Clone Name	rbags33a01
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence	551	e-154
2	emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3	545	e-152
3	gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds	531	e-148
4	ref|XM_493701.1| Oryza sativa (japonica cultivar-group), mRNA	525	e-146
5	gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cd...	523	e-145
6	gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial ...	498	e-137
7	gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence	490	e-135
8	dbj|AB205017.1| Lolium multiflorum gene for replacement histone ...	456	e-125
9	ref|NM_190750.1| Oryza sativa (japonica cultivar-group), predic...	448	e-123
10	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	448	e-123
11	dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D...	448	e-123
12	dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clon...	448	e-123
13	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	446	e-122
14	dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic D...	446	e-122
15	ref|XM_475315.1| Oryza sativa (japonica cultivar-group), predic...	444	e-121
16	gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome...	444	e-121
17	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	444	e-121
18	dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clon...	444	e-121
19	gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence	424	e-115
20	emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene	424	e-115
21	ref|XM_472456.1| Oryza sativa (japonica cultivar-group), predic...	414	e-112
22	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	414	e-112
23	emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4,...	414	e-112
24	emb|X00937.1|TAHI02 Wheat histone H3 gene	410	e-111
25	gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial ...	410	e-111
26	gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds	408	e-111
27	gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), com...	408	e-111
28	ref|NM_185607.1| Oryza sativa (japonica cultivar-group), predic...	406	e-110
29	ref|NM_185613.1| Oryza sativa (japonica cultivar-group), predic...	406	e-110
30	emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11	406	e-110
31	dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic D...	406	e-110
32	dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic D...	406	e-110
33	gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds	404	e-109
34	gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end	404	e-109
35	ref|NM_185612.1| Oryza sativa (japonica cultivar-group), predic...	400	e-108
36	gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence	392	e-106
37	gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome...	392	e-106
38	gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome...	392	e-106
39	emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2	392	e-106
40	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	392	e-106
41	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	392	e-106
42	gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds	392	e-106
43	gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds	392	e-106
44	gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds	392	e-106
45	emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23	381	e-102
46	emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr...	371	2e-99
47	gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, compl...	371	2e-99
48	gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), com...	371	2e-99
49	ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA	369	6e-99
50	emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4...	369	6e-99
51	gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I...	369	6e-99
52	ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2a...	363	4e-97
53	ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2a...	363	4e-97
54	ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA	361	2e-96
55	ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2a...	361	2e-96
56	ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro...	361	2e-96
57	ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone ...	361	2e-96
58	emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143	361	2e-96
59	ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone pro...	359	6e-96
60	gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds	359	6e-96
61	ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone ...	357	2e-95
62	ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone ...	357	2e-95
63	ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone ...	357	2e-95
64	ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone ...	357	2e-95
65	gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence	353	4e-94
66	ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_8822...	353	4e-94
67	ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_8822...	353	4e-94
68	emb|X80326.1|MPMPH312 M.pahari mpH312 gene	353	4e-94
69	emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15	353	4e-94
70	gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, compl...	353	4e-94
71	emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV	353	4e-94
72	gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complet...	353	4e-94
73	gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds	353	4e-94
74	ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans...	351	2e-93
75	gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339	351	2e-93
76	ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h...	351	2e-93
77	gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ...	351	2e-93
78	gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MG...	351	2e-93
79	gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, comp...	351	2e-93
80	gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp...	351	2e-93
81	gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple...	351	2e-93
82	gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds	351	2e-93
83	ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone ...	349	6e-93
84	ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone ...	349	6e-93
85	ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ...	349	6e-93
86	ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ...	349	6e-93
87	dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RI...	349	6e-93
88	ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudoge...	349	6e-93
89	gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, co...	349	6e-93
90	gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, compl...	349	6e-93
91	ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA	349	6e-93
92	ref|NM_185609.1| Oryza sativa (japonica cultivar-group), predic...	345	9e-92
93	gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence	345	9e-92
94	ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_8822...	345	9e-92
95	dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-...	345	9e-92
96	gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, compl...	345	9e-92
97	emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V	345	9e-92
98	gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete...	345	9e-92
99	emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12	345	9e-92
100	gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds	345	9e-92
101	ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone ...	343	4e-91
102	emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes	343	4e-91
103	ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone ...	341	1e-90
104	gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and...	341	1e-90
105	gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, comp...	341	1e-90
106	gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds	339	6e-90
107	ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA	337	2e-89
108	ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histo...	337	2e-89
109	ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histo...	337	2e-89
110	gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple...	337	2e-89
111	ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (pr...	337	2e-89
112	gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	337	2e-89
113	ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2a...	335	9e-89
114	ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2a...	335	9e-89
115	ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-...	335	9e-89
116	gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds	331	1e-87
117	ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA	329	6e-87
118	emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his...	329	6e-87
119	emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene	329	6e-87
120	gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist...	329	6e-87
121	dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-...	329	6e-87
122	gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I...	329	6e-87
123	gb|AY749708.1| Baetis tricaudatus histone H3 (H3) gene, partial cds	327	2e-86
124	gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds	323	3e-85
125	emb|X80325.1|MPMPH315 M.pahari mpH315 gene	323	3e-85
126	emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA	319	5e-84
127	gb|AY338619.1| Baetis sp. Eph11 histone 3 gene, partial cds	317	2e-83
128	ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2a...	315	8e-83
129	ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2a...	311	1e-81
130	ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2a...	311	1e-81
131	gb|AY749737.1| Platybaetis probus histone H3 (H3) gene, partial cds	311	1e-81
132	ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2a...	309	5e-81
133	gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) ge...	309	5e-81
134	gb|AY521718.1| Romalea sp. BYU_ACOR015 histone H3 (H3) gene, par...	307	2e-80
135	gb|AY338631.1| Anthopotamus sp. EP022 histone 3 gene, partial cds	307	2e-80
136	ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2a...	305	8e-80
137	gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, parti...	305	8e-80
138	gb|AY749709.1| Mystaxiops venatoris histone H3 (H3) gene, partia...	303	3e-79
139	ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA	301	1e-78
140	gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds	301	1e-78
141	gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNI...	301	1e-78
142	gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMA...	301	1e-78
143	emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch...	301	1e-78
144	ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (...	301	1e-78
145	ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudoge...	301	1e-78
146	gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE...	301	1e-78
147	gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete...	301	1e-78
148	gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, co...	301	1e-78
149	gb|AY749722.1| Adenophlebia peringueyella histone H3 (H3) gene, ...	301	1e-78
150	ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2a...	297	2e-77
151	ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA	297	2e-77
152	gb|AY749702.1| Thraulodes sp. EP014 histone H3 (H3) gene, partia...	297	2e-77
153	gb|AY749738.1| Jubabaetis sp. EP139 histone H3 (H3) gene, partia...	293	3e-76
154	gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 p...	291	1e-75
155	gb|AY749739.1| Stygifloris sp. EP141 histone H3 (H3) gene, parti...	291	1e-75
156	gb|AY749713.1| Penaphlebia sp. EP076 histone H3 (H3) gene, parti...	289	5e-75
157	emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11	287	2e-74
158	ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone ...	285	7e-74
159	gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	285	7e-74
160	gb|AY520709.1| Chthamalus stellatus histone H3 gene, partial cds	283	3e-73
161	emb|AJ556872.1|XLA556872 Expression vector pET3-H3 H3 gene for X...	283	3e-73
162	ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2a...	281	1e-72
163	gb|AY749714.1| Meridialaris diguillina histone H3 (H3) gene, par...	281	1e-72
164	emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant	280	5e-72
165	gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA	280	5e-72
166	ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA...	280	5e-72
167	gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA	280	5e-72
168	gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial...	280	5e-72
169	gb|DQ284405.1| Arthroleptis tanneri histone H3a gene, partial cds	278	2e-71
170	gb|AY520720.1| Capitulum mitella histone H3 gene, partial cds	276	7e-71
171	gb|AY520703.1| Elminius modestus histone H3 gene, partial cds	276	7e-71
172	emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for h...	276	7e-71
173	gb|DQ284420.1| Pleurodeles waltl histone H3a gene, partial cds	274	3e-70
174	gb|DQ284249.1| Iguana iguana histone H3a gene, partial cds	274	3e-70
