||||| || ||||| | ||| |
Sbjct: 533 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 474

                                                                       
Query: 354 caaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgtt 413
           |||||| |||||| || || ||||||||||| || ||||| || ||||| ||  |||| |
Sbjct: 473 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 414

                                                               
Query: 414 caattaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           |||| |||||||| |||||||| ||||| ||||| || ||||| ||||||||
Sbjct: 413 caatgaggtaggtcacatggttgaggccgtatttgactacaatgggcttctt 362



to top

>gb|AY088386.1| Arabidopsis thaliana clone 6394 mRNA, complete sequence
          Length = 1092

 Score =  214 bits (108), Expect = 2e-52
 Identities = 336/412 (81%)
 Strand = Plus / Minus

                                                                       
Query: 54  cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
           |||| |||||||  || |||||||||||||| ||||  |||||| | ||||||||||| |
Sbjct: 840 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 781

                                                                       
Query: 114 cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
           | || ||||| || ||||| |  || || ||||| ||||||||    || ||| | ||||
Sbjct: 780 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 721

                                                                       
Query: 174 cattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattct 233
           |||||||||| ||||||||||| || ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 720 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 661

                                                                       
Query: 234 tcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgag 293
           | || |||||||  ||||    ||| |||||||||| |||||||| || |||||| ||||
Sbjct: 660 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 601

                                                                       
Query: 294 attttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccaca 353
           |||| ||||| ||||||||||| ||||| ||||| |||||||| || ||||| | ||| |
Sbjct: 600 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 541

                                                                       
Query: 354 caaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgtt 413
           |||||| |||||| || || ||||||||||| || ||||| || ||||| ||  |||| |
Sbjct: 540 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 481

                                                               
Query: 414 caattaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           |||| |||||||| |||||||| ||||| ||||| || ||||| ||||||||
Sbjct: 480 caatgaggtaggtcacatggttgaggccgtatttgactacaatgggcttctt 429



to top

>gb|BT000500.1| Arabidopsis thaliana 60S ribosomal protein L7A
           (At2g47610/T30B22.8) mRNA, complete cds
          Length = 774

 Score =  212 bits (107), Expect = 8e-52
 Identities = 323/395 (81%)
 Strand = Plus / Minus

                                                                       
Query: 71  gcagcctcctttgcgataagcctttccctggccttggtcttcgcttgcgacttcgagccc 130
           |||||||||||||| ||||  |||||| | ||||||||||| || || ||||| || |||
Sbjct: 758 gcagcctcctttgcaataactctttcctttgccttggtctttgcctgagacttagatccc 699

                                                                       
Query: 131 atgacaccaccaccccacttcttcctaacttcatcgaatttgtcattgaagtttgccttg 190
           || |  || || ||||| ||||||||    || ||| | |||||||||||||| ||||||
Sbjct: 698 attatgcctcctccccatttcttcctgtactcctcgtacttgtcattgaagttggccttg 639

                                                                       
Query: 191 atagcctcaaggatcttgctgaactcaagcttatcctcattcttcactgtggtcaggcac 250
           ||||| || ||||| ||||||||||| ||||| ||||| ||||| || |||||||  |||
Sbjct: 638 atagcttccaggattttgctgaactctagcttgtcctcgttcttgacagtggtcaaacac 579

                                                                       
Query: 251 agaacagaggcagtcttcttgtgaacaatcgatccaaggcgagattttcccttaacaatg 310
           |    ||| |||||||||| |||||||| || |||||| |||||||| ||||| ||||||
Sbjct: 578 aagcaagaagcagtcttctggtgaacaaccgctccaagacgagatttgcccttgacaatg 519

                                                                       
Query: 311 cagtaagggacctccattttcctgcaaagggcagggagccacacaaccagctcaatcgga 370
           ||||| ||||| ||||| |||||||| || ||||| | ||| ||||||| |||||| || 
Sbjct: 518 cagtacgggacttccatcttcctgcacagagcaggcaaccagacaaccaactcaattggg 459

                                                                       
Query: 371 tcaacatcatgagctatgacaaccagctgggctttactctgttcaattaggtaggtaaca 430
           || ||||||||||| || ||||| || ||||| ||  |||| ||||| |||||||| |||
Sbjct: 458 tcgacatcatgagcaataacaacaagttgggccttgttctgctcaatgaggtaggtcaca 399

                                              
Query: 431 tggttaaggccatatttcacaacaattggcttctt 465
           ||||| ||||| ||||| || ||||| ||||||||
Sbjct: 398 tggttgaggccgtatttgactacaatgggcttctt 364



to top

>emb|BX824178.1|CNS0A6S9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH28ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 983

 Score =  210 bits (106), Expect = 3e-51
 Identities = 334/410 (81%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 809 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 750

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 749 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 690

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 689 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 630

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 629 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 570

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           |||||||||||||||||||||||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 569 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 510

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 509 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 450

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| |  ||||| || |||||||| ||||||||
Sbjct: 449 atgaggtaagtcacatggtttacaccatacttaacaacaatgggcttctt 400



to top

>emb|BX822281.1|CNS0A71I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB26ZA10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 870

 Score =  210 bits (106), Expect = 3e-51
 Identities = 334/410 (81%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 763 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 704

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 703 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 644

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 643 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 584

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 583 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 524

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           ||||||||||||||||||| |||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 523 tttcccttaacaatgcagttagggacttccattttcctgcagagtgcaggtaaccagacc 464

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 463 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 404

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| || ||||| || |||||||| ||||||||
Sbjct: 403 atgaggtaagttacatggttgagaccatacttaacaacaatgggcttctt 354



to top

>emb|BX819217.1|CNS0A8T4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB58ZF10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 747

 Score =  206 bits (104), Expect = 5e-50
 Identities = 335/412 (81%)
 Strand = Plus / Minus

                                                                       
Query: 54  cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
           |||| |||||||  || |||||||||||||| ||||  |||||| | ||||||||||| |
Sbjct: 585 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 526

                                                                       
Query: 114 cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
           | || ||||| || ||||| |  || || ||||| ||||||||    || ||| | ||||
Sbjct: 525 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 466

                                                                       
Query: 174 cattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattct 233
           |||||||||| ||||||||||| || ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 465 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 406

                                                                       
Query: 234 tcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgag 293
           | || |||||||  ||||    ||| |||||||||| |||||||| || |||||| ||||
Sbjct: 405 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 346

                                                                       
Query: 294 attttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccaca 353
           |||| ||||| | ||||||||| ||||| ||||| |||||||| || ||||| | ||| |
Sbjct: 345 atttgcccttgaaaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 286

                                                                       
Query: 354 caaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgtt 413
           |||||| || ||| || || ||||||||||| || ||||| || ||||| ||  |||| |
Sbjct: 285 caaccaacttaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 226

                                                               
Query: 414 caattaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           |||| |||||||| |||||||| ||||| |||||||| ||||| ||||||||
Sbjct: 225 caatgaggtaggtcacatggttgaggccgtatttcactacaatgggcttctt 174



to top

>emb|BX824325.1|CNS0A7R8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH3ZF06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 793

 Score =  202 bits (102), Expect = 8e-49
 Identities = 333/410 (81%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 720 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 661

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || ||||| || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 660 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 601

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 600 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 541

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           || ||||||| |||||   |||  |||||||||| |||||| | || |||||| ||||||
Sbjct: 540 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 481

                                                                       
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacaca 355
           |||||||||| |||||||| |||||| |||||||||||||| || ||||| | ||| || 
Sbjct: 480 tttcccttaaaaatgcagtgagggacttccattttcctgcagagtgcaggtaaccagacc 421

                                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttca 415
           |||| ||| || || |||||||| || || ||||| || ||||| || ||  |||| || 
Sbjct: 420 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 361

                                                             
Query: 416 attaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| || |||||||| || ||||| || |||||||| ||||||||
Sbjct: 360 atgaggtaagtgacatggttgagaccatacttaacaacaatgggcttctt 311



to top

>emb|BX842094.1|CNS09Y94 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZH02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 877

 Score =  198 bits (100), Expect = 1e-47
 Identities = 334/412 (81%)
 Strand = Plus / Minus

                                                                       
Query: 54  cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
           |||| |||||||  || |||||||||||||| ||||  |||||| | ||||||||||| |
Sbjct: 814 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 755

                                                                       
Query: 114 cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
           | || ||||| || ||||| |  || |   |||| ||||||||    || ||| | ||||
Sbjct: 754 cctgagacttagatcccattatgcctctttcccatttcttcctgtactcctcgtacttgt 695

                                                                       
Query: 174 cattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattct 233
           |||||||||| ||||||||||| || ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 694 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 635

                                                                       
Query: 234 tcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgag 293
           | || |||||||  ||||    ||| |||||||||| |||||||| || |||||| ||||
Sbjct: 634 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 575

                                                                       
Query: 294 attttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccaca 353
           |||| ||||| ||||||||||| ||||| ||||| |||||||| || ||||| | ||| |
Sbjct: 574 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 515

                                                                       
Query: 354 caaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgtt 413
           |||||| |||||| || || ||||||||||| || ||||| || ||||| ||  |||| |
Sbjct: 514 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 455

                                                               
Query: 414 caattaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           |||| |||||||| |||||||| ||||| ||||| || ||||| ||||||||
Sbjct: 454 caatgaggtaggtcacatggttgaggccgtatttgactacaatgggcttctt 403



to top

>emb|BX842006.1|CNS09Y9Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 979

 Score =  198 bits (100), Expect = 1e-47
 Identities = 247/296 (83%)
 Strand = Plus / Minus

                                                                       
Query: 170 ttgtcattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctca 229
           |||||||||||||| |||||||||||  | ||||| ||||||||||| ||||| ||||| 
Sbjct: 702 ttgtcattgaagttggccttgatagctcccaggattttgctgaactctagcttgtcctcg 643

                                                                       
Query: 230 ttcttcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaagg 289
           |||||||| |||||||  ||||    ||| |||||||||| |||||||| || |||||| 
Sbjct: 642 ttcttcacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaaga 583

                                                                       
Query: 290 cgagattttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagc 349
           ||| |||| ||||| ||||||||||| ||||| ||||| |||||||| || ||||| | |
Sbjct: 582 cgacatttgcccttcacaatgcagtacgggacttccatcttcctgcacagagcaggcaac 523

                                                                       
Query: 350 cacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactc 409
           |||||||||| |||||| || || ||||||||||| || ||||| || ||||| ||  ||
Sbjct: 522 cacacaaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttc 463

                                                                   
Query: 410 tgttcaattaggtaggtaacatggttaaggccatatttcacaacaattggcttctt 465
           || ||||| |||||||| |||||||| ||||| ||||| || ||||| ||||||||
Sbjct: 462 tgctcaatgaggtaggtcacatggttgaggccgtatttgactacaatgggcttctt 407



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 54  cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtctt 111
           |||| |||||||  || |||||||||||||| ||||  |||||| | |||||||||||
Sbjct: 818 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctt 761



to top

>gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone
              OSJNBa0072P02, complete sequence
          Length = 157488

 Score =  167 bits (84), Expect = 4e-38
 Identities = 120/132 (90%)
 Strand = Plus / Plus

                                                                          
Query: 280    cgatccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaag 339
              |||||||||||||| ||| |||||||| |||||||||||||||||||| ||||| || ||
Sbjct: 108543 cgatccaaggcgagctttgcccttaacgatgcagtaagggacctccatcttcctacacag 108602

                                                                          
Query: 340    ggcagggagccacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctg 399
              ||| || |||||||||||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 108603 ggctggaagccacacaaccagctcaattggatcaacatcatgagcgatgacaaccagctg 108662

                          
Query: 400    ggctttactctg 411
              ||| || |||||
Sbjct: 108663 ggccttgctctg 108674



 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Plus

                                                                          
Query: 55     ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
              |||| |||||||||| || |||||||| |||| |||| ||||||||||||||||||||||
Sbjct: 108114 ttaggtcatccgctgggcggcctccttagcgagaagcttttccctggccttggtcttcgc 108173

                                                                          
Query: 115    ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
               |||||||| ||||||||||| || || |||||||||||||| || || ||||| |||||
Sbjct: 108174 ctgcgacttggagcccatgacgccgcctccccacttcttcctgacctcgtcgaacttgtc 108233

                            
Query: 175    attgaagtttgcct 188
               |||||||| ||||
Sbjct: 108234 gttgaagttcgcct 108247



 Score =  117 bits (59), Expect = 4e-23
 Identities = 86/95 (90%)
 Strand = Plus / Plus

                                                                          
Query: 186    ccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactgtggtca 245
              ||||||| ||||| | ||||||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 108349 ccttgatggcctccaagatcttgctgaactcaagcttgtcctcgttcttgacagtggtca 108408

                                                 
Query: 246    ggcacagaacagaggcagtcttcttgtgaacaatc 280
               |||||||||||| |||||||||||||||||||||
Sbjct: 108409 agcacagaacagatgcagtcttcttgtgaacaatc 108443



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                          
Query: 413    tcaattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctca 472
              ||||| ||||| || || |||||||| ||||| |||||||||||||||||||| ||||||
Sbjct: 108789 tcaatgaggtaagtcacgtggttaagaccatacttcacaacaattggcttcttggcctca 108848

