ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags33a02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_475315.1| Oryza sativa (japonica cultivar-group), predic... 204 1e-49
2gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome... 204 1e-49
3dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 204 1e-49
4dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clon... 204 1e-49
5ref|NM_190750.1| Oryza sativa (japonica cultivar-group), predic... 198 7e-48
6dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 198 7e-48
7dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D... 198 7e-48
8dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clon... 198 7e-48
9gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end 198 7e-48
10ref|NM_185613.1| Oryza sativa (japonica cultivar-group), predic... 188 6e-45
11dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 188 6e-45
12dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic D... 188 6e-45
13dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic D... 188 6e-45
14emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3 186 3e-44
15ref|NM_185612.1| Oryza sativa (japonica cultivar-group), predic... 182 4e-43
16ref|NM_185609.1| Oryza sativa (japonica cultivar-group), predic... 182 4e-43
17ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 182 4e-43
18emb|X80326.1|MPMPH312 M.pahari mpH312 gene 182 4e-43
19emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 182 4e-43
20emb|X00937.1|TAHI02 Wheat histone H3 gene 182 4e-43
21emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12 182 4e-43
22ref|NM_185607.1| Oryza sativa (japonica cultivar-group), predic... 180 2e-42
23emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11 180 2e-42
24dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic D... 180 2e-42
25gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds 180 2e-42
26gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence 176 2e-41
27ref|XM_493701.1| Oryza sativa (japonica cultivar-group), mRNA 174 1e-40
28ref|XM_472456.1| Oryza sativa (japonica cultivar-group), predic... 174 1e-40
29ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA 174 1e-40
30ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA 174 1e-40
31gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence 174 1e-40
32gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome... 174 1e-40
33gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome... 174 1e-40
34ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone pro... 174 1e-40
35ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 174 1e-40
36ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 174 1e-40
37ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 174 1e-40
38emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 174 1e-40
39emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes 174 1e-40
40emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2 174 1e-40
41emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 174 1e-40
42emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15 174 1e-40
43dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
44dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
45gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, compl... 174 1e-40
46gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, compl... 174 1e-40
47emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV 174 1e-40
48gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complet... 174 1e-40
49gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete... 174 1e-40
50gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds 174 1e-40
51gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 174 1e-40
52emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4,... 174 1e-40
53gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds 174 1e-40
54emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene 174 1e-40
55gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds 174 1e-40
56gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds 174 1e-40
57gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds 174 1e-40
58gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence 172 4e-40
59gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, c... 172 4e-40
60gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds 172 4e-40
61gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds 172 4e-40
62emb|X80325.1|MPMPH315 M.pahari mpH315 gene 168 6e-39
63ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA 167 2e-38
64gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence 167 2e-38
65ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone ... 167 2e-38
66ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone ... 167 2e-38
67ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone ... 167 2e-38
68ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone ... 167 2e-38
69ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone ... 167 2e-38
70emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his... 167 2e-38
71emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene 167 2e-38
72dbj|AB205017.1| Lolium multiflorum gene for replacement histone ... 167 2e-38
73dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-... 167 2e-38
74gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist... 167 2e-38
75dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-... 167 2e-38
76gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, compl... 167 2e-38
77emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V 167 2e-38
78gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds 167 2e-38
79gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds 167 2e-38
80gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), com... 167 2e-38
81ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans... 165 9e-38
82gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 165 9e-38
83ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h... 165 9e-38
84emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 165 9e-38
85dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RI... 165 9e-38
86gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and... 165 9e-38
87gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ... 165 9e-38
88ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudoge... 165 9e-38
89gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MG... 165 9e-38
90dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, comp... 165 9e-38
91dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, comp... 165 9e-38
92gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, co... 165 9e-38
93gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, compl... 165 9e-38
94gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, comp... 165 9e-38
95gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, comp... 165 9e-38
96gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 165 9e-38
97gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 165 9e-38
98ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA 165 9e-38
99gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 165 9e-38
100gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds 165 9e-38
101emb|X85102.1|OSRNAHIS3 O.sativa mRNA for histone H3 163 4e-37
102gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial ... 161 1e-36
103ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA 159 6e-36
104gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence 159 6e-36
105gb|L19706.1| Rattus norvegicus H3 histone gene, complete cds 159 6e-36
106ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2a... 159 6e-36
107ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2a... 159 6e-36
108ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2a... 159 6e-36
109ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2a... 159 6e-36
110ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2a... 159 6e-36
111gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MG... 159 6e-36
112ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA 159 6e-36
113ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA 159 6e-36
114gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 159 6e-36
115ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
116ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
117ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
118ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ... 159 6e-36
119ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histo... 159 6e-36
120ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histo... 159 6e-36
121ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-... 159 6e-36
122gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 159 6e-36
123emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for hist... 159 6e-36
124emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3... 159 6e-36
125emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant 159 6e-36
126emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 159 6e-36
127emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 159 6e-36
128gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA 159 6e-36
129ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA... 159 6e-36
130gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA 159 6e-36
131dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-... 159 6e-36
132gb|AC008233.3|AC008233 Drosophila melanogaster, chromosome 2L, r... 159 6e-36
133ref|NM_001013056.1| Rattus norvegicus histone 1, H2ai (predicted... 159 6e-36
134ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (pr... 159 6e-36
135gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, compl... 159 6e-36
136gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, compl... 159 6e-36
137gb|AE003608.5| Drosophila melanogaster chromosome 2L, section 17... 159 6e-36
138gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 159 6e-36
139gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 159 6e-36
140gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 159 6e-36
141emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3 159 6e-36
142gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds 159 6e-36
143gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds 159 6e-36
144ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans... 157 2e-35
145gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 157 2e-35
146gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 157 2e-35
147gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 157 2e-35
148ref|NG_001335.1| Homo sapiens genomic large histone family clust... 157 2e-35
149ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA 157 2e-35
150gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete... 157 2e-35
151gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds 157 2e-35
152ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus simila... 157 2e-35
153ref|XM_780236.1| PREDICTED: Strongylocentrotus purpuratus simila... 157 2e-35
154ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus simila... 157 2e-35
155ref|XM_777897.1| PREDICTED: Strongylocentrotus purpuratus simila... 157 2e-35
156emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes 157 2e-35
157gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 157 2e-35
158emb|CR541858.1| Homo sapiens full open reading frame cDNA clone ... 157 2e-35
159emb|Z61129.1|HS45E8R H.sapiens CpG island DNA genomic Mse1 fragm... 157 2e-35
160gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 157 2e-35
161gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 157 2e-35
162gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 157 2e-35
163gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I... 157 2e-35
164gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 157 2e-35
165emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a 157 2e-35
166ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus simila... 155 9e-35
167emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for h... 155 9e-35
168gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 153 4e-34
169ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA 153 4e-34
170gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds 153 4e-34
171ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2a... 153 4e-34
172ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA 153 4e-34
173ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone ... 153 4e-34
174gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNI... 153 4e-34
175gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMA... 153 4e-34
176emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 153 4e-34
177ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (... 153 4e-34
178ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudoge... 153 4e-34
179gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE... 153 4e-34
180gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete... 153 4e-34
181gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, co... 153 4e-34
182gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, compl... 153 4e-34
183gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cd... 153 4e-34
184emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3 153 4e-34
185gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds 153 4e-34
186gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 151 1e-33
187ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA 151 1e-33
188ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA 151 1e-33
189ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2a... 151 1e-33
190ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2a... 151 1e-33
191ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2a... 151 1e-33
192ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone ... 151 1e-33
193emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a... 151 1e-33
194ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 151 1e-33
195dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells... 151 1e-33
196gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 151 1e-33
197gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 151 1e-33
198gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, co... 151 1e-33
199gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, co... 151 1e-33
200gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 151 1e-33
201gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple... 151 1e-33
202ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA 151 1e-33
203ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone... 151 1e-33
204gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, compl... 151 1e-33
205gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, compl... 151 1e-33
206gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, compl... 151 1e-33
207emb|Z56112.1|HS89C12R H.sapiens CpG island DNA genomic Mse1 frag... 151 1e-33
208emb|Z56111.1|HS89C12F H.sapiens CpG island DNA genomic Mse1 frag... 151 1e-33
209emb|Z63365.1|HS81H7R H.sapiens CpG island DNA genomic Mse1 fragm... 151 1e-33
210ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA 151 1e-33
211emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 151 1e-33
212ref|XM_527253.1| PREDICTED: Pan troglodytes similar to histone 1... 149 5e-33
213ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 149 5e-33
214ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 149 5e-33
215gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 149 5e-33
216gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H... 149 5e-33
217ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2a... 147 2e-32
218ref|XM_793816.1| PREDICTED: Strongylocentrotus purpuratus simila... 147 2e-32
219ref|XM_789723.1| PREDICTED: Strongylocentrotus purpuratus simila... 147 2e-32
220ref|XM_686806.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 147 2e-32
221gb|AY231774.1| Drosophila yakuba clone yak-em_His3.3A mRNA sequence 145 9e-32
222emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3 145 9e-32
223gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequ... 143 3e-31
224gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence 143 3e-31
225emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA 143 3e-31
226ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 143 3e-31
227ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 143 3e-31
228ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 143 3e-31
229ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 143 3e-31
230ref|XM_687893.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 143 3e-31
231ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 143 3e-31
232ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (p... 143 3e-31
233ref|XM_320335.2| Anopheles gambiae str. PEST ENSANGP00000014183 ... 143 3e-31
234ref|XM_314446.2| Anopheles gambiae str. PEST ENSANGP00000016066 ... 143 3e-31
235gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), com... 143 3e-31
236emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones 141 1e-30
237ref|XM_779415.1| PREDICTED: Strongylocentrotus purpuratus simila... 141 1e-30
238gb|BC097059.1| Danio rerio zgc:113983, mRNA (cDNA clone MGC:1139... 141 1e-30
239ref|NM_001025171.1| Danio rerio zgc:113983 (zgc:113983), mRNA 141 1e-30
240dbj|AB185067.1| Conocephalum conicum H3 gene for histone 3, comp... 141 1e-30
241gb|BC054666.1| Danio rerio zgc:66241, mRNA (cDNA clone MGC:66241... 139 5e-30
242emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic ... 139 5e-30
243ref|NM_199745.1| Danio rerio zgc:66241 (zgc:66241), mRNA 139 5e-30
244ref|NM_214547.1| Strongylocentrotus purpuratus late embryonic hi... 139 5e-30
245gb|BC084311.1| Xenopus laevis cDNA clone IMAGE:6865011 137 2e-29
246ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2a... 137 2e-29
247emb|X72949.1|XLH3HIS X.laevis H3r gene for histone H3 137 2e-29
248emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 137 2e-29
249gb|DQ096858.1| Xenopus laevis h3r mRNA, complete sequence 137 2e-29
250gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequ... 137 2e-29
251gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence 137 2e-29
252gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequ... 137 2e-29
253gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequ... 137 2e-29
254ref|XM_560604.1| Anopheles gambiae str. PEST ENSANGP00000025641 ... 137 2e-29
255gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial ... 137 2e-29
256gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 137 2e-29
257ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476... 135 8e-29
258gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462 135 8e-29
259gb|BC033095.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC... 135 8e-29
260gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC... 135 8e-29