175	gb|DQ284094.1| Synapturanus mirandaribeiroi histone H3a gene, pa...	274	3e-70
176	gb|AY749741.1| Rhoenanthus sp. EP143 histone H3 (H3) gene, parti...	274	3e-70
177	gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds	274	3e-70
178	gb|AY749710.1| Centroptilum luteolum histone H3 (H3) gene, parti...	274	3e-70
179	gb|AY749701.1| Paraleptophlebia vaciva histone H3 (H3) gene, par...	274	3e-70
180	gb|DQ284386.1| Elachistocleis ovalis histone H3a gene, partial cds	272	1e-69
181	gb|AY520708.1| Tetraclita japonica histone H3 gene, partial cds	270	4e-69
182	gb|AY520695.1| Semibalanus cariosus histone H3 gene, partial cds	270	4e-69
183	dbj|AB195652.1| Lilium longiflorum soH3-2 mRNA for histone soH3-...	270	4e-69
184	dbj|AB195974.1| Lilium longiflorum MPH3 mRNA for histone H3, com...	270	4e-69
185	gb|AY218163.1| Echinorhynchus gadi histone H3 gene, partial cds	270	4e-69
186	gb|AY520711.1| Chthamalus challengeri histone H3 gene, partial cds	268	2e-68
187	gb|AY520694.1| Semibalanus balanoides histone H3 gene, partial cds	268	2e-68
188	gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequ...	268	2e-68
189	gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence	268	2e-68
190	gb|BC084311.1| Xenopus laevis cDNA clone IMAGE:6865011	266	7e-68
191	gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequ...	266	7e-68
192	gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequ...	264	3e-67
193	gb|AY555567.1| Heterojapyx sp. GG-2001 histone H3 gene, partial cds	264	3e-67
194	gb|AF093108.1|AF093108 Tortula ruralis histone H3 (rnp49) mRNA, ...	264	3e-67
195	gb|AY520706.1| Tetraclitella purpurascens histone H3 gene, parti...	262	1e-66
196	gb|AY521731.1| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene,...	262	1e-66
197	gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462	260	4e-66
198	gb|BC007518.2| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	260	4e-66
199	ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@...	260	4e-66
200	ref|NM_003536.2| Homo sapiens histone 1, H3h (HIST1H3H), mRNA	260	4e-66
201	gb|AY520704.1| Elminius kingii histone H3 gene, partial cds	260	4e-66
202	gb|AF531281.1| Homo sapiens histone H3 (HIST1H3H) gene, complete...	260	4e-66
203	gb|AY125233.1| Isoperla davisi histone 3 gene, partial cds	260	4e-66
204	gb|AY125229.1| Argia vivida histone 3 gene, partial cds	260	4e-66
205	emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o...	260	4e-66
206	emb|Z83735.1|HSZ83735 H.sapiens hH3/k gene	260	4e-66
207	gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence	260	4e-66
208	gb|AY655591.1| Cololabis saira histone H3a gene, partial cds	258	2e-65
209	gb|AY655588.1| Menidia menidia histone H3a gene, partial cds	258	2e-65
210	emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for hist...	258	2e-65
211	gb|DQ284421.1| Pachytriton brevipes histone H3a gene, partial cds	258	2e-65
212	gb|DQ284081.1| Leptobrachium chapaense histone H3a gene, partial...	258	2e-65
213	gb|AY520705.1| Tetraclitella divisa histone H3 gene, partial cds	256	7e-65
214	gb|AY520702.1| Austromegabalanus psittacus histone H3 gene, part...	256	7e-65
215	gb|AY555569.1| Choroterpes sp. GG-2004 histone H3 gene, partial cds	256	7e-65
216	gb|DQ079673.1| Emerita brasiliensis voucher KCembr histone H3 (H...	254	3e-64
217	gb|AY520716.1| Catomerus polymerus histone H3 gene, partial cds	254	3e-64
218	ref|XM_789723.1| PREDICTED: Strongylocentrotus purpuratus simila...	254	3e-64
219	gb|DQ284378.1| Tylototriton shanjing histone H3a gene, partial cds	254	3e-64
220	gb|AY428836.1| Pycnophyes greenlandicus histone H3 gene, partial...	252	1e-63
221	gb|DQ284417.1| Triturus cristatus histone H3a gene, partial cds	250	4e-63
222	gb|AY539178.1| Menidia menidia histone H3 gene, partial cds	250	4e-63
223	gb|DQ284201.1| Bufo regularis histone H3a gene, partial cds	248	2e-62
224	gb|J00984.1|XELHIS3LB x.laevis histone gene h3 and flanks	248	2e-62
225	gb|DQ028079.1| Velifer hypselopterus histone H3 gene, partial cds	246	6e-62
226	ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus simila...	246	6e-62
227	gb|AF370817.1|AF370817 Locusta migratoria histone H3 gene, parti...	246	6e-62
228	gb|AY539186.1| Sebastes matsubarae histone H3 gene, partial cds	246	6e-62
229	gb|DQ028081.1| Trachipterus trachypterus histone H3 gene, partia...	244	3e-61
230	gb|AY520718.1| Pollicipes pollicipes histone H3 gene, partial cds	244	3e-61
231	gb|AY520693.1| Balanus glandula histone H3 gene, partial cds	244	3e-61
232	gb|AY520692.1| Balanus crenatus histone H3 gene, partial cds	244	3e-61
233	gb|DQ284374.1| Bufo maculatus histone H3a gene, partial cds	244	3e-61
234	gb|DQ284325.1| Thorius sp. JAC 21291 histone H3a gene, partial cds	244	3e-61
235	gb|AY662888.1| Embiotoca jacksoni histone H3a gene, partial cds	244	3e-61
236	gb|AY539253.1| Careproctus melanurus histone H3 gene, partial cds	244	3e-61
237	gb|DQ284413.1| Kassina senegalensis histone H3a gene, partial cds	242	1e-60
238	gb|DQ284411.1| Dyscophus guineti histone H3a gene, partial cds	242	1e-60
239	gb|DQ284397.1| Breviceps mossambicus histone H3a gene, partial cds	242	1e-60
240	gb|DQ284343.1| Phlyctimantis leonardi histone H3a gene, partial cds	242	1e-60
241	dbj|AB195975.1| Lilium longiflorum YAH3 mRNA for histone H3, com...	242	1e-60
242	gb|AY662903.1| Paretroplus polyactis 'South' histone H3a gene, p...	242	1e-60
243	gb|AY749717.1| Siphlonella sp. EP083 histone H3 (H3) gene, parti...	242	1e-60
244	gb|AY520719.1| Pollicipes polymerus histone H3 gene, partial cds	240	4e-60
245	gb|AY662887.1| Cymatogaster aggregata histone H3a gene, partial cds	240	4e-60
246	gb|AY655592.1| Fundulus heteroclitus histone H3a-like gene, part...	238	2e-59
247	gb|DQ028083.1| Lota lota histone H3 gene, partial cds	238	2e-59
248	gb|AY520707.1| Tetraclita squamosa histone H3 gene, partial cds	238	2e-59
249	gb|AY870291.1| Ameletus costalis histone H3 gene, partial cds	238	2e-59
250	gb|AY064472.1| Aplysia californica histone H3 (His.H3) gene, com...	238	2e-59
251	gb|AY539234.1| Leptocottus armatus histone H3 gene, partial cds	238	2e-59
252	gb|AY520710.1| Chthamalus montagui histone H3 gene, partial cds	236	6e-59
253	gb|AY539263.1| Etheostoma blennioides histone H3 gene, partial cds	236	6e-59
254	gb|AY539254.1| Liparis mucosus histone H3-like gene, partial seq...	236	6e-59
255	gb|DQ028126.1| Leiognathus fasciatus isolate L36 histone H3 gene...	234	2e-58
256	gb|DQ284349.1| Nyctibates corrugatus histone H3a gene, partial cds	234	2e-58
257	gb|DQ284348.1| Cardioglossa leucomystax histone H3a gene, partia...	234	2e-58
258	gb|DQ284335.1| Trichobatrachus robustus histone H3a gene, partia...	234	2e-58
259	gb|DQ284132.1| Cardioglossa leucomystax histone H3a gene, partia...	234	2e-58
260	gb|AF361949.1| Eimeria tenella histone 3 (H3) mRNA, complete cds	234	2e-58
261	gb|AY923964.1| Phenacolepas osculans isolate PHE1 histone H3 (H3...	234	2e-58
262	gb|AY662881.1| Polycentropsis abbreviata histone H3a gene, parti...	234	2e-58
263	gb|AY539272.1| Harpagifer kerguelensis histone H3 gene, partial cds	234	2e-58
264	gb|AY539247.1| Xeneretmus latifrons histone H3 gene, partial cds	234	2e-58
265	gb|AY539243.1| Hemitripterus americanus histone H3 gene, partial...	234	2e-58
266	gb|AY539221.1| Pleurogrammus azonus histone H3 gene, partial cds	234	2e-58
267	gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, part...	234	2e-58
268	emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones	232	1e-57
269	emb|X82414.1|AOHISTH3 A.officinalis mRNA for Histone H3	232	1e-57
270	emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene	232	1e-57
271	gb|DQ284332.1| Bufo latifrons histone H3a gene, partial cds	232	1e-57
272	gb|DQ284169.1| Plethodon jordani histone H3a gene, partial cds	232	1e-57
273	gb|AF370818.1|AF370818 Balanus balanus histone H3 gene, partial cds	232	1e-57
274	gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone...	232	1e-57
275	gb|AY539273.1| Gymnodraco acuticeps histone H3 gene, partial cds	232	1e-57
276	gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, ...	232	1e-57
277	gb|AY655578.1| Pseudomugil signifer histone H3a gene, partial cds	230	4e-57
278	gb|DQ028130.1| Leiognathus robustus isolate LEQ1s histone H3 gen...	230	4e-57
279	gb|AY520701.1| Megabalanus spinosus histone H3 gene, partial cds	230	4e-57
280	gb|DQ284257.1| Hydromantes platycephalus histone H3a gene, parti...	230	4e-57
281	gb|AY539275.1| Trichodon trichodon histone H3 gene, partial cds	230	4e-57
282	gb|AY539251.1| Aptocyclus ventricosus histone H3 gene, partial cds	230	4e-57
283	gb|AY539215.1| Bembras japonica histone H3 gene, partial cds	230	4e-57
284	gb|AY539197.1| Taenianotus triacanthus histone H3-like gene, par...	230	4e-57
285	gb|AY338629.1| Heptagenia sp. EP018 histone 3 gene, partial cds	230	4e-57
286	gb|AY338628.1| Isonychia sp. EP017 histone 3 gene, partial cds	230	4e-57
287	gb|AY655584.1| Iso rhothophilus histone H3a gene, partial cds	228	1e-56
288	gb|AY655577.1| Pseudomugil gertrudae histone H3a gene, partial cds	228	1e-56
289	gb|DQ284213.1| Cardioglossa gratiosa histone H3a gene, partial cds	228	1e-56
290	gb|DQ284131.1| Schoutedenella sylvatica histone H3a gene, partia...	228	1e-56
291	gb|AY869753.1| Hylaius oregonensis histone H3 gene, partial cds	228	1e-56
292	gb|AY662930.1| Crenicichla alta histone H3a gene, partial cds	228	1e-56
293	gb|AY338622.1| Ametropus neavei histone 3 gene, partial cds	228	1e-56
294	gb|DQ028139.1| Leiognathus nuchalis histone H3 gene, partial cds	226	6e-56
295	gb|DQ028134.1| Leiognathus decorus histone H3 gene, partial cds	226	6e-56
296	gb|DQ028131.1| Leiognathus sp. Philippines histone H3 gene, part...	226	6e-56
297	gb|DQ028127.1| Leiognathus fasciatus histone H3 gene, partial cds	226	6e-56
298	gb|DQ028116.1| Leiognathus sp. L39 histone H3 gene, partial cds	226	6e-56
299	gb|DQ028113.1| Gazza squamiventralis isolate WLS52 histone H3 ge...	226	6e-56
300	gb|DQ028089.1| Gasterosteus aculeatus histone H3 gene, partial cds	226	6e-56
301	gb|DQ284424.1| Tachycnemis seychellensis histone H3a gene, parti...	226	6e-56
302	gb|DQ284422.1| Heterixalus sp. UMMZ 219330 histone H3a gene, par...	226	6e-56
303	gb|DQ284351.1| Leptodactylodon bicolor histone H3a gene, partial...	226	6e-56
304	gb|DQ284340.1| Astylosternus schioetzi histone H3a gene, partial...	226	6e-56
305	gb|DQ284256.1| Leptopelis argenteus histone H3a gene, partial cds	226	6e-56
306	gb|DQ284199.1| Leptopelis sp. AMNH A168408 histone H3a gene, par...	226	6e-56
307	gb|DQ284133.1| Arthroleptis variabilis histone H3a gene, partial...	226	6e-56
308	gb|AY923967.1| Peltospira delicata isolate PS1 histone H3 (H3) g...	226	6e-56
309	gb|AY662931.1| Dicrossus sp. JSS-2004 histone H3a gene, partial cds	226	6e-56
310	gb|AY539232.1| Icelinus filamentosus histone H3 gene, partial cds	226	6e-56
311	gb|DQ028120.1| Leiognathus sp. L9 histone H3 gene, partial cds	224	2e-55
312	gb|DQ284414.1| Hamptophryne boliviana histone H3a gene, partial cds	224	2e-55
313	gb|DQ284345.1| Bufo camerunensis histone H3a gene, partial cds	224	2e-55
314	gb|DQ284241.1| Genyophryne thomsoni histone H3a gene, partial cds	224	2e-55
315	gb|DQ284044.1| Aplastodiscus perviridis histone H3a gene, partia...	224	2e-55
316	gb|DQ028122.1| Leiognathus equulus histone H3 gene, partial cds	222	9e-55
317	gb|DQ028118.1| Leiognathus sp. Singapore histone H3 gene, partia...	222	9e-55
318	gb|DQ028117.1| Leiognathus sp. L41 histone H3 gene, partial cds	222	9e-55
319	gb|DQ028112.1| Gazza squamiventralis isolate WLS51 histone H3 ge...	222	9e-55
320	gb|AY520697.1| Balanus perforatus histone H3 gene, partial cds	222	9e-55
321	gb|AY520696.1| Balanus balanus histone H3 gene, partial cds	222	9e-55
322	gb|DQ284353.1| Scotobleps gabonicus histone H3a gene, partial cds	222	9e-55
323	gb|DQ284291.1| Eleutherodactylus augusti histone H3a gene, parti...	222	9e-55
324	gb|DQ284268.1| Leptopelis vermiculatus histone H3a gene, partial...	222	9e-55
325	gb|DQ284090.1| Hoplobatrachus occipitalis histone H3a gene, part...	222	9e-55
326	gb|AY539246.1| Sarritor frenatus histone H3 gene, partial cds	222	9e-55
327	gb|AY539180.1| Apeltes quadracus histone H3 gene, partial cds	222	9e-55
328	gb|AY326298.1| Siphonosoma vastum MCZ DNA100628 histone H3 gene,...	222	9e-55
329	gb|AY749736.1| Atopopus sp. EP134 histone H3 (H3) gene, partial cds	222	9e-55
330	gb|DQ028146.1| Leiognathus bindus histone H3 gene, partial cds	220	4e-54
331	gb|DQ028128.1| Leiognathus fasciatus histone H3 gene, partial cds	220	4e-54
332	gb|DQ028119.1| Leiognathus sp. L2 histone H3 gene, partial cds	220	4e-54
333	gb|DQ079690.1| Nematoscelis sp. KCnesp histone H3 (H3) gene, par...	220	4e-54
334	gb|DQ079682.1| Lysmata wurdemanni voucher MLP120 histone H3 (H3)...	220	4e-54
335	ref|NG_001335.1| Homo sapiens genomic large histone family clust...	220	4e-54
336	gb|AY520715.1| Chamaesipho tasmanica histone H3 gene, partial cds	220	4e-54
337	gb|AF109910.1|AF109910 Porteresia coarctata histone H3 mRNA, com...	220	4e-54