                                       
Query: 473    acagttttcccttcggcttcagcct 497
              || ||||||||||| || |||||||
Sbjct: 108849 acggttttcccttcagcctcagcct 108873



to top

>dbj|AK220651.1| Arabidopsis thaliana mRNA for 60S ribosomal protein L7A, complete
           cds, clone: RAFL21-65-D24
          Length = 498

 Score =  167 bits (84), Expect = 4e-38
 Identities = 267/328 (81%)
 Strand = Plus / Minus

                                                                       
Query: 54  cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
           |||| |||||||  || |||||||||||||| ||||  |||||| | ||||||||||| |
Sbjct: 328 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 269

                                                                       
Query: 114 cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
           | || ||||| || ||||| |  || || ||||| ||||||||    || ||| | ||||
Sbjct: 268 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 209

                                                                       
Query: 174 cattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattct 233
           |||||||||| ||||||||||| || ||||| ||||||||||| ||||| ||||| ||||
Sbjct: 208 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 149

                                                                       
Query: 234 tcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgag 293
           | || |||||||  ||||    ||| |||||||||| |||||||| || |||||| ||||
Sbjct: 148 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 89

                                                                       
Query: 294 attttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccaca 353
           |||| ||||| ||||||||||| ||||| ||||| |||||||| || ||||| | ||| |
Sbjct: 88  atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 29

                                       
Query: 354 caaccagctcaatcggatcaacatcatg 381
           |||||| |||||| || || ||||||||
Sbjct: 28  caaccaactcaattgggtcgacatcatg 1



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  167 bits (84), Expect = 4e-38
 Identities = 120/132 (90%)
 Strand = Plus / Plus

                                                                            
Query: 280      cgatccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaag 339
                |||||||||||||| ||| |||||||| |||||||||||||||||||| ||||| || ||
Sbjct: 19389317 cgatccaaggcgagctttgcccttaacgatgcagtaagggacctccatcttcctacacag 19389376

                                                                            
Query: 340      ggcagggagccacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctg 399
                ||| || |||||||||||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 19389377 ggctggaagccacacaaccagctcaattggatcaacatcatgagcgatgacaaccagctg 19389436

                            
Query: 400      ggctttactctg 411
                ||| || |||||
Sbjct: 19389437 ggccttgctctg 19389448



 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Plus

                                                                            
Query: 55       ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
                |||| |||||||||| || |||||||| |||| |||| ||||||||||||||||||||||
Sbjct: 19388888 ttaggtcatccgctgggcggcctccttagcgagaagcttttccctggccttggtcttcgc 19388947

                                                                            
Query: 115      ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
                 |||||||| ||||||||||| || || |||||||||||||| || || ||||| |||||
Sbjct: 19388948 ctgcgacttggagcccatgacgccgcctccccacttcttcctgacctcgtcgaacttgtc 19389007

                              
Query: 175      attgaagtttgcct 188
                 |||||||| ||||
Sbjct: 19389008 gttgaagttcgcct 19389021



 Score =  117 bits (59), Expect = 4e-23
 Identities = 86/95 (90%)
 Strand = Plus / Plus

                                                                            
Query: 186      ccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactgtggtca 245
                ||||||| ||||| | ||||||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 19389123 ccttgatggcctccaagatcttgctgaactcaagcttgtcctcgttcttgacagtggtca 19389182

                                                   
Query: 246      ggcacagaacagaggcagtcttcttgtgaacaatc 280
                 |||||||||||| |||||||||||||||||||||
Sbjct: 19389183 agcacagaacagatgcagtcttcttgtgaacaatc 19389217



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                            
Query: 413      tcaattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctca 472
                ||||| ||||| || || |||||||| ||||| |||||||||||||||||||| ||||||
Sbjct: 19389563 tcaatgaggtaagtcacgtggttaagaccatacttcacaacaattggcttcttggcctca 19389622

                                         
Query: 473      acagttttcccttcggcttcagcct 497
                || ||||||||||| || |||||||
Sbjct: 19389623 acggttttcccttcagcctcagcct 19389647



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  147 bits (74), Expect = 4e-32
 Identities = 119/134 (88%)
 Strand = Plus / Plus

                                                                            
Query: 55       ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
                |||| |||||||||| ||||||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 14333553 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 14333612

                                                                            
Query: 115      ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
                 |||||||| || |||||||| || || ||||||||||||||||| ||||||||||||||
Sbjct: 14333613 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 14333672

                              
Query: 175      attgaagtttgcct 188
                 |||||||| ||||
Sbjct: 14333673 gttgaagttcgcct 14333686



 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Plus

                                                                            
Query: 281      gatccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaagg 340
                |||||||| || | |||||| || ||||||||||||||||||||||| |||||||| |||
Sbjct: 14333978 gatccaagacgggcttttcctttcacaatgcagtaagggacctccatcttcctgcacagg 14334037

                                                                            
Query: 341      gcagggagccacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctgg 400
                || || |||||||||||||||||||||||||| ||||||||||| ||||| ||||| |||
Sbjct: 14334038 gctggaagccacacaaccagctcaatcggatcgacatcatgagcaatgacgaccagttgg 14334097

                           
Query: 401      gctttactctg 411
                || || |||||
Sbjct: 14334098 gccttgctctg 14334108



 Score =  109 bits (55), Expect = 9e-21
 Identities = 85/95 (89%)
 Strand = Plus / Plus

                                                                            
Query: 186      ccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactgtggtca 245
                ||||||||||||| ||||||||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 14333794 ccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttcttgacagtggtca 14333853

                                                   
Query: 246      ggcacagaacagaggcagtcttcttgtgaacaatc 280
                 ||| || ||||| ||||| |||||||||||||||
Sbjct: 14333854 agcagaggacagatgcagttttcttgtgaacaatc 14333888



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                            
Query: 413      tcaattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctca 472
                ||||| ||||| || ||||||||||| ||||| |||||||||||||| ||||||||||||
Sbjct: 14334224 tcaatgaggtatgtgacatggttaagaccatacttcacaacaattggtttctttgcctca 14334283

                                         
Query: 473      acagttttcccttcggcttcagcct 497
                || ||||| ||||| || |||||||
Sbjct: 14334284 acggttttaccttcagcctcagcct 14334308



to top

>dbj|AP004637.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0703C03
          Length = 162620

 Score =  147 bits (74), Expect = 4e-32
 Identities = 119/134 (88%)
 Strand = Plus / Plus

                                                                          
Query: 55     ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
              |||| |||||||||| ||||||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 149109 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 149168

                                                                          
Query: 115    ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
               |||||||| || |||||||| || || ||||||||||||||||| ||||||||||||||
Sbjct: 149169 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 149228

                            
Query: 175    attgaagtttgcct 188
               |||||||| ||||
Sbjct: 149229 gttgaagttcgcct 149242



 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Plus

                                                                          
Query: 281    gatccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaagg 340
              |||||||| || | |||||| || ||||||||||||||||||||||| |||||||| |||
Sbjct: 149534 gatccaagacgggcttttcctttcacaatgcagtaagggacctccatcttcctgcacagg 149593

                                                                          
Query: 341    gcagggagccacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctgg 400
              || || |||||||||||||||||||||||||| ||||||||||| ||||| ||||| |||
Sbjct: 149594 gctggaagccacacaaccagctcaatcggatcgacatcatgagcaatgacgaccagttgg 149653

                         
Query: 401    gctttactctg 411
              || || |||||
Sbjct: 149654 gccttgctctg 149664



 Score =  109 bits (55), Expect = 9e-21
 Identities = 85/95 (89%)
 Strand = Plus / Plus

                                                                          
Query: 186    ccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactgtggtca 245
              ||||||||||||| ||||||||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 149350 ccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttcttgacagtggtca 149409

                                                 
Query: 246    ggcacagaacagaggcagtcttcttgtgaacaatc 280
               ||| || ||||| ||||| |||||||||||||||
Sbjct: 149410 agcagaggacagatgcagttttcttgtgaacaatc 149444



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                          
Query: 413    tcaattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctca 472
              ||||| ||||| || ||||||||||| ||||| |||||||||||||| ||||||||||||
Sbjct: 149780 tcaatgaggtatgtgacatggttaagaccatacttcacaacaattggtttctttgcctca 149839

                                       
Query: 473    acagttttcccttcggcttcagcct 497
              || ||||| ||||| || |||||||
Sbjct: 149840 acggttttaccttcagcctcagcct 149864



to top

>dbj|AP003884.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1136_A10
          Length = 101249

 Score =  147 bits (74), Expect = 4e-32
 Identities = 119/134 (88%)
 Strand = Plus / Plus

                                                                         
Query: 55    ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
             |||| |||||||||| ||||||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 36633 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 36692

                                                                         
Query: 115   ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
              |||||||| || |||||||| || || ||||||||||||||||| ||||||||||||||
Sbjct: 36693 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 36752

                           
Query: 175   attgaagtttgcct 188
              |||||||| ||||
Sbjct: 36753 gttgaagttcgcct 36766



 Score =  141 bits (71), Expect = 2e-30
 Identities = 116/131 (88%)
 Strand = Plus / Plus

                                                                         
Query: 281   gatccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaagg 340
             |||||||| || | |||||| || ||||||||||||||||||||||| |||||||| |||
Sbjct: 37058 gatccaagacgggcttttcctttcacaatgcagtaagggacctccatcttcctgcacagg 37117

                                                                         
Query: 341   gcagggagccacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctgg 400
             || || |||||||||||||||||||||||||| ||||||||||| ||||| ||||| |||
Sbjct: 37118 gctggaagccacacaaccagctcaatcggatcgacatcatgagcaatgacgaccagttgg 37177

                        
Query: 401   gctttactctg 411
             || || |||||
Sbjct: 37178 gccttgctctg 37188



 Score =  109 bits (55), Expect = 9e-21
 Identities = 85/95 (89%)
 Strand = Plus / Plus

                                                                         
Query: 186   ccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactgtggtca 245
             ||||||||||||| ||||||||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 36874 ccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttcttgacagtggtca 36933

                                                
Query: 246   ggcacagaacagaggcagtcttcttgtgaacaatc 280
              ||| || ||||| ||||| |||||||||||||||
Sbjct: 36934 agcagaggacagatgcagttttcttgtgaacaatc 36968



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                         
Query: 413   tcaattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctca 472
             ||||| ||||| || ||||||||||| ||||| |||||||||||||| ||||||||||||
Sbjct: 37304 tcaatgaggtatgtgacatggttaagaccatacttcacaacaattggtttctttgcctca 37363

                                      
Query: 473   acagttttcccttcggcttcagcct 497
             || ||||| ||||| || |||||||
Sbjct: 37364 acggttttaccttcagcctcagcct 37388



to top

>emb|BX821934.1|CNS0A88T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL86ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 829

 Score =  145 bits (73), Expect = 2e-31
 Identities = 325/409 (79%)
 Strand = Plus / Minus

                                                                       
Query: 54  cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
           |||| |||||||  || |||||||||||||| || |  |||||| | ||||||||||| |
Sbjct: 656 cttaattcatcctttgggcagcctcctttgcaattactctttcctttgccttggtctttg 597

                                                                       
Query: 114 cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
           | || ||||| || ||||| |  || || ||||| ||||||||    || ||| | ||||
Sbjct: 596 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 537

                                                                       
Query: 174 cattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattct 233
            ||||||||| ||||| ||||| || ||||| ||||||||||| ||||| | ||| ||||
Sbjct: 536 aattgaagttggccttaatagcttccaggattttgctgaactctagcttgttctcgttct 477

                                                                       
Query: 234 tcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgag 293
           | |  |||||||  ||||    ||| |||||||||| |||||||| || |||||| ||||
Sbjct: 476 tgatagtggtcaaacacaagcaagatgcagtcttctggtgaacaaccgctccaagacgag 417

                                                                       
Query: 294 attttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccaca 353
           |||| ||||| | ||||||||  ||||| ||||| |||||||| || ||||| | ||| |
Sbjct: 416 atttgccctttataatgcagttcgggacttccatcttcctgcacagagcaggtaaccaga 357

                                                                       
Query: 354 caaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgtt 413
           |||||| || ||| || || ||||||||||| || ||||| || ||||| ||  |||| |
Sbjct: 356 caaccaacttaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 297

                                                            
Query: 414 caattaggtaggtaacatggttaaggccatatttcacaacaattggctt 462
           |||| |||||||| |||||||| ||||| ||||| || ||||| |||||
Sbjct: 296 caatgaggtaggtcacatggttgaggccgtatttaactacaatgggctt 248



to top

>gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete
             sequence
          Length = 98937

 Score =  125 bits (63), Expect = 1e-25
 Identities = 153/183 (83%)
 Strand = Plus / Plus

                                                                         
Query: 283   tccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaagggc 342
             |||||| |||||||| ||||| ||||||||||| ||||| ||||| |||||||| || ||
Sbjct: 17640 tccaagacgagatttgcccttgacaatgcagtacgggacttccatcttcctgcacagagc 17699