261gb|BC007518.2| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 135 8e-29
262ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA 135 8e-29
263ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 135 8e-29
264ref|NM_003536.2| Homo sapiens histone 1, H3h (HIST1H3H), mRNA 135 8e-29
265gb|AF531281.1| Homo sapiens histone H3 (HIST1H3H) gene, complete... 135 8e-29
266gb|AF531277.1| Homo sapiens histone H3 (HIST1H3D) gene, complete... 135 8e-29
267gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 p... 135 8e-29
268emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o... 135 8e-29
269emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o... 135 8e-29
270emb|AJ556872.1|XLA556872 Expression vector pET3-H3 H3 gene for X... 135 8e-29
271gb|BC096130.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 135 8e-29
272gb|BC096128.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 135 8e-29
273gb|BC096129.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC... 135 8e-29
274emb|Z83735.1|HSZ83735 H.sapiens hH3/k gene 135 8e-29
275dbj|AK097020.1| Homo sapiens cDNA FLJ39701 fis, clone SMINT2011656 135 8e-29
276ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, ... 135 8e-29
277ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 135 8e-29
278dbj|AK020421.1| Mus musculus 12 days embryo embryonic body betwe... 135 8e-29
279ref|XM_318362.1| Anopheles gambiae str. PEST ENSANGP00000016005 ... 135 8e-29
280ref|XM_307081.1| Anopheles gambiae str. PEST ENSANGP00000001387 ... 135 8e-29
281ref|XM_305996.1| Anopheles gambiae str. PEST ENSANGP00000012784 ... 135 8e-29
282emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11 135 8e-29
283emb|X16496.1|MMHIST31 Murine H3.1 gene for histone H3.1 135 8e-29
284gb|J00984.1|XELHIS3LB x.laevis histone gene h3 and flanks 135 8e-29
285gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene 135 8e-29
286ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone ... 133 3e-28
287emb|CR733515.2|CNS0GSRE Tetraodon nigroviridis full-length cDNA 133 3e-28
288emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes 133 3e-28
289emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene 133 3e-28
290ref|XM_315130.1| Anopheles gambiae str. PEST ENSANGP00000015258 ... 133 3e-28
291ref|XM_314445.2| Anopheles gambiae str. PEST ENSANGP00000016056 ... 133 3e-28
292ref|XM_307601.1| Anopheles gambiae str. PEST ENSANGP00000016200 ... 133 3e-28
293ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2a... 131 1e-27
294emb|Z98866.1|CEY49E10 Caenorhabditis elegans YAC Y49E10, complet... 131 1e-27
295ref|NM_067207.3| Caenorhabditis elegans HIStone family member (h... 131 1e-27
296dbj|AB185075.1| Conocephalum conicum H3 gene for histone 3, comp... 131 1e-27
297dbj|AB185072.1| Conocephalum conicum H3 gene for histone 3, comp... 131 1e-27
298ref|XM_871486.1| PREDICTED: Bos taurus similar to H3 histone, fa... 129 5e-27
299ref|XM_871460.1| PREDICTED: Bos taurus similar to H3 histone, fa... 129 5e-27
300ref|XM_866686.1| PREDICTED: Bos taurus similar to H3 histone, fa... 129 5e-27
301emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chr... 129 5e-27
302emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ... 129 5e-27
303gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence 129 5e-27
304ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H... 127 2e-26
305ref|XM_322230.1| Neurospora crassa OR74A hypothetical protein (N... 127 2e-26
306ref|XM_951565.1| Neurospora crassa OR74A hypothetical protein (N... 127 2e-26
307ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa... 127 2e-26
308gb|AY125233.1| Isoperla davisi histone 3 gene, partial cds 127 2e-26
309gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds 127 2e-26
310gb|AY125229.1| Argia vivida histone 3 gene, partial cds 127 2e-26
311gb|AY923963.1| Nerita polita isolate NR2 histone H3 (H3) gene, p... 127 2e-26
312ref|XM_307606.1| Anopheles gambiae str. PEST ENSANGP00000016172 ... 127 2e-26
313gb|AY749744.1| Dipteromimus sp. EP150 histone H3 (H3) gene, part... 127 2e-26
314gb|AY749709.1| Mystaxiops venatoris histone H3 (H3) gene, partia... 127 2e-26
315gb|AY749708.1| Baetis tricaudatus histone H3 (H3) gene, partial cds 127 2e-26
316gb|AY749702.1| Thraulodes sp. EP014 histone H3 (H3) gene, partia... 127 2e-26
317gb|AF520775.1| Hypocrea jecorina histone H3 gene, complete cds 125 8e-26
318ref|XM_786159.1| PREDICTED: Strongylocentrotus purpuratus simila... 125 8e-26
319emb|X81207.1|DMHISH333 D.melanogaster genes for histone H3.3 and... 125 8e-26
320emb|X81205.1|DMHSTH331 D.melanogaster mRNA for histone H3.3 125 8e-26
321emb|X53822.1|DMH33Q D.melanogaster mRNA for histone H3.3Q (variant) 125 8e-26
322gb|AY521718.1| Romalea sp. BYU_ACOR015 histone H3 (H3) gene, par... 125 8e-26
323gb|AC023729.5| Drosophila melanogaster X BAC RP98-39L4 (Roswell ... 125 8e-26
324gb|AC023719.4| Drosophila melanogaster X BAC RP98-4L24 (Roswell ... 125 8e-26
325gb|AY118325.1| Drosophila melanogaster LD17717 full insert cDNA 125 8e-26
326ref|NM_176719.1| Drosophila melanogaster CG8989-RC, transcript v... 125 8e-26
327ref|NM_167180.3| Drosophila melanogaster CG8989-RB, transcript v... 125 8e-26
328ref|NM_078540.4| Drosophila melanogaster CG8989-RA, transcript v... 125 8e-26
329dbj|AB185078.1| Conocephalum conicum H3 gene for histone 3, comp... 125 8e-26
330gb|AE003446.4| Drosophila melanogaster chromosome X, section 30 ... 125 8e-26
331ref|XM_465456.1| Oryza sativa (japonica cultivar-group), mRNA 123 3e-25
332ref|XM_694212.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 123 3e-25
333ref|XM_688339.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 123 3e-25
334dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 123 3e-25
335dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 123 3e-25
336dbj|AB185074.1| Conocephalum conicum H3 gene for histone 3, comp... 123 3e-25
337dbj|AP005696.2| Oryza sativa (japonica cultivar-group) genomic D... 123 3e-25
338gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 123 3e-25
339emb|AL844879.5|CNS08CB2 Oryza sativa chromosome 12, . BAC OSJNBa... 123 3e-25
340gb|AY749703.1| Callibaetis sp. EP020 histone H3 (H3) gene, parti... 123 3e-25
341ref|XM_518888.1| PREDICTED: Pan troglodytes similar to histone 1... 121 1e-24
342gb|BC067492.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC... 121 1e-24
343gb|AF531279.1| Homo sapiens histone H3 (HIST1H3F) gene, complete... 121 1e-24
344emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N2... 121 1e-24
345emb|Z80784.1|HSH3B H.sapiens H3/b gene 121 1e-24
346emb|X72950.1|XLH3LHIS X.laevis H3l gene for histone H3 121 1e-24
347ref|NM_001016636.3| Xenopus tropicalis histone 2, H3c (hist1h3g)... 121 1e-24
348gb|BC096131.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC... 121 1e-24
349ref|NM_021018.2| Homo sapiens histone 1, H3f (HIST1H3F), mRNA 121 1e-24
350dbj|AB185045.1| Conocephalum supradecompositum H3 gene for histo... 121 1e-24
351dbj|AB185037.1| Conocephalum supradecompositum H3 gene for histo... 121 1e-24
352gb|BC069818.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC... 121 1e-24
353emb|CR855729.2| Xenopus tropicalis finished cDNA, clone TGas081o10 121 1e-24
354gb|U96764.1|CVHIST1 Chaetopterus variopedatus histone H1, histon... 121 1e-24
355emb|Z80786.1|HSH3I H.sapiens H3/i gene 121 1e-24
356ref|XM_527604.1| PREDICTED: Pan troglodytes similar to histone 1... 119 5e-24
357ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H... 119 5e-24
358ref|XM_580747.2| PREDICTED: Bos taurus similar to CG31613-PA (LO... 119 5e-24
359gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds 119 5e-24
360ref|NM_001025303.1| Homo sapiens similar to histone H2B histone ... 119 5e-24
361gb|BC092854.1| Danio rerio zgc:110292, mRNA (cDNA clone MGC:1102... 119 5e-24
362ref|XM_686609.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 119 5e-24
363ref|XM_688063.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 119 5e-24
364emb|CR542011.1| Homo sapiens full open reading frame cDNA clone ... 119 5e-24
365emb|CR541983.1| Homo sapiens full open reading frame cDNA clone ... 119 5e-24
366ref|NM_001017599.1| Danio rerio zgc:110292 (zgc:110292), mRNA 119 5e-24
367gb|AY923977.1| Gibbula zonata isolate T25 histone H3 (H3) gene, ... 119 5e-24
368gb|AY923958.1| Haliotis varia isolate H37 histone H3 (H3) gene, ... 119 5e-24
369gb|AY923954.1| Haliotis pustulata isolate H15 histone H3 (H3) ge... 119 5e-24
370gb|AY923953.1| Haliotis asinina isolate H11 histone H3 (H3) gene... 119 5e-24
371gb|AY923952.1| Haliotis jacnensis isolate H1 histone H3 (H3) gen... 119 5e-24
372gb|DQ275318.1| Graphoderus fascicollis voucher BYU KBMGrfa65 his... 119 5e-24
373gb|AY338635.1| Chaquihua sp. EP080 histone 3 gene, partial cds 119 5e-24
374gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial... 119 5e-24
375gb|AY749737.1| Platybaetis probus histone H3 (H3) gene, partial cds 119 5e-24
376gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds 119 5e-24
377gb|AY749722.1| Adenophlebia peringueyella histone H3 (H3) gene, ... 119 5e-24
378gb|AY749718.1| Siphlonurus sp. EP084 histone H3 (H3) gene, parti... 119 5e-24
379gb|BC052981.1| Homo sapiens histone 1, H3e, mRNA (cDNA clone MGC... 117 2e-23
380ref|NM_003532.2| Homo sapiens histone 1, H3e (HIST1H3E), mRNA 117 2e-23
381gb|AF531278.1| Homo sapiens histone H3 (HIST1H3E) gene, complete... 117 2e-23
382gb|AY521731.1| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene,... 117 2e-23
383gb|AY521729.1| Tallaperla lobata voucher BYU_ACPL059 histone H3 ... 117 2e-23
384gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) ge... 117 2e-23
385gb|AY521720.1| Ceuthophilus utahensis voucher BYU_ACOR017 histon... 117 2e-23
386ref|XM_320336.2| Anopheles gambiae str. PEST ENSANGP00000014197 ... 117 2e-23
387gb|M60746.1|HUMHISAA Human histone H3.1 (H1F3) gene, complete cds 117 2e-23
388gb|AY338642.1| Malenka californica histone 3 gene, partial cds 117 2e-23
389gb|AY338632.1| Ameletus sp. EP023 histone 3 gene, partial cds 117 2e-23
390gb|AY749746.1| Proboscidoplocia sp. EP162 histone H3 (H3) gene, ... 117 2e-23
391gb|J00869.1|CHKH3A Chicken histone H3 gene (intronless) 117 2e-23
392ref|XM_465459.1| Oryza sativa (japonica cultivar-group), mRNA 115 8e-23
393ref|XM_527263.1| PREDICTED: Pan troglodytes similar to histone 1... 115 8e-23
394ref|XM_747656.1| Aspergillus fumigatus Af293 histone H3 (Afu1g13... 115 8e-23
395gb|DQ073573.1| Craterostigma plantagineum histone H3.3 mRNA, com... 115 8e-23
396gb|BC107980.1| Danio rerio zgc:123334, mRNA (cDNA clone MGC:1233... 115 8e-23
397gb|BC097060.1| Danio rerio zgc:113984, mRNA (cDNA clone MGC:1139... 115 8e-23
398ref|NM_001040004.1| Danio rerio zgc:123334 (zgc:123334), mRNA 115 8e-23
399emb|X07505.1|DIHIST3 Sea star (D.imbricata) histone H3 gene 115 8e-23
400emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercon... 115 8e-23
401ref|NM_001025176.3| Danio rerio zgc:113984 (zgc:113984), mRNA 115 8e-23
402ref|XM_701573.1| PREDICTED: Danio rerio similar to CG31613-PA, t... 115 8e-23
403gb|AY035716.1| Anopheles gambiae histone 3A (HIS3A) mRNA, comple... 115 8e-23
404emb|CR542014.1| Homo sapiens full open reading frame cDNA clone ... 115 8e-23
405dbj|AB185058.1| Marchantia polymorpha H3 gene for histone 3, com... 115 8e-23
406dbj|AB185035.1| Conocephalum supradecompositum H3 gene for histo... 115 8e-23
407gb|AC084653.1|CBRG45O14 Caenorhabditis briggsae cosmid G45O14, c... 115 8e-23
408ref|XM_321242.2| Anopheles gambiae str. PEST ENSANGP00000018496 ... 115 8e-23
409gb|AY749714.1| Meridialaris diguillina histone H3 (H3) gene, par... 115 8e-23
410ref|XM_472667.1| Oryza sativa (japonica cultivar-group), predic... 113 3e-22
411gb|AY525328.1| Oryza sativa (japonica cultivar-group) putative h... 113 3e-22
412gb|AF517876.1| Griffithsia japonica isolate Gj410 putative histo... 113 3e-22
413gb|DQ445518.1| Graphocephala atropunctata isolate WHGA0430 putat... 113 3e-22
414emb|AL606615.4|OSJN00048 Oryza sativa genomic DNA, chromosome 4,... 113 3e-22
415dbj|AB185073.1| Conocephalum conicum H3 gene for histone 3, comp... 113 3e-22
416gb|AC084502.1|CBRG14F21 Caenorhabditis briggsae cosmid G14F21, c... 113 3e-22
417gb|AY923964.1| Phenacolepas osculans isolate PHE1 histone H3 (H3... 113 3e-22
418dbj|AK100960.1| Oryza sativa (japonica cultivar-group) cDNA clon... 113 3e-22
419gb|AF109910.1|AF109910 Porteresia coarctata histone H3 mRNA, com... 113 3e-22
420ref|XM_527285.1| PREDICTED: Pan troglodytes similar to HIST1H3I ... 111 1e-21
421gb|J01181.1|SUPHISP04 Psammechinus miliaris histone H3 gene, com... 111 1e-21
422ref|XM_610495.1| PREDICTED: Bos taurus similar to CG31613-PA (LO... 111 1e-21
423gb|AY125238.1| Eurycantha insularis histone 3 gene, partial cds 111 1e-21
424gb|AY125230.1| Stenopelmatus fuscus histone 3 gene, partial cds 111 1e-21
425emb|V01143.1|PMHIS7 Sea urchin (P. miliaris) gene for histones H... 111 1e-21
426gb|AY707438.1| Elaunon bipartitus histone 3 gene, partial cds 111 1e-21
427gb|AY923978.1| Stomatella sp. CET-2005 histone H3 (H3) gene, par... 111 1e-21
428gb|AY923975.1| Stomatella sp. CET-2005 histone H3 (H3) gene, par... 111 1e-21
429gb|AY923967.1| Peltospira delicata isolate PS1 histone H3 (H3) g... 111 1e-21
430gb|AY923965.1| Perotrochus amabilis isolate PL3 histone H3 (H3) ... 111 1e-21
431gb|AY923955.1| Haliotis virginea isolate H19 histone H3 (H3) gen... 111 1e-21
432emb|Z61668.1|HS56E3R H.sapiens CpG island DNA genomic Mse1 fragm... 111 1e-21
433gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone... 111 1e-21
434gb|AY338626.1| Coloburiscus humeralis histone 3 gene, partial cds 111 1e-21
435gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, part... 111 1e-21
436gb|AY749741.1| Rhoenanthus sp. EP143 histone H3 (H3) gene, parti... 111 1e-21
437gb|AY749738.1| Jubabaetis sp. EP139 histone H3 (H3) gene, partia... 111 1e-21
438gb|AY749729.1| Edmundsius agilis histone H3 (H3) gene, partial cds 111 1e-21
439gb|AY749713.1| Penaphlebia sp. EP076 histone H3 (H3) gene, parti... 111 1e-21
440gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, parti... 111 1e-21
441gb|AY749701.1| Paraleptophlebia vaciva histone H3 (H3) gene, par... 111 1e-21
442gb|J00982.1|XELHIS358 xenopus laevis histone gene h3 on 5.8 kb e... 111 1e-21
443gb|U28732.1| Caenorhabditis elegans cosmid F45E1, complete sequence 109 5e-21
444emb|X52393.1|TCH3H4 Tigriopus californicus DNA for histone H3 an... 109 5e-21
445gb|AY521723.1| Morsea californica voucher BYU_ACOR023 histone H3... 109 5e-21
446ref|NM_076943.2| Caenorhabditis elegans HIStone family member (h... 109 5e-21
447dbj|AB185039.1| Conocephalum supradecompositum H3 gene for histo... 109 5e-21
448gb|AY064472.1| Aplysia californica histone H3 (His.H3) gene, com... 109 5e-21
449gb|M84797.1|TIGH1234A Tigriopus californicus histone H1 gene, co... 109 5e-21
450gb|AY338619.1| Baetis sp. Eph11 histone 3 gene, partial cds 109 5e-21
451gb|AY749740.1| Isonychia sp. EP142 histone H3 (H3) gene, partial... 109 5e-21
452gb|AY725673.1| Cylindrocladium multiphialidicum strain CBS 11267... 107 2e-20
453gb|AC024696.1| Caenorhabditis elegans cosmid F07B7, complete seq... 107 2e-20
454gb|U64843.2| Caenorhabditis elegans cosmid K06C4, complete sequence 107 2e-20
455ref|XM_384466.1| Gibberella zeae PH-1 chromosome 2 H3_NEUCR Hist... 107 2e-20
456emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 wi... 107 2e-20
457gb|AY707431.1| Anisolabididae sp. DM22 histone 3 gene, partial cds 107 2e-20
458gb|U64845.1| Caenorhabditis elegans cosmid F45F2, complete sequence 107 2e-20
459dbj|AB226293.1| Aspergillus oryzae cDNA, contig sequence: AoEST3155 107 2e-20
460dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012 107 2e-20
461ref|XM_677616.1| PREDICTED: Danio rerio similar to CG31613-PA, t... 107 2e-20
462ref|NM_072891.1| Caenorhabditis elegans HIStone family member (h... 107 2e-20
463ref|NM_072896.2| Caenorhabditis elegans HIStone family member (h... 107 2e-20
464ref|NM_072798.1| Caenorhabditis elegans HIStone family member (h... 107 2e-20
465ref|NM_072875.1| Caenorhabditis elegans HIStone family member (h... 107 2e-20
466ref|NM_074632.1| Caenorhabditis elegans HIStone family member (h... 107 2e-20
467dbj|AB195975.1| Lilium longiflorum YAH3 mRNA for histone H3, com... 107 2e-20
468gb|AY923976.1| Trochus niloticus isolate T12 histone H3 (H3) gen... 107 2e-20
469gb|AY923956.1| Haliotis kamtschatkana isolate H22 histone H3 (H3... 107 2e-20
470emb|X03104.1|XLHISH3G Xenopus laevis gene for histone H3 (clone ... 107 2e-20
471gb|DQ275324.1| Acilius sulcatus voucher BYU KBMAcsu49 histone 3 ... 107 2e-20
472gb|DQ275316.1| Acilius duvergeri voucher BYU KBMAcdu50 histone 3... 107 2e-20
473emb|Z93388.1|CET10C6 Caenorhabditis elegans Cosmid T10C6, comple... 107 2e-20
474gb|AY749730.1| Cinygma sp. EP123 histone H3 (H3) gene, partial cds 107 2e-20
475gb|M21286.1|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 gene... 107 2e-20
476gb|AY725671.1| Cylindrocladium malesianum strain CBS 112710 hist... 105 7e-20
477emb|CR733198.1|CNS0GSLF Tetraodon nigroviridis full-length cDNA 105 7e-20
478emb|CR732463.2|CNS0GS44 Tetraodon nigroviridis full-length cDNA 105 7e-20
479emb|CR732337.2|CNS0GS0M Tetraodon nigroviridis full-length cDNA 105 7e-20
480emb|CR729702.2|CNS0GPZG Tetraodon nigroviridis full-length cDNA 105 7e-20
481emb|CR728891.2|CNS0GPCX Tetraodon nigroviridis full-length cDNA 105 7e-20
482emb|CR728060.2|CNS0GOPU Tetraodon nigroviridis full-length cDNA 105 7e-20
483emb|CR726879.2|CNS0GNT1 Tetraodon nigroviridis full-length cDNA 105 7e-20
484gb|U58750.1| Caenorhabditis elegans cosmid F55G1, complete sequence 105 7e-20
485gb|AF348241.1| Cylindrocladium pseudospathiphylli strain 1623 hi... 105 7e-20
486gb|AF348237.1| Cylindrocladium spathiphylli strain STE-U2188 his... 105 7e-20
487gb|AF348230.1| Cylindrocladium spathiphylli strain ATCC 44730 hi... 105 7e-20
488gb|AF257780.1|AF257780 Populus tremula x Populus tremuloides his... 105 7e-20
489ref|NM_068803.1| Caenorhabditis elegans F55G1.2 (Histone) mRNA, ... 105 7e-20
490dbj|AB185024.1| Conocephalum conicum H3 gene for histone 3, comp... 105 7e-20
491dbj|AK120807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 105 7e-20
492gb|AY105203.1| Zea mays PCO121645 mRNA sequence 105 7e-20
493gb|AY749739.1| Stygifloris sp. EP141 histone H3 (H3) gene, parti... 105 7e-20
494gb|BC069305.1| Homo sapiens histone 1, H3i, mRNA (cDNA clone IMA... 103 3e-19
495gb|BC067494.1| Homo sapiens histone 1, H3i, mRNA (cDNA clone IMA... 103 3e-19
496gb|BC067493.1| Homo sapiens histone 1, H3i, mRNA (cDNA clone MGC... 103 3e-19
497ref|NM_003533.2| Homo sapiens histone 1, H3i (HIST1H3I), mRNA 103 3e-19
498ref|XM_356549.3| PREDICTED: Mus musculus similar to histone 1, H... 103 3e-19
499gb|AF531282.1| Homo sapiens histone H3 (HIST1H3I) gene, complete... 103 3e-19
500gb|AY125246.1| Timema knulli histone 3 gene, partial cds 103 3e-19