338	gb|AY539264.1| Perca flavescens histone H3 gene, partial cds	220	4e-54
339	gb|AY539249.1| Dasycottus setiger histone H3 gene, partial cds	220	4e-54
340	gb|AY539248.1| Cottunculus thomsonii histone H3 gene, partial cds	220	4e-54
341	gb|AY539244.1| Nautichthys pribilovius histone H3 gene, partial cds	220	4e-54
342	gb|AY539236.1| Myoxocephalus polyacanthocephalus histone H3 gene...	220	4e-54
343	gb|AY539176.1| Chilara taylori histone H3 gene, partial cds	220	4e-54
344	gb|AY655576.1| Marosatherina ladigesi histone H3a gene, partial cds	218	1e-53
345	gb|DQ028138.1| Leiognathus dussumieri isolate L30 histone H3 gen...	218	1e-53
346	gb|DQ028125.1| Leiognathus fasciatus isolate L16 histone H3 gene...	218	1e-53
347	gb|DQ028115.1| Leiognathus sp. L25 histone H3 gene, partial cds	218	1e-53
348	gb|DQ028103.1| Gazza sp. L22 histone H3 gene, partial cds	218	1e-53
349	gb|DQ284398.1| Hoplophryne rogersi histone H3a gene, partial cds	218	1e-53
350	gb|DQ284381.1| Hyperolius tuberilinguis histone H3a gene, partia...	218	1e-53
351	gb|DQ284375.1| Hyperolius puncticulatus histone H3a gene, partia...	218	1e-53
352	gb|DQ284318.1| Eleutherodactylus alfredi histone H3a gene, parti...	218	1e-53
353	gb|DQ284255.1| Hyperolius alticola histone H3a gene, partial cds	218	1e-53
354	gb|DQ284209.1| Alexteroon obstetricans histone H3a gene, partial...	218	1e-53
355	gb|AY662897.1| Paretroplus cf. kieneri 'Ravelobe' histone H3a ge...	218	1e-53
356	gb|AY539231.1| Hemilepidotus zapus histone H3 gene, partial cds	218	1e-53
357	gb|AY655596.1| Atherinomorus sp. Karianga histone H3a gene, part...	216	6e-53
358	gb|DQ028121.1| Leiognathus equulus histone H3 gene, partial cds	216	6e-53
359	gb|DQ028095.1| Cepola pauciradiata histone H3 gene, partial cds	216	6e-53
360	gb|DQ028094.1| Cepola macrophthalma histone H3 gene, partial cds	216	6e-53
361	gb|DQ079694.1| Pachygrapsus marmoratus voucher KCpama histone H3...	216	6e-53
362	gb|DQ284096.1| Dendrophryniscus minutus histone H3a gene, partia...	216	6e-53
363	ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	216	6e-53
364	ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	216	6e-53
365	gb|AY539267.1| Kuhlia rupestris histone H3 gene, partial cds	216	6e-53
366	gb|AY539235.1| Microcottus sellaris histone H3 gene, partial cds	216	6e-53
367	gb|AY539194.1| Scorpaena plumieri histone H3 gene, partial cds	216	6e-53
368	gb|AY326297.1| Siphonosoma vastum MCZ DNA100625 histone H3 gene,...	216	6e-53
369	gb|DQ028162.1| Secutor megalolepis histone H3 gene, partial cds	214	2e-52
370	gb|DQ028156.1| Secutor sp. L26 histone H3 gene, partial cds	214	2e-52
371	gb|DQ028129.1| Leiognathus robustus isolate L35 histone H3 gene,...	214	2e-52
372	gb|DQ028124.1| Leiognathus equulus histone H3 gene, partial cds	214	2e-52
373	gb|DQ079688.1| Munida subrugosa voucher KCmusu histone H3 (H3) g...	214	2e-52
374	gb|DQ284336.1| Opisthothylax immaculatus histone H3a gene, parti...	214	2e-52
375	gb|DQ284263.1| Afrixalus pygmaeus histone H3a gene, partial cds	214	2e-52
376	gb|AY662898.1| Paretroplus cf. kieneri 'Amboaboa' histone H3a ge...	214	2e-52
377	gb|AY662894.1| Paretroplus damii histone H3a gene, partial cds	214	2e-52
378	gb|AY539240.1| Batrachocottus baicalensis histone H3 gene, parti...	214	2e-52
379	gb|AY539230.1| Hemilepidotus jordani histone H3 gene, partial cds	214	2e-52
380	gb|AY338626.1| Coloburiscus humeralis histone 3 gene, partial cds	214	2e-52
381	gb|AY655580.1| Atherinomorus lacunosus histone H3a gene, partial...	212	9e-52
382	gb|AY655563.1| Bedotia sp. 'Ivoloina' histone H3a gene, partial cds	212	9e-52
383	ref|XM_470806.1| Oryza sativa (japonica cultivar-group), mRNA	212	9e-52
384	gb|DQ073572.1| Craterostigma plantagineum histone H3.2 mRNA, com...	212	9e-52
385	dbj|AK104901.1| Oryza sativa (japonica cultivar-group) cDNA clon...	212	9e-52
386	dbj|AK063199.1| Oryza sativa (japonica cultivar-group) cDNA clon...	212	9e-52
387	gb|AY662901.1| Paretroplus menarambo histone H3a gene, partial cds	212	9e-52
388	gb|AY539268.1| Cirrhitus rivulatus histone H3 gene, partial cds	212	9e-52
389	gb|AY539266.1| Haemulon plumieri histone H3 gene, partial cds	212	9e-52
390	gb|AY539245.1| Hypsagonus quadricornis histone H3 gene, partial cds	212	9e-52
391	gb|AY655589.1| Neostethus bicornis histone H3a gene, partial cds	210	4e-51
392	gb|AY655586.1| Atherinops affinis histone H3a gene, partial cds	210	4e-51
393	gb|DQ028114.1| Leiognathus sp. Fiji histone H3 gene, partial cds	210	4e-51
394	gb|DQ284219.1| Rana clamitans histone H3a gene, partial cds	210	4e-51
395	gb|DQ284211.1| Opisthothylax immaculatus histone H3a gene, parti...	210	4e-51
396	gb|DQ284208.1| Cryptothylax greshoffii histone H3a gene, partial...	210	4e-51
397	gb|DQ284180.1| Staurois tuberilinguis histone H3a gene, partial cds	210	4e-51
398	gb|AY923981.1| Turbo setosus isolate TU5 histone H3 (H3) gene, p...	210	4e-51
399	gb|AY662883.1| Cetoscarus bicolor histone H3a gene, partial cds	210	4e-51
400	gb|AY539239.1| Triglops scepticus histone H3 gene, partial cds	210	4e-51
401	gb|AY539220.1| Hexagrammos decagrammus histone H3 gene, partial cds	210	4e-51
402	gb|AY655583.1| Teramulus waterloti histone H3a gene, partial cds	208	1e-50
403	gb|AY655569.1| Bedotia sp. 'Vevembe' histone H3a gene, partial cds	208	1e-50
404	gb|AY655567.1| Bedotia sp. 'Ranomafana' histone H3a gene, partia...	208	1e-50
405	gb|AY655566.1| Bedotia sp. 'Manombo' histone H3a gene, partial cds	208	1e-50
406	gb|DQ079672.1| Cryphiops caementarius voucher JC1219 histone H3 ...	208	1e-50
407	gb|AF467728.1| Oryza sativa disease-resistent-related protein (R...	208	1e-50
408	gb|AY662900.1| Paretroplus maromandia histone H3a-like gene, par...	208	1e-50
409	gb|AY662892.1| Etroplus maculatus histone H3a gene, partial cds	208	1e-50
410	gb|AY662875.1| Badis badis histone H3a gene, partial cds	208	1e-50
411	gb|DQ028157.1| Secutor sp. L37 histone H3 gene, partial cds	206	5e-50
412	gb|DQ028111.1| Gazza minuta isolate L29 histone H3 gene, partial...	206	5e-50
413	gb|DQ079703.1| Uroptychus parvulus voucher KCurpa histone H3 (H3...	206	5e-50
414	gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	206	5e-50
415	gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	206	5e-50
416	gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	206	5e-50
417	ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA	206	5e-50
418	gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete...	206	5e-50
419	gb|AY347801.1| Malus x domestica clone 13-2 histone 3 mRNA, part...	206	5e-50
420	gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h...	206	5e-50
421	emb|CR541858.1| Homo sapiens full open reading frame cDNA clone ...	206	5e-50
422	gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	206	5e-50
423	gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	206	5e-50
424	gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	206	5e-50
425	gb|AY662936.1| Teleocichla sp. JSS-2004 histone H3a gene, partia...	206	5e-50
426	gb|AY662890.1| Etroplus canarensis histone H3a gene, partial cds	206	5e-50
427	gb|AY539257.1| Diplectrum formosum histone H3 gene, partial cds	206	5e-50
428	gb|AY539241.1| Comephorus baicalensis histone H3 gene, partial cds	206	5e-50
429	gb|AY539225.1| Marukawichthys ambulator histone H3 gene, partial...	206	5e-50
430	gb|AY749706.1| Austrophlebiodes sp. EP027 histone H3 (H3) gene, ...	206	5e-50
431	gb|AY655558.1| Rheocles wrightae histone H3a gene, partial cds	204	2e-49
432	gb|AY520713.1| Jehlius cirratus histone H3 gene, partial cds	204	2e-49
433	gb|DQ073571.1| Craterostigma plantagineum histone H3.1 mRNA, com...	204	2e-49
434	gb|DQ284406.1| Callulina kisiwamsitu histone H3a gene, partial cds	204	2e-49
435	gb|DQ284112.1| Lithodytes lineatus histone H3a gene, partial cds	204	2e-49
436	gb|AY338635.1| Chaquihua sp. EP080 histone 3 gene, partial cds	204	2e-49
437	gb|DQ028108.1| Gazza achlamys histone H3 gene, partial cds	202	9e-49
438	gb|DQ284377.1| Rana guentheri histone H3a gene, partial cds	202	9e-49
439	gb|DQ284287.1| Rana guentheri histone H3a gene, partial cds	202	9e-49
440	gb|DQ284267.1| Rana grahami histone H3a gene, partial cds	202	9e-49
441	gb|DQ284226.1| Crinia signifera histone H3a gene, partial cds	202	9e-49
442	gb|AY869763.1| Graphocephala coccinea histone H3 gene, partial cds	202	9e-49
443	gb|AY539193.1| Scorpaena guttata histone H3 gene, partial cds	202	9e-49
444	gb|DQ028164.1| Secutor cf. ruconius JS-2005 histone H3 gene, par...	200	3e-48
445	gb|AY923975.1| Stomatella sp. CET-2005 histone H3 (H3) gene, par...	200	3e-48
446	gb|AY662926.1| Astronotus ocellatus histone H3a gene, partial cds	200	3e-48
447	gb|AY662911.1| Paratilapia sp. 'East' histone H3a gene, partial cds	200	3e-48
448	gb|AY662908.1| Paratilapia cf. bleekeri JSS-2004 histone H3a gen...	200	3e-48
449	gb|AY662904.1| Paretroplus tsimoly histone H3a gene, partial cds	200	3e-48
450	gb|AY662902.1| Paretroplus nourissati histone H3a gene, partial cds	200	3e-48
451	gb|AY749725.1| Rallidens mcfarlanei histone H3 (H3) gene, partia...	200	3e-48
452	gb|AY655585.1| Atherinella panamensis histone H3a gene, partial cds	198	1e-47
453	ref|XM_465456.1| Oryza sativa (japonica cultivar-group), mRNA	198	1e-47
454	gb|DQ284289.1| Bufo alvarius histone H3a gene, partial cds	198	1e-47
455	gb|AY662925.1| Apistogramma sp. JSS-2004 histone H3a gene, parti...	198	1e-47
456	gb|AY662895.1| Paretroplus kieneri 'Kinkony' histone H3a gene, p...	198	1e-47
457	gb|AY338638.1| Hetaerina americana histone 3 gene, partial cds	198	1e-47
458	emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a	198	1e-47
459	gb|AY655582.1| Craterocephalus honoriae histone H3a gene, partia...	196	5e-47
460	gb|DQ028102.1| Gazza sp. Fiji histone H3 gene, partial cds	196	5e-47
461	gb|DQ284239.1| Choerophryne sp. ABTC 47720 histone H3a gene, par...	196	5e-47
462	gb|AY662912.1| Paratilapia sp. 'Ifasy' histone H3a gene, partial...	196	5e-47
463	gb|AY662899.1| Paretroplus maculatus histone H3a gene, partial cds	196	5e-47
464	ref|XM_465459.1| Oryza sativa (japonica cultivar-group), mRNA	194	2e-46
465	gb|DQ284309.1| Rana maculata histone H3a gene, partial cds	194	2e-46
466	gb|DQ284292.1| Rana yavapaiensis histone H3a gene, partial cds	194	2e-46
467	dbj|AB195653.1| Lilium longiflorum soH3-2 gene for histone soH3-...	194	2e-46
468	gb|AY923980.1| Astraea undosa isolate T6 histone H3 (H3) gene, p...	194	2e-46
469	gb|DQ275313.1| Acilius athabascae voucher BYU KBMAcat158 histone...	194	2e-46
470	gb|AY491357.1| Orthodera sp. MN033 histone 3 gene, partial cds	192	8e-46
471	gb|AY788897.1| Mnais nawai histone 3 gene, partial cds	192	8e-46
472	gb|AY745680.1| Lancetes varius histone H3 (his3) gene, partial cds	192	8e-46
473	gb|DQ284288.1| Gastrophryne olivacea histone H3a gene, partial cds	192	8e-46
474	gb|AY662910.1| Paratilapia polleni 'Ravelobe' histone H3a gene, ...	192	8e-46
475	gb|AY662893.1| Paretroplus dambabe histone H3a gene, partial cds	192	8e-46
476	gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds	190	3e-45
477	gb|DQ284163.1| Rana adenopleura histone H3a gene, partial cds	190	3e-45
478	gb|DQ284086.1| Hypsiboas boans histone H3a gene, partial cds	190	3e-45
479	dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, comp...	190	3e-45
480	dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, comp...	190	3e-45
481	gb|AY923977.1| Gibbula zonata isolate T25 histone H3 (H3) gene, ...	190	3e-45
482	gb|AY869766.1| Homalodisca coagulata histone H3 gene, partial cds	190	3e-45
483	gb|AY539228.1| Cottus carolinae histone H3 gene, partial cds	190	3e-45
484	emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ...	188	1e-44
485	gb|DQ284262.1| Schoutedenella taeniata histone H3a gene, partial...	188	1e-44
486	gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, c...	188	1e-44
487	gb|AY662927.1| Chaetobranchopsis orbicularis histone H3a gene, p...	188	1e-44
488	gb|AY662891.1| Etroplus suratensis histone H3a gene, partial cds	188	1e-44
489	gb|AY326299.1| Phascolosoma nigrescens MCZ DNA100621 histone H3 ...	188	1e-44
490	gb|DQ079679.1| Lithodes santolla voucher KClisa histone H3 (H3) ...	186	5e-44
491	ref|XM_356549.3| PREDICTED: Mus musculus similar to histone 1, H...	186	5e-44
492	gb|DQ284356.1| Fejervarya limnocharis histone H3a gene, partial cds	186	5e-44
493	gb|DQ284333.1| Huia nasica histone H3a gene, partial cds	186	5e-44
494	gb|DQ284185.1| Chaperina fusca histone H3a gene, partial cds	186	5e-44
495	emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr...	186	5e-44
496	gb|DQ284373.1| Rana sylvatica histone H3a gene, partial cds	184	2e-43
497	gb|AY539222.1| Zaniolepis frenatus histone H3 gene, partial cds	184	2e-43
498	gb|AY923982.1| Homalopoma maculosa isolate TU6 histone H3 (H3) g...	182	8e-43
499	gb|AY869755.1| Pagaronia tredecimpunctata histone H3 gene, parti...	182	8e-43
500	gb|AY744883.1| Flexamia areolata histone 3 (H3) gene, partial cds	182	8e-43