                                                                         
Query: 343   agggagccacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctgggc 402
             ||| | ||| ||||||| |||||| || || ||||||||||| || ||||| || |||||
Sbjct: 17700 aggcaaccagacaaccaactcaattgggtcgacatcatgagcaataacaacaagttgggc 17759

                                                                         
Query: 403   tttactctgttcaattaggtaggtaacatggttaaggccatatttcacaacaattggctt 462
              ||  |||| ||||| |||||||| |||||||| ||||| ||||| || ||||| |||||
Sbjct: 17760 cttgttctgctcaatgaggtaggtcacatggttgaggccgtatttgactacaatgggctt 17819

                
Query: 463   ctt 465
             |||
Sbjct: 17820 ctt 17822



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 77/93 (82%)
 Strand = Plus / Plus

                                                                         
Query: 186   ccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactgtggtca 245
             |||||||||| || ||||| ||||||||||| ||||| ||||| ||||| || |||||||
Sbjct: 17462 ccttgatagcttccaggattttgctgaactctagcttgtcctcgttcttgacagtggtca 17521

                                              
Query: 246   ggcacagaacagaggcagtcttcttgtgaacaa 278
               ||||    ||| |||||||||| ||||||||
Sbjct: 17522 aacacaagcaagaagcagtcttctggtgaacaa 17554



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 107/135 (79%)
 Strand = Plus / Plus

                                                                         
Query: 54    cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
             |||| |||||||  || |||||||||||||| ||||  |||||| | ||||||||||| |
Sbjct: 17238 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 17297

                                                                         
Query: 114   cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
             | || ||||| || ||||| |  || || ||||| ||||||||    || ||| | ||||
Sbjct: 17298 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 17357

                            
Query: 174   cattgaagtttgcct 188
             |||||||||| ||||
Sbjct: 17358 cattgaagttggcct 17372



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  125 bits (63), Expect = 1e-25
 Identities = 114/131 (87%)
 Strand = Plus / Plus

                                                                            
Query: 55       ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
                |||| |||||| ||| ||||| ||||| || | |||| |||||||||| |||||||| ||
Sbjct: 40488702 ttaggtcatcctctgggcagcttccttggctagaagcttttccctggctttggtcttggc 40488761

                                                                            
Query: 115      ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
                ||| ||||| |||||||||| ||||||||||||||||||||| || |||||||| |||||
Sbjct: 40488762 ttgtgactttgagcccatgataccaccaccccacttcttcctgacctcatcgaacttgtc 40488821

                           
Query: 175      attgaagtttg 185
                 ||||||||||
Sbjct: 40488822 gttgaagtttg 40488832



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                            
Query: 280      cgatccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaag 339
                ||||||||| ||||  |||||||| |||||||| |||||||  ||||| |||||||| | 
Sbjct: 40489125 cgatccaagacgagcctttcccttcacaatgcaataagggatttccatcttcctgcacaa 40489184

                                                                            
Query: 340      ggcagggagccacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctg 399
                ||| |||||||| || || || ||||| || || ||||||||||| ||||| || |||||
Sbjct: 40489185 ggctgggagccaaacgacgagttcaatggggtcgacatcatgagcaatgaccacaagctg 40489244



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Plus

                                                                            
Query: 409      ctgttcaattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgc 468
                ||||||||| |  ||||| ||||||| ||| ||||| |||||||||||||| ||||| ||
Sbjct: 40489379 ctgttcaatcaaataggtcacatggtcaagaccatacttcacaacaattggtttcttggc 40489438

                                  
Query: 469      ctcaacagttttcccttc 486
                 |||||||| ||||||||
Sbjct: 40489439 ttcaacagtcttcccttc 40489456



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                            
Query: 206      ttgctgaactcaagcttatcctcattcttcactgtggtcaggcacagaacagaggcagtc 265
                ||||||||||| | ||| || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 40488947 ttgctgaactccaacttgtcttcattcttcacagtcgtcagacaaaggacagatgctgtc 40489006

                               
Query: 266      ttcttgtgaacaatc 280
                |||||||| ||||||
Sbjct: 40489007 ttcttgtgcacaatc 40489021



to top

>dbj|AP004672.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0592G05
          Length = 146220

 Score =  125 bits (63), Expect = 1e-25
 Identities = 114/131 (87%)
 Strand = Plus / Plus

                                                                          
Query: 55     ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
              |||| |||||| ||| ||||| ||||| || | |||| |||||||||| |||||||| ||
Sbjct: 139943 ttaggtcatcctctgggcagcttccttggctagaagcttttccctggctttggtcttggc 140002

                                                                          
Query: 115    ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
              ||| ||||| |||||||||| ||||||||||||||||||||| || |||||||| |||||
Sbjct: 140003 ttgtgactttgagcccatgataccaccaccccacttcttcctgacctcatcgaacttgtc 140062

                         
Query: 175    attgaagtttg 185
               ||||||||||
Sbjct: 140063 gttgaagtttg 140073



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                          
Query: 280    cgatccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaag 339
              ||||||||| ||||  |||||||| |||||||| |||||||  ||||| |||||||| | 
Sbjct: 140366 cgatccaagacgagcctttcccttcacaatgcaataagggatttccatcttcctgcacaa 140425

                                                                          
Query: 340    ggcagggagccacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctg 399
              ||| |||||||| || || || ||||| || || ||||||||||| ||||| || |||||
Sbjct: 140426 ggctgggagccaaacgacgagttcaatggggtcgacatcatgagcaatgaccacaagctg 140485



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Plus

                                                                          
Query: 409    ctgttcaattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgc 468
              ||||||||| |  ||||| ||||||| ||| ||||| |||||||||||||| ||||| ||
Sbjct: 140620 ctgttcaatcaaataggtcacatggtcaagaccatacttcacaacaattggtttcttggc 140679

                                
Query: 469    ctcaacagttttcccttc 486
               |||||||| ||||||||
Sbjct: 140680 ttcaacagtcttcccttc 140697



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                          
Query: 206    ttgctgaactcaagcttatcctcattcttcactgtggtcaggcacagaacagaggcagtc 265
              ||||||||||| | ||| || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 140188 ttgctgaactccaacttgtcttcattcttcacagtcgtcagacaaaggacagatgctgtc 140247

                             
Query: 266    ttcttgtgaacaatc 280
              |||||||| ||||||
Sbjct: 140248 ttcttgtgcacaatc 140262



to top

>dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1033B05
          Length = 138882

 Score =  125 bits (63), Expect = 1e-25
 Identities = 114/131 (87%)
 Strand = Plus / Plus

                                                                         
Query: 55    ttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgc 114
             |||| |||||| ||| ||||| ||||| || | |||| |||||||||| |||||||| ||
Sbjct: 50326 ttaggtcatcctctgggcagcttccttggctagaagcttttccctggctttggtcttggc 50385

                                                                         
Query: 115   ttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtc 174
             ||| ||||| |||||||||| ||||||||||||||||||||| || |||||||| |||||
Sbjct: 50386 ttgtgactttgagcccatgataccaccaccccacttcttcctgacctcatcgaacttgtc 50445

                        
Query: 175   attgaagtttg 185
              ||||||||||
Sbjct: 50446 gttgaagtttg 50456



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                         
Query: 280   cgatccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaag 339
             ||||||||| ||||  |||||||| |||||||| |||||||  ||||| |||||||| | 
Sbjct: 50749 cgatccaagacgagcctttcccttcacaatgcaataagggatttccatcttcctgcacaa 50808

                                                                         
Query: 340   ggcagggagccacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctg 399
             ||| |||||||| || || || ||||| || || ||||||||||| ||||| || |||||
Sbjct: 50809 ggctgggagccaaacgacgagttcaatggggtcgacatcatgagcaatgaccacaagctg 50868



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Plus

                                                                         
Query: 409   ctgttcaattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttgc 468
             ||||||||| |  ||||| ||||||| ||| ||||| |||||||||||||| ||||| ||
Sbjct: 51003 ctgttcaatcaaataggtcacatggtcaagaccatacttcacaacaattggtttcttggc 51062

                               
Query: 469   ctcaacagttttcccttc 486
              |||||||| ||||||||
Sbjct: 51063 ttcaacagtcttcccttc 51080



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                         
Query: 206   ttgctgaactcaagcttatcctcattcttcactgtggtcaggcacagaacagaggcagtc 265
             ||||||||||| | ||| || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 50571 ttgctgaactccaacttgtcttcattcttcacagtcgtcagacaaaggacagatgctgtc 50630

                            
Query: 266   ttcttgtgaacaatc 280
             |||||||| ||||||
Sbjct: 50631 ttcttgtgcacaatc 50645



to top

>emb|AL162651.1|ATF26K9 Arabidopsis thaliana DNA chromosome 3, BAC clone F26K9
          Length = 110257

 Score =  117 bits (59), Expect = 4e-23
 Identities = 152/183 (83%)
 Strand = Plus / Plus

                                                                         
Query: 283   tccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaagggc 342
             |||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||
Sbjct: 96271 tccaagacgagattttcccttaacaatgcagtaagggacttccattttcctgcagagtgc 96330

                                                                         
Query: 343   agggagccacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctgggc 402
             ||| | ||| || |||| ||| || || |||||||| || || ||||| || ||||| ||
Sbjct: 96331 aggtaaccagaccaccaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgc 96390

                                                                         
Query: 403   tttactctgttcaattaggtaggtaacatggttaaggccatatttcacaacaattggctt 462
              ||  |||| || || ||||| || |||||||| || ||||| || |||||||| |||||
Sbjct: 96391 cttgttctgctcgatgaggtaagtcacatggttgagaccatacttaacaacaatgggctt 96450

                
Query: 463   ctt 465
             |||
Sbjct: 96451 ctt 96453



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 77/91 (84%)
 Strand = Plus / Plus

                                                                         
Query: 186   ccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactgtggtca 245
             ||||||| ||||| ||||| ||||||||||||||||| ||||| ||||| || |||||||
Sbjct: 96071 ccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttgacagtggtca 96130

                                            
Query: 246   ggcacagaacagaggcagtcttcttgtgaac 276
              |||||   |||  |||||||||| ||||||
Sbjct: 96131 agcacaaggcagcagcagtcttctggtgaac 96161



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                         
Query: 56    tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
             |||||||| | ||| ||||||||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 95837 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 95896

                                                      
Query: 116   tgcgacttcgagcccatgacaccaccaccccacttcttcct 156
             || ||||| || ||||| |  ||||| ||||||||||||||
Sbjct: 95897 tgagacttggatcccattatgccacctccccacttcttcct 95937



to top

>gb|DQ268850.1| Solanum tuberosum clone 155G10 60S ribosomal protein L7A-like
           protein mRNA, complete cds
          Length = 1003

 Score =  113 bits (57), Expect = 6e-22
 Identities = 297/377 (78%)
 Strand = Plus / Minus

                                                                       
Query: 119 gacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtcattg 178
           ||||| |||||||||| |||||||||||||||||||||    || ||  | |||||||||
Sbjct: 727 gacttggagcccatgataccaccaccccacttcttcctgttctcttcatacttgtcattg 668

                                                                       
Query: 179 aagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcact 238
           ||||| ||||| || ||||| |  ||  |||||||||| |  || |||||||||||||| 
Sbjct: 667 aagttagccttaatggcctccaaaattctgctgaactccattttgtcctcattcttcacg 608

                                                                       
Query: 239 gtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagatttt 298
           || ||||  ||||   | || ||||| ||||  || ||||||||||| |  |||| ||| 
Sbjct: 607 gttgtcaaacacaaggctgaagcagttttctgatgcacaatcgatcctaaacgagctttg 548

                                                                       
Query: 299 cccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacacaacc 358
           ||||| |||||||||||||| |  ||||| || ||||| || ||||| ||||| ||||||
Sbjct: 547 cccttcacaatgcagtaaggaatttccatctttctgcatagcgcaggaagccagacaacc 488

                                                                       
Query: 359 agctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttcaatt 418
           | ||| || || || ||||||||||| || || |||| ||| |||||  |||| ||||| 
Sbjct: 487 aactctattgggtccacatcatgagcaatcactaccaactgagctttgttctgctcaata 428

                                                                       
Query: 419 aggtaggtaacatggttaaggccatatttcacaacaattggcttctttgcctcaacagtt 478
           ||||| || |  || ||||| ||||| ||||||| ||| || |||||||  |||  ||||
Sbjct: 427 aggtaagtgatgtgcttaagcccatacttcacaataataggtttctttgtttcaggagtt 368

                            
Query: 479 ttcccttcggcttcagc 495
           || ||||| ||||||||
Sbjct: 367 tttccttctgcttcagc 351



to top

>gb|BT014547.1| Lycopersicon esculentum clone 133964F, mRNA sequence
          Length = 1092

 Score =  103 bits (52), Expect = 5e-19
 Identities = 316/404 (78%)
 Strand = Plus / Minus

                                                                       
Query: 92  ctttccctggccttggtcttcgcttgcgacttcgagcccatgacaccaccaccccacttc 151
           |||||| ||||||||||  | || || ||||| |||||||||| ||||||||||||||||
Sbjct: 795 ctttccttggccttggttctggcctgtgacttagagcccatgataccaccaccccacttc 736

