>gb|BT018920.1| Zea mays clone Contig21.F mRNA sequence
          Length = 931

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 308 cgcagcctgcttgcgacgcagtcagggcttc 338
           |||||||||||||||| ||||||||||||||
Sbjct: 438 cgcagcctgcttgcgatgcagtcagggcttc 468

>ref|XM_600052.2| PREDICTED: Bos taurus similar to transmembrane protein 16F
            (LOC521784), mRNA
          Length = 3405

 Score = 50.1 bits (25), Expect = 0.011
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 128  gccacatccatcactgcttccctca 152
            |||||||||||||||||||||||||
Sbjct: 2176 gccacatccatcactgcttccctca 2200

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 50.1 bits (25), Expect = 0.011
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                        
Query: 175     acaaccaacaaacccaaaacacacc 199
               |||||||||||||||||||||||||
Sbjct: 3680040 acaaccaacaaacccaaaacacacc 3680064

>gb|AC124301.6| Homo sapiens chromosome 11, clone RP11-358H18, complete sequence
          Length = 145713

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 557   ttcttcatgtttccttccttct 578
             ||||||||||||||||||||||
Sbjct: 80280 ttcttcatgtttccttccttct 80259

>gb|AC124056.8| Homo sapiens chromosome 11, clone RP5-1082L12, complete sequence
          Length = 115971

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 557   ttcttcatgtttccttccttct 578
             ||||||||||||||||||||||
Sbjct: 10037 ttcttcatgtttccttccttct 10058

>emb|BX088527.5| Zebrafish DNA sequence from clone DKEY-200F8 in linkage group 1, complete
              sequence
          Length = 148904

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 7      aacatttttgataaatagacaa 28
              ||||||||||||||||||||||
Sbjct: 125178 aacatttttgataaatagacaa 125199

>gb|AC004736.1|AC004736 Human Chromosome 11p14.3 PAC clone pDJ1082L12 containing KNCN1 and MyoD,
              complete sequence
          Length = 115958

 Score = 44.1 bits (22), Expect = 0.67
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 557    ttcttcatgtttccttccttct 578
              ||||||||||||||||||||||
Sbjct: 105926 ttcttcatgtttccttccttct 105905

>ref|XM_462221.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G16676g)
           partial mRNA
          Length = 3801

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 349 ccacttcctcttcttcttcggctcc 373
           ||||||| |||||||||||||||||
Sbjct: 76  ccacttcttcttcttcttcggctcc 52

>gb|AY659174.1| Synthetic construct Peudomonas aeruginosa clone FLH036934.01F
           PA0536 gene, partial cds
          Length = 1026

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 356 ctcttcttcttcggctccggc 376
           |||||||||||||||||||||
Sbjct: 620 ctcttcttcttcggctccggc 600

>gb|BT012702.1| Lycopersicon esculentum clone 113577R, mRNA sequence
          Length = 1952

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 457  cttgcagaccacatcagcagt 477
            |||||||||||||||||||||
Sbjct: 1041 cttgcagaccacatcagcagt 1021

>gb|AC124987.9| Mus musculus chromosome 3, clone RP24-364E17, complete sequence
          Length = 165330

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 557    ttcttcatgtttccttccttc 577
              |||||||||||||||||||||
Sbjct: 154799 ttcttcatgtttccttccttc 154779

>gb|AC109152.13| Mus musculus chromosome 18, clone RP23-166J4, complete sequence
          Length = 206894

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 541    gacttcatccttggccttctt 561
              |||||||||||||||||||||
Sbjct: 124594 gacttcatccttggccttctt 124574

>emb|AL139044.15| Human DNA sequence from clone RP11-6B20 on chromosome 6 Contains the
             ITPR3 gene for inositol 1,4,5-triphosphate receptor type
             3, a novel gene and the IHPK3 gene for inositol
             hexaphosphate kinase 3, complete sequence
          Length = 134250

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 554   gccttcttcatgtttccttccttct 578
             |||||||||||||||| ||||||||
Sbjct: 87852 gccttcttcatgtttctttccttct 87828

>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces
               hansenii
          Length = 2051428

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 349     ccacttcctcttcttcttcggctcc 373
               ||||||| |||||||||||||||||
Sbjct: 1277411 ccacttcttcttcttcttcggctcc 1277387

>gb|AC158763.6| Mus musculus chromosome 18, clone RP23-343L17, complete sequence
          Length = 204022

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    gacttcatccttggccttctt 561
              |||||||||||||||||||||
Sbjct: 197255 gacttcatccttggccttctt 197275

>gb|AC128039.4| Rattus norvegicus  BAC CH230-394A24 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 164278

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 175    acaaccaacaaacccaaaaca 195
              |||||||||||||||||||||
Sbjct: 121583 acaaccaacaaacccaaaaca 121563

>gb|AC072044.9| Homo sapiens 3 BAC RP11-213O23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 178453

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 609    tgctgctcagatcagcatcctgctt 633
              |||||||||||||||| ||||||||
Sbjct: 170517 tgctgctcagatcagcttcctgctt 170493

>gb|AC005831.1| Homo sapiens 12p13.3 PAC RPCI5-1180D12 (Roswell Park Cancer Institute
              Human PAC Library) complete sequence
          Length = 144515

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 571    ttccttctgctcaacttcacc 591
              |||||||||||||||||||||
Sbjct: 102772 ttccttctgctcaacttcacc 102792

>gb|AE004490.1| Pseudomonas aeruginosa PAO1, section 51 of 529 of the complete genome
          Length = 11445

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 356  ctcttcttcttcggctccggc 376
            |||||||||||||||||||||
Sbjct: 4823 ctcttcttcttcggctccggc 4843

>dbj|AP006628.1| Onion yellows phytoplasma OY-M DNA, complete genome
          Length = 860631

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 580    ctcaacttcaccagcatcatt 600
              |||||||||||||||||||||
Sbjct: 470197 ctcaacttcaccagcatcatt 470177

>gb|AF484513.1| HIV-1 isolate 98UG57146 from Uganda, partial genome
          Length = 8768

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 347  acccacttcctcttcttcttc 367
            |||||||||||||||||||||
Sbjct: 8162 acccacttcctcttcttcttc 8142

>dbj|AP006545.1| Homo sapiens genomic DNA, chromosome 8p11.21, clone: KB1836B05, complete
              sequence
          Length = 156888

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 347    acccacttcctcttcttcttc 367
              |||||||||||||||||||||
Sbjct: 110842 acccacttcctcttcttcttc 110822

>gb|AC141632.4| Mus musculus BAC clone RP24-100G24 from 3, complete sequence
          Length = 180488

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 557    ttcttcatgtttccttccttc 577
              |||||||||||||||||||||
Sbjct: 171257 ttcttcatgtttccttccttc 171277

>gb|AC155338.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1
             clone KBrH138P04, complete sequence
          Length = 137697

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 347   acccacttcctcttcttcttc 367
             |||||||||||||||||||||
Sbjct: 95960 acccacttcctcttcttcttc 95940


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,646,030
Number of Sequences: 3902068
Number of extensions: 8646030
Number of successful extensions: 174294
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 174163
Number of HSP's gapped (non-prelim): 131
length of query: 761
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 738
effective length of database: 17,143,297,704
effective search space: 12651753705552
effective search space used: 12651753705552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)