---

>gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence
          Length = 636

 Score =  551 bits (278), Expect = e-154
 Identities = 392/426 (92%), Gaps = 3/426 (0%)
 Strand = Plus / Plus

                                                                       
Query: 92  cggagaggatggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgg 151
           |||||| ||||||| |||| | ||||||||||||||||||||||||||||||||||||||
Sbjct: 121 cggagatgatggct-acgcgcgctcgccacggatgcggcgggcgagctggatgtccttgg 179

                                                                       
Query: 152 gcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccga 211
           ||||||||||||||||||| |||||||||||||| ||||||||||||||||| || ||||
Sbjct: 180 gcatgatggtgacgcgcttagcgtggatggcgcagaggttggtgtcctcgaagagaccga 239

                                                                       
Query: 212 caaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgaggt 271
           | ||||| |||||||| ||||||||||| |||||||||||||||  |||||| | |||||
Sbjct: 240 cgaggtaggcctcggcggcctcctggagcgccagcacggcgtggctctggaatcggaggt 299

                                                                       
Query: 272 cggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatca 331
           | ||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||
Sbjct: 300 ctgtcttgaagtcctgcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatca 359

                                                                       
Query: 332 gcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcctg 391
           |||| ||||||||||||||||||||||||||||||||| || |||||||| |||||||||
Sbjct: 360 gcag-ctccgtgctcttctggtacttgcggatctcgcgcagcgccacggttccgggcctg 418

                                                                       
Query: 392 tagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtg 451
           || | ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 419 tacctgtggggcttcttcacgccgccggtcgtcggcgccgacttcctcgccgccttggtg 478

                                                                       
Query: 452 gcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgcttggtacg 511
           ||||||||||||||||| |||||||| || |||||||||||| ||||||||||| |||||
Sbjct: 479 gcgagctgcttgcggggggccttgcctcccgtggacttgcgg-gcggtctgcttcgtacg 537

                 
Query: 512 ggccat 517
            |||||
Sbjct: 538 agccat 543

---

>emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3
          Length = 657

 Score =  545 bits (275), Expect = e-152
 Identities = 388/423 (91%), Gaps = 2/423 (0%)
 Strand = Plus / Minus

                                                                       
Query: 99  gatggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgat 158
           ||||||||| || | ||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 468 gatggcttaggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgat 409

                                                                       
Query: 159 ggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggta 218
           ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 408 ggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggta 349

                                                                       
Query: 219 cgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtctt 278
            |||||||| ||||||||||| |||||||||||||||  ||||||||  ||||| || ||
Sbjct: 348 ggcctcggccgcctcctggagcgccagcacggcgtggctctggaaccgcaggtccgtttt 289

                                                                       
Query: 279 gaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcct 338
           |||||||||||||||||| |  || ||||||||||| || ||||||||||| ||||| ||
Sbjct: 288 gaagtcctgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag-ct 230

                                                                       
Query: 339 ccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggt 398
           ||||||||||||||||||||||||||||||| || || ||||| ||||||||||||||||
Sbjct: 229 ccgtgctcttctggtacttgcggatctcgcgcagcgcgacggtgccgggcctgtagcggt 170

                                                                       
Query: 399 gaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagct 458
           | |||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 169 ggggcttcttcacgccgccggtggtcggggccgacttcctcgcggccttggtggcgagct 110

                                                                       
Query: 459 gcttgcggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
           |||| | ||| |||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 109 gcttcctgggggccttgccgccggtggacttgcgg-gcggtctgcttggtacgggccatg 51

              
Query: 519 gcg 521
           |||
Sbjct: 50  gcg 48

---

>gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds
          Length = 793

 Score =  531 bits (268), Expect = e-148
 Identities = 381/416 (91%), Gaps = 2/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 102 ggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 161
           ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 502 ggcttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 443

                                                                       
Query: 162 gacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgc 221
           |||||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 442 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggc 383

                                                                       
Query: 222 ctcggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaa 281
           |||||| |||||||||||||| ||||| ||||||  |||||| | |||||||||||||||
Sbjct: 382 ctcggcggcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaa 323

                                                                       
Query: 282 gtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccg 341
           ||||||||||||||| |  || ||||||||||| || |||||||||||||| || |||||
Sbjct: 322 gtcctgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggag-ctccg 264

                                                                       
Query: 342 tgctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgag 401
           ||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| |
Sbjct: 263 tgctcttctggtacttgcggatctcgcggagcgccaccgtccccggcctgtagcggtggg 204

                                                                       
Query: 402 gcttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgct 461
           ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||
Sbjct: 203 gcttcttcacgccgccggtggtcggagcagacttcctcgccgccttggtggcgagctgct 144

                                                                   
Query: 462 tgcggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | |  || |||||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 143 tcctcggggccttgccgccggtggacttgcgg-gcggtctgcttcgtacgggccat 89

---

>ref|XM_493701.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score =  525 bits (265), Expect = e-146
 Identities = 378/413 (91%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 ttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           ||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctc 292

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           ||| |||||||||||||| ||||| ||||||  |||||| | ||||||||||||||||||
Sbjct: 291 ggcggcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtc 232

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| |  || ||||||||||| || |||||||||||||| || ||||||||
Sbjct: 231 ctgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggag-ctccgtgc 173

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
           |||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| ||||
Sbjct: 172 tcttctggtacttgcggatctcgcggagcgccaccgtccccggcctgtagcggtggggct 113

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
Sbjct: 112 tcttcacgccgccggtggtcggagcagacttcctcgccgccttggtggcgagctgcttcc 53

                                                                
Query: 465 ggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
             || |||||||||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 52  tcggggccttgccgccggtggacttgcgg-gcggtctgcttcgtacgggccat 1

---

>gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cds, clone B1
          Length = 494

 Score =  523 bits (264), Expect = e-145
 Identities = 303/312 (97%), Gaps = 3/312 (0%)
 Strand = Plus / Minus

                                                                       
Query: 136 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 195
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 494 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 435

                                                                       
Query: 196 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 255
           |||||||||||||||  |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 434 tcctcgaacagcccgcgaaggtatgcctcggcagcctcctggagggccagcacggcgtgg 375

                                                                       
Query: 256 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 315
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 374 gactggaacctgaggtcggtcttgaagtcctgagcgatctccctcaccaggcgctggaac 315

                                                                       
Query: 316 ggcagcttgcggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggc 375
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 314 ggcagcttgcggatcagcag-ctccgtgctcttctggtacttgcggatctcgcggagggc 256

                                                                       
Query: 376 cacggtcccgggcctgtagcggtgaggcttcttcacgccg-ccggtggtcggcgccgact 434
           ||||||||||||||||||||||||| ||||||||| |||| ||||||||| |||||||||
Sbjct: 255 cacggtcccgggcctgtagcggtgaagcttcttca-gccgcccggtggtccgcgccgact 197

                       
Query: 435 tcctcgccgcct 446
           ||||||||||||
Sbjct: 196 tcctcgccgcct 185



 Score =  101 bits (51), Expect = 2e-18
 Identities = 67/71 (94%), Gaps = 1/71 (1%)
 Strand = Plus / Minus

                                                                       
Query: 447 tggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgcttg 506
           ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 70  tggtggcgagctgcttgtggggcgccttgccgccggtggacttgcgg-gcggtctgcttc 12

                      
Query: 507 gtacgggccat 517
           || ||||||||
Sbjct: 11  gtgcgggccat 1

---

>gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial cds, clone W1
          Length = 479

 Score =  498 bits (251), Expect = e-137
 Identities = 297/311 (95%), Gaps = 1/311 (0%)
 Strand = Plus / Minus

                                                                       
Query: 136 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 195
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 479 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 420

                                                                       
Query: 196 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 255
           |||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 419 tcctcgaacagccccaccaggtacgcctcggccgcctcctggagggccagcacggcgtgg 360

                                                                       
Query: 256 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 315
           |||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 359 gactggaagcggaggtccgtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 300

                                                                       
Query: 316 ggcagcttgcggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggc 375
           |||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||| ||
Sbjct: 299 ggcagcttgcggatcagcag-ctccgtgctcttctggtacttgcgggtctcccggagcgc 241

                                                                       
Query: 376 cacggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgactt 435
           |||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||
Sbjct: 240 cacggtaccgggcctgtagcggtggggcttcttcactccgccggtggtcggcgccgactt 181

                      
Query: 436 cctcgccgcct 446
           ||| |||||||
Sbjct: 180 cctggccgcct 170



 Score =  115 bits (58), Expect = 2e-22
 Identities = 71/74 (95%), Gaps = 1/74 (1%)
 Strand = Plus / Minus

                                                                       
Query: 444 ccttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgc 503
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 73  ccttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcgg-gcggtctgc 15

                         
Query: 504 ttggtacgggccat 517
           || || ||||||||
Sbjct: 14  ttcgtgcgggccat 1

---

>gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence
          Length = 639

 Score =  490 bits (247), Expect = e-135
 Identities = 366/403 (90%), Gaps = 2/403 (0%)
 Strand = Plus / Minus

                                                                       
Query: 114 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
           |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 401 ctcgccgcggatgcggcgggcgagctggatgtctttgggcatgatggtgacgcgcttggc 342

                                                                       
Query: 174 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
           |||||||||||| |||||||||||||||||||| ||||| ||||| |||||||| || ||
Sbjct: 341 gtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcctcggcggcttc 282

                                                                       
Query: 234 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
           |||||||||||| |||||||||  ||||||||  || || |||||||||||||| |||||
Sbjct: 281 ctggagggccaggacggcgtggctctggaaccgcagatccgtcttgaagtcctgagcgat 222

                                                                       
Query: 294 ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
           ||| |  |||||||||||||| |||| ||| ||||||||||| |||||||||||||||||
Sbjct: 221 ctcacggaccaggcgctggaagggcaacttccggatcagcag-ctccgtgctcttctggt 163

                                                                       
Query: 354 acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
           |||||||||||||||| || ||||| |||||||||||||| | ||| |||||||||||||
Sbjct: 162 acttgcggatctcgcgcagagccaccgtcccgggcctgtacctgtggggcttcttcacgc 103

                                                                       
Query: 414 cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
           ||||||| |||||||| ||||||||||||||||||||||||||||||||||| || ||||
Sbjct: 102 cgccggtcgtcggcgcagacttcctcgccgccttggtggcgagctgcttgcgcggggcct 43

                                                      
Query: 474 tgccgccggtggacttgcggngcggtctgcttggtacgggcca 516
           |||| ||||||||||||||| ||||||||||| ||||| ||||
Sbjct: 42  tgcctccggtggacttgcgg-gcggtctgcttcgtacgagcca 1

---

>dbj|AB205017.1| Lolium multiflorum gene for replacement histone H3, exon 1-2,
           complete cds
          Length = 784

 Score =  456 bits (230), Expect = e-125
 Identities = 303/326 (92%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 559 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 500

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||| ||||||||||||||||| || ||||| ||||| |||||||| ||||||||||| 
Sbjct: 499 gcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggccgcctcctggagc 440

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           |||||||||||||||  ||||||||  ||||| ||||||||||||||||||||||| |  
Sbjct: 439 gccagcacggcgtggctctggaaccgcaggtccgtcttgaagtcctgcgcgatctcgcgg 380

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| || ||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 379 accaggcgctggaaggggagcttgcggatgagcag-ctccgtgctcttctggtacttgcg 321

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           |||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 320 gatctcgcggagcgccacggttccgggcctgtagcggtggggcttcttcacgccgccggt 261

                                     
Query: 421 ggtcggcgccgacttcctcgccgcct 446
           |||||| |||||||||||||||||||
Sbjct: 260 ggtcggggccgacttcctcgccgcct 235