                                                                       
Query: 152 ttcctaacttcatcgaatttgtcattgaagtttgccttgatagcctcaaggatcttgctg 211
           |||||    || ||  | |||||||||||||| ||||| || ||||| |  ||  |||||
Sbjct: 735 ttcctgttctcttcatacttgtcattgaagttagccttaatggcctccaaaattctgctg 676

                                                                       
Query: 212 aactcaagcttatcctcattcttcactgtggtcaggcacagaacagaggcagtcttcttg 271
           ||||| |  || || ||||||||||| || | ||  ||||   | || ||||| ||||| 
Sbjct: 675 aactccattttgtcttcattcttcacggttgacaaacacaaggctgaagcagttttctta 616

                                                                       
Query: 272 tgaacaatcgatccaaggcgagattttcccttaacaatgcagtaagggacctccattttc 331
           || || |||||||| |  |||| ||| ||||| |||||||||||||| |  ||||| || 
Sbjct: 615 tgcacgatcgatcctaaacgagctttgcccttcacaatgcagtaaggaatttccatcttt 556

                                                                       
Query: 332 ctgcaaagggcagggagccacacaaccagctcaatcggatcaacatcatgagctatgaca 391
           ||||| || ||||| ||||| ||||||| ||| || || || || |||||||| || || 
Sbjct: 555 ctgcatagcgcaggaagccagacaaccaactctattgggtccacgtcatgagcaatcact 496

                                                                       
Query: 392 accagctgggctttactctgttcaattaggtaggtaacatggttaaggccatatttcaca 451
           |||| ||| |||||  |||| ||||| ||||| || |  || ||||| ||||| ||||||
Sbjct: 495 accaactgagctttgttctgctcaataaggtaagtgatgtgcttaagcccatacttcaca 436

                                                       
Query: 452 acaattggcttctttgcctcaacagttttcccttcggcttcagc 495
           ||||| || |||||||  |||  |||||| ||||| ||||||||
Sbjct: 435 acaatgggtttctttgtttcaggagtttttccttctgcttcagc 392



to top

>gb|AC155335.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone
              KBrH001H24, complete sequence
          Length = 118144

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 149/183 (81%)
 Strand = Plus / Plus

                                                                          
Query: 283    tccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaagggc 342
              |||||| |||||||| || ||||||||||||||||| || ||||| ||||| ||||| ||
Sbjct: 112054 tccaagacgagatttgcctttaacaatgcagtaaggcacttccatcttcctacaaagagc 112113

                                                                          
Query: 343    agggagccacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctgggc 402
              ||| | ||| || || |||||||| || |||||||| ||||| |||||||| ||||| ||
Sbjct: 112114 aggtaaccagacgacaagctcaatggggtcaacatcgtgagcaatgacaacaagctgcgc 112173

                                                                          
Query: 403    tttactctgttcaattaggtaggtaacatggttaaggccatatttcacaacaattggctt 462
               ||  |||| || || | ||| || || ||||| || ||||| || |||||||| |||||
Sbjct: 112174 cttgttctgctcgatcaagtaagtcacgtggttgagcccatacttgacaacaatgggctt 112233

                 
Query: 463    ctt 465
              |||
Sbjct: 112234 ctt 112236



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                          
Query: 186    ccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactgtggtca 245
              |||||||||| |||||||| ||||||||||| ||||||||||| ||||| || |||||||
Sbjct: 111879 ccttgatagcttcaaggattttgctgaactcgagcttatcctcgttcttgacagtggtca 111938

                    
Query: 246    ggcaca 251
               |||||
Sbjct: 111939 agcaca 111944



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 107/135 (79%)
 Strand = Plus / Plus

                                                                          
Query: 54     cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
              |||||||||| | ||| ||||||||||| || | || ||| ||| | || |||||||| |
Sbjct: 111667 cttagttcattctctgggcagcctccttggcaagaaccctctccttagctttggtcttgg 111726

                                                                          
Query: 114    cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
              |||| ||||| || ||||| |  || || ||||||||||||||    || ||| | ||||
Sbjct: 111727 cttgagacttggatcccattatgcctcctccccacttcttcctgtactcctcgtacttgt 111786

                             
Query: 174    cattgaagtttgcct 188
              | |||||||||||||
Sbjct: 111787 cgttgaagtttgcct 111801



to top

>gb|BC106480.1| Xenopus laevis cDNA clone IMAGE:7211162
          Length = 935

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 87/101 (86%)
 Strand = Plus / Plus

                                                                       
Query: 299 cccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacacaacc 358
           ||||| ||||||||||| |||||  |||| |||||||| | |||||||||  ||||||| 
Sbjct: 335 cccttgacaatgcagtatgggactcccatcttcctgcacaaggcagggaggaacacaaca 394

                                                    
Query: 359 agctcaatcggatcaacatcatgagctatgacaaccagctg 399
           |||||||| ||||||||||||||||| || ||||| |||||
Sbjct: 395 agctcaattggatcaacatcatgagcgatcacaacaagctg 435



to top

>gb|AY393839.1| Xenopus laevis ribosomal protein L7a mRNA, partial cds
          Length = 715

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 87/101 (86%)
 Strand = Plus / Minus

                                                                       
Query: 299 cccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacacaacc 358
           ||||| ||||||||||| |||||  |||| |||||||| | |||||||||  ||||||| 
Sbjct: 522 cccttgacaatgcagtatgggactcccatcttcctgcacaaggcagggaggaacacaaca 463

                                                    
Query: 359 agctcaatcggatcaacatcatgagctatgacaaccagctg 399
           |||||||| ||||||||||||||||| || ||||| |||||
Sbjct: 462 agctcaattggatcaacatcatgagcgatcacaacaagctg 422



to top

>emb|BX821043.1|CNS0A8L9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH94ZE02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 764

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 155/193 (80%)
 Strand = Plus / Minus

                                                                       
Query: 264 tcttcttgtgaacaatcgatccaaggcgagattttcccttaacaatgcagtaagggacct 323
           |||||| |||||||| || ||||||  ||||||| ||||| ||||||||||| || || |
Sbjct: 394 tcttctggtgaacaaccgctccaagaggagatttgcccttcacaatgcagtacggcactt 335

                                                                       
Query: 324 ccattttcctgcaaagggcagggagccacacaaccagctcaatcggatcaacatcatgag 383
           |||| |||||||| |  ||||| | ||||||||||| |||||| || || |||||||| |
Sbjct: 334 ccatcttcctgcacatagcaggaaaccacacaaccaactcaattgggtcgacatcatgcg 275

                                                                       
Query: 384 ctatgacaaccagctgggctttactctgttcaattaggtaggtaacatggttaaggccat 443
           | || ||||| ||  |||| ||  |||| ||||| |||| | | |||| ||| ||||| |
Sbjct: 274 caatcacaacaagtggggccttcttctgctcaatcaggtcgctcacatcgtttaggccgt 215

                        
Query: 444 atttcacaacaat 456
           ||||||| |||||
Sbjct: 214 atttcactacaat 202



to top

>gb|AC155339.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1
             clone KBrH015H17, complete sequence
          Length = 110885

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 149/184 (80%), Gaps = 1/184 (0%)
 Strand = Plus / Plus

                                                                         
Query: 283   tccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaagggc 342
             |||||| |||||||| || ||||||||||||||||| || ||||| ||||| ||||| ||
Sbjct: 25877 tccaagacgagatttgcctttaacaatgcagtaaggcacttccatcttcctacaaagagc 25936

                                                                         
Query: 343   agggagccacacaaccagctcaatcggatcaacatc-atgagctatgacaaccagctggg 401
             ||| | ||| || || |||||||| || ||||||||  ||||| |||||||| ||||| |
Sbjct: 25937 aggtaaccagacgacaagctcaatggggtcaacatcgttgagcaatgacaacaagctgcg 25996

                                                                         
Query: 402   ctttactctgttcaattaggtaggtaacatggttaaggccatatttcacaacaattggct 461
             | ||  |||| || || | ||| || || ||||| || ||||| || |||||||| ||||
Sbjct: 25997 ccttgttctgctcgatcaagtaagtcacgtggttgagcccatacttgacaacaatgggct 26056

                 
Query: 462   tctt 465
             ||||
Sbjct: 26057 tctt 26060



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 186   ccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttcactgtggtca 245
             |||||||||| |||||||| ||||||||||| ||||||||||| ||||| || |||||||
Sbjct: 25702 ccttgatagcttcaaggattttgctgaactcgagcttatcctcgttcttgacagtggtca 25761

                   
Query: 246   ggcaca 251
              |||||
Sbjct: 25762 agcaca 25767



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 107/135 (79%)
 Strand = Plus / Plus

                                                                         
Query: 54    cttagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcg 113
             |||||||||| | ||| ||||||||||| || | || ||| ||| | || |||||||| |
Sbjct: 25490 cttagttcattctctgggcagcctccttggcaagaaccctctccttagctttggtcttgg 25549

                                                                         
Query: 114   cttgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgt 173
             |||| ||||| || ||||| |  || || ||||||||||||||    || ||| | ||||
Sbjct: 25550 cttgagacttggatcccattatgcctcctccccacttcttcctgtactcctcgtacttgt 25609

                            
Query: 174   cattgaagtttgcct 188
             | |||||||||||||
Sbjct: 25610 cgttgaagtttgcct 25624



to top

>gb|AY496113.1| Capsicum annuum 60S ribosomal protein L7A mRNA, partial cds
          Length = 737

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 233/298 (78%)
 Strand = Plus / Minus

                                                                       
Query: 170 ttgtcattgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctca 229
           |||||||||||||| ||||| |||||||| |  |   |||||||||| | ||| || |||
Sbjct: 689 ttgtcattgaagttagccttaatagcctccaaaactctgctgaactccatcttgtcttca 630

                                                                       
Query: 230 ttcttcactgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaagg 289
           |||||||| || ||||  |||||  | || ||||| ||||| || || || ||||| |  
Sbjct: 629 ttcttcacagttgtcaaacacagggctgaagcagttttcttatgcacgattgatcctaaa 570

                                                                       
Query: 290 cgagattttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagc 349
           || | ||| || || |||||||||||||| |  ||||| || ||||| ||||| || |||
Sbjct: 569 cgggctttccctttcacaatgcagtaaggaatttccatctttctgcatagggccggaagc 510

                                                                       
Query: 350 cacacaaccagctcaatcggatcaacatcatgagctatgacaaccagctgggctttactc 409
           || ||||||| |||||| || || ||||||||||| || || || | ||| |||||| ||
Sbjct: 509 cagacaaccaactcaattgggtccacatcatgagcaatcactactaactgagctttattc 450

                                                                     
Query: 410 tgttcaattaggtaggtaacatggttaaggccatatttcacaacaattggcttctttg 467
           || ||||| ||||| || |  || ||||| ||||||||||| | ||| || |||||||
Sbjct: 449 tgctcaataaggtacgtgatgtgcttaagcccatatttcacgataatgggtttctttg 392



to top

>gb|DQ241858.1| Solanum tuberosum clone 014F11 60S ribosomal protein L7A-like mRNA,
           complete cds
          Length = 983

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 136/169 (80%)
 Strand = Plus / Minus

                                                                       
Query: 299 cccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacacaacc 358
           ||||| |||||||||||||| |  ||||| || ||||| || ||||| ||||| ||||||
Sbjct: 541 cccttcacaatgcagtaaggaatttccatctttctgcatagtgcaggaagccagacaacc 482

                                                                       
Query: 359 agctcaatcggatcaacatcatgagctatgacaaccagctgggctttactctgttcaatt 418
           | ||| || || || ||||||||||| || || || || || |||||  |||| ||||| 
Sbjct: 481 aactctattgggtccacatcatgagcaatcactactagttgagctttgttctgctcaata 422

                                                            
Query: 419 aggtaggtaacatggttaaggccatatttcacaacaattggcttctttg 467
           ||||| || | ||| ||||||||||| ||||||| ||| || |||||||
Sbjct: 421 aggtaagtgatatgcttaaggccatacttcacaataatgggtttctttg 373



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 99  tggccttggtcttcgcttgcgacttcgagcccatgacaccaccaccccacttcttcct 156
           ||||||||||| | || || ||||| |||||||||| ||| |||||||||||||||||
Sbjct: 741 tggccttggtcctggcctgtgacttggagcccatgataccgccaccccacttcttcct 684



to top

>gb|BC072834.1| Xenopus laevis MGC80199 protein, mRNA (cDNA clone MGC:80199
           IMAGE:4970819), complete cds
          Length = 916

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 299 cccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacacaacc 358
           ||||| ||||||||||| |||||  |||| |||| ||| | |||||||||  ||||||| 
Sbjct: 602 cccttgacaatgcagtatgggactcccatcttccggcacaaggcagggaggaacacaacg 543

                                                          
Query: 359 agctcaatcggatcaacatcatgagctatgacaaccagctgggcttt 405
           |||||||| ||||| || ||||| || || ||||| ||||| |||||
Sbjct: 542 agctcaatgggatccacgtcatgggcaatcacaacaagctgagcttt 496



to top

>gb|AY769275.1| Bombyx mori ribosomal protein L7A (RpL7A) mRNA, complete cds
          Length = 964