>ref|XM_475315.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  204 bits (103), Expect = 1e-49
 Identities = 115/119 (96%)
 Strand = Plus / Minus

                                                                       
Query: 160 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 219
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 410 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 351

                                                                      
Query: 220 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 350 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 292



to top

>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0042J17, complete sequence
          Length = 124139

 Score =  204 bits (103), Expect = 1e-49
 Identities = 115/119 (96%)
 Strand = Plus / Plus

                                                                         
Query: 160   tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 219
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72762 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 72821

                                                                        
Query: 220   cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 72822 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 72880



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  204 bits (103), Expect = 1e-49
 Identities = 115/119 (96%)
 Strand = Plus / Plus

                                                                            
Query: 160      tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 219
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21355440 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 21355499

                                                                           
Query: 220      cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
                |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 21355500 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 21355558



to top

>dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039F20, full
           insert sequence
          Length = 735

 Score =  204 bits (103), Expect = 1e-49
 Identities = 115/119 (96%)
 Strand = Plus / Minus

                                                                       
Query: 160 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 219
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 495 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 436

                                                                      
Query: 220 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 435 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 377



to top

>ref|NM_190750.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  198 bits (100), Expect = 7e-48
 Identities = 112/116 (96%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 292



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  198 bits (100), Expect = 7e-48
 Identities = 112/116 (96%)
 Strand = Plus / Minus

                                                                            
Query: 163      gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 37507562 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 37507503

                                                                        
Query: 223      ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
                ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 37507502 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 37507447



to top

>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0505D12
          Length = 146951

 Score =  198 bits (100), Expect = 7e-48
 Identities = 112/116 (96%)
 Strand = Plus / Minus

                                                                          
Query: 163    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 102099 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 102040

                                                                      
Query: 223    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 102039 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 101984



to top

>dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E03, full
           insert sequence
          Length = 1296

 Score =  198 bits (100), Expect = 7e-48
 Identities = 112/116 (96%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 485 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 426

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 425 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 370



to top

>gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end
          Length = 505

 Score =  198 bits (100), Expect = 7e-48
 Identities = 103/104 (99%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 227 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 168

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 167 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctc 124



to top

>ref|NM_185613.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  188 bits (95), Expect = 6e-45
 Identities = 107/111 (96%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctc 292



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  188 bits (95), Expect = 6e-45
 Identities = 107/111 (96%)
 Strand = Plus / Minus

                                                                           
Query: 168     ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
               |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 3055564 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 3055505

                                                                  
Query: 228     gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
               ||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 3055504 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctc 3055454



 Score =  182 bits (92), Expect = 4e-43
 Identities = 101/104 (97%)
 Strand = Plus / Plus

                                                                           
Query: 175     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3054220 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3054279

                                                           
Query: 235     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
               ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 3054280 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctc 3054323



 Score =  182 bits (92), Expect = 4e-43
 Identities = 101/104 (97%)
 Strand = Plus / Plus

                                                                           
Query: 175     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
               ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3045573 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3045632

                                                           
Query: 235     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
               |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 3045633 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctc 3045676



 Score =  180 bits (91), Expect = 2e-42
 Identities = 106/111 (95%)
 Strand = Plus / Plus

                                                                           
Query: 168     ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
               |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 3039536 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 3039595

                                                                  
Query: 228     gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
               ||||||||| ||||||||||||||||||||||||||||| |||||||||||
Sbjct: 3039596 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctc 3039646



 Score =  180 bits (91), Expect = 2e-42
 Identities = 115/123 (93%)
 Strand = Plus / Plus

                                                                           
Query: 156     ggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 215
               ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1644693 ggcttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 1644752

                                                                           
Query: 216     gacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgc 275
               |||||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 1644753 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggc 1644812

                  
Query: 276     ctc 278
               |||
Sbjct: 1644813 ctc 1644815



to top

>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0702F05
          Length = 145018

 Score =  188 bits (95), Expect = 6e-45
 Identities = 107/111 (96%)
 Strand = Plus / Minus

                                                                          
Query: 168    ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
              |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 143513 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 143454

                                                                 
Query: 228    gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              ||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 143453 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctc 143403



 Score =  182 bits (92), Expect = 4e-43
 Identities = 101/104 (97%)
 Strand = Plus / Plus

                                                                          
Query: 175    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142169 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 142228

                                                          
Query: 235    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 142229 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctc 142272



 Score =  182 bits (92), Expect = 4e-43
 Identities = 101/104 (97%)
 Strand = Plus / Plus

                                                                          
Query: 175    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
              ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 133522 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 133581

                                                          
Query: 235    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 133582 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctc 133625



 Score =  180 bits (91), Expect = 2e-42
 Identities = 106/111 (95%)
 Strand = Plus / Plus

                                                                          
Query: 168    ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
              |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 127485 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 127544

                                                                 
Query: 228    gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              ||||||||| ||||||||||||||||||||||||||||| |||||||||||
Sbjct: 127545 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctc 127595



to top

>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone:P0681F10
          Length = 170371

 Score =  188 bits (95), Expect = 6e-45
 Identities = 107/111 (96%)
 Strand = Plus / Minus

                                                                        
Query: 168  ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
            |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 9749 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 9690

                                                               
Query: 228  gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 9689 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctc 9639



 Score =  182 bits (92), Expect = 4e-43
 Identities = 101/104 (97%)
 Strand = Plus / Plus

                                                                        
Query: 175  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8405 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 8464

                                                        
Query: 235  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 8465 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctc 8508



to top

>emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3
          Length = 657

 Score =  186 bits (94), Expect = 3e-44
 Identities = 118/126 (93%)
 Strand = Plus / Minus