 Score =  115 bits (58), Expect = 2e-22
 Identities = 74/78 (94%), Gaps = 1/78 (1%)
 Strand = Plus / Minus

                                                                       
Query: 444 ccttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgc 503
           ||||||||||||||||||| | ||| |||||||||||||||||||||||| |||||||||
Sbjct: 125 ccttggtggcgagctgcttcctgggggccttgccgccggtggacttgcgg-gcggtctgc 67

                             
Query: 504 ttggtacgggccatggcg 521
           ||||||||||||||||||
Sbjct: 66  ttggtacgggccatggcg 49

---

>ref|NM_190750.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  448 bits (226), Expect = e-123
 Identities = 365/409 (89%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||||| 
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcc 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||    ||||||  |  |||||| | ||||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 227 gcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcagc-tcggtgctctt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           |||||||||||||||||| ||||| || ||||| ||||| | | ||||||| ||||||||
Sbjct: 168 ctggtacttgcggatctcccggagcgcgacggtgccggggcggaagcggtggggcttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||| |||||||| | ||||||||| || || |||||||| |  ||
Sbjct: 108 cacgccgccggtggccggggccgacttgcgcgccgccttcgtcgccagctgcttcctcgg 49

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||||||||||||||| |   || ||||||||||| ||||||||
Sbjct: 48  cgccttgccgccggtggactt-cctcgccgtctgcttggtgcgggccat 1

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  448 bits (226), Expect = e-123
 Identities = 365/409 (89%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                            
Query: 109      gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 37507562 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 37507503

                                                                            
Query: 169      ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
                ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||||| 
Sbjct: 37507502 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcc 37507443

                                                                            
Query: 229      gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
                |||||||| || ||    ||||||  |  |||||| | ||||||||||||||||||||||
Sbjct: 37507442 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 37507383

                                                                            
Query: 289      gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
                |||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 37507382 gcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcagc-tcggtgctctt 37507324

                                                                            
Query: 349      ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
                |||||||||||||||||| ||||| || ||||| ||||| | | ||||||| ||||||||
Sbjct: 37507323 ctggtacttgcggatctcccggagcgcgacggtgccggggcggaagcggtggggcttctt 37507264

                                                                            
Query: 409      cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
                |||||||||||||| ||| |||||||| | ||||||||| || || |||||||| |  ||
Sbjct: 37507263 cacgccgccggtggccggggccgacttgcgcgccgccttcgtcgccagctgcttcctcgg 37507204

                                                                 
Query: 469      cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
                ||||||||||||||||||||| |   || ||||||||||| ||||||||
Sbjct: 37507203 cgccttgccgccggtggactt-cctcgccgtctgcttggtgcgggccat 37507156

---

>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0505D12
          Length = 146951

 Score =  448 bits (226), Expect = e-123
 Identities = 365/409 (89%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                          
Query: 109    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 102099 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 102040

                                                                          
Query: 169    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
              ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||||| 
Sbjct: 102039 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcc 101980

                                                                          
Query: 229    gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
              |||||||| || ||    ||||||  |  |||||| | ||||||||||||||||||||||
Sbjct: 101979 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 101920

                                                                          
Query: 289    gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
              |||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 101919 gcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcagc-tcggtgctctt 101861

                                                                          
Query: 349    ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
              |||||||||||||||||| ||||| || ||||| ||||| | | ||||||| ||||||||
Sbjct: 101860 ctggtacttgcggatctcccggagcgcgacggtgccggggcggaagcggtggggcttctt 101801

                                                                          
Query: 409    cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
              |||||||||||||| ||| |||||||| | ||||||||| || || |||||||| |  ||
Sbjct: 101800 cacgccgccggtggccggggccgacttgcgcgccgccttcgtcgccagctgcttcctcgg 101741

                                                               
Query: 469    cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
              ||||||||||||||||||||| |   || ||||||||||| ||||||||
Sbjct: 101740 cgccttgccgccggtggactt-cctcgccgtctgcttggtgcgggccat 101693

---

>dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E03, full
           insert sequence
          Length = 1296

 Score =  448 bits (226), Expect = e-123
 Identities = 365/409 (89%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 485 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 426

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||||| 
Sbjct: 425 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcc 366

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||    ||||||  |  |||||| | ||||||||||||||||||||||
Sbjct: 365 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 306

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 305 gcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcagc-tcggtgctctt 247

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           |||||||||||||||||| ||||| || ||||| ||||| | | ||||||| ||||||||
Sbjct: 246 ctggtacttgcggatctcccggagcgcgacggtgccggggcggaagcggtggggcttctt 187

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||| |||||||| | ||||||||| || || |||||||| |  ||
Sbjct: 186 cacgccgccggtggccggggccgacttgcgcgccgccttcgtcgccagctgcttcctcgg 127

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||||||||||||||| |   || ||||||||||| ||||||||
Sbjct: 126 cgccttgccgccggtggactt-cctcgccgtctgcttggtgcgggccat 79

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  446 bits (225), Expect = e-122
 Identities = 316/345 (91%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                           
Query: 102     ggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 161
               ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1644693 ggcttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 1644752

                                                                           
Query: 162     gacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgc 221
               |||||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 1644753 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggc 1644812

                                                                           
Query: 222     ctcggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaa 281
               |||||| |||||||||||||| ||||| ||||||  |||||| | |||||||||||||||
Sbjct: 1644813 ctcggcggcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaa 1644872

                                                                           
Query: 282     gtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccg 341
               ||||||||||||||| |  || ||||||||||| || |||||||||||||| || |||||
Sbjct: 1644873 gtcctgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggag-ctccg 1644931

                                                                           
Query: 342     tgctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgag 401
               ||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| |
Sbjct: 1644932 tgctcttctggtacttgcggatctcgcggagcgccaccgtccccggcctgtagcggtggg 1644991

                                                            
Query: 402     gcttcttcacgccgccggtggtcggcgccgacttcctcgccgcct 446
               ||||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 1644992 gcttcttcacgccgccggtggtcggagcagacttcctcgccgcct 1645036



 Score =  406 bits (205), Expect = e-110
 Identities = 356/404 (88%), Gaps = 2/404 (0%)
 Strand = Plus / Minus

                                                                           
Query: 114     ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
               |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 3055564 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 3055505

                                                                           
Query: 174     gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
               ||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 3055504 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 3055445

                                                                           
Query: 234     ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
               ||| |||||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 3055444 ctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 3055385

                                                                           
Query: 294     ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
               ||| |  || ||||||||||| || ||||||||||| |||||| ||||||||||||||||
Sbjct: 3055384 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggt 3055326

                                                                           
Query: 354     acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
               ||||||||||||| ||||| || ||||| || |||||| ||||||| |||||||||||||
Sbjct: 3055325 acttgcggatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgc 3055266

                                                                           
Query: 414     cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
               ||||||||| |||||||||||| | |||||||||||| || ||||| || |  |||||||
Sbjct: 3055265 cgccggtggccggcgccgacttgcgcgccgccttggtcgccagctgtttcctcggcgcct 3055206

                                                           
Query: 474     tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
               | |||||||||||||||| | || |||||||| || ||||||||
Sbjct: 3055205 tcccgccggtggacttgc-gcgccgtctgcttcgtgcgggccat 3055163



 Score =  406 bits (205), Expect = e-110
 Identities = 356/404 (88%), Gaps = 2/404 (0%)
 Strand = Plus / Plus

                                                                           
Query: 114     ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
               |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 3039536 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 3039595

                                                                           
Query: 174     gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
               ||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct: 3039596 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 3039655

                                                                           
Query: 234     ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
               ||| || ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 3039656 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 3039715

                                                                           
Query: 294     ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
               ||| |  || ||||||||||| || ||||||||||| |||||| ||||||||||||||||
Sbjct: 3039716 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggt 3039774

                                                                           
Query: 354     acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
               ||||||||||||| ||||| || ||||| ||||||||| ||||||| |||||||||||||
Sbjct: 3039775 acttgcggatctcacggagcgcgacggtgccgggcctgaagcggtggggcttcttcacgc 3039834

                                                                           
Query: 414     cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
               ||||||||| ||| |||||||| | |||||||||||| || |||||||| |  |||||||
Sbjct: 3039835 cgccggtggccggggccgacttgcgcgccgccttggtcgccagctgcttcctcggcgcct 3039894

                                                           
Query: 474     tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
               | |||||||||||||||| | || |||||||| || ||||||||
Sbjct: 3039895 tcccgccggtggacttgc-gcgccgtctgcttcgtgcgggccat 3039937



 Score =  400 bits (202), Expect = e-108
 Identities = 350/397 (88%), Gaps = 2/397 (0%)
 Strand = Plus / Plus

                                                                           
Query: 121     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3054220 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3054279

                                                                           
Query: 181     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
               ||||||||||| ||||||||||| |||||||| ||||||||||| || |||||||| || 
Sbjct: 3054280 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 3054339

                                                                           
Query: 241     gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
               ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 3054340 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 3054399

                                                                           
Query: 301     accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
               || ||||||||||| || ||||||||||| |||||| |||||||||||||||||||||||
Sbjct: 3054400 acgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggtacttgcg 3054458

                                                                           
Query: 361     gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
               |||||| ||||| || ||||| || |||||| ||||||| ||||||||||||||||||||
Sbjct: 3054459 gatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccgccggt 3054518

                                                                           
Query: 421     ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
               || |||||||||||| | |||||||||||| || |||||||| |  |||||||| |||||
Sbjct: 3054519 ggccggcgccgacttgcgcgccgccttggtcgccagctgcttcctcggcgccttcccgcc 3054578

                                                    
Query: 481     ggtggacttgcggngcggtctgcttggtacgggccat 517
               ||||||||||| | || |||||||| || ||||||||
Sbjct: 3054579 ggtggacttgc-gcgccgtctgcttcgtgcgggccat 3054614



 Score =  345 bits (174), Expect = 9e-92
 Identities = 301/342 (88%), Gaps = 1/342 (0%)
 Strand = Plus / Plus

                                                                           
Query: 121     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
               ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3045573 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3045632

                                                                           
Query: 181     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
               |||||||||||||||||||||||||||||||| |||||||||||||| |||||||| || 
Sbjct: 3045633 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 3045692

                                                                           
Query: 241     gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
               ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 3045693 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 3045752

                                                                           
Query: 301     accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
               || ||||||||||| || ||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 3045753 acgaggcgctggaaggggagcttgcggatgagcag-ctccgtgctcttctggtacttgcg 3045811

                                                                           
Query: 361     gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
               |||||| ||||| || ||||| || |||||| ||||||| ||||||||||||||||||||
Sbjct: 3045812 gatctcacggagcgcgacggtgcctggcctgaagcggtgcggcttcttcacgccgccggt 3045871

                                                         
Query: 421     ggtcggcgccgacttcctcgccgccttggtggcgagctgctt 462
               || ||| || ||||| | ||  |||||||| || ||||||||
Sbjct: 3045872 ggccggagctgacttgcacgttgccttggtcgccagctgctt 3045913



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 68/74 (91%), Gaps = 1/74 (1%)
 Strand = Plus / Plus

                                                                           
Query: 444     ccttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgc 503
               ||||||||||||||||||| |  || |||||||||||||||||||||||| |||||||||
Sbjct: 1645142 ccttggtggcgagctgcttcctcggggccttgccgccggtggacttgcgg-gcggtctgc 1645200

                             
Query: 504     ttggtacgggccat 517
               || |||||||||||
Sbjct: 1645201 ttcgtacgggccat 1645214



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 216      gtacgcctcggcagcctcct 235
                ||||||||||||||||||||
Sbjct: 26644722 gtacgcctcggcagcctcct 26644703

---

>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0493C11
          Length = 143113

 Score =  446 bits (225), Expect = e-122
 Identities = 316/345 (91%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                         
Query: 102   ggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 161
             ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 47864 ggcttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 47923

                                                                         
Query: 162   gacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgc 221
             |||||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 47924 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggc 47983

                                                                         
Query: 222   ctcggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaa 281
             |||||| |||||||||||||| ||||| ||||||  |||||| | |||||||||||||||
Sbjct: 47984 ctcggcggcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaa 48043

                                                                         
Query: 282   gtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccg 341
             ||||||||||||||| |  || ||||||||||| || |||||||||||||| || |||||
Sbjct: 48044 gtcctgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggag-ctccg 48102

                                                                         
Query: 342   tgctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgag 401
             ||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| |
Sbjct: 48103 tgctcttctggtacttgcggatctcgcggagcgccaccgtccccggcctgtagcggtggg 48162

                                                          
Query: 402   gcttcttcacgccgccggtggtcggcgccgacttcctcgccgcct 446
             ||||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 48163 gcttcttcacgccgccggtggtcggagcagacttcctcgccgcct 48207



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 68/74 (91%), Gaps = 1/74 (1%)
 Strand = Plus / Plus