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 355 aaccagctcaatcggatcaacatcatgagctatgacaaccagctg 399
           |||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 624 aaccagctcaataggatcaacatcatgagcgatgaccacaagctg 580



to top

>ref|XM_846090.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC490635), mRNA
          Length = 809

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 353 acaaccagctcaatcggatcaacatcatgagctatgacaaccagctg 399
           |||||||||||||| ||||| |||||||| ||||| || ||||||||
Sbjct: 464 acaaccagctcaatgggatccacatcatgtgctatcactaccagctg 418



to top

>emb|AM049005.1| Meladema coriacea mRNA for ribosomal protein L7Ae (rpL7Ae gene)
          Length = 807

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 66/79 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ccattttcctgcaaagggcagggagccacacaaccagctcaatcggatcaacatcatgag 383
           ||||||||||||| ||||| |||||  | | ||||| |||||  ||||||||||||||||
Sbjct: 538 ccattttcctgcacagggctgggagatagagaaccaactcaagaggatcaacatcatgag 479

                              
Query: 384 ctatgacaaccagctgggc 402
           | || ||||| || |||||
Sbjct: 478 caataacaacaagttgggc 460



to top

>emb|BX825080.1|CNS0A6S2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH94ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 932

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 224/290 (77%)
 Strand = Plus / Minus

                                                                       
Query: 56  tagttcatccgctgcgcagcctcctttgcgataagcctttccctggccttggtcttcgct 115
           |||||||| | ||| ||||| ||||| || |||| ||| ||| | || |||||||| |||
Sbjct: 799 tagttcattctctgggcagcgtccttagcaataaccctctccttcgctttggtcttggct 740

                                                                       
Query: 116 tgcgacttcgagcccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           || || || || ||||| |  ||||| ||||||||||||||    || ||| | ||||| 
Sbjct: 739 tgagagttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 680

                                                                       
Query: 176 ttgaagtttgccttgatagcctcaaggatcttgctgaactcaagcttatcctcattcttc 235
           |||||||  || ||||| ||||| ||||| |||| ||||| |||| | ||||| ||||| 
Sbjct: 679 ttgaagtgagcgttgatggcctcgaggattttgcggaactgaagcgtgtcctcgttcttg 620

                                                                       
Query: 236 actgtggtcaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgagat 295
           |  ||||| | |||||    ||  ||| |||||| |||||| | || ||||||  |||||
Sbjct: 619 agagtggtgaagcacaagggagcagcactcttctggtgaacgaccgctccaagaggagat 560

                                                             
Query: 296 tttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagg 345
           | | |||||| |||||||| |||||| |||| | ||||||| || |||||
Sbjct: 559 tgtgccttaagaatgcagtgagggacttccactctcctgcagagtgcagg 510



to top

>gb|AY924998.1| Seculamonas ecuadoriensis Rpl7A mRNA, partial cds
          Length = 653

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Minus

                                                                       
Query: 284 ccaaggcgagattttcccttaacaatgcagtaagggacctccattttcctgcaaagggca 343
           ||||||||||  || ||||| ||||||||||| |||||  |||| ||| |||| ||||  
Sbjct: 537 ccaaggcgagccttgcccttgacaatgcagtacgggacacccatcttcttgcagagggtc 478

                                     
Query: 344 gggagccacacaaccagctcaatcgg 369
           |||||||| || || |||||||||||
Sbjct: 477 gggagccagacgacgagctcaatcgg 452



to top

>gb|AY439881.1| Armigeres subalbatus ASAP ID: 38933 cytosolic large ribosomal
           subunit L7a mRNA sequence
          Length = 786

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccag 396
           ||||||||||| ||||||||||| ||||  |||||||||||
Sbjct: 571 accagctcaattggatcaacatcgtgagagatgacaaccag 531



to top

>ref|XM_759559.1| Theileria parva strain Muguga 60S ribosomal protein L7a (TP02_0083)
           partial mRNA
          Length = 915

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 311 cagtaagggacctccattttcctgcaaagggcagggagcca 351
           ||||| ||||||||| |||||||||| || |||||||||||
Sbjct: 635 cagtacgggacctcctttttcctgcatagtgcagggagcca 595



to top

>gb|AY925011.1| Trimastix pyriformis ATCC50562 Rpl7A gene, partial cds
          Length = 608

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 284 ccaaggcgagattttcccttaacaatgcagtaagggacctccat 327
           ||||||||||  || ||||||||||||||||| ||||| |||||
Sbjct: 388 ccaaggcgagccttgcccttaacaatgcagtaggggacgtccat 345



to top

>gb|DQ118092.1| Trimastix pyriformis ribosomal protein L7A mRNA, complete cds
          Length = 804

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 284 ccaaggcgagattttcccttaacaatgcagtaagggacctccat 327
           ||||||||||  || ||||||||||||||||| ||||| |||||
Sbjct: 572 ccaaggcgagccttgcccttaacaatgcagtaggggacgtccat 529



to top

>emb|AL441963.7| Human DNA sequence from clone RP11-280O24 on chromosome 9 Contains a ATP
              synthase, H+ transporting, mitochondrial F0 complex,
              subunit d (ATP5H) (ATPQ, ATP5JD) pseudogene, the 3' end of
              the NFIB gene for nuclear factor I/B (NFIB2, NFIB3,
              NFI-RED) and a ribosomal protein L7a (RPL7A) pseudogene,
              complete sequence
          Length = 159476

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                          
Query: 309    tgcagtaagggacctccattttcctgcaaagggcagggagccacacaaccagctcaatcg 368
              |||||||||||||| ||||||| |  || |||||||| ||  ||||||||||||| || |
Sbjct: 141326 tgcagtaagggacccccattttacgacacagggcaggcaggaacacaaccagctcgatgg 141267

                  
Query: 369    gatc 372
              ||||
Sbjct: 141266 gatc 141263



to top

>emb|AM049007.1| Scarabaeus laticollis mRNA for ribosomal protein L7Ae (rpL7Ae gene)
          Length = 810

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 359 agctcaatcggatcaacatcatgagctatgacaaccagctgggc 402
           ||||||||||| ||||||||||| || |||||||| || |||||
Sbjct: 506 agctcaatcgggtcaacatcatgcgcaatgacaacaagttgggc 463



to top

>gb|AY924996.1| Malawimonas jakobiformis Rpl7A mRNA, partial cds
          Length = 735

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 344 gggagccacacaaccagctcaatcggatcaacatcatgagctatgacaacca 395
           |||||||| | ||| ||||||||||| |||||||| ||||| ||||| ||||
Sbjct: 568 gggagccagagaacaagctcaatcgggtcaacatcgtgagcgatgacgacca 517



to top

>gb|AF401560.1| Ictalurus punctatus ribosomal protein L7a mRNA, complete cds
          Length = 860

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 87/108 (80%)
 Strand = Plus / Minus

                                                                       
Query: 295 ttttcccttaacaatgcagtaagggacctccattttcctgcaaagggcagggagccacac 354
           |||||| ||||| |||||||| |||||  |||| || | ||| || ||||| ||  ||| 
Sbjct: 566 ttttcctttaacgatgcagtatgggacacccatcttacggcacagagcaggcaggaacaa 507

                                                           
Query: 355 aaccagctcaatcggatcaacatcatgagctatgacaaccagctgggc 402
            |||||||| || || || ||||||||||| || ||||||||||||||
Sbjct: 506 caccagctcgattgggtcgacatcatgagcgatcacaaccagctgggc 459



to top

>gb|AC022294.15| Homo sapiens 3 BAC RP11-4B14 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 153940

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 299   cccttaacaatgcagtaagggacctccatttt 330
             ||||||| |||||||||||||||| |||||||
Sbjct: 68347 cccttaataatgcagtaagggacccccatttt 68316



to top

>gb|AY239295.1| Homo sapiens proliferation-inducing protein 10 mRNA, complete cds
          Length = 3245

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 342 tttcccttgataatgcagtaagggacccccatttt 376



to top

>gb|AY239294.1| Homo sapiens proliferation-inducing protein 9 mRNA, complete cds
          Length = 3245

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 342 tttcccttgataatgcagtaagggacccccatttt 376



to top

>gb|BC059533.1| Danio rerio ribosomal protein L7a, mRNA (cDNA clone MGC:73183
           IMAGE:4786870), complete cds
          Length = 854

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 351 acacaaccagctcaatcggatcaacatcatgagctatgacaaccagctgggcttt 405
           |||| ||||||||||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 508 acaccaccagctcaatgggatccacatcatgagcaataacgaccagttgtgcttt 454



to top

>gb|AY389942.1| Protopterus dolloi ribosomal protein L7a-like mRNA, partial
           sequence
          Length = 666

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 359 agctcaatcggatcaacatcatgagctatgacaaccagctgggcttt 405
           |||||||| ||||||||||||||||| |   | ||||||||||||||
Sbjct: 417 agctcaataggatcaacatcatgagcaacagcgaccagctgggcttt 371



to top

>gb|BC073802.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:88823
           IMAGE:4336858), complete cds
          Length = 892

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 561 tttcccttgataatgcagtaagggacccccatttt 527



to top

>gb|BC023624.2| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:23179
           IMAGE:4810336), complete cds
          Length = 944

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 626 tttcccttgataatgcagtaagggacccccatttt 592



to top

>gb|BC023594.2| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:23150
           IMAGE:4841982), complete cds
          Length = 939

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 621 tttcccttgataatgcagtaagggacccccatttt 587



to top

>gb|BC021979.2| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:16547
           IMAGE:4053567), complete cds
          Length = 882

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 562 tttcccttgataatgcagtaagggacccccatttt 528



to top

>gb|BC105290.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:104270
           IMAGE:6495031), complete cds
          Length = 915

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 587 tttcccttgataatgcagtaagggacccccatttt 553



to top

>ref|XM_535657.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a
           (LOC478479), mRNA
          Length = 574

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 353 acaaccagctcaatcggatcaacatcatgagctatgacaaccagctg 399
           |||||||||||| | ||||| |||||||| ||||| || ||||||||
Sbjct: 227 acaaccagctcagtgggatccacatcatgggctatcactaccagctg 181



to top

>emb|X61923.1|HSSURF3 H.sapiens surf3 gene for ribosomal protein L7a
          Length = 3433

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 296  tttcccttaacaatgcagtaagggacctccatttt 330
            |||||||| | |||||||||||||||| |||||||
Sbjct: 2662 tttcccttgataatgcagtaagggacccccatttt 2628



to top

>gb|BC069215.1| Homo sapiens cDNA clone IMAGE:6375716, **** WARNING: chimeric clone
            ****
          Length = 1796

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 296  tttcccttaacaatgcagtaagggacctccatttt 330
            |||||||| | |||||||||||||||| |||||||
Sbjct: 1478 tttcccttgataatgcagtaagggacccccatttt 1444



to top

>gb|BC082978.1| Homo sapiens cDNA clone IMAGE:6579115, **** WARNING: chimeric clone
            ****
          Length = 1968

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 296  tttcccttaacaatgcagtaagggacctccatttt 330
            |||||||| | |||||||||||||||| |||||||
Sbjct: 1666 tttcccttgataatgcagtaagggacccccatttt 1632



to top

>gb|BC012174.2| Homo sapiens cDNA clone IMAGE:4643754, **** WARNING: chimeric clone
           ****
          Length = 1710

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 315 tttcccttgataatgcagtaagggacccccatttt 349



to top

>ref|NG_000837.1| Homo sapiens surfeit locus (SURF@) on chromosome 9
          Length = 45425

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 296   tttcccttaacaatgcagtaagggacctccatttt 330
             |||||||| | |||||||||||||||| |||||||
Sbjct: 19975 tttcccttgataatgcagtaagggacccccatttt 19941



to top

>ref|NM_000972.2| Homo sapiens ribosomal protein L7a (RPL7A), mRNA
          Length = 890

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 590 tttcccttgataatgcagtaagggacccccatttt 556



to top

>emb|AL158826.23| Human DNA sequence from clone RP11-244N20 on chromosome 9 Contains the
             5' end of the ABO gene for ABO blood group (transferase A
             alpha 1-3-N-acetylgalactosaminyltransferase; transferase B
             alpha 1-3-galactosyltransferase) pseudogene ABO-*O02
             allele, the gene for a novel protein similar to lipocalin
             1 (protein migrating faster than albumin tear prealbumin)
             (LCN1), a ribosomal protein L21 (RPL21) pseudogene, the
             RPL7A gene for ribosomal protein L7a, a novel gene
             (MGC43306), the XPMC2H gene for Xenopus prevents mitotic
             catastrophe 2 homolog, the 5' end of the ADAMTS13 gene for
             a disintegrin-like and metalloprotease (reprolysin type)
             with thrombospondin type 1 motif 13, the SURF1 gene for
             surfeit 1, the SURF2 gene for surfeit 2, the SURF4 gene
             for surfeit 4, the SURF5 gene for surfeit 5, the SURF6
             gene for surfeit 6 and eight CpG islands, complete
             sequence
          Length = 184513

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 296   tttcccttaacaatgcagtaagggacctccatttt 330
             |||||||| | |||||||||||||||| |||||||
Sbjct: 84172 tttcccttgataatgcagtaagggacccccatttt 84138



to top

>gb|BC005128.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:10607
           IMAGE:3938260), complete cds
          Length = 892