                                                                       
Query: 153 gatggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgat 212
           ||||||||| || | ||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 468 gatggcttaggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgat 409

                                                                       
Query: 213 ggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggta 272
           ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 408 ggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggta 349

                 
Query: 273 cgcctc 278
            |||||
Sbjct: 348 ggcctc 343



to top

>ref|NM_185612.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  182 bits (92), Expect = 4e-43
 Identities = 101/104 (97%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 335 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctc 292



to top

>ref|NM_185609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 432

 Score =  182 bits (92), Expect = 4e-43
 Identities = 101/104 (97%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 357

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 356 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctc 313



to top

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score =  182 bits (92), Expect = 4e-43
 Identities = 110/116 (94%)
 Strand = Plus / Minus

                                                                        
Query: 163  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
            |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2267 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2208

                                                                    
Query: 223  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 2207 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 2152



to top

>emb|X80326.1|MPMPH312 M.pahari mpH312 gene
          Length = 580

 Score =  182 bits (92), Expect = 4e-43
 Identities = 110/116 (94%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 452 gccctctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 393

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 392 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 337



to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  182 bits (92), Expect = 4e-43
 Identities = 110/116 (94%)
 Strand = Plus / Plus

                                                                        
Query: 163  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
            |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3348 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 3407

                                                                    
Query: 223  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 3408 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 3463



to top

>emb|X00937.1|TAHI02 Wheat histone H3 gene
          Length = 811

 Score =  182 bits (92), Expect = 4e-43
 Identities = 110/116 (94%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 654 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 595

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| || || || ||||| |||||
Sbjct: 594 ttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctc 539



to top

>emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12
          Length = 1920

 Score =  182 bits (92), Expect = 4e-43
 Identities = 101/104 (97%)
 Strand = Plus / Minus

                                                                        
Query: 175  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
            ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1515 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 1456

                                                        
Query: 235  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1455 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctc 1412



to top

>ref|NM_185607.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  180 bits (91), Expect = 2e-42
 Identities = 106/111 (95%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||| ||||||||||||||||||||||||||||| |||||||||||
Sbjct: 342 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctc 292



to top

>emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11
          Length = 1200

 Score =  180 bits (91), Expect = 2e-42
 Identities = 106/111 (95%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 743

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||| ||||||||||||||||||||||||||||| |||||||||||
Sbjct: 742 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctc 692



to top

>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0493C11
          Length = 143113

 Score =  180 bits (91), Expect = 2e-42
 Identities = 115/123 (93%)
 Strand = Plus / Plus

                                                                         
Query: 156   ggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 215
             ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 47864 ggcttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 47923

                                                                         
Query: 216   gacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgc 275
             |||||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 47924 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggc 47983

                
Query: 276   ctc 278
             |||
Sbjct: 47984 ctc 47986



to top

>gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds
          Length = 793

 Score =  180 bits (91), Expect = 2e-42
 Identities = 115/123 (93%)
 Strand = Plus / Minus

                                                                       
Query: 156 ggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 215
           ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 502 ggcttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 443

                                                                       
Query: 216 gacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgc 275
           |||||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 442 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggc 383

              
Query: 276 ctc 278
           |||
Sbjct: 382 ctc 380



to top

>gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence
          Length = 636

 Score =  176 bits (89), Expect = 2e-41
 Identities = 123/133 (92%), Gaps = 1/133 (0%)
 Strand = Plus / Plus

                                                                       
Query: 146 cggagaggatggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgg 205
           |||||| ||||||| |||| | ||||||||||||||||||||||||||||||||||||||
Sbjct: 121 cggagatgatggct-acgcgcgctcgccacggatgcggcgggcgagctggatgtccttgg 179

                                                                       
Query: 206 gcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccga 265
           ||||||||||||||||||| |||||||||||||| ||||||||||||||||| || ||||
Sbjct: 180 gcatgatggtgacgcgcttagcgtggatggcgcagaggttggtgtcctcgaagagaccga 239

                        
Query: 266 caaggtacgcctc 278
           | ||||| |||||
Sbjct: 240 cgaggtaggcctc 252



to top

>ref|XM_493701.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score =  174 bits (88), Expect = 1e-40
 Identities = 112/120 (93%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 ttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctc 292



to top

>ref|XM_472456.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctc 292



to top

>ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA
          Length = 411

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 407 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 292



to top

>ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA
          Length = 480

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 431 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 372

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 371 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 316



to top

>gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence
          Length = 887

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 226 gccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 285

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| || || || ||||| |||||
Sbjct: 286 ttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctc 341



to top

>gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0076K20,
              complete sequence
          Length = 127338

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                          
Query: 175    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118162 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 118103

                                                          
Query: 235    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              ||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 118102 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 118059



to top

>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0030I09 map C83B, complete sequence
          Length = 123477

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                         
Query: 175   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13768 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 13709

                                                         
Query: 235   gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             ||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 13708 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 13665



to top

>ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC427890), mRNA
          Length = 600

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 525

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 524 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 481



to top

>ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417958),
           mRNA
          Length = 1512

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Plus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 643

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 644 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 687



to top

>ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417949),
           mRNA
          Length = 752

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Plus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 388

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 389 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 432



to top

>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945),
           mRNA
          Length = 972

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Plus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 392 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 451

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 452 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 495



to top

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Minus

                                                                        
Query: 163  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
            |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 3041 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 2982

                                                                    
Query: 223  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 2981 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 2926



to top

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                        
Query: 175  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3230 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3171

                                                        
Query: 235  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 3170 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 3127



 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Plus

                                                                        
Query: 175  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1491 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 1550

                                                        
Query: 235  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 1551 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 1594



to top

>emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2
          Length = 1200

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 795 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 736

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 735 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 692



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Minus

                                                                          
Query: 163    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
              |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 143287 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 143228

                                                                      
Query: 223    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 143227 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 143172



 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Plus

                                                                          
Query: 163    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
              |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 135592 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 135651

                                                                      
Query: 223    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 135652 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 135707



 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                          
Query: 159    ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
              |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 126435 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 126376

                                                                          
Query: 219    gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
               ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 126375 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 126316



to top

>emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15
          Length = 578

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Plus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 207

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 208 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 251



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Minus

                                                                            
Query: 163      gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
                ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20749059 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 20749000

                                                                        
Query: 223      ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
                ||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 20748999 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctc 20748944



 Score =  113 bits (57), Expect = 3e-22
 Identities = 81/89 (91%)
 Strand = Plus / Minus

                                                                            
Query: 190      agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 249
                ||||| |||||||||||||||||||| || |||||||| |||||||||||||||||||||
Sbjct: 22438361 agctgaatgtccttgggcatgatggtcacacgcttggcatggatggcgcacaggttggtg 22438302

                                             
Query: 250      tcctcgaacagcccgacaaggtacgcctc 278
                |||||||| || || || |||||||||||
Sbjct: 22438301 tcctcgaagagacccaccaggtacgcctc 22438273



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Plus

                                                                           
Query: 175     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2608636 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 2608695

                                                           
Query: 235     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
               ||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 2608696 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 2608739



to top

>gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, complete cds
          Length = 1411

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 848

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 792



to top

>gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, complete cds
          Length = 1408

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 848

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 792



to top

>emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV
          Length = 1094

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 809 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 750

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 749 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 706



to top

>gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complete cds
          Length = 1809

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 866 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 807

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 806 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 763



to top

>gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete cds
          Length = 1204

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 883 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 824

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 823 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 780



to top

>gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds
          Length = 1271

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 679 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 620

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 619 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 576



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Plus

                                                                           
Query: 175     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2617667 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 2617726

                                                           
Query: 235     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
               ||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 2617727 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 2617770



to top

>emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0108J11,
             complete sequence
          Length = 124629

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Minus

                                                                         
Query: 163   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
             ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95210 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 95151

                                                                     
Query: 223   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             ||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 95150 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctc 95095



to top

>gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds
          Length = 642

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 466 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 407

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 406 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 363



to top

>emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene
          Length = 1119

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 791 gccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 732

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| || || || ||||| |||||
Sbjct: 731 ttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctc 676



to top

>gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds
          Length = 784

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 748 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 689

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 688 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 645



to top

>gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds
          Length = 693

 Score =  174 bits (88), Expect = 1e-40
 Identities = 109/116 (93%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 557 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 498

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 497 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 442



to top

>gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds
          Length = 1177

 Score =  174 bits (88), Expect = 1e-40
 Identities = 100/104 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 940 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 881

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||| |||||||||||||||||||| ||||| ||||| |||||
Sbjct: 880 gcgcagaggttggtgtcctcgaacaggccgacgaggtaggcctc 837



to top

>gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence
          Length = 639

 Score =  172 bits (87), Expect = 4e-40
 Identities = 105/111 (94%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 401 ctcgccgcggatgcggcgggcgagctggatgtctttgggcatgatggtgacgcgcttggc 342

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||| |||||||||||||||||||| ||||| ||||| |||||
Sbjct: 341 gtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcctc 291



to top

>gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, complete cds
          Length = 626

 Score =  172 bits (87), Expect = 4e-40
 Identities = 105/111 (94%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           ||||||||||||||||||||| ||||||||||||||||||||||| || || ||||||||
Sbjct: 413 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtcacacgcttggc 354

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 353 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtaggcctc 303



to top

>gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds
          Length = 711

 Score =  172 bits (87), Expect = 4e-40
 Identities = 96/99 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 625 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 566

                                                  
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtac 273
           ||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 565 gcgcacaggttagtgtcctcgaagagcccgacgaggtac 527



to top

>gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds
          Length = 568

 Score =  172 bits (87), Expect = 4e-40
 Identities = 96/99 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 532 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 473

                                                  
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtac 273
           ||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 472 gcgcacaggttagtgtcctcgaagagcccgacgaggtac 434



to top

>emb|X80325.1|MPMPH315 M.pahari mpH315 gene
          Length = 974

 Score =  168 bits (85), Expect = 6e-39
 Identities = 112/121 (92%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||||||| || |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 593 cttaagccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtga 534

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           | ||||||||||||||||||||||||||||||||||| ||||| || |||||||| ||||
Sbjct: 533 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcct 474

            
Query: 278 c 278
           |
Sbjct: 473 c 473



to top

>ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA
          Length = 535

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 445 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 386

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 385 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 326



to top

>gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence
          Length = 663

 Score =  167 bits (84), Expect = 2e-38
 Identities = 108/116 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||| | |||||||||||||||||||||||||||||||||||||||||| | |
Sbjct: 154 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgaccctc 213

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| ||||| || |||||||||||
Sbjct: 214 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtacgcctc 269



to top

>ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611519), mRNA
          Length = 471

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 471 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 412

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 411 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 352



to top

>ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488277), mRNA
          Length = 411

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488275), mRNA
          Length = 459

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 459 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 400

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 399 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 340



to top

>ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488307), mRNA
          Length = 411

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488263), mRNA
          Length = 411

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Plus

                                                                        
Query: 159  ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
            |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 2126 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 2185

                                                                        
Query: 219  gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 2186 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 2245



to top

>emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene
          Length = 990

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 851 ttacgccctctccccgcggatgcggcgggccagctggatgtccttaggcatgatggtgac 792

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 791 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 732



to top

>dbj|AB205017.1| Lolium multiflorum gene for replacement histone H3, exon 1-2,
           complete cds
          Length = 784

 Score =  167 bits (84), Expect = 2e-38
 Identities = 99/104 (95%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 559 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 500

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 499 gcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctc 456



to top

>dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700049H14 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 514

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 424 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 365

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 364 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 305



to top

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
           complete cds
          Length = 2321

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 762 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 703

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 702 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 643



to top

>dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700111A06 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 535

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 445 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 386

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 385 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 326



to top

>gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, complete cds
          Length = 1408

 Score =  167 bits (84), Expect = 2e-38
 Identities = 111/120 (92%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 911 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 852

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 851 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 792



to top

>emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V
          Length = 1107

 Score =  167 bits (84), Expect = 2e-38
 Identities = 99/104 (95%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 809 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcatggatg 750

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 749 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 706



to top

>gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds
          Length = 411

 Score =  167 bits (84), Expect = 2e-38
 Identities = 108/116 (93%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctc 292



to top

>gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds
          Length = 1017

 Score =  167 bits (84), Expect = 2e-38
 Identities = 99/104 (95%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 555 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgcatg 496

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 495 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 452



to top

>gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), complete cds
          Length = 1001

 Score =  167 bits (84), Expect = 2e-38
 Identities = 108/116 (93%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 828 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 769

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 768 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctc 713



to top

>ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 2,
           mRNA
          Length = 546

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 533 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 474

                                                          
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 473 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 427



to top

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                        
Query: 172  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1671

                                                           
Query: 232  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 1670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 1624



to top

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                        
Query: 172  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1671

                                                           
Query: 232  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 1670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 1624



to top

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                        
Query: 172  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
            ||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||
Sbjct: 2539 ccacggatgcggcggaccaactggatgtccttgggcatgatggtgacgcgcttggcgtgg 2480

                                                           
Query: 232  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 2479 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 2433



to top

>dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
            enriched library, clone:6430517B15
            product:unclassifiable, full insert sequence
          Length = 3217