                                                                         
Query: 444   ccttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgc 503
             ||||||||||||||||||| |  || |||||||||||||||||||||||| |||||||||
Sbjct: 48313 ccttggtggcgagctgcttcctcggggccttgccgccggtggacttgcgg-gcggtctgc 48371

                           
Query: 504   ttggtacgggccat 517
             || |||||||||||
Sbjct: 48372 ttcgtacgggccat 48385

---

>ref|XM_475315.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  444 bits (224), Expect = e-121
 Identities = 345/384 (89%), Gaps = 1/384 (0%)
 Strand = Plus / Minus

                                                                       
Query: 106 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 165
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 410 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 351

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 350 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcg 291

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
           || |||||||| || ||    ||||||  |  |||||| | |||||||||||||||||||
Sbjct: 290 gcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcc 231

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           ||||||||||||| |||||| ||||||||||||||||||||||| |||||| ||||||||
Sbjct: 230 tgcgcgatctcccgcaccagccgctggaacggcagcttgcggatgagcagc-tccgtgct 172

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           ||||||||||||||||||||| ||||| || ||||| || |||||| ||||||| |||||
Sbjct: 171 cttctggtacttgcggatctcccggagcgcgacggttcccggcctgaagcggtggggctt 112

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||||||||||||||| | ||| |||||||| | ||||||||| || || |||||||| | 
Sbjct: 111 cttcacgccgccggtcgccggggccgacttgcgcgccgccttcgtcgccagctgcttcct 52

                                   
Query: 466 gggcgccttgccgccggtggactt 489
            |||||||||||||||||||||||
Sbjct: 51  cggcgccttgccgccggtggactt 28

---

>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0042J17, complete sequence
          Length = 124139

 Score =  444 bits (224), Expect = e-121
 Identities = 345/384 (89%), Gaps = 1/384 (0%)
 Strand = Plus / Plus

                                                                         
Query: 106   tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 165
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72762 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 72821

                                                                         
Query: 166   cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
             |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 72822 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcg 72881

                                                                         
Query: 226   gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
             || |||||||| || ||    ||||||  |  |||||| | |||||||||||||||||||
Sbjct: 72882 gcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcc 72941

                                                                         
Query: 286   tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
             ||||||||||||| |||||| ||||||||||||||||||||||| |||||| ||||||||
Sbjct: 72942 tgcgcgatctcccgcaccagccgctggaacggcagcttgcggatgagcagc-tccgtgct 73000

                                                                         
Query: 346   cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
             ||||||||||||||||||||| ||||| || ||||| || |||||| ||||||| |||||
Sbjct: 73001 cttctggtacttgcggatctcccggagcgcgacggttcccggcctgaagcggtggggctt 73060

                                                                         
Query: 406   cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
             ||||||||||||||| | ||| |||||||| | ||||||||| || || |||||||| | 
Sbjct: 73061 cttcacgccgccggtcgccggggccgacttgcgcgccgccttcgtcgccagctgcttcct 73120

                                     
Query: 466   gggcgccttgccgccggtggactt 489
              |||||||||||||||||||||||
Sbjct: 73121 cggcgccttgccgccggtggactt 73144

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  444 bits (224), Expect = e-121
 Identities = 345/384 (89%), Gaps = 1/384 (0%)
 Strand = Plus / Plus

                                                                            
Query: 106      tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 165
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21355440 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 21355499

                                                                            
Query: 166      cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
                |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 21355500 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcg 21355559

                                                                            
Query: 226      gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
                || |||||||| || ||    ||||||  |  |||||| | |||||||||||||||||||
Sbjct: 21355560 gcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcc 21355619

                                                                            
Query: 286      tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
                ||||||||||||| |||||| ||||||||||||||||||||||| |||||| ||||||||
Sbjct: 21355620 tgcgcgatctcccgcaccagccgctggaacggcagcttgcggatgagcagc-tccgtgct 21355678

                                                                            
Query: 346      cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
                ||||||||||||||||||||| ||||| || ||||| || |||||| ||||||| |||||
Sbjct: 21355679 cttctggtacttgcggatctcccggagcgcgacggttcccggcctgaagcggtggggctt 21355738

                                                                            
Query: 406      cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
                ||||||||||||||| | ||| |||||||| | ||||||||| || || |||||||| | 
Sbjct: 21355739 cttcacgccgccggtcgccggggccgacttgcgcgccgccttcgtcgccagctgcttcct 21355798

                                        
Query: 466      gggcgccttgccgccggtggactt 489
                 |||||||||||||||||||||||
Sbjct: 21355799 cggcgccttgccgccggtggactt 21355822

---

>dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039F20, full
           insert sequence
          Length = 735

 Score =  444 bits (224), Expect = e-121
 Identities = 345/384 (89%), Gaps = 1/384 (0%)
 Strand = Plus / Minus

                                                                       
Query: 106 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 165
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 495 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 436

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 435 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcg 376

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
           || |||||||| || ||    ||||||  |  |||||| | |||||||||||||||||||
Sbjct: 375 gcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcc 316

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           ||||||||||||| |||||| ||||||||||||||||||||||| |||||| ||||||||
Sbjct: 315 tgcgcgatctcccgcaccagccgctggaacggcagcttgcggatgagcagc-tccgtgct 257

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           ||||||||||||||||||||| ||||| || ||||| || |||||| ||||||| |||||
Sbjct: 256 cttctggtacttgcggatctcccggagcgcgacggttcccggcctgaagcggtggggctt 197

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||||||||||||||| | ||| |||||||| | ||||||||| || || |||||||| | 
Sbjct: 196 cttcacgccgccggtcgccggggccgacttgcgcgccgccttcgtcgccagctgcttcct 137

                                   
Query: 466 gggcgccttgccgccggtggactt 489
            |||||||||||||||||||||||
Sbjct: 136 cggcgccttgccgccggtggactt 113

---

>gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence
          Length = 887

 Score =  424 bits (214), Expect = e-115
 Identities = 362/409 (88%), Gaps = 2/409 (0%)
 Strand = Plus / Plus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 226 gccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 285

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| || || || ||||| |||||||| 
Sbjct: 286 ttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcg 345

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||   |||||||  ||||||||||| |||||| |||||||||||||||
Sbjct: 346 gcctcctgcagcgcggccacggcggaggactggaaccggaggtccgtcttgaagtcctgc 405

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||||| |||||| ||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 406 gcgatctcccgcaccagccgctggaacggcagcttccggatcagcag-ctccgtgctctt 464

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           |||||||||||||||||| || || |||||||| || || | | ||||||| ||||||||
Sbjct: 465 ctggtacttgcggatctcccgcagcgccacggtgcccgggcggaagcggtgcggcttctt 524

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||| || |||| |||||||||||| | ||||||||| || || |||||||| || ||
Sbjct: 525 cacgccccccgtggccggcgccgacttgcgcgccgccttcgtcgccagctgcttccgcgg 584

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||| || ||||||| | || |||||||| || ||||||||
Sbjct: 585 cgccttgccgcccgtcgacttgc-gcgccgtctgcttcgtgcgggccat 632

---

>emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene
          Length = 1119

 Score =  424 bits (214), Expect = e-115
 Identities = 362/409 (88%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 791 gccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 732

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| || || || ||||| |||||||| 
Sbjct: 731 ttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcg 672

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||   |||||||  ||||||||||| |||||| |||||||||||||||
Sbjct: 671 gcctcctgcagcgcggccacggcggaggactggaaccggaggtccgtcttgaagtcctgc 612

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||||| |||||| ||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 611 gcgatctcccgcaccagccgctggaacggcagcttccggatcagcag-ctccgtgctctt 553

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           |||||||||||||||||| || || |||||||| || || | | ||||||| ||||||||
Sbjct: 552 ctggtacttgcggatctcccgcagcgccacggtgcccgggcggaagcggtgcggcttctt 493

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||| || |||| |||||||||||| | ||||||||| || || |||||||| || ||
Sbjct: 492 cacgccccccgtggccggcgccgacttgcgcgccgccttcgtcgccagctgcttccgcgg 433

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||| || ||||||| | || |||||||| || ||||||||
Sbjct: 432 cgccttgccgcccgtcgacttgc-gcgccgtctgcttcgtgcgggccat 385

---

>ref|XM_472456.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  414 bits (209), Expect = e-112
 Identities = 339/381 (88%), Gaps = 1/381 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||||| 
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||    ||||||   |||||||||| |||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgc 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||||| |||||| ||||||||||| ||||| |||||||||||| |||||||||||
Sbjct: 227 gcgatctcccgcaccagccgctggaacgggagcttccggatcagcagc-tccgtgctctt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           |||||||||||||||||| ||||| ||||| || || |||| | ||||||| ||||||||
Sbjct: 168 ctggtacttgcggatctcccggagtgccaccgtgcccggccggaagcggtgcggcttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||| | |||||||||||||| ||||||||| || || |||||||| || ||
Sbjct: 108 cacgccgccggtcgccggcgccgacttccgcgccgccttcgtcgccagctgcttccgagg 49

                                
Query: 469 cgccttgccgccggtggactt 489
           |||||| |||||||| |||||
Sbjct: 48  cgccttcccgccggtcgactt 28

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  414 bits (209), Expect = e-112
 Identities = 339/381 (88%), Gaps = 1/381 (0%)
 Strand = Plus / Minus

                                                                            
Query: 109      gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
                ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20749059 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 20749000

                                                                            
Query: 169      ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
                ||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||||| 
Sbjct: 20748999 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 20748940

                                                                            
Query: 229      gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
                |||||||| || ||    ||||||   |||||||||| |||||| |||||||||||||||
Sbjct: 20748939 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgc 20748880

                                                                            
Query: 289      gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
                |||||||||| |||||| ||||||||||| ||||| |||||||||||| |||||||||||
Sbjct: 20748879 gcgatctcccgcaccagccgctggaacgggagcttccggatcagcagc-tccgtgctctt 20748821

                                                                            
Query: 349      ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
                |||||||||||||||||| ||||| ||||| || || |||| | ||||||| ||||||||
Sbjct: 20748820 ctggtacttgcggatctcccggagtgccaccgtgcccggccggaagcggtgcggcttctt 20748761

                                                                            
Query: 409      cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
                |||||||||||| | |||||||||||||| ||||||||| || || |||||||| || ||
Sbjct: 20748760 cacgccgccggtcgccggcgccgacttccgcgccgccttcgtcgccagctgcttccgagg 20748701

                                     
Query: 469      cgccttgccgccggtggactt 489
                |||||| |||||||| |||||
Sbjct: 20748700 cgccttcccgccggtcgactt 20748680



 Score =  137 bits (69), Expect = 4e-29
 Identities = 102/113 (90%)
 Strand = Plus / Minus

                                                                            
Query: 136      agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 195
                ||||| |||||||||||||||||||| || |||||||| |||||||||||||||||||||
Sbjct: 22438361 agctgaatgtccttgggcatgatggtcacacgcttggcatggatggcgcacaggttggtg 22438302

                                                                     
Query: 196      tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcac 248
                |||||||| || || || ||||||||||||||||| ||||| ||||| |||||
Sbjct: 22438301 tcctcgaagagacccaccaggtacgcctcggcagcttcctgaagggcaagcac 22438249

---

>emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0108J11,
             complete sequence
          Length = 124629

 Score =  414 bits (209), Expect = e-112
 Identities = 339/381 (88%), Gaps = 1/381 (0%)
 Strand = Plus / Minus

                                                                         
Query: 109   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
             ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95210 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 95151

                                                                         
Query: 169   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
             ||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||||| 
Sbjct: 95150 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 95091

                                                                         
Query: 229   gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
             |||||||| || ||    ||||||   |||||||||| |||||| |||||||||||||||
Sbjct: 95090 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgc 95031

                                                                         
Query: 289   gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
             |||||||||| |||||| ||||||||||| ||||| |||||||||||| |||||||||||
Sbjct: 95030 gcgatctcccgcaccagccgctggaacgggagcttccggatcagcagc-tccgtgctctt 94972

                                                                         
Query: 349   ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
             |||||||||||||||||| ||||| ||||| || || |||| | ||||||| ||||||||
Sbjct: 94971 ctggtacttgcggatctcccggagtgccaccgtgcccggccggaagcggtgcggcttctt 94912

                                                                         
Query: 409   cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
             |||||||||||| | |||||||||||||| ||||||||| || || |||||||| || ||
Sbjct: 94911 cacgccgccggtcgccggcgccgacttccgcgccgccttcgtcgccagctgcttccgagg 94852

                                  
Query: 469   cgccttgccgccggtggactt 489
             |||||| |||||||| |||||
Sbjct: 94851 cgccttcccgccggtcgactt 94831

---

>emb|X00937.1|TAHI02 Wheat histone H3 gene
          Length = 811

 Score =  410 bits (207), Expect = e-111
 Identities = 361/410 (88%), Gaps = 2/410 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 654 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 595

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| || || || ||||| |||||||| 
Sbjct: 594 ttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcg 535

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| |||||    ||||||  ||||||||| | ||||||||||||||||||||| 
Sbjct: 534 gcctcctgcagggcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgg 475