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 573 tttcccttgataatgcagtaagggacccccatttt 539



to top

>emb|AJ224080.1|HSAJ4080 Homo sapiens rpL7a pseudogene, clone 10
          Length = 949

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 80/99 (80%)
 Strand = Plus / Minus

                                                                       
Query: 307 aatgcagtaagggacctccattttcctgcaaagggcagggagccacacaaccagctcaat 366
           |||||||||||||||| ||||||| |  || |||||||| |   | ||||||||||| ||
Sbjct: 582 aatgcagtaagggacccccattttacgacacagggcaggcaagaagacaaccagctcgat 523

                                                  
Query: 367 cggatcaacatcatgagctatgacaaccagctgggcttt 405
            ||||| ||||| || || || || |||||||| |||||
Sbjct: 522 gggatccacatcgtgtgcaatcaccaccagctgagcttt 484



to top

>emb|CR626449.1| full-length cDNA clone CS0DI008YE21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 744

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 443 tttcccttgataatgcagtaagggacccccatttt 409



to top

>emb|CR626332.1| full-length cDNA clone CS0DI072YC01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 849

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR625438.1| full-length cDNA clone CS0DF028YK01 of Fetal brain of Homo sapiens
           (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR624133.1| full-length cDNA clone CS0DJ002YP23 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR624123.1| full-length cDNA clone CS0DI068YF02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 868

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR623324.1| full-length cDNA clone CL0BB020ZB03 of Neuroblastoma of Homo
           sapiens (human)
          Length = 849

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR622399.1| full-length cDNA clone CS0DK005YH12 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR621543.1| full-length cDNA clone CS0DF006YL14 of Fetal brain of Homo sapiens
           (human)
          Length = 611

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 310 tttcccttgataatgcagtaagggacccccatttt 276



to top

>emb|CR620132.1| full-length cDNA clone CS0DA002YB17 of Neuroblastoma of Homo
           sapiens (human)
          Length = 861

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 560 tttcccttgataatgcagtaagggacccccatttt 526



to top

>emb|CR620003.1| full-length cDNA clone CS0DI019YE20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 835

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 534 tttcccttgataatgcagtaagggacccccatttt 500



to top

>emb|CR619456.1| full-length cDNA clone CS0DJ008YK12 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 863

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR618604.1| full-length cDNA clone CS0DC017YJ22 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 554

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 253 tttcccttgataatgcagtaagggacccccatttt 219



to top

>emb|CR618555.1| full-length cDNA clone CS0DI032YH07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR618005.1| full-length cDNA clone CS0DJ012YM08 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 828

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 557 tttcccttgataatgcagtaagggacccccatttt 523



to top

>emb|CR617703.1| full-length cDNA clone CS0DC023YL20 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR616252.1| full-length cDNA clone CS0DH002YO03 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 849

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR612749.1| full-length cDNA clone CS0DI008YF18 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 849

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR612394.1| full-length cDNA clone CS0DA004YP13 of Neuroblastoma of Homo
           sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR611385.1| full-length cDNA clone CS0DA004YA15 of Neuroblastoma of Homo
           sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR611037.1| full-length cDNA clone CS0DF026YB01 of Fetal brain of Homo sapiens
           (human)
          Length = 863

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR609256.1| full-length cDNA clone CS0DD001YK02 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR608942.1| full-length cDNA clone CS0DA004YF01 of Neuroblastoma of Homo
           sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR608873.1| full-length cDNA clone CS0DA002YH20 of Neuroblastoma of Homo
           sapiens (human)
          Length = 864

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR608089.1| full-length cDNA clone CS0DI040YM16 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 849

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR607087.1| full-length cDNA clone CS0DE002YC01 of Placenta of Homo sapiens
           (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR605545.1| full-length cDNA clone CS0DE005YD07 of Placenta of Homo sapiens
           (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR605232.1| full-length cDNA clone CS0DI042YI01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 866

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR602650.1| full-length cDNA clone CS0DF020YM12 of Fetal brain of Homo sapiens
           (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR601819.1| full-length cDNA clone CS0DF011YI01 of Fetal brain of Homo sapiens
           (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR601499.1| full-length cDNA clone CS0DI063YH20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR600454.1| full-length cDNA clone CS0DH003YI02 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR599403.1| full-length cDNA clone CL0BB016ZC01 of Neuroblastoma of Homo
           sapiens (human)
          Length = 857

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR598739.1| full-length cDNA clone CS0DA006YH23 of Neuroblastoma of Homo
           sapiens (human)
          Length = 842

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR596222.1| full-length cDNA clone CS0DK006YL18 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR595948.1| full-length cDNA clone CS0DI064YJ09 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1486

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 296  tttcccttaacaatgcagtaagggacctccatttt 330
            |||||||| | |||||||||||||||| |||||||
Sbjct: 1022 tttcccttgataatgcagtaagggacccccatttt 988



to top

>emb|CR594094.1| full-length cDNA clone CL0BB027ZC11 of Neuroblastoma of Homo
           sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR593347.1| full-length cDNA clone CS0DI039YP05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR593208.1| full-length cDNA clone CS0DE003YC07 of Placenta of Homo sapiens
           (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR592716.1| full-length cDNA clone CS0DI042YK12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 843

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 542 tttcccttgataatgcagtaagggacccccatttt 508



to top

>emb|CR592304.1| full-length cDNA clone CS0DA005YN22 of Neuroblastoma of Homo
           sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR590883.1| full-length cDNA clone CS0DC024YJ24 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>emb|CR590295.1| full-length cDNA clone CS0DF023YB23 of Fetal brain of Homo sapiens
           (human)
          Length = 859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 558 tttcccttgataatgcagtaagggacccccatttt 524



to top

>gb|AC044782.6| Homo sapiens chromosome 10 clone RP11-170M17, complete sequence
          Length = 149041

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 80/99 (80%)
 Strand = Plus / Minus

                                                                         
Query: 307   aatgcagtaagggacctccattttcctgcaaagggcagggagccacacaaccagctcaat 366
             |||||||||||||||| ||||||| |  || |||||||| |   | ||||||||||| ||
Sbjct: 96802 aatgcagtaagggacccccattttacgacacagggcaggcaagaagacaaccagctcgat 96743

                                                    
Query: 367   cggatcaacatcatgagctatgacaaccagctgggcttt 405
              ||||| ||||| || || || || |||||||| |||||
Sbjct: 96742 gggatccacatcgtgtgcaatcaccaccagctgagcttt 96704



to top

>gb|AC069543.5| Homo sapiens chromosome 10 clone RP11-393H5, complete sequence
          Length = 179789

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 80/99 (80%)
 Strand = Plus / Plus

                                                                          
Query: 307    aatgcagtaagggacctccattttcctgcaaagggcagggagccacacaaccagctcaat 366
              |||||||||||||||| ||||||| |  || |||||||| |   | ||||||||||| ||
Sbjct: 110527 aatgcagtaagggacccccattttacgacacagggcaggcaagaagacaaccagctcgat 110586

                                                     
Query: 367    cggatcaacatcatgagctatgacaaccagctgggcttt 405
               ||||| ||||| || || || || |||||||| |||||
Sbjct: 110587 gggatccacatcgtgtgcaatcaccaccagctgagcttt 110625



to top

>ref|NG_003062.1| Homo sapiens ribosomal protein L7a pseudogene 1 (RPL7AP1) on
           chromosome 10
          Length = 949

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 80/99 (80%)
 Strand = Plus / Minus

                                                                       
Query: 307 aatgcagtaagggacctccattttcctgcaaagggcagggagccacacaaccagctcaat 366
           |||||||||||||||| ||||||| |  || |||||||| |   | ||||||||||| ||
Sbjct: 582 aatgcagtaagggacccccattttacgacacagggcaggcaagaagacaaccagctcgat 523

                                                  
Query: 367 cggatcaacatcatgagctatgacaaccagctgggcttt 405
            ||||| ||||| || || || || |||||||| |||||
Sbjct: 522 gggatccacatcgtgtgcaatcaccaccagctgagcttt 484



to top

>dbj|AK222534.1| Homo sapiens mRNA for ribosomal protein L7a variant, clone:
           adSE01733
          Length = 904

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 587 tttcccttgataatgcagtaagggacccccatttt 553



to top

>ref|NM_200047.1| Danio rerio ribosomal protein L7a (rpl7a), mRNA
          Length = 854

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 351 acacaaccagctcaatcggatcaacatcatgagctatgacaaccagctgggcttt 405
           |||| ||||||||||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 508 acaccaccagctcaatgggatccacatcatgagcaataacgaccagttgtgcttt 454



to top

>gb|AY892190.1| Synthetic construct Homo sapiens clone FLH029846.01L ribosomal
           protein L7a (RPL7A) mRNA, partial cds
          Length = 801

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 560 tttcccttgataatgcagtaagggacccccatttt 526



to top

>gb|AY889730.1| Synthetic construct Homo sapiens clone FLH029850.01X ribosomal
           protein L7a (RPL7A) mRNA, complete cds
          Length = 801

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 560 tttcccttgataatgcagtaagggacccccatttt 526



to top

>emb|BX641050.1|HSM806744 Homo sapiens mRNA; cDNA DKFZp686J0697 (from clone DKFZp686J0697)
          Length = 3020

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 296  tttcccttaacaatgcagtaagggacctccatttt 330
            |||||||| | |||||||||||||||| |||||||
Sbjct: 2251 tttcccttgataatgcagtaagggacccccatttt 2217



to top

>gb|BC071900.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:88579
           IMAGE:6090366), complete cds
          Length = 880

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 562 tttcccttgataatgcagtaagggacccccatttt 528



to top

>gb|BC071901.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone MGC:88580
           IMAGE:6262332), complete cds
          Length = 874

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 570 tttcccttgataatgcagtaagggacccccatttt 536



to top

>gb|BC071352.1| Danio rerio ribosomal protein L7a, mRNA (cDNA clone MGC:86667
           IMAGE:6894731), complete cds
          Length = 889

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 351 acacaaccagctcaatcggatcaacatcatgagctatgacaaccagctgggcttt 405
           |||| ||||||||||| ||||| ||||||||||| || || ||||| || |||||
Sbjct: 524 acaccaccagctcaatgggatccacatcatgagcaataacgaccagttgtgcttt 470



to top

>gb|BC021052.1| Homo sapiens ribosomal protein L7a, mRNA (cDNA clone IMAGE:3505760)
          Length = 882

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 564 tttcccttgataatgcagtaagggacccccatttt 530



to top

>gb|AC002107.1|AC002107 Genomic sequence from Human 9q34, complete sequence
          Length = 39265

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 296   tttcccttaacaatgcagtaagggacctccatttt 330
             |||||||| | |||||||||||||||| |||||||
Sbjct: 31374 tttcccttgataatgcagtaagggacccccatttt 31340



to top

>gb|M36072.1|HUMRPL7A Human ribosomal protein L7a (surf 3) large subunit mRNA, complete
           cds
          Length = 891

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 591 tttcccttgataatgcagtaagggacccccatttt 557



to top

>emb|X06705.1|HSPLAX Human PLA-X mRNA
          Length = 883

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 590 tttcccttgataatgcagtaagggacccccatttt 556



to top

>emb|X52138.1|HSL7A Human L7a gene for large ribosomal subunit component (L7a)
          Length = 5506

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 296  tttcccttaacaatgcagtaagggacctccatttt 330
            |||||||| | |||||||||||||||| |||||||
Sbjct: 4505 tttcccttgataatgcagtaagggacccccatttt 4471



to top

>dbj|AB056665.1| Homo sapiens RP-L7a mRNA for ribosomal protein L7a, partial cds
          Length = 502

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 296 tttcccttaacaatgcagtaagggacctccatttt 330
           |||||||| | |||||||||||||||| |||||||
Sbjct: 189 tttcccttgataatgcagtaagggacccccatttt 155



to top

>gb|AY389941.1| Latimeria chalumnae ribosomal protein L7a-like mRNA, partial
           sequence
          Length = 704

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 356 accagctcaatcggatcaacatcatgagctatga 389
           ||||||||||| ||||| ||||||||||| ||||
Sbjct: 464 accagctcaatgggatccacatcatgagcaatga 431



to top

>ref|XM_962142.1| PREDICTED: Tribolium castaneum similar to CG3314-PD, isoform D
           (LOC655581), mRNA
          Length = 968

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 299 cccttaacaatgcagtaagggacctccattttcctgca 336
           ||||| ||||| ||||| |||||| |||||||||||||
Sbjct: 663 cccttgacaatacagtaggggacccccattttcctgca 626



to top

>ref|XM_523914.1| PREDICTED: Pan troglodytes similar to ribosomal protein L7a; thyroid
            hormone receptor uncoupling protein; 60S ribosomal
            protein L7a; surfeit 3; surfeit locus protein 3; PLA-X
            polypeptide (LOC468525), mRNA
          Length = 1365

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 75/93 (80%)
 Strand = Plus / Minus