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Plus

                                                                        
Query: 172  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1200 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1259

                                                           
Query: 232  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 1260 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 1306



to top

>gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and histone H2b-616
           (H2b-616) genes, complete cds
          Length = 2371

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 978 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 919

                                                          
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 918 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 872



to top

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                        
Query: 172  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 2713 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 2654

                                                           
Query: 232  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 2653 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 2607



to top

>ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudogene on chromosome 1
          Length = 1411

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                          
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 792



to top

>gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MGC:102454
           IMAGE:5099464), complete cds
          Length = 1831

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 599 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 540

                                                          
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 539 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 493



to top

>dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           T135
          Length = 473

 Score =  165 bits (83), Expect = 9e-38
 Identities = 104/111 (93%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 464 ctcgcctcggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgcttggc 405

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 404 gtggatggcgcagaggttggtgtcctcgaagaggccgaccaggtaggcctc 354



to top

>dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           T117
          Length = 474

 Score =  165 bits (83), Expect = 9e-38
 Identities = 104/111 (93%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 465 ctcgcctcggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgcttggc 406

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 405 gtggatggcgcagaggttggtgtcctcgaagaggccgaccaggtaggcctc 355



to top

>gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, complete sequence
          Length = 1411

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                          
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 792



to top

>gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, complete cds
          Length = 1411

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                          
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 792



to top

>gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, complete cds
          Length = 1675

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                        
Query: 172  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1084 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1025

                                                           
Query: 232  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 1024 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 978



to top

>gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, complete cds
          Length = 1500

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 523 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 582

                                                          
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 583 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 629



to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                         
Query: 172   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 93730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 93671

                                                            
Query: 232   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 93670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 93624



 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                         
Query: 172   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 71922 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 71863

                                                            
Query: 232   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 71862 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 71816



 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Plus

                                                                         
Query: 172   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 63183 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 63242

                                                            
Query: 232   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 63243 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 63289



to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                         
Query: 172   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 37510 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 37451

                                                            
Query: 232   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 37450 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 37404



 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Plus

                                                                         
Query: 172   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 28771 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 28830

                                                            
Query: 232   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 28831 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 28877



 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Plus

                                                                        
Query: 172  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 6963 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 7022

                                                           
Query: 232  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 7023 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 7069



to top

>ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA
          Length = 411

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 398 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 339

                                                          
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 338 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 292



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4
           (ch4-III), histone H2B (ch2b-III) and histone H2A
           (ch2a-III) genes, complete cds
          Length = 4582

 Score =  165 bits (83), Expect = 9e-38
 Identities = 104/111 (93%)
 Strand = Plus / Plus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 473 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 532

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||||||||||||| || || ||||| |||||
Sbjct: 533 gtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctc 583



to top

>gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds
          Length = 1110

 Score =  165 bits (83), Expect = 9e-38
 Identities = 101/107 (94%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 737 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 678

                                                          
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 677 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 631



to top

>emb|X85102.1|OSRNAHIS3 O.sativa mRNA for histone H3
          Length = 274

 Score =  163 bits (82), Expect = 4e-37
 Identities = 88/90 (97%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 90  ctcgccgcggatccggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 31

                                         
Query: 228 gtggatggcgcacaggttggtgtcctcgaa 257
           ||||||||||||||||||||||||||||||
Sbjct: 30  gtggatggcgcacaggttggtgtcctcgaa 1



to top

>gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial cds, clone W1
          Length = 479

 Score =  161 bits (81), Expect = 1e-36
 Identities = 87/89 (97%)
 Strand = Plus / Minus

                                                                       
Query: 190 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 249
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 479 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 420

                                        
Query: 250 tcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||| || |||||||||||
Sbjct: 419 tcctcgaacagccccaccaggtacgcctc 391



to top

>ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA
          Length = 1851

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 927 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 868

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 867 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 812



to top

>gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence
          Length = 638

 Score =  159 bits (80), Expect = 6e-36
 Identities = 98/104 (94%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 337 cggatgcggcgggcgagctgaatgtccttgggcatgatggtgacgcgcttggcgtggatg 278

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 277 gcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctc 234



to top

>gb|L19706.1| Rattus norvegicus H3 histone gene, complete cds
          Length = 2040

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                        
Query: 163  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
            |||||||||||||| ||||||||||| |||||||||||||||||||||||||| || |||
Sbjct: 1923 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 1864

                                                                    
Query: 223  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||| |||||||||||||| ||||| || |||||||| |||||
Sbjct: 1863 ttggcgtggatggcgcataggttggtgtcctcaaacagacccacaaggtaggcctc 1808



to top

>ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618948), mRNA
          Length = 484

 Score =  159 bits (80), Expect = 6e-36
 Identities = 110/120 (91%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||| || ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618149), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 6e-36
 Identities = 110/120 (91%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || ||||| |||||||| ||||||||||| |||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatccggcgggcaagctggatgtctttgggcatgatggtgac 352

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||| |||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcacacaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC617888), mRNA
          Length = 714

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 710 gccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 651

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||| |||||||||||||||||||| || || || ||||| |||||
Sbjct: 650 ttggcgtggatggcacacaggttggtgtcctcgaagagtcccaccaggtaggcctc 595



to top

>ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC540148), mRNA
          Length = 484

 Score =  159 bits (80), Expect = 6e-36
 Identities = 110/120 (91%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||| || ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC521581), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||| || ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MGC:18559
           IMAGE:4240748), complete cds
          Length = 1124

 Score =  159 bits (80), Expect = 6e-36
 Identities = 89/92 (96%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 584 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 525

                                           
Query: 232 atggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||||||||||
Sbjct: 524 atggcgcacaggttggtgtcctcgaacagccc 493



to top

>ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA
          Length = 1124

 Score =  159 bits (80), Expect = 6e-36
 Identities = 89/92 (96%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 584 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 525

                                           
Query: 232 atggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||||||||||
Sbjct: 524 atggcgcacaggttggtgtcctcgaacagccc 493



to top

>ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA
          Length = 488

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 438 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 379

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 378 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 323



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Plus

                                                                         
Query: 163   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
             |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 90487 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 90546

                                                                     
Query: 223   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 90547 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 90602



 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Plus

                                                                         
Query: 158   cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
             |||| |||||||| || |||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 99521 cttaagccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtga 99580

                                                                         
Query: 218   cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
             | ||||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 99581 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcct 99640

              
Query: 278   c 278
             |
Sbjct: 99641 c 99641



 Score =  151 bits (76), Expect = 1e-33
 Identities = 106/116 (91%)
 Strand = Plus / Minus

                                                                         
Query: 163   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
             |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 73419 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 73360

                                                                     
Query: 223   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 73359 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 73304



 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Plus

                                                                         
Query: 159   ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
             |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 59166 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 59225

                                                                         
Query: 219   gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 59226 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 59285



to top

>ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488298), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611138), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483172), mRNA
          Length = 525

 Score =  159 bits (80), Expect = 6e-36
 Identities = 98/104 (94%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 450

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 449 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 406



to top

>ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483167), mRNA
          Length = 525

 Score =  159 bits (80), Expect = 6e-36
 Identities = 98/104 (94%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 450

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 449 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 406



to top

>ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-PA (LOC608586), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 6e-36
 Identities = 98/104 (94%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 335 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123925
           IMAGE:40044771), complete cds
          Length = 1003

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 840 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 781

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 780 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 725



to top

>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4
          Length = 1898

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                        
Query: 163  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
            |||| ||||||||| |||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 1510 gcccgctcgccacgaatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 1451

                                                                    
Query: 223  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||| ||||||||||| || || ||||| |||||
Sbjct: 1450 ttggcgtggatggcgcacaggttggtatcctcgaacaggcccaccaggtaggcctc 1395



to top

>emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3, CD-1
          Length = 287

 Score =  159 bits (80), Expect = 6e-36
 Identities = 110/120 (91%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 177 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 118

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 117 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 58



to top

>emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant
          Length = 772

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 504 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 445

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||| ||||||||||| ||||||||||||||||| ||||| |||||||||||
Sbjct: 444 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctc 389



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                         
Query: 163   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
             |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 25493 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 25434

                                                                     
Query: 223   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 25433 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 25378



 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                         
Query: 158   cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
             |||| |||||||| || |||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 16459 cttaagccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtga 16400

                                                                         
Query: 218   cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
             | ||||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 16399 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcct 16340

              
Query: 278   c 278
             |
Sbjct: 16339 c 16339



 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                         
Query: 159   ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
             |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 56818 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 56759

                                                                         
Query: 219   gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 56758 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 56699



 Score =  151 bits (76), Expect = 1e-33
 Identities = 106/116 (91%)
 Strand = Plus / Plus

                                                                         
Query: 163   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
             |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 42565 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 42624

                                                                     
Query: 223   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 42625 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 42680



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                          
Query: 163    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
              |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 139055 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 138996

                                                                      
Query: 223    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 138995 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 138940



 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Plus

                                                                          
Query: 159    ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
              |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 203950 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 204009

                                                                          
Query: 219    gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
               ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 204010 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 204069



to top

>gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA
          Length = 824

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 569 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 510

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||| ||||||||||| ||||||||||||||||| ||||| |||||||||||
Sbjct: 509 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctc 454



to top

>ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA, transcript variant
           A (His3.3A), mRNA
          Length = 853

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 608 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 549

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||| ||||||||||| ||||||||||||||||| ||||| |||||||||||
Sbjct: 548 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctc 493



to top

>gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA
          Length = 824

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 569 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 510

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||| ||||||||||| ||||||||||||||||| ||||| |||||||||||
Sbjct: 509 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctc 454



to top

>dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310069A13 product:HISTONE H3-VI homolog
           [Gallus gallus], full insert sequence
          Length = 852

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 429 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 370

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 369 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 314



to top

>gb|AC008233.3|AC008233 Drosophila melanogaster, chromosome 2L, region 25C-25C, BAC clone
              BACR13M11, complete sequence
          Length = 162387

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                          
Query: 163    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
              |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 112058 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 111999

                                                                      
Query: 223    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              |||||||| ||||||||||| ||||||||||||||||| ||||| |||||||||||
Sbjct: 111998 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctc 111943



to top

>ref|NM_001013056.1| Rattus norvegicus histone 1, H2ai (predicted)
           (Hist1h2ai_predicted), mRNA
          Length = 411

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||| || |||
Sbjct: 407 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| |||||||||||||| ||||| || |||||||| |||||
Sbjct: 347 ttggcgtggatggcgcataggttggtgtcctcaaacagacccacaaggtaggcctc 292



to top

>ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (predicted)
           (Hist1h4a_predicted), mRNA
          Length = 428

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||| || |||
Sbjct: 408 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 349

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||| ||||||||||| ||||| || |||||||| |||||
Sbjct: 348 ttggcgtggatggcgcacagattggtgtcctcaaacagacccacaaggtaggcctc 293



to top

>gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, complete cds
          Length = 1851

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 927 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 868

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 867 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 812



to top

>gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, complete cds
          Length = 1408

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 848

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 792



to top

>gb|AE003608.5| Drosophila melanogaster chromosome 2L, section 17 of 83 of the complete
              sequence
          Length = 174887

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                          
Query: 163    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
              |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 114331 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 114272

                                                                      
Query: 223    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              |||||||| ||||||||||| ||||||||||||||||| ||||| |||||||||||
Sbjct: 114271 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctc 114216



to top

>gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123923
           IMAGE:40044769), complete cds
          Length = 1004

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 840 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 781

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 780 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 725



to top

>gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123922
           IMAGE:40044765), complete cds
          Length = 1004

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 840 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 781

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 780 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 725



to top

>gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123924
           IMAGE:40044770), complete cds
          Length = 1004

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 840 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 781

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 780 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 725



to top

>emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3
          Length = 702

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 558 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 499

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 498 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 443



to top

>gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds
          Length = 927

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 745 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 686

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 685 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 630



to top

>gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds
          Length = 982

 Score =  159 bits (80), Expect = 6e-36
 Identities = 107/116 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 815 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 756

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 755 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 700



to top

>ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 1,
           mRNA
          Length = 411

 Score =  157 bits (79), Expect = 2e-35
 Identities = 100/107 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||| 
Sbjct: 398 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgc 339

                                                          
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 338 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 292



to top

>gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:97421
           IMAGE:7262697), complete cds
          Length = 461

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 409 acgccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 350

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307



to top

>gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79343
           IMAGE:7002071), complete cds
          Length = 465

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 409 acgccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 350

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307



to top

>gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79344
           IMAGE:7002072), complete cds
          Length = 464

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 409 acgccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 350

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307



to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on
            chromosome 6
          Length = 269712

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                        
Query: 161  acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
            |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 4840 acgccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 4781

                                                       
Query: 221  gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
            ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 4780 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 4738



 Score =  135 bits (68), Expect = 8e-29
 Identities = 107/120 (89%)
 Strand = Plus / Plus

                                                                          
Query: 159    ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
              |||||||||||| ||||| |||||||| || ||||||||||||||||||||||| || ||
Sbjct: 180840 ttacgccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcac 180899