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | ||| ||||||||||| || ||||||||||| ||||| ||||||||||||
Sbjct: 474 gcgatctcgcgcactaggcgctggaaggggagcttgcggatgagcag-ctccgtgctctt 416

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           |||||||||||||||||||||||| |||||||| ||||| | | ||||||| ||||||||
Sbjct: 415 ctggtacttgcggatctcgcggagcgccacggtgccggggcggaagcggtggggcttctt 356

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||| || ||||| |  || |||||||| || |||||||| |  ||
Sbjct: 355 cacgccgccggtggccggggcggacttgcgagcggccttggtcgccagctgcttcctcgg 296

                                                             
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
           ||||||||||||||| ||||| |   || ||||||||||| |||||||||
Sbjct: 295 cgccttgccgccggtcgactt-cctcgccgtctgcttggtgcgggccatg 247

---

>gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial cds, clone W2
          Length = 486

 Score =  410 bits (207), Expect = e-111
 Identities = 286/311 (91%), Gaps = 1/311 (0%)
 Strand = Plus / Minus

                                                                       
Query: 136 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 195
           |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
Sbjct: 486 agctggatgtccttgggcatgatggtgacgcgcttggcatggatggcgcaggggttggtg 427

                                                                       
Query: 196 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 255
           |||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 426 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagggccagcacggcgtgg 367

                                                                       
Query: 256 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 315
             |||||| |  || || |||||||||||||| |||||||||| || |||||||||||||
Sbjct: 366 ctctggaagcgcagatccgtcttgaagtcctgggcgatctcccgcagcaggcgctggaac 307

                                                                       
Query: 316 ggcagcttgcggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggc 375
           |||||||||||||| |||||  ||||||||||||||||||||||||||||| ||||||||
Sbjct: 306 ggcagcttgcggatgagcag-atccgtgctcttctggtacttgcggatctcccggagggc 248

                                                                       
Query: 376 cacggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgactt 435
           |||||| || |||||||||||||| ||||||||||| ||||| |||||||||||||||||
Sbjct: 247 cacggtgcccggcctgtagcggtggggcttcttcactccgcccgtggtcggcgccgactt 188

                      
Query: 436 cctcgccgcct 446
           |||||||||||
Sbjct: 187 cctcgccgcct 177



 Score =  115 bits (58), Expect = 2e-22
 Identities = 71/74 (95%), Gaps = 1/74 (1%)
 Strand = Plus / Minus

                                                                       
Query: 444 ccttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgc 503
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 73  ccttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcgg-gcggtctgc 15

                         
Query: 504 ttggtacgggccat 517
           || || ||||||||
Sbjct: 14  ttcgtgcgggccat 1

---

>gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds
          Length = 411

 Score =  408 bits (206), Expect = e-111
 Identities = 360/409 (88%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||||| 
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcg 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||    || |||  ||||||||| | ||||||||||||||| ||||||
Sbjct: 287 gcctcctgcagcgcggcgacagcggaggactggaagcggaggtcggtcttgaaatcctgc 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| |  || ||||||||||| |||||||||||||| |||||| |||||||||||
Sbjct: 227 gcgatctcacggacgaggcgctggaagggcagcttgcggatgagcagc-tccgtgctctt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           |||||||||||| ||||| ||||| || ||||| ||||| | | ||||||||||||||||
Sbjct: 168 ctggtacttgcgaatctcccggagcgcgacggtgccggggcggaagcggtgaggcttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||| ||||| | |||||||||||| | ||||||||||||||| ||||||||||||||
Sbjct: 108 cacgccaccggttgccggcgccgacttgcgcgccgccttggtggccagctgcttgcgggg 49

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||| || ||||||| | || |||||||| || ||||||||
Sbjct: 48  cgccttgccgcccgtcgacttgc-gcgccgtctgcttcgtgcgggccat 1

---

>gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), complete cds
          Length = 1001

 Score =  408 bits (206), Expect = e-111
 Identities = 360/409 (88%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 828 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 769

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||||| 
Sbjct: 768 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcg 709

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||    || |||  ||||||||| | ||||||||||||||| ||||||
Sbjct: 708 gcctcctgcagcgcggcgacagcggaggactggaagcggaggtcggtcttgaaatcctgc 649

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| |  || ||||||||||| |||||||||||||| |||||| |||||||||||
Sbjct: 648 gcgatctcacggacgaggcgctggaagggcagcttgcggatgagcagc-tccgtgctctt 590

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           |||||||||||| ||||| ||||| || ||||| ||||| | | ||||||||||||||||
Sbjct: 589 ctggtacttgcgaatctcccggagcgcgacggtgccggggcggaagcggtgaggcttctt 530

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||| ||||| | |||||||||||| | ||||||||||||||| ||||||||||||||
Sbjct: 529 cacgccaccggttgccggcgccgacttgcgcgccgccttggtggccagctgcttgcgggg 470

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||| || ||||||| | || |||||||| || ||||||||
Sbjct: 469 cgccttgccgcccgtcgacttgc-gcgccgtctgcttcgtgcgggccat 422

---

>ref|NM_185607.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  406 bits (205), Expect = e-110
 Identities = 356/404 (88%), Gaps = 2/404 (0%)
 Strand = Plus / Minus

                                                                       
Query: 114 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
           |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 174 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
           ||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct: 342 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 283

                                                                       
Query: 234 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
           ||| || ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 282 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 223

                                                                       
Query: 294 ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
           ||| |  || ||||||||||| || ||||||||||| |||||| ||||||||||||||||
Sbjct: 222 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggt 164

                                                                       
Query: 354 acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
           ||||||||||||| ||||| || ||||| ||||||||| ||||||| |||||||||||||
Sbjct: 163 acttgcggatctcacggagcgcgacggtgccgggcctgaagcggtggggcttcttcacgc 104

                                                                       
Query: 414 cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
           ||||||||| ||| |||||||| | |||||||||||| || |||||||| |  |||||||
Sbjct: 103 cgccggtggccggggccgacttgcgcgccgccttggtcgccagctgcttcctcggcgcct 44

                                                       
Query: 474 tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | |||||||||||||||| | || |||||||| || ||||||||
Sbjct: 43  tcccgccggtggacttgc-gcgccgtctgcttcgtgcgggccat 1

---

>ref|NM_185613.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  406 bits (205), Expect = e-110
 Identities = 356/404 (88%), Gaps = 2/404 (0%)
 Strand = Plus / Minus

                                                                       
Query: 114 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
           |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 174 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
           ||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 283

                                                                       
Query: 234 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
           ||| |||||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 282 ctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 223

                                                                       
Query: 294 ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
           ||| |  || ||||||||||| || ||||||||||| |||||| ||||||||||||||||
Sbjct: 222 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggt 164

                                                                       
Query: 354 acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
           ||||||||||||| ||||| || ||||| || |||||| ||||||| |||||||||||||
Sbjct: 163 acttgcggatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgc 104

                                                                       
Query: 414 cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
           ||||||||| |||||||||||| | |||||||||||| || ||||| || |  |||||||
Sbjct: 103 cgccggtggccggcgccgacttgcgcgccgccttggtcgccagctgtttcctcggcgcct 44

                                                       
Query: 474 tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | |||||||||||||||| | || |||||||| || ||||||||
Sbjct: 43  tcccgccggtggacttgc-gcgccgtctgcttcgtgcgggccat 1

---

>emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11
          Length = 1200

 Score =  406 bits (205), Expect = e-110
 Identities = 356/404 (88%), Gaps = 2/404 (0%)
 Strand = Plus / Minus

                                                                       
Query: 114 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
           |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 743

                                                                       
Query: 174 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
           ||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct: 742 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 683

                                                                       
Query: 234 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
           ||| || ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 682 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 623

                                                                       
Query: 294 ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
           ||| |  || ||||||||||| || ||||||||||| |||||| ||||||||||||||||
Sbjct: 622 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggt 564

                                                                       
Query: 354 acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
           ||||||||||||| ||||| || ||||| ||||||||| ||||||| |||||||||||||
Sbjct: 563 acttgcggatctcacggagcgcgacggtgccgggcctgaagcggtggggcttcttcacgc 504

                                                                       
Query: 414 cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
           ||||||||| ||| |||||||| | |||||||||||| || |||||||| |  |||||||
Sbjct: 503 cgccggtggccggggccgacttgcgcgccgccttggtcgccagctgcttcctcggcgcct 444

                                                       
Query: 474 tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | |||||||||||||||| | || |||||||| || ||||||||
Sbjct: 443 tcccgccggtggacttgc-gcgccgtctgcttcgtgcgggccat 401

---

>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0702F05
          Length = 145018

 Score =  406 bits (205), Expect = e-110
 Identities = 356/404 (88%), Gaps = 2/404 (0%)
 Strand = Plus / Minus

                                                                          
Query: 114    ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
              |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 143513 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 143454

                                                                          
Query: 174    gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
              ||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 143453 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 143394

                                                                          
Query: 234    ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
              ||| |||||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 143393 ctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 143334

                                                                          
Query: 294    ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
              ||| |  || ||||||||||| || ||||||||||| |||||| ||||||||||||||||
Sbjct: 143333 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggt 143275

                                                                          
Query: 354    acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
              ||||||||||||| ||||| || ||||| || |||||| ||||||| |||||||||||||
Sbjct: 143274 acttgcggatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgc 143215

                                                                          
Query: 414    cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
              ||||||||| |||||||||||| | |||||||||||| || ||||| || |  |||||||
Sbjct: 143214 cgccggtggccggcgccgacttgcgcgccgccttggtcgccagctgtttcctcggcgcct 143155

                                                          
Query: 474    tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
              | |||||||||||||||| | || |||||||| || ||||||||
Sbjct: 143154 tcccgccggtggacttgc-gcgccgtctgcttcgtgcgggccat 143112



 Score =  406 bits (205), Expect = e-110
 Identities = 356/404 (88%), Gaps = 2/404 (0%)
 Strand = Plus / Plus

                                                                          
Query: 114    ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
              |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 127485 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 127544

                                                                          
Query: 174    gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
              ||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct: 127545 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 127604

                                                                          
Query: 234    ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
              ||| || ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 127605 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 127664

                                                                          
Query: 294    ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
              ||| |  || ||||||||||| || ||||||||||| |||||| ||||||||||||||||
Sbjct: 127665 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggt 127723

                                                                          
Query: 354    acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
              ||||||||||||| ||||| || ||||| ||||||||| ||||||| |||||||||||||
Sbjct: 127724 acttgcggatctcacggagcgcgacggtgccgggcctgaagcggtggggcttcttcacgc 127783

                                                                          
Query: 414    cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
              ||||||||| ||| |||||||| | |||||||||||| || |||||||| |  |||||||
Sbjct: 127784 cgccggtggccggggccgacttgcgcgccgccttggtcgccagctgcttcctcggcgcct 127843

                                                          
Query: 474    tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
              | |||||||||||||||| | || |||||||| || ||||||||
Sbjct: 127844 tcccgccggtggacttgc-gcgccgtctgcttcgtgcgggccat 127886



 Score =  400 bits (202), Expect = e-108
 Identities = 350/397 (88%), Gaps = 2/397 (0%)
 Strand = Plus / Plus

                                                                          
Query: 121    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142169 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 142228

                                                                          
Query: 181    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
              ||||||||||| ||||||||||| |||||||| ||||||||||| || |||||||| || 
Sbjct: 142229 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 142288

                                                                          
Query: 241    gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
              ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 142289 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 142348

                                                                          
Query: 301    accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
              || ||||||||||| || ||||||||||| |||||| |||||||||||||||||||||||
Sbjct: 142349 acgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggtacttgcg 142407

                                                                          
Query: 361    gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
              |||||| ||||| || ||||| || |||||| ||||||| ||||||||||||||||||||
Sbjct: 142408 gatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccgccggt 142467

                                                                          
Query: 421    ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
              || |||||||||||| | |||||||||||| || |||||||| |  |||||||| |||||
Sbjct: 142468 ggccggcgccgacttgcgcgccgccttggtcgccagctgcttcctcggcgccttcccgcc 142527

                                                   
Query: 481    ggtggacttgcggngcggtctgcttggtacgggccat 517
              ||||||||||| | || |||||||| || ||||||||
Sbjct: 142528 ggtggacttgc-gcgccgtctgcttcgtgcgggccat 142563



 Score =  345 bits (174), Expect = 9e-92
 Identities = 301/342 (88%), Gaps = 1/342 (0%)
 Strand = Plus / Plus

                                                                          
Query: 121    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
              ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 133522 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 133581

                                                                          
Query: 181    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
              |||||||||||||||||||||||||||||||| |||||||||||||| |||||||| || 
Sbjct: 133582 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 133641

                                                                          
Query: 241    gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
              ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 133642 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 133701

                                                                          
Query: 301    accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
              || ||||||||||| || ||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 133702 acgaggcgctggaaggggagcttgcggatgagcag-ctccgtgctcttctggtacttgcg 133760