                                                                        
Query: 307  aatgcagtaagggacctccattttcctgcaaagggcagggagccacacaaccagctcaat 366
            |||||||||||||||| ||||||| |  || |||||||| |   | ||||||||||| ||
Sbjct: 1113 aatgcagtaagggacccccattttacgacacagggcaggcaagaagacaaccagctcgat 1054

                                             
Query: 367  cggatcaacatcatgagctatgacaaccagctg 399
             ||||| || ||||| || || || ||||||||
Sbjct: 1053 gggatccacgtcatgtgcaatcaccaccagctg 1021



to top

>ref|NM_196995.1| Oryza sativa (japonica cultivar-group) putative polyubiquitin
           (OSJNBb0044B19.4), mRNA
          Length = 1346

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 216 caagcttatcctcattcttca 236
           |||||||||||||||||||||
Sbjct: 318 caagcttatcctcattcttca 298



to top

>ref|XM_848911.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a
           (LOC492106), mRNA
          Length = 750

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 353 acaaccagctcaatcggatcaacatcatg 381
           |||||||||||||| ||||| ||||||||
Sbjct: 452 acaaccagctcaatgggatccacatcatg 424



to top

>ref|XM_537800.2| PREDICTED: Canis familiaris Ribosomal protein L7a (RPL7A), mRNA
          Length = 907

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 75/93 (80%)
 Strand = Plus / Minus

                                                                       
Query: 307 aatgcagtaagggacctccattttcctgcaaagggcagggagccacacaaccagctcaat 366
           |||||||||||| ||| |||| || |  || |||||||| ||  | ||||||||||||||
Sbjct: 599 aatgcagtaaggaacccccatcttacgacacagggcaggcaggaagacaaccagctcaat 540

                                            
Query: 367 cggatcaacatcatgagctatgacaaccagctg 399
            ||||| || || || ||||| || ||||||||
Sbjct: 539 gggatccacgtcgtgggctatcactaccagctg 507



to top

>gb|AC078893.10| Oryza sativa chromosome 10 BAC OSJNBb0044B19 genomic sequence, complete
             sequence
          Length = 81784

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 216   caagcttatcctcattcttca 236
             |||||||||||||||||||||
Sbjct: 38594 caagcttatcctcattcttca 38614



to top

>gb|AY857419.1| Suberites domuncula L7a mRNA, complete cds
          Length = 807

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 acacaaccagctcaatcggatcaacatcatgagctatgacaacca 395
           |||| |||| ||| || |||||||| || ||||||||||||||||
Sbjct: 514 acaccaccacctcgatgggatcaacgtcgtgagctatgacaacca 470



to top

>ref|XM_393034.2| PREDICTED: Apis mellifera similar to ribosomal protein L7A
           (LOC409528), mRNA
          Length = 1056

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 160 ttcatcgaatttgtcattgaagtttgccttgatagcctcaa 200
           ||||||| || | ||||||||||||| ||| ||||||||||
Sbjct: 818 ttcatcgtatctatcattgaagtttgtcttaatagcctcaa 778



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 216      caagcttatcctcattcttca 236
                |||||||||||||||||||||
Sbjct: 17209006 caagcttatcctcattcttca 17208986



to top

>gb|AY130409.1| Scyliorhinus canicula ribosomal protein L7A-like mRNA, partial
           sequence
          Length = 796

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 305 acaatgcagtaagggacctccattttcctgcaaagggcagggagccacacaaccagctca 364
           |||||||| ||||| ||  |||| |||| ||| || ||||| ||  |||| |||||||||
Sbjct: 550 acaatgcaataaggaactcccatcttccggcagagcgcaggcaggaacacgaccagctca 491

                            
Query: 365 atcggatcaacatcatg 381
           || || |||||||||||
Sbjct: 490 atggggtcaacatcatg 474



to top

>gb|AY130406.1| Branchiostoma lanceolatum ribosomal protein L7A-like mRNA, partial
           sequence
          Length = 715

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 127 gcccatgacaccaccacccca 147
           |||||||||||||||||||||
Sbjct: 697 gcccatgacaccaccacccca 677



to top

>dbj|AK101853.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033069L14, full
           insert sequence
          Length = 1356

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 216 caagcttatcctcattcttca 236
           |||||||||||||||||||||
Sbjct: 358 caagcttatcctcattcttca 338



to top

>emb|AL138499.4|CNS01DWU Human chromosome 14 DNA sequence BAC R-132J14 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 185713

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 310   gcagtaagggacctccatttt 330
             |||||||||||||||||||||
Sbjct: 43079 gcagtaagggacctccatttt 43059



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 216      caagcttatcctcattcttca 236
                |||||||||||||||||||||
Sbjct: 17218046 caagcttatcctcattcttca 17218026



to top

>gb|AC119240.11| Mus musculus chromosome 3, clone RP24-228K15, complete sequence
          Length = 161819

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   aactcaagcttatcctcatt 231
             ||||||||||||||||||||
Sbjct: 50282 aactcaagcttatcctcatt 50263



to top

>ref|XM_510379.1| PREDICTED: Pan troglodytes LOC453407 (LOC453407), mRNA
          Length = 644

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 59/72 (81%)
 Strand = Plus / Minus

                                                                       
Query: 307 aatgcagtaagggacctccattttcctgcaaagggcagggagccacacaaccagctcaat 366
           |||||||||||||||| ||||||| |  || |||||||| |   | ||||||||||| ||
Sbjct: 333 aatgcagtaagggacccccattttacgacacagggcaggcaagaagacaaccagctcgat 274

                       
Query: 367 cggatcaacatc 378
            ||||| |||||
Sbjct: 273 gggatccacatc 262



to top

>ref|XM_507735.1| PREDICTED: Pan troglodytes similar to hypothetical protein
           (LOC450396), mRNA
          Length = 3771

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 549 aatgcagtaagggacccccatttt 526



to top

>ref|XM_528454.1| PREDICTED: Pan troglodytes similar to ribosomal protein L7a;
           thyroid hormone receptor uncoupling protein; 60S
           ribosomal protein L7a; surfeit 3; surfeit locus protein
           3; PLA-X polypeptide (LOC473084), mRNA
          Length = 1062

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 810 aatgcagtaagggacccccatttt 787



to top

>ref|XM_517569.1| PREDICTED: Pan troglodytes similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC461647), mRNA
          Length = 580

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 505 aatgcagtaagggacccccatttt 482



to top

>gb|CP000114.1| Streptococcus agalactiae A909, complete genome
          Length = 2127839

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    ttgaagtttgccttgatagc 195
              ||||||||||||||||||||
Sbjct: 670551 ttgaagtttgccttgatagc 670532



to top

>gb|AC113454.8| Mus musculus chromosome 3, clone RP24-176I19, complete sequence
          Length = 171480

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    aactcaagcttatcctcatt 231
              ||||||||||||||||||||
Sbjct: 165280 aactcaagcttatcctcatt 165261



to top

>ref|XM_445858.1| Candida glabrata CBS138, CAGL0E03938g partial mRNA
          Length = 771

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 128 cccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
           ||||||| |||||||||||| | |||| | ||||||||| | ||||||
Sbjct: 716 cccatgataccaccaccccagtgcttcttgacttcatcgtacttgtca 669



to top

>gb|AC127349.3| Mus musculus BAC clone RP23-62M5 from chromosome 13, complete sequence
          Length = 193255

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 464    tttgcctcaacagttttccc 483
              ||||||||||||||||||||
Sbjct: 103493 tttgcctcaacagttttccc 103512



to top

>gb|AC124525.3| Mus musculus BAC clone RP23-406I17 from chromosome 2, complete sequence
          Length = 173181

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 319    gacctccattttcctgcaaa 338
              ||||||||||||||||||||
Sbjct: 110752 gacctccattttcctgcaaa 110771



to top

>ref|XM_644983.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal protein L7a, putative
           (248.t00005) partial mRNA
          Length = 861

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 tttcccttaacaatgcagta 315
           ||||||||||||||||||||
Sbjct: 539 tttcccttaacaatgcagta 520



to top

>ref|XM_850046.1| PREDICTED: Canis familiaris similar to cAMP responsive element
            binding protein 3-like 4 (LOC612303), mRNA
          Length = 1542

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 99   tggccttggtcttcgcttgc 118
            ||||||||||||||||||||
Sbjct: 1235 tggccttggtcttcgcttgc 1216



to top

>ref|XM_850043.1| PREDICTED: Canis familiaris similar to jumping translocation
           breakpoint (LOC612300), mRNA
          Length = 1116

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 99  tggccttggtcttcgcttgc 118
           ||||||||||||||||||||
Sbjct: 634 tggccttggtcttcgcttgc 653



to top

>emb|CR648468.2|CNS0EZBU Tetraodon nigroviridis full-length cDNA
          Length = 829

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 371 tcaacatcatgagctatgacaaccagctgggc 402
           |||||||||||||| ||||  |||||||||||
Sbjct: 483 tcaacatcatgagcaatgatgaccagctgggc 452



to top

>emb|AL604028.15| Human DNA sequence from clone RP11-767N6 on chromosome 1 Contains the
             gene for a novel protein (SP192) (DKFZp434H1428,
             FLJ21319), a ribosomal protein S15a (RPS15A) pseudogene, a
             ribosomal protein L7a (RPL7A) pseudogene, the gene for a
             novel protein (FLJ21029) and one CpG island, complete
             sequence
          Length = 82964

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 307   aatgcagtaagggacctccatttt 330
             |||||||||||||||| |||||||
Sbjct: 26381 aatgcagtaagggacccccatttt 26404



to top

>emb|AL591623.15| Human DNA sequence from clone RP11-1086F11 on chromosome 1 Contains
             part of the gene for a novel protein (FLJ32001), a novel
             gene and a ribosomal protein L7a (RPL7A) pseudogene,
             complete sequence
          Length = 82383

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 307   aatgcagtaagggacctccatttt 330
             |||||||||||||||| |||||||
Sbjct: 56779 aatgcagtaagggacccccatttt 56802



to top

>emb|AL590077.19| Human DNA sequence from clone RP11-35F15 on chromosome X Contains the
             5' end of the ATP11C gene for ATPase, Class VI, type 11C
             (ATPIG, ATPIQ), the gene for a novel protein and a CpG
             island, complete sequence
          Length = 71877

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 133   gacaccaccaccccacttcttcct 156
             |||||||||||||| |||||||||
Sbjct: 23143 gacaccaccacccctcttcttcct 23120



to top

>emb|AL356378.17| Human DNA sequence from clone RP11-337C18 on chromosome 1 Contains the
             PRKAB2 gene for protein kinase, AMP-activated, beta 2
             non-catalytic subunit protein, a FMO5 gene for the flavin
             containing monooxygenase 5 protein, the CHD1L gene for
             chromodomain helicase DNA binding protein 1-like
             (FLJ22530) protein, a processed pseudogene similar to
             glucose regulated protein, 58kDa (GRP58), a processed
             pseudogene similar to chaperonin containing TCP1, subunit
             8 (theta) (CCT8) protein, a processed pseudogene similar
             to ribosomal protein L7a (RPL7A) protein, a processed
             pseudogene similar to leukotriene B4
             12-hydroxydehydrogenase (LTB4DH) protein and three CpG
             islands, complete sequence
          Length = 202955

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 307   aatgcagtaagggacctccatttt 330
             |||||||||||||||| |||||||
Sbjct: 93678 aatgcagtaagggacccccatttt 93655



to top

>emb|AL162853.17| Human DNA sequence from clone RP11-363G2 on chromosome 13 Contains a
             ribosomal protein L7a (RPL7A) pseudogene, a pseudogene
             similar to part of inositol hexakisphosphate kinase 1
             (IHPK1) (KIAA0263), a novel pseudogene, a novel gene and 2
             CpG islands, complete sequence
          Length = 123693

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 307   aatgcagtaagggacctccatttt 330
             |||||||||||||||| |||||||
Sbjct: 38592 aatgcagtaagggacccccatttt 38569



to top

>emb|AL354681.8| Human DNA sequence from clone RP11-534L20 on chromosome 1 Contains the
             IKBKE gene for inhibitor of kappa light polypeptide gene
             enhancer in B-cells kinase epsilon, a novel gene, the 5'
             end of the RASSF5 gene for Ras association (RalGDS/AF-6)
             domain family 5, a ribosomal protein L7a (RPL7A)
             pseudogene and a CpG island, complete sequence
          Length = 107689

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 307   aatgcagtaagggacctccatttt 330
             |||||||||||||||| |||||||
Sbjct: 63092 aatgcagtaagggacccccatttt 63069



to top

>emb|AL135933.11| Human DNA sequence from clone RP4-774E4 on chromosome 11p13-14.2
             Contains a pseudogene similar to ribosomal protein L7a,
             STSs and GSSs, complete sequence
          Length = 111135

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 307   aatgcagtaagggacctccatttt 330
             |||||||||||||||| |||||||
Sbjct: 33521 aatgcagtaagggacccccatttt 33498



to top

>emb|AL136226.9| Human DNA sequence from clone RP3-486D24 on chromosome 6 Contains a
             ribosomal protein L7A (RPL7A) pseudogene and a CpG island,
             complete sequence
          Length = 72553