                                                                          
Query: 219    gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
               ||||||||||| |||||||| |||||||||||||| |||||||| || ||||| |||||
Sbjct: 180900 tcgcttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctc 180959



 Score =  121 bits (61), Expect = 1e-24
 Identities = 106/121 (87%)
 Strand = Plus / Plus

                                                                          
Query: 158    cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
              |||| |||||||| || || |||||||| |||||||||||||||||||||||||| || |
Sbjct: 234194 cttatgccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtca 234253

                                                                          
Query: 218    cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
              | |||||||||||||| || ||||||||||||||||| || ||||| || ||||| ||||
Sbjct: 234254 ctcgcttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcct 234313

               
Query: 278    c 278
              |
Sbjct: 234314 c 234314



 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Minus

                                                                          
Query: 161    acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
              |||||||||| ||||| ||||||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 209563 acgccctctccccacgaatgcggcgggcaagctggatgtctttaggcatgatggtcacgc 209504

                                                         
Query: 221    gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
              | ||||| || || ||||||||||||||||||||||| |||||
Sbjct: 209503 gtttggcatgaatagcgcacaggttggtgtcctcgaaaagccc 209461



 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 90/104 (86%)
 Strand = Plus / Plus

                                                                          
Query: 160    tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 219
              ||||| ||||| ||||| |||||||| |||||||| ||||||||||||||||| || || 
Sbjct: 254975 tacgctctctccccacgaatgcggcgagcgagctgaatgtccttgggcatgatagtcact 255034

                                                          
Query: 220    cgcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
              ||||| || |||||||| ||||||||||| ||||| || |||||
Sbjct: 255035 cgcttagcatggatggcacacaggttggtatcctcaaagagccc 255078



 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 102/121 (84%)
 Strand = Plus / Minus

                                                                         
Query: 158   cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
             |||| ||||| || ||||||||||| || || |||||||| || ||||||||||||||||
Sbjct: 29764 cttatgccctttccccacggatgcgacgtgccagctggatatctttgggcatgatggtga 29705

                                                                         
Query: 218   cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
             |||| || ||||| || |||||||| |||||||| ||||| || || || ||||| ||||
Sbjct: 29704 cgcgtttagcgtgaatagcgcacagattggtgtcttcgaagagtcccaccaggtaggcct 29645

              
Query: 278   c 278
             |
Sbjct: 29644 c 29644



 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 74/86 (86%)
 Strand = Plus / Plus

                                                                         
Query: 178   atgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcg 237
             |||||||| |||||||||||||| |||||||| || || || ||||| || |||||||||
Sbjct: 15611 atgcggcgagcgagctggatgtctttgggcataatagtcactcgcttagcatggatggcg 15670

                                       
Query: 238   cacaggttggtgtcctcgaacagccc 263
             || ||||| |||||||| || |||||
Sbjct: 15671 caaaggtttgtgtcctcaaagagccc 15696



to top

>ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA
          Length = 469

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 409 acgccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 350

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307



to top

>gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete cds
          Length = 1227

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 819 acgccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 760

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 759 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 717



to top

>gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds
          Length = 411

 Score =  157 bits (79), Expect = 2e-35
 Identities = 100/107 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           |||||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 398 ccacggatgcggcgagcgagctgaatgtccttgggcatgatggtgacacgcttggcgtgg 339

                                                          
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||| ||||||||||||||| |||||||| ||||| |||||
Sbjct: 338 atggcgcacaagttggtgtcctcgaagagcccgacgaggtaagcctc 292



to top

>ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC582332), mRNA
          Length = 411

 Score =  157 bits (79), Expect = 2e-35
 Identities = 94/99 (94%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 402 ctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 343

                                                  
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||||||||||||||||||||||||| || |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaagagaccgac 304



to top

>ref|XM_780236.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC580163), mRNA
          Length = 363

 Score =  157 bits (79), Expect = 2e-35
 Identities = 94/99 (94%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           ||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 354 ctcgccacggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttggc 295

                                                  
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||||||||||||||||||||||||| || |||||
Sbjct: 294 gtggatggcgcacaggttggtgtcctcgaagagaccgac 256



to top

>ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC579977), mRNA
          Length = 411

 Score =  157 bits (79), Expect = 2e-35
 Identities = 94/99 (94%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           ||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 402 ctcgccacggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttggc 343

                                                  
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||||||||||||||||||||||||| || |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaagagaccgac 304



to top

>ref|XM_777897.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC577682), mRNA
          Length = 411

 Score =  157 bits (79), Expect = 2e-35
 Identities = 94/99 (94%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 402 ctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 343

                                                  
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||||||||||||||||||||||||| || |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaagagaccgac 304



to top

>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes
          Length = 3098

 Score =  157 bits (79), Expect = 2e-35
 Identities = 100/107 (93%)
 Strand = Plus / Minus

                                                                        
Query: 172  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||| 
Sbjct: 2570 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgc 2511

                                                           
Query: 232  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||||||||| || ||||| |||||
Sbjct: 2510 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctc 2464



to top

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
              hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
              sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Plus

                                                                          
Query: 161    acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
              |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 120161 acgccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 120220

                                                         
Query: 221    gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
              ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 120221 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 120263



 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 102/121 (84%)
 Strand = Plus / Plus

                                                                         
Query: 158   cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
             |||| ||||| || ||||||||||| || || |||||||| || ||||||||||||||||
Sbjct: 95237 cttatgccctttccccacggatgcgacgtgccagctggatatctttgggcatgatggtga 95296

                                                                         
Query: 218   cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
             |||| || ||||| || |||||||| |||||||| ||||| || || || ||||| ||||
Sbjct: 95297 cgcgtttagcgtgaatagcgcacagattggtgtcttcgaagagtcccaccaggtaggcct 95356

              
Query: 278   c 278
             |
Sbjct: 95357 c 95357



 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                          
Query: 178    atgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcg 237
              |||||||| |||||||||||||| |||||||| || || || ||||| || |||||||||
Sbjct: 109390 atgcggcgagcgagctggatgtctttgggcataatagtcactcgcttagcatggatggcg 109331

                                        
Query: 238    cacaggttggtgtcctcgaacagccc 263
              || ||||| |||||||| || |||||
Sbjct: 109330 caaaggtttgtgtcctcaaagagccc 109305



to top

>emb|CR541858.1| Homo sapiens full open reading frame cDNA clone RZPDo834H0632D for
           gene HIST1H3A, histone 1, H3a; complete cds, incl.
           stopcodon
          Length = 411

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 409 acgccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 350

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307



to top

>emb|Z61129.1|HS45E8R H.sapiens CpG island DNA genomic Mse1 fragment, clone 45e8, reverse
           read cpg45e8.rt1d
          Length = 257

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 171 acgccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 112

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 111 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 69



to top

>gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79341
           IMAGE:7002069), complete cds
          Length = 465

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 409 acgccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 350

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307



to top

>gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79340
           IMAGE:7002068), complete cds
          Length = 465

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 409 acgccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 350

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307



to top

>gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79342
           IMAGE:7002070), complete cds
          Length = 465

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 409 acgccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 350

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307



to top

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
           genes, complete cds
          Length = 1338

 Score =  157 bits (79), Expect = 2e-35
 Identities = 103/111 (92%)
 Strand = Plus / Plus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 209 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 268

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||| |||||||||||||| || || ||||| |||||
Sbjct: 269 gtggatggcgcacaggttcgtgtcctcgaacaggcccaccaggtaggcctc 319



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
           histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
           complete cds
          Length = 3777

 Score =  157 bits (79), Expect = 2e-35
 Identities = 103/111 (92%)
 Strand = Plus / Plus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           ||||||||||||||||||||| ||||||||||||||||||||||| || || ||||||||
Sbjct: 253 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtcacacgcttggc 312

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||||||||||||| || || ||||| |||||
Sbjct: 313 gtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctc 363



to top

>emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a
          Length = 969

 Score =  157 bits (79), Expect = 2e-35
 Identities = 97/103 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 716 acgccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 657

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 656 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 614



to top

>ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC581030), mRNA
          Length = 411

 Score =  155 bits (78), Expect = 9e-35
 Identities = 93/98 (94%)
 Strand = Plus / Minus

                                                                       
Query: 169 tcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 228
           ||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 401 tcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcg 342

                                                 
Query: 229 tggatggcgcacaggttggtgtcctcgaacagcccgac 266
           ||||||||||||||||||||||||||||| || |||||
Sbjct: 341 tggatggcgcacaggttggtgtcctcgaagagaccgac 304



to top

>emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for histones H3 and H4
          Length = 1504

 Score =  155 bits (78), Expect = 9e-35
 Identities = 96/102 (94%)
 Strand = Plus / Minus

                                                                        
Query: 158  cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
            ||||||| | ||||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 1162 cttacgcgcgctcgccacggatgcgacgggccagctggatgtccttgggcatgatggtga 1103

                                                      
Query: 218  cgcgcttggcgtggatggcgcacaggttggtgtcctcgaaca 259
            |||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 1102 cgcgcttggcgtggatggcgcaaaggttagtgtcctcgaaca 1061



to top

>gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053006),
           partial cds
          Length = 417

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||
Sbjct: 410 cttaagcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtga 351

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           | ||||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 350 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcct 291

            
Query: 278 c 278
           |
Sbjct: 290 c 290



to top

>ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA
          Length = 507

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 448 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 389

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 388 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 329

            
Query: 278 c 278
           |
Sbjct: 328 c 328



to top

>gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds
          Length = 1227

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 821 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 762

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 761 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 702

            
Query: 278 c 278
           |
Sbjct: 701 c 701



to top

>ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC525511), mRNA
          Length = 448

 Score =  153 bits (77), Expect = 4e-34
 Identities = 104/113 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 225
           ||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 404 ctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttg 345

                                                                
Query: 226 gcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||| ||||||||||||||||| || ||||| || ||||| |||||
Sbjct: 344 gcgtggatggcacacaggttggtgtcctcaaagagccccaccaggtaggcctc 292



to top

>ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA
          Length = 492

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||||||| || |||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 440 cttaagccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtga 381

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           | ||||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 380 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcct 321

            
Query: 278 c 278
           |
Sbjct: 320 c 320



to top

>ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611167), mRNA
          Length = 504

 Score =  153 bits (77), Expect = 4e-34
 Identities = 104/113 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 225
           ||||| || ||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 497 ctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 438

                                                                
Query: 226 gcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 437 gcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 385



to top

>gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNING: chimeric clone
           ****
          Length = 1047

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 425 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 366

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 365 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 306

            
Query: 278 c 278
           |
Sbjct: 305 c 305



to top

>gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMAGE:3913365)
          Length = 1672

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 448 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 389

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 388 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 329

            
Query: 278 c 278
           |
Sbjct: 328 c 328



to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                          
Query: 158    cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
              |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 114788 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 114729

                                                                          
Query: 218    cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
              |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 114728 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 114669

               
Query: 278    c 278
              |
Sbjct: 114668 c 114668



 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Plus

                                                                          
Query: 158    cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
              |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 102478 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 102537

                                                                          
Query: 218    cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
              |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 102538 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 102597

               
Query: 278    c 278
              |
Sbjct: 102598 c 102598



 Score =  137 bits (69), Expect = 2e-29
 Identities = 108/121 (89%)
 Strand = Plus / Plus

                                                                         
Query: 158   cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
             |||| |||| ||| || |||||||||||||| | |||||||||||||||||||||||| |
Sbjct: 74985 cttaggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtca 75044

                                                                         
Query: 218   cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
             |||||||||| ||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 75045 cgcgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 75104

              
Query: 278   c 278
             |
Sbjct: 75105 c 75105



to top

>ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (LOC653611), mRNA
          Length = 824

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 701 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 642

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 641 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 582

            
Query: 278 c 278
           |
Sbjct: 581 c 581



to top

>ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudogene on chromosome 1
          Length = 1323

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 935 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 876

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 875 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 816

            
Query: 278 c 278
           |
Sbjct: 815 c 815



to top

>gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE:30915509),
           partial cds
          Length = 481

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 440 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 381

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 380 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 321

            
Query: 278 c 278
           |
Sbjct: 320 c 320



to top

>gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete cds
          Length = 1227

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 821 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 762

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 761 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 702

            
Query: 278 c 278
           |
Sbjct: 701 c 701



to top

>gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, complete sequence
          Length = 1323

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 935 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 876

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 875 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 816

            
Query: 278 c 278
           |
Sbjct: 815 c 815



to top

>gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, complete cds
          Length = 1405

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||||||| || |||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 909 cttaagccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtga 850

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           | ||||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 849 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcct 790

            
Query: 278 c 278
           |
Sbjct: 789 c 789



to top

>gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cds, clone B1
          Length = 494

 Score =  153 bits (77), Expect = 4e-34
 Identities = 86/89 (96%)
 Strand = Plus / Minus

                                                                       
Query: 190 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 249
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 494 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 435

                                        
Query: 250 tcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||  |||||| |||||
Sbjct: 434 tcctcgaacagcccgcgaaggtatgcctc 406



to top

>emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3
          Length = 1244

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||||||| || |||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 764 cttaagccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtga 705

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           | ||||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 704 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcct 645

            
Query: 278 c 278
           |
Sbjct: 644 c 644



to top

>gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds
          Length = 1125

 Score =  153 bits (77), Expect = 4e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 217
           |||| |||||||| || |||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 764 cttaagccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtga 705

                                                                       
Query: 218 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 277
           | ||||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 704 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcct 645

            
Query: 278 c 278
           |
Sbjct: 644 c 644



to top

>gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053019),
           partial cds
          Length = 415

 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 407 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 348

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 347 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 288



to top

>ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA
          Length = 411

 Score =  151 bits (76), Expect = 1e-33
 Identities = 106/116 (91%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 407 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 292



to top

>ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA
          Length = 411

 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 351 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 292



to top

>ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618987), partial mRNA
          Length = 521

 Score =  151 bits (76), Expect = 1e-33
 Identities = 88/92 (95%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 410 gccctctctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 351

                                           
Query: 223 ttggcgtggatggcgcacaggttggtgtcctc 254
           |||||||||||||| |||||||||||||||||
Sbjct: 350 ttggcgtggatggcacacaggttggtgtcctc 319



to top

>ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC613840), partial mRNA
          Length = 547

 Score =  151 bits (76), Expect = 1e-33
 Identities = 88/92 (95%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 436 gccctctctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 377

                                           
Query: 223 ttggcgtggatggcgcacaggttggtgtcctc 254
           |||||||||||||| |||||||||||||||||
Sbjct: 376 ttggcgtggatggcacacaggttggtgtcctc 345



to top

>ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC523214), mRNA
          Length = 1459

 Score =  151 bits (76), Expect = 1e-33
 Identities = 97/104 (93%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 915 cggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 856

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           || || ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 855 gcacaaaggttggtgtcctcgaagagccccaccaggtaggcctc 812



to top

>ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488306), mRNA
          Length = 411

 Score =  151 bits (76), Expect = 1e-33
 Identities = 97/104 (93%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 335 gcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292



to top

>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2
          Length = 2927

 Score =  151 bits (76), Expect = 1e-33
 Identities = 97/104 (93%)
 Strand = Plus / Minus

                                                                        
Query: 175  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
            |||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2750 cggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgcttggcgtggatg 2691

                                                        
Query: 235  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            |||||||||||||||||||||||||| || || ||||| |||||
Sbjct: 2690 gcgcacaggttggtgtcctcgaacagacccaccaggtaggcctc 2647



to top

>ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560897), mRNA
          Length = 471

 Score =  151 bits (76), Expect = 1e-33
 Identities = 88/92 (95%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 455 cggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggcgtggatg 396

                                           
Query: 235 gcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||||||||||||||||||||| |||||
Sbjct: 395 gcgcacaggttggtgtcctcgaacagaccgac 364



to top

>dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F730210F11
           product:histone 1, H3h, full insert sequence
          Length = 1806

 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 439 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 380

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 379 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 320



to top

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                        
Query: 159  ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
            |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 2012 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 1953

                                                                        
Query: 219  gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 1952 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 1893



to top

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                        
Query: 159  ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
            |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 2010 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 1951

                                                                        
Query: 219  gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
             ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 1950 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 1891



to top

>gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, complete cds
          Length = 1100

 Score =  151 bits (76), Expect = 1e-33
 Identities = 106/116 (91%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 893 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 834

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 833 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 778



to top

>gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, complete cds
          Length = 727

 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 557 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 498

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 497 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 438



to top

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F),
           histone H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Plus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 87  ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 146

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 147 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 206



to top

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score =  151 bits (76), Expect = 1e-33
 Identities = 97/104 (93%)
 Strand = Plus / Plus

                                                                          
Query: 175    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
              |||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 102364 cggatgcggcgggccagctggatgtctttgggcatgatggtgacccgcttggcgtggatg 102423

                                                          
Query: 235    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              |||||||||||||||||||||||||| || || ||||| |||||
Sbjct: 102424 gcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctc 102467



to top

>ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA
          Length = 411

 Score =  151 bits (76), Expect = 1e-33
 Identities = 106/116 (91%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| ||||||
Sbjct: 407 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 348

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| ||||||||||| || ||||| |||||
Sbjct: 347 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctc 292



to top

>ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone protein Hist2h3c1
           (LOC310679), mRNA
          Length = 573

 Score =  151 bits (76), Expect = 1e-33
 Identities = 97/104 (93%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 557 cggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgcttggcgtggatg 498

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||| || || ||||| |||||
Sbjct: 497 gcgcacaggttggtgtcctcgaacagacccaccaggtaggcctc 454



to top

>gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, complete cds
          Length = 2249

 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 950 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 891

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 890 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 831



to top

>gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, complete cds
          Length = 1408

 Score =  151 bits (76), Expect = 1e-33
 Identities = 106/116 (91%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 907 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 848

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 792



to top

>gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, complete cds
          Length = 1408

 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 911 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 852

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 851 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 792



to top

>emb|Z56112.1|HS89C12R H.sapiens CpG island DNA genomic Mse1 fragment, clone 89c12,
           reverse read cpg89c12.rt1a
          Length = 172

 Score =  151 bits (76), Expect = 1e-33
 Identities = 106/116 (91%)
 Strand = Plus / Plus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| ||||||
Sbjct: 2   gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 61

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| ||||||||||| || ||||| |||||
Sbjct: 62  ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctc 117



to top

>emb|Z56111.1|HS89C12F H.sapiens CpG island DNA genomic Mse1 fragment, clone 89c12,
           forward read cpg89c12.ft1a
          Length = 171

 Score =  151 bits (76), Expect = 1e-33
 Identities = 106/116 (91%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| ||||||
Sbjct: 171 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 112

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| ||||||||||| || ||||| |||||
Sbjct: 111 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctc 56



to top

>emb|Z63365.1|HS81H7R H.sapiens CpG island DNA genomic Mse1 fragment, clone 81h7, reverse
           read cpg81h7.rt1a
          Length = 171

 Score =  151 bits (76), Expect = 1e-33
 Identities = 106/116 (91%)
 Strand = Plus / Plus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| ||||||
Sbjct: 2   gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 61

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||||| ||||| ||||||||||| || ||||| |||||
Sbjct: 62  ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctc 117



to top

>ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA
          Length = 483

 Score =  151 bits (76), Expect = 1e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 218
           |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 438 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 379

                                                                       
Query: 219 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
            ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 378 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 319



to top

>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25,
             complete sequence
          Length = 167326

 Score =  151 bits (76), Expect = 1e-33
 Identities = 88/92 (95%)
 Strand = Plus / Plus

                                                                         
Query: 175   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
             |||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 79285 cggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggcgtggatg 79344

                                             
Query: 235   gcgcacaggttggtgtcctcgaacagcccgac 266
             |||||||||||||||||||||||||| |||||
Sbjct: 79345 gcgcacaggttggtgtcctcgaacagaccgac 79376



 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Plus

                                                                          
Query: 175    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
              |||||||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||
Sbjct: 116400 cggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtggatg 116459

                                              
Query: 235    gcgcacaggttggtgtcctcgaacagcccgac 266
              |||||||||||||||||||||||||| |||||
Sbjct: 116460 gcgcacaggttggtgtcctcgaacagaccgac 116491



 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Plus

                                                                         
Query: 175   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
             |||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 99236 cggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggcgtggatg 99295

                                             
Query: 235   gcgcacaggttggtgtcctcgaacagcccgac 266
             ||||||||||| |||||||||||||| |||||
Sbjct: 99296 gcgcacaggttagtgtcctcgaacagaccgac 99327



 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Plus

                                                                         
Query: 175   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
             |||||||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||
Sbjct: 85984 cggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtggatg 86043

                                             
Query: 235   gcgcacaggttggtgtcctcgaacagcccgac 266
             |||||||||||||||||||||||||| |||||
Sbjct: 86044 gcgcacaggttggtgtcctcgaacagaccgac 86075



 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Minus

                                                                         
Query: 175   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
             |||||||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||
Sbjct: 63670 cggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtggatg 63611

                                             
Query: 235   gcgcacaggttggtgtcctcgaacagcccgac 266
             |||||||||||||||||||||||||| |||||
Sbjct: 63610 gcgcacaggttggtgtcctcgaacagaccgac 63579



to top

>ref|XM_527253.1| PREDICTED: Pan troglodytes similar to histone 1, H3g (LOC471875),
           mRNA
          Length = 411

 Score =  149 bits (75), Expect = 5e-33
 Identities = 96/103 (93%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||| ||| || |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 409 acgcccgctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgc 350

                                                      
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           ||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcaaatagccc 307



to top

>ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570618), mRNA
          Length = 411

 Score =  149 bits (75), Expect = 5e-33
 Identities = 90/95 (94%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           |||||||||||||| || ||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 398 ccacggatgcggcgagccagctggatgtccttgggcatgatggtgaccctcttggcgtgg 339

                                              
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgac 266
           ||||||||||||||||||||||||||||| |||||
Sbjct: 338 atggcgcacaggttggtgtcctcgaacagaccgac 304



to top

>ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570590), mRNA
          Length = 411

 Score =  149 bits (75), Expect = 5e-33
 Identities = 90/95 (94%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 398 ccacggatgcggcgggctagctggatgtccttgggcatgatggtgaccctcttggcgtgg 339

                                              
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgac 266
           ||||||||||| ||||||||||||||||| |||||
Sbjct: 338 atggcgcacagattggtgtcctcgaacagaccgac 304



to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
           histone H2A genes, complete cds
          Length = 4358

 Score =  149 bits (75), Expect = 5e-33
 Identities = 102/111 (91%)
 Strand = Plus / Plus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 275 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 334

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |  |||||||||||||||||||||||||||||| || || ||||| |||||
Sbjct: 335 ggtgatggcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctc 385



to top

>gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H3 and H4 genes
          Length = 2133

 Score =  149 bits (75), Expect = 5e-33
 Identities = 93/99 (93%)
 Strand = Plus / Minus

                                                                        
Query: 168  ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
            |||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1915 ctcgccacggatacggcgggcaagctggatgtccttgggcatgatggtgacacgcttggc 1856

                                                   
Query: 228  gtggatggcgcacaggttggtgtcctcgaacagcccgac 266
            |||||||||||| ||||||||||||||||| || |||||
Sbjct: 1855 gtggatggcgcaaaggttggtgtcctcgaagagaccgac 1817



to top

>ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC539875), mRNA
          Length = 411

 Score =  147 bits (74), Expect = 2e-32
 Identities = 107/118 (90%)
 Strand = Plus / Minus

                                                                       
Query: 161 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 220
           |||||||||| || ||||||||||| || |||||||||||||||||||||||||||||||
Sbjct: 409 acgccctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatggtgacgc 350

                                                                     
Query: 221 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||| || |||||||||||||| || || || ||||| |||||
Sbjct: 349 gcttggcgtggatggcgcagagattggtgtcctcgaagaggcccaccaggtaggcctc 292



to top

>ref|XM_793816.1| PREDICTED: Strongylocentrotus purpuratus similar to H3 histone,
           family 3B (LOC594373), mRNA
          Length = 411

 Score =  147 bits (74), Expect = 2e-32
 Identities = 92/98 (93%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||||||||| ||||| || ||||||||||| ||||||||||||||||| || 
Sbjct: 407 gccctctcgccacggatacggcgtgcaagctggatgtctttgggcatgatggtgacacgt 348

                                                 
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacag 260
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacag 310



to top

>ref|XM_789723.1| PREDICTED: Strongylocentrotus purpuratus similar to H3 histone,
           family 2 isoform 2 (LOC590106), mRNA
          Length = 438

 Score =  147 bits (74), Expect = 2e-32
 Identities = 92/98 (93%)
 Strand = Plus / Minus

                                                                       
Query: 169 tcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 228
           ||||||||||| |||||||| |||||||||||||| |||||||||||||| |||||||||
Sbjct: 428 tcgccacggatacggcgggccagctggatgtcctttggcatgatggtgacacgcttggcg 369

                                                 
Query: 229 tggatggcgcacaggttggtgtcctcgaacagcccgac 266
           ||||||||||||||||||||||||||||| || |||||
Sbjct: 368 tggatggcgcacaggttggtgtcctcgaagagaccgac 331



to top

>ref|XM_686806.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC563445), mRNA
          Length = 444

 Score =  147 bits (74), Expect = 2e-32
 Identities = 83/86 (96%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 428 cggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggcgtggatg 369

                                     
Query: 235 gcgcacaggttggtgtcctcgaacag 260
           ||||||||||||||||||||||||||
Sbjct: 368 gcgcacaggttggtgtcctcgaacag 343



to top

>gb|AY231774.1| Drosophila yakuba clone yak-em_His3.3A mRNA sequence
          Length = 408

 Score =  145 bits (73), Expect = 9e-32
 Identities = 103/113 (91%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 407 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 348

                                                                
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgc 275
           ||||| || ||||||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 347 ttggcatgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgc 295



to top

>emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3
          Length = 529

 Score =  145 bits (73), Expect = 9e-32
 Identities = 91/98 (92%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 467 cggatgcggcgggcgagctggatgtccttgggcatgatggagacgcgcttggcgtggatg 408