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 299   cccttaacaatgcagtaagggacc 322
             ||||||| ||||||||||||||||
Sbjct: 58115 cccttaataatgcagtaagggacc 58092



to top

>emb|AL133333.15| Human DNA sequence from clone RP11-462L8 on chromosome 10 Contains the
             3' end of a novel gene, a ribosomal protein L7a (RPL7A)
             pseudogene and a CpG island, complete sequence
          Length = 47610

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 307   aatgcagtaagggacctccatttt 330
             |||||||||||||||| |||||||
Sbjct: 15998 aatgcagtaagggacccccatttt 16021



to top

>emb|CR936627.1| Homo sapiens mRNA; cDNA DKFZp781A0112 (from clone DKFZp781A0112)
          Length = 10778

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 307  aatgcagtaagggacctccatttt 330
            |||||||||||||||| |||||||
Sbjct: 3523 aatgcagtaagggacccccatttt 3546



to top

>emb|CR380951.1| Candida glabrata strain CBS138 chromosome E complete sequence
          Length = 687501

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                              
Query: 128    cccatgacaccaccaccccacttcttcctaacttcatcgaatttgtca 175
              ||||||| |||||||||||| | |||| | ||||||||| | ||||||
Sbjct: 374688 cccatgataccaccaccccagtgcttcttgacttcatcgtacttgtca 374641



to top

>gb|AC079841.10| Homo sapiens 3 BAC RP11-10G15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 167865

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 307    aatgcagtaagggacctccatttt 330
              |||||||||||||||| |||||||
Sbjct: 152378 aatgcagtaagggacccccatttt 152355



to top

>emb|AJ224081.1|HSAJ4081 Homo sapiens rpL7a pseudogene, clone 34
          Length = 1200

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 875 aatgcagtaagggacccccatttt 852



to top

>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete sequence
          Length = 1877212

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 113     gcttgcgacttcgagcccat 132
               ||||||||||||||||||||
Sbjct: 1192056 gcttgcgacttcgagcccat 1192037



to top

>dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, complete genome
          Length = 4171146

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 436     aaggccatatttcacaacaa 455
               ||||||||||||||||||||
Sbjct: 1240384 aaggccatatttcacaacaa 1240403



to top

>gb|AC093789.3| Homo sapiens BAC clone RP11-219G10 from 4, complete sequence
          Length = 202937

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 307  aatgcagtaagggacctccatttt 330
            |||||||||||||||| |||||||
Sbjct: 8054 aatgcagtaagggacccccatttt 8077



to top

>gb|AC011139.8| Homo sapiens chromosome 18, clone RP11-1I2, complete sequence
          Length = 180360

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 307    aatgcagtaagggacctccatttt 330
              |||||||||||||||| |||||||
Sbjct: 102199 aatgcagtaagggacccccatttt 102222



to top

>gb|AC068388.7| Homo sapiens chromosome 3, clone RP11-296M9, complete sequence
          Length = 148372

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 307   aatgcagtaagggacctccatttt 330
             |||||||||||||||| |||||||
Sbjct: 61239 aatgcagtaagggacccccatttt 61216



to top

>gb|AC093657.4| Homo sapiens BAC clone RP11-447B21 from 4, complete sequence
          Length = 162689

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 219   gcttatcctcattcttcact 238
             ||||||||||||||||||||
Sbjct: 11972 gcttatcctcattcttcact 11953



to top

>gb|AC016764.8| Homo sapiens BAC clone RP11-549G13 from 2, complete sequence
          Length = 155868

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   gcacagaacagaggcagtct 266
             ||||||||||||||||||||
Sbjct: 44285 gcacagaacagaggcagtct 44266



to top

>ref|XM_938181.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a,
           transcript variant 3 (LOC388474), mRNA
          Length = 916

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 579 aatgcagtaagggacccccatttt 556



to top

>ref|XM_371115.4| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a,
           transcript variant 1 (LOC388474), mRNA
          Length = 916

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 579 aatgcagtaagggacccccatttt 556



to top

>ref|XM_944890.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a,
           transcript variant 2 (LOC649032), mRNA
          Length = 896

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 571 aatgcagtaagggacccccatttt 548



to top

>ref|XM_940934.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a,
           transcript variant 1 (LOC649032), mRNA
          Length = 707

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 384 aatgcagtaagggacccccatttt 361



to top

>ref|XM_933879.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a,
           transcript variant 2 (LOC644029), mRNA
          Length = 896

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 571 aatgcagtaagggacccccatttt 548



to top

>ref|XM_929689.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a,
           transcript variant 1 (LOC644029), mRNA
          Length = 707

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 384 aatgcagtaagggacccccatttt 361



to top

>ref|XM_940836.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a
           (LOC152663), mRNA
          Length = 849

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 774 aatgcagtaagggacccccatttt 751



to top

>ref|XM_087499.9| PREDICTED: Homo sapiens similar to 60S ribosomal protein L7a
           (LOC152663), mRNA
          Length = 849

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 774 aatgcagtaagggacccccatttt 751



to top

>gb|AC148828.2| Pan troglodytes BAC clone CH251-136M2 from chromosome 7, complete
             sequence
          Length = 162801

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 247   gcacagaacagaggcagtct 266
             ||||||||||||||||||||
Sbjct: 39463 gcacagaacagaggcagtct 39482



to top

>emb|BX901884.7| Zebrafish DNA sequence from clone DKEY-89E13 in linkage group 4, complete
              sequence
          Length = 137389

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 28     aatagctatggtttaacaat 47
              ||||||||||||||||||||
Sbjct: 109762 aatagctatggtttaacaat 109781



to top

>emb|BX530060.6| Zebrafish DNA sequence from clone DKEY-283F16 in linkage group 16,
             complete sequence
          Length = 174837

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 295   ttttcccttaacaatgcagt 314
             ||||||||||||||||||||
Sbjct: 17372 ttttcccttaacaatgcagt 17391



to top

>dbj|AB169622.1| Macaca fascicularis brain cDNA, clone: QtrA-11940, similar to human
           60S ribosomal protein L7a (Surfeit locusprotein 3)
           (PLA-X polypeptide) (LOC147346), mRNA, RefSeq:
           XM_085775.4
          Length = 903

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 571 aatgcagtaagggacccccatttt 548



to top

>dbj|AK077886.1| Mus musculus 13 days embryo male testis cDNA, RIKEN full-length
            enriched library, clone:6030408H15 product:aquarius, full
            insert sequence
          Length = 3104

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 319  gacctccattttcctgcaaa 338
            ||||||||||||||||||||
Sbjct: 2908 gacctccattttcctgcaaa 2927



to top

>gb|AC000089.1| Homo sapiens Chromosome 22q11.2 Cosmid Clone 89h In DGCR Region,
            complete sequence
          Length = 39754

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 307  aatgcagtaagggacctccatttt 330
            |||||||||||||||| |||||||
Sbjct: 9338 aatgcagtaagggacccccatttt 9315



to top

>ref|NG_001316.1| Homo sapiens ribosomal protein L7a pseudogene 9 (RPL7AP9) on
           chromosome 12
          Length = 1200

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 875 aatgcagtaagggacccccatttt 852



to top

>ref|NG_002562.1| Homo sapiens ribosomal protein L7a pseudogene 6 (RPL7AP6) on
           chromosome 14
          Length = 1081

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 307 aatgcagtaagggacctccatttt 330
           |||||||||||||||| |||||||
Sbjct: 671 aatgcagtaagggacccccatttt 648



to top

>gb|AC018900.8|AC018900 Homo sapiens chromosome 15 clone RP11-198M11 map 15q21.1, complete
            sequence
          Length = 177657

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 307  aatgcagtaagggacctccatttt 330
            |||||||||||||||| |||||||
Sbjct: 7518 aatgcagtaagggacccccatttt 7541



to top

>gb|AC083863.2|AC083863 Homo sapiens chromosome 7 clone RP11-162O1, complete sequence
          Length = 179488

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 307  aatgcagtaagggacctccattttcctgcaaagggcagggagccacacaaccagct 362
            ||||||||||||||||  |||||| | ||| |||||||| | | | ||||||||||
Sbjct: 9286 aatgcagtaagggaccctcattttacagcacagggcaggcaacaagacaaccagct 9231



to top

>gb|AC044787.6|AC044787 Homo sapiens chromosome 15 clone CTD-2270N23 map 15q21, complete sequence
          Length = 148147

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 307    aatgcagtaagggacctccatttt 330
              |||||||||||||||| |||||||
Sbjct: 127390 aatgcagtaagggacccccatttt 127413



to top

>ref|XM_575193.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499852), mRNA
          Length = 684

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 356 accagctcaatcggatcaacatcatgagctatgacaaccagctg 399
           ||||||||||| || || ||||||||||| || || ||||||||
Sbjct: 383 accagctcaatggggtctacatcatgagcaatcaccaccagctg 340



to top

>gb|AY961486.1| Lysiphlebus testaceipes ribosomal protein L7a (RpL7a) mRNA,
           complete cds
          Length = 807

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 361 ctcaatcggatcaacatcatgagc 384
           |||||| |||||||||||||||||
Sbjct: 501 ctcaattggatcaacatcatgagc 478



to top

>emb|X17204.1|SCRPL4A Yeast RPL4A gene for ribosomal protein L4
          Length = 1596

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 136  accaccaccccacttcttcctaacttcatcgaatttgtca 175
            |||||||||||| | |||| | ||||||||| ||||||||
Sbjct: 1334 accaccaccccagtgcttcttgacttcatcgtatttgtca 1295



to top

>emb|X56836.1|SCL42 S.cerevisiae L4-2 gene for ribosomal protein L4-2
          Length = 1650

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 136  accaccaccccacttcttcctaacttcatcgaatttgtca 175
            |||||||||||| | |||| | ||||||||| ||||||||
Sbjct: 1251 accaccaccccagtgcttcttgacttcatcgtatttgtca 1212



to top

>emb|AL157789.6|CNS01RG6 Human chromosome 14 DNA sequence BAC R-880O3 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 225603

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 307    aatgcagtaagggacctccatttt 330
              |||||||||||||||| |||||||
Sbjct: 182470 aatgcagtaagggacccccatttt 182493



to top

>emb|AL121594.6|CNS01DRY Human chromosome 14 DNA sequence BAC R-173D9 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 196023

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 307   aatgcagtaagggacctccatttt 330
             |||||||||||||||| |||||||
Sbjct: 65670 aatgcagtaagggacccccatttt 65647



to top

>gb|AY902236.1| Homo sapiens flavin containing monooxygenase 5 (FMO5) gene, complete
            cds
          Length = 41824

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 307  aatgcagtaagggacctccatttt 330
            |||||||||||||||| |||||||
Sbjct: 2517 aatgcagtaagggacccccatttt 2540



to top

>gb|AC140446.5| Mus musculus BAC clone RP24-114J11 from chromosome 8, complete sequence
          Length = 152392

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 356   accagctcaatcggatcaacatcatgagctatgacaaccagctg 399
             ||||||||||| || ||||||||||| || || || ||||||||
Sbjct: 44592 accagctcaatggggtcaacatcatgggcaatcaccaccagctg 44549



to top

>emb|BX890608.15| Zebrafish DNA sequence from clone CH211-195J11 in linkage group 2,
              complete sequence
          Length = 194388

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 331    cctgcaaagggcagggagcc 350
              ||||||||||||||||||||
Sbjct: 190154 cctgcaaagggcagggagcc 190173



to top

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 91     cctttccctggccttggtcttcgc 114
              ||||||||||||| ||||||||||
Sbjct: 126603 cctttccctggccctggtcttcgc 126626



to top

>gb|U17361.1|SCU17361 Saccharomyces cerevisiae ribosomal protein L4 (RPL4A) gene, complete
            cds
          Length = 2500

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 136  accaccaccccacttcttcctaacttcatcgaatttgtca 175
            |||||||||||| | |||| | ||||||||| ||||||||
Sbjct: 1079 accaccaccccagtgcttcttgacttcatcgtatttgtca 1040



to top

>emb|AL844569.4| Mouse DNA sequence from clone RP23-230H3 on chromosome 2, complete
              sequence
          Length = 198872

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 319    gacctccattttcctgcaaa 338
              ||||||||||||||||||||
Sbjct: 145526 gacctccattttcctgcaaa 145507



to top

>gb|U11583.2|YSCH9196 Saccharomyces cerevisiae chromosome VIII cosmid 9196
          Length = 55070

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                     
Query: 136   accaccaccccacttcttcctaacttcatcgaatttgtca 175
             |||||||||||| | |||| | ||||||||| ||||||||
Sbjct: 35316 accaccaccccagtgcttcttgacttcatcgtatttgtca 35355



to top

>dbj|AP003112.1| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1288E10
          Length = 144703

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 170   ttgtcattgaagtttgcctt 189
             ||||||||||||||||||||
Sbjct: 48330 ttgtcattgaagtttgcctt 48349


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,335,933
Number of Sequences: 3902068
Number of extensions: 4335933
Number of successful extensions: 80716
Number of sequences better than 10.0: 230
Number of HSP's better than 10.0 without gapping: 230
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80216
Number of HSP's gapped (non-prelim): 447
length of query: 497
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 475
effective length of database: 17,147,199,772
effective search space: 8144919891700
effective search space used: 8144919891700
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top