                                                 
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggta 272
           ||||| |||||||| || ||||| |||| ||| |||||
Sbjct: 407 gcgcagaggttggtntcntcgaagagccngacgaggta 370



to top

>gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequence
          Length = 188026

 Score =  143 bits (72), Expect = 3e-31
 Identities = 96/104 (92%)
 Strand = Plus / Plus

                                                                          
Query: 175    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
              |||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||||
Sbjct: 183209 cggatgcggcgggccagctggatgtccttgggcatgatagtcacgcgcttggcgtggatg 183268

                                                          
Query: 235    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
              ||||||||||| ||||| ||||||||||| || ||||| |||||
Sbjct: 183269 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctc 183312



to top

>gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence
          Length = 716

 Score =  143 bits (72), Expect = 3e-31
 Identities = 105/116 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 467 gccctctctcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 408

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||||||| | |||||||| || ||||| || ||||| |||||
Sbjct: 407 ttggcgtggatggcgcacagggtagtgtcctcaaagagccccacgaggtaggcctc 352



to top

>emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score =  143 bits (72), Expect = 3e-31
 Identities = 105/116 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || ||||||||||| || ||||||||||| ||||||||||||||||| | |
Sbjct: 644 gccctctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtgaccctc 585

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||||||||||||||| || || ||||| |||||
Sbjct: 584 ttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctc 529



to top

>ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC561114), mRNA
          Length = 411

 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtggatg 336

                                           
Query: 235 gcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||||||||||||||||||||| |||||
Sbjct: 335 gcgcacaggttggtgtcctcgaacagaccgac 304



to top

>ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560616), mRNA
          Length = 411

 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtggatg 336

                                           
Query: 235 gcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||||||||||||||||||||| |||||
Sbjct: 335 gcgcacaggttggtgtcctcgaacagaccgac 304



to top

>ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560090), mRNA
          Length = 411

 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttggcgtggatg 336

                                           
Query: 235 gcgcacaggttggtgtcctcgaacagcccgac 266
           ||||||||||| |||||||||||||| |||||
Sbjct: 335 gcgcacaggttagtgtcctcgaacagaccgac 304



to top

>ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC559765), mRNA
          Length = 411

 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtggatg 336

                                           
Query: 235 gcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||||||||||||||||||||| |||||
Sbjct: 335 gcgcacaggttggtgtcctcgaacagaccgac 304



to top

>ref|XM_687893.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC564560), mRNA
          Length = 411

 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtggatg 336

                                           
Query: 235 gcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||||||||||||||||||||| |||||
Sbjct: 335 gcgcacaggttggtgtcctcgaacagaccgac 304



to top

>ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570644), mRNA
          Length = 411

 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||
Sbjct: 395 cggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtggatg 336

                                           
Query: 235 gcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||||||||||||||||||||| |||||
Sbjct: 335 gcgcacaggttggtgtcctcgaacagaccgac 304



to top

>ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (predicted)
           (Hist2h3c2_predicted), mRNA
          Length = 411

 Score =  143 bits (72), Expect = 3e-31
 Identities = 96/104 (92%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||| ||||| | |||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 395 cggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtggatg 336

                                                       
Query: 235 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           |||||||||||||||||||||||||| || || ||||| |||||
Sbjct: 335 gcgcacaggttggtgtcctcgaacagacccaccaggtaggcctc 292



to top

>ref|XM_320335.2| Anopheles gambiae str. PEST ENSANGP00000014183
           (ENSANGG00000011694), partial mRNA
          Length = 411

 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctcgccacggatacggcgggccagctggatgtccttgggcatgatcgtgacgcgcttggc 343

                                           
Query: 228 gtggatggcgcacaggttggtgtcctcgaaca 259
           ||||||||||||||| ||||||||||| ||||
Sbjct: 342 gtggatggcgcacagattggtgtcctcaaaca 311



to top

>ref|XM_314446.2| Anopheles gambiae str. PEST ENSANGP00000016066
           (ENSANGG00000013577), partial mRNA
          Length = 411

 Score =  143 bits (72), Expect = 3e-31
 Identities = 87/92 (94%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                           
Query: 228 gtggatggcgcacaggttggtgtcctcgaaca 259
            |||||||||||||| ||||||||||| ||||
Sbjct: 342 atggatggcgcacagattggtgtcctcaaaca 311



to top

>gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), complete cds
          Length = 1264

 Score =  143 bits (72), Expect = 3e-31
 Identities = 105/116 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || | ||||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 932 gccctctctcccctgatgcggcgcgcgagctgaatgtccttgggcatgatggtgacgcgc 873

                                                                   
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||||||||||||| ||||| |||||||| || ||||| |||||||| |||||
Sbjct: 872 ttggcgtggatggcgcagaggttagtgtcctcaaagagccccacaaggtaggcctc 817



to top

>emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones
          Length = 4942

 Score =  141 bits (71), Expect = 1e-30
 Identities = 92/99 (92%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||||||||| || | ||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 747 ctcgccacggatacgtctggccagctggatgtccttgggcatgatggtgacacgcttggc 688

                                                  
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||||||||||||||||||||||||| || |||||
Sbjct: 687 gtggatggcgcacaggttggtgtcctcgaagagaccgac 649



to top

>ref|XM_779415.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC579293), mRNA
          Length = 330

 Score =  141 bits (71), Expect = 1e-30
 Identities = 98/107 (91%)
 Strand = Plus / Minus

                                                                       
Query: 160 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 219
           ||||| ||||| ||||||||||| ||||| | ||||||||||||||||||||||||||| 
Sbjct: 329 tacgctctctctccacggatgcgacgggctaactggatgtccttgggcatgatggtgaca 270

                                                          
Query: 220 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgac 266
           |||||||| ||||||||||||||||||||||||||||| || |||||
Sbjct: 269 cgcttggcatggatggcgcacaggttggtgtcctcgaagagaccgac 223



to top

>gb|BC097059.1| Danio rerio zgc:113983, mRNA (cDNA clone MGC:113983 IMAGE:7226638),
           complete cds
          Length = 1331

 Score =  141 bits (71), Expect = 1e-30
 Identities = 89/95 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| ||||||||||| ||||||||||||||||| | ||||||||||
Sbjct: 443 ccacggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtgg 384

                                              
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgac 266
           ||||||||||||||||||||| ||||||| |||||
Sbjct: 383 atggcgcacaggttggtgtccccgaacagaccgac 349



to top

>ref|NM_001025171.1| Danio rerio zgc:113983 (zgc:113983), mRNA
          Length = 1331

 Score =  141 bits (71), Expect = 1e-30
 Identities = 89/95 (93%)
 Strand = Plus / Minus

                                                                       
Query: 172 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 231
           ||||||||||||||||| ||||||||||| ||||||||||||||||| | ||||||||||
Sbjct: 443 ccacggatgcggcgggccagctggatgtctttgggcatgatggtgaccctcttggcgtgg 384

                                              
Query: 232 atggcgcacaggttggtgtcctcgaacagcccgac 266
           ||||||||||||||||||||| ||||||| |||||
Sbjct: 383 atggcgcacaggttggtgtccccgaacagaccgac 349



to top

>dbj|AB185067.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           YFS1
          Length = 480

 Score =  141 bits (71), Expect = 1e-30
 Identities = 101/111 (90%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           |||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 471 ctcgcctcggatgcggggggccagctggatgtccttgggcatgatggtgacgcgcttgac 412

                                                              
Query: 228 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 278
           ||||||| |||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 411 gtggatgacgcagaggttggtgtcctcgaagagaccgacgaggtatgcctc 361



to top

>gb|BC054666.1| Danio rerio zgc:66241, mRNA (cDNA clone MGC:66241 IMAGE:3818929),
           complete cds
          Length = 2172

 Score =  139 bits (70), Expect = 5e-30
 Identities = 82/86 (95%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||
Sbjct: 407 cggatgcggcgggccagctggatgtctttgggcatgatggtgactctcttggcgtggatg 348

                                     
Query: 235 gcgcacaggttggtgtcctcgaacag 260
           ||||||||||||||||||||||||||
Sbjct: 347 gcgcacaggttggtgtcctcgaacag 322



to top

>emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic H3 and H4 histone genes
          Length = 2506

 Score =  139 bits (70), Expect = 5e-30
 Identities = 85/90 (94%)
 Strand = Plus / Minus

                                                                        
Query: 168  ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
            ||||||||||||||||||||| |||||||||||||| ||||||||||| || ||||||||
Sbjct: 2407 ctcgccacggatgcggcgggccagctggatgtcctttggcatgatggtaacacgcttggc 2348

                                          
Query: 228  gtggatggcgcacaggttggtgtcctcgaa 257
            |||||||||||| |||||||||||||||||
Sbjct: 2347 gtggatggcgcaaaggttggtgtcctcgaa 2318



to top

>ref|NM_199745.1| Danio rerio zgc:66241 (zgc:66241), mRNA
          Length = 2172

 Score =  139 bits (70), Expect = 5e-30
 Identities = 82/86 (95%)
 Strand = Plus / Minus

                                                                       
Query: 175 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 234
           |||||||||||||| ||||||||||| ||||||||||||||||| | |||||||||||||
Sbjct: 407 cggatgcggcgggccagctggatgtctttgggcatgatggtgactctcttggcgtggatg 348

                                     
Query: 235 gcgcacaggttggtgtcctcgaacag 260
           ||||||||||||||||||||||||||
Sbjct: 347 gcgcacaggttggtgtcctcgaacag 322



to top

>ref|NM_214547.1| Strongylocentrotus purpuratus late embryonic histone H3
           (LOC373340), mRNA
          Length = 411

 Score =  139 bits (70), Expect = 5e-30
 Identities = 85/90 (94%)
 Strand = Plus / Minus

                                                                       
Query: 168 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 227
           ||||||||||||||||||||| |||||||||||||| ||||||||||| || ||||||||
Sbjct: 402 ctcgccacggatgcggcgggccagctggatgtcctttggcatgatggtaacacgcttggc 343

                                         
Query: 228 gtggatggcgcacaggttggtgtcctcgaa 257
           |||||||||||| |||||||||||||||||
Sbjct: 342 gtggatggcgcaaaggttggtgtcctcgaa 313



to top

>gb|BC084311.1| Xenopus laevis cDNA clone IMAGE:6865011
          Length = 1959

 Score =  137 bits (69), Expect = 2e-29
 Identities = 90/97 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||| ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 440 gccctctcgccccggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 381

                                                
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaaca 259
           |||||||||||||||||||||||||||||||| ||||
Sbjct: 380 ttggcgtggatggcgcacaggttggtgtcctcaaaca 344



to top

>ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616800), mRNA
          Length = 411

 Score =  137 bits (69), Expect = 2e-29
 Identities = 93/101 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           |||||||| || ||||||||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgc 348

                                                    
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
           |||||||||||||| |||||||||||||| ||||| |||||
Sbjct: 347 ttggcgtggatggcacacaggttggtgtcttcgaagagccc 307



to top

>emb|X72949.1|XLH3HIS X.laevis H3r gene for histone H3
          Length = 1048

 Score =  137 bits (69), Expect = 2e-29
 Identities = 90/97 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||| ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 751 gccctctcgcctcggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 692

                                                
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaaca 259
           |||||||||||||||||||||||||||||||| ||||
Sbjct: 691 ttggcgtggatggcgcacaggttggtgtcctcaaaca 655



to top

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  137 bits (69), Expect = 2e-29
 Identities = 93/101 (92%)
 Strand = Plus / Plus

                                                                        
Query: 163  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
            |||||||| || ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 5556 gccctctctcctcggatcctgcgggccagctggatgtccttgggcatgatggtgactctc 5615

                                                     
Query: 223  ttggcgtggatggcgcacaggttggtgtcctcgaacagccc 263
            ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 5616 ttggcgtggatggcgcacaggttggtgtcctcgaagagccc 5656



to top

>gb|DQ096858.1| Xenopus laevis h3r mRNA, complete sequence
          Length = 1062

 Score =  137 bits (69), Expect = 2e-29
 Identities = 90/97 (92%)
 Strand = Plus / Minus

                                                                       
Query: 163 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 222
           ||||||||||| ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 425 gccctctcgcctcggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 366

                                                
Query: 223 ttggcgtggatggcgcacaggttggtgtcctcgaaca 259
           |||||||||||||||||||||||||||||||| ||||
Sbjct: 365 ttggcgtggatggcgcacaggttggtgtcctcaaaca 329



to top

>gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequence
          Length = 517

 Score =  137 bits (69), Expect = 2e-29
 Identities = 84/89 (94%)
 Strand = Plus / Plus

                                                                       
Query: 190 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 249
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 147 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 206

                                        
Query: 250 tcctcgaacagcccgacaaggtacgcctc 278
           |||||||| || ||||| ||||| |||||
Sbjct: 207 tcctcgaagagaccgacgaggtaagcctc 235


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,609,783
Number of Sequences: 3902068
Number of extensions: 1609783
Number of successful extensions: 37101
Number of sequences better than 10.0: 3285
Number of HSP's better than 10.0 without gapping: 3284
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 33362
Number of HSP's gapped (non-prelim): 3729
length of query: 278
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 256
effective length of database: 17,147,199,772
effective search space: 4389683141632
effective search space used: 4389683141632
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top