                                                                          
Query: 361    gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
              |||||| ||||| || ||||| || |||||| ||||||| ||||||||||||||||||||
Sbjct: 133761 gatctcacggagcgcgacggtgcctggcctgaagcggtgcggcttcttcacgccgccggt 133820

                                                        
Query: 421    ggtcggcgccgacttcctcgccgccttggtggcgagctgctt 462
              || ||| || ||||| | ||  |||||||| || ||||||||
Sbjct: 133821 ggccggagctgacttgcacgttgccttggtcgccagctgctt 133862

---

>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone:P0681F10
          Length = 170371

 Score =  406 bits (205), Expect = e-110
 Identities = 356/404 (88%), Gaps = 2/404 (0%)
 Strand = Plus / Minus

                                                                        
Query: 114  ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
            |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 9749 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 9690

                                                                        
Query: 174  gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
            ||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 9689 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 9630

                                                                        
Query: 234  ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
            ||| |||||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 9629 ctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 9570

                                                                        
Query: 294  ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
            ||| |  || ||||||||||| || ||||||||||| |||||| ||||||||||||||||
Sbjct: 9569 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggt 9511

                                                                        
Query: 354  acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
            ||||||||||||| ||||| || ||||| || |||||| ||||||| |||||||||||||
Sbjct: 9510 acttgcggatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgc 9451

                                                                        
Query: 414  cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
            ||||||||| |||||||||||| | |||||||||||| || ||||| || |  |||||||
Sbjct: 9450 cgccggtggccggcgccgacttgcgcgccgccttggtcgccagctgtttcctcggcgcct 9391

                                                        
Query: 474  tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            | |||||||||||||||| | || |||||||| || ||||||||
Sbjct: 9390 tcccgccggtggacttgc-gcgccgtctgcttcgtgcgggccat 9348



 Score =  400 bits (202), Expect = e-108
 Identities = 350/397 (88%), Gaps = 2/397 (0%)
 Strand = Plus / Plus

                                                                        
Query: 121  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8405 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 8464

                                                                        
Query: 181  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
            ||||||||||| ||||||||||| |||||||| ||||||||||| || |||||||| || 
Sbjct: 8465 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 8524

                                                                        
Query: 241  gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
            ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 8525 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 8584

                                                                        
Query: 301  accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
            || ||||||||||| || ||||||||||| |||||| |||||||||||||||||||||||
Sbjct: 8585 acgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggtacttgcg 8643

                                                                        
Query: 361  gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
            |||||| ||||| || ||||| || |||||| ||||||| ||||||||||||||||||||
Sbjct: 8644 gatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccgccggt 8703

                                                                        
Query: 421  ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
            || |||||||||||| | |||||||||||| || |||||||| |  |||||||| |||||
Sbjct: 8704 ggccggcgccgacttgcgcgccgccttggtcgccagctgcttcctcggcgccttcccgcc 8763

                                                 
Query: 481  ggtggacttgcggngcggtctgcttggtacgggccat 517
            ||||||||||| | || |||||||| || ||||||||
Sbjct: 8764 ggtggacttgc-gcgccgtctgcttcgtgcgggccat 8799



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 368 cggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggtcggc 427
           ||||| || ||||| || |||||| ||||||| |||||||||||||||||||||| ||| 
Sbjct: 4   cggagcgcgacggtgcctggcctgaagcggtgcggcttcttcacgccgccggtggccgga 63

                                              
Query: 428 gccgacttcctcgccgccttggtggcgagctgctt 462
           || ||||| | ||  |||||||| || ||||||||
Sbjct: 64  gctgacttgcacgttgccttggtcgccagctgctt 98

---

>gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds
          Length = 1177

 Score =  404 bits (204), Expect = e-109
 Identities = 331/372 (88%), Gaps = 1/372 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 940 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 881

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||| |||||||||||||||||||| ||||| ||||| |||||||| |||||||| || 
Sbjct: 880 gcgcagaggttggtgtcctcgaacaggccgacgaggtaggcctcggcggcctcctgcagc 821

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||    ||||||  ||||||||| | |||||||||||||||||||||||||||||| |  
Sbjct: 820 gcggcgacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcgcgg 761

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 760 accaggcgctggaagggcagcttgcggatgagcag-ctccgtgctcttctggtacttgcg 702

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || |||||||| || || | | ||||||| ||||||||||||||||||||
Sbjct: 701 gatctcgcgcagcgccacggtgcccgggcggaagcggtgcggcttcttcacgccgccggt 642

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
            | ||| |||||||| | |||||||||||| || |||||||| |  || |||||||||||
Sbjct: 641 cgccggggccgacttgcgcgccgccttggtcgccagctgcttcctcggggccttgccgcc 582

                       
Query: 481 ggtggacttgcg 492
            |||||||||||
Sbjct: 581 cgtggacttgcg 570

---

>gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end
          Length = 505

 Score =  404 bits (204), Expect = e-109
 Identities = 213/216 (98%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 227 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 168

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 167 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctggagg 108

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 107 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 48

                                               
Query: 301 accaggcgctggaacggcagcttgcggatcagcagc 336
           ||||||||||||||||| ||||||||||||||||||
Sbjct: 47  accaggcgctggaacgggagcttgcggatcagcagc 12

---

>ref|NM_185612.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  400 bits (202), Expect = e-108
 Identities = 350/397 (88%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||| ||||||||||| |||||||| ||||||||||| || |||||||| || 
Sbjct: 335 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 276

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 275 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 216

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           || ||||||||||| || ||||||||||| |||||| |||||||||||||||||||||||
Sbjct: 215 acgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggtacttgcg 157

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           |||||| ||||| || ||||| || |||||| ||||||| ||||||||||||||||||||
Sbjct: 156 gatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccgccggt 97

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || |||||||||||| | |||||||||||| || |||||||| |  |||||||| |||||
Sbjct: 96  ggccggcgccgacttgcgcgccgccttggtcgccagctgcttcctcggcgccttcccgcc 37

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||||| | || |||||||| || ||||||||
Sbjct: 36  ggtggacttgc-gcgccgtctgcttcgtgcgggccat 1

---

>gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence
          Length = 663

 Score =  392 bits (198), Expect = e-106
 Identities = 358/409 (87%), Gaps = 2/409 (0%)
 Strand = Plus / Plus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| | |||||||||||||||||||||||||||||||||||||||||| | |
Sbjct: 154 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgaccctc 213

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||||||||| || 
Sbjct: 214 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtacgcctccgcg 273

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || |||  ||| ||    ||||||||||  ||||| |||||||||||||||
Sbjct: 274 gcctcctgcagcgccgccaccgccgacgactggaaccgcaggtccgtcttgaagtcctgc 333

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| |  |||||||||||||| || ||||||||||| |||||| |||||||||||
Sbjct: 334 gcgatctcgcgaaccaggcgctggaaggggagcttgcggatgagcagc-tccgtgctctt 392

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           |||||||||||||||||||||||| || ||||| ||||| | | ||||||| ||||||||
Sbjct: 393 ctggtacttgcggatctcgcggagcgcgacggtgccggggcggaagcggtgcggcttctt 452

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||| || |||| ||| |||||||| | ||||||||||||||| |||||||| || ||
Sbjct: 453 cacgccccccgtggccggggccgacttgcgcgccgccttggtggccagctgcttccgcgg 512

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||||||||| ||||||| | || |||||||| || ||||||||
Sbjct: 513 cgccttgccgccggtcgacttgc-gcgccgtctgcttcgtgcgggccat 560

---

>gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0076K20,
              complete sequence
          Length = 127338

 Score =  392 bits (198), Expect = e-106
 Identities = 349/397 (87%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                          
Query: 121    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118162 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 118103

                                                                          
Query: 181    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
              ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 118102 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 118043

                                                                          
Query: 241    gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
              ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 118042 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 117983

                                                                          
Query: 301    accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
              || || |||||||| || |||||||||||||||||| |||||||||||||||||||||||
Sbjct: 117982 acgagccgctggaaggggagcttgcggatcagcagc-tccgtgctcttctggtacttgcg 117924

                                                                          
Query: 361    gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
              |||||| ||||| || ||||| || |||| | | ||||| ||||||||||||||||||||
Sbjct: 117923 gatctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccgccggt 117864

                                                                          
Query: 421    ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
              || |||||||||||||| ||||||||| || || |||||||| |  |||||||| |||||
Sbjct: 117863 ggccggcgccgacttccgcgccgccttcgtcgccagctgcttcctcggcgccttcccgcc 117804

                                                   
Query: 481    ggtggacttgcggngcggtctgcttggtacgggccat 517
              ||| ||||| | | || |||||||| || ||||||||
Sbjct: 117803 ggtcgactt-ccgagccgtctgcttcgtgcgggccat 117768

---

>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0030I09 map C83B, complete sequence
          Length = 123477

 Score =  392 bits (198), Expect = e-106
 Identities = 349/397 (87%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                         
Query: 121   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13768 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 13709

                                                                         
Query: 181   gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
             ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 13708 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 13649

                                                                         
Query: 241   gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
             ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 13648 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 13589

                                                                         
Query: 301   accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
             || || |||||||| || |||||||||||||||||| |||||||||||||||||||||||
Sbjct: 13588 acgagccgctggaaggggagcttgcggatcagcagc-tccgtgctcttctggtacttgcg 13530

                                                                         
Query: 361   gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
             |||||| ||||| || ||||| || |||| | | ||||| ||||||||||||||||||||
Sbjct: 13529 gatctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccgccggt 13470

                                                                         
Query: 421   ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
             || |||||||||||||| ||||||||| || || |||||||| |  |||||||| |||||
Sbjct: 13469 ggccggcgccgacttccgcgccgccttcgtcgccagctgcttcctcggcgccttcccgcc 13410

                                                  
Query: 481   ggtggacttgcggngcggtctgcttggtacgggccat 517
             ||| ||||| | | || |||||||| || ||||||||
Sbjct: 13409 ggtcgactt-ccgagccgtctgcttcgtgcgggccat 13374

---

>emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2
          Length = 1200

 Score =  392 bits (198), Expect = e-106
 Identities = 349/397 (87%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 795 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 736

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 735 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 676

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 675 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 616

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           || || |||||||| || |||||||||||||||||| |||||||||||||||||||||||
Sbjct: 615 acgagccgctggaaggggagcttgcggatcagcagc-tccgtgctcttctggtacttgcg 557

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           |||||| ||||| || ||||| || |||| | | ||||| ||||||||||||||||||||
Sbjct: 556 gatctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccgccggt 497

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || |||||||||||||| ||||||||| || || |||||||| |  |||||||| |||||
Sbjct: 496 ggccggcgccgacttccgcgccgccttcgtcgccagctgcttcctcggcgccttcccgcc 437

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
           ||| ||||| | | || |||||||| || ||||||||
Sbjct: 436 ggtcgactt-ccgagccgtctgcttcgtgcgggccat 401

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  392 bits (198), Expect = e-106
 Identities = 349/397 (87%), Gaps = 2/397 (0%)
 Strand = Plus / Plus

                                                                           
Query: 121     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2608636 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 2608695

                                                                           
Query: 181     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
               ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 2608696 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 2608755

                                                                           
Query: 241     gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
               ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 2608756 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 2608815

                                                                           
Query: 301     accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
               || || |||||||| || |||||||||||||||||| |||||||||||||||||||||||
Sbjct: 2608816 acgagccgctggaaggggagcttgcggatcagcagc-tccgtgctcttctggtacttgcg 2608874

                                                                           
Query: 361     gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
               |||||| ||||| || ||||| || |||| | | ||||| ||||||||||||||||||||
Sbjct: 2608875 gatctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccgccggt 2608934

                                                                           
Query: 421     ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
               || |||||||||||||| ||||||||| || || |||||||| |  |||||||| |||||
Sbjct: 2608935 ggccggcgccgacttccgcgccgccttcgtcgccagctgcttcctcggcgccttcccgcc 2608994

                                                    
Query: 481     ggtggacttgcggngcggtctgcttggtacgggccat 517
               ||| ||||| | | || |||||||| || ||||||||
Sbjct: 2608995 ggtcgactt-ccgagccgtctgcttcgtgcgggccat 2609030

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  392 bits (198), Expect = e-106
 Identities = 349/397 (87%), Gaps = 2/397 (0%)
 Strand = Plus / Plus

                                                                           
Query: 121     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2617667 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 2617726

                                                                           
Query: 181     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
               ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 2617727 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 2617786

                                                                           
Query: 241     gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
               ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 2617787 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 2617846

                                                                           
Query: 301     accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
               || || |||||||| || |||||||||||||||||| |||||||||||||||||||||||
Sbjct: 2617847 acgagccgctggaaggggagcttgcggatcagcagc-tccgtgctcttctggtacttgcg 2617905

                                                                           
Query: 361     gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
               |||||| ||||| || ||||| || |||| | | ||||| ||||||||||||||||||||
Sbjct: 2617906 gatctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccgccggt 2617965

                                                                           
Query: 421     ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
               || |||||||||||||| ||||||||| || || |||||||| |  |||||||| |||||
Sbjct: 2617966 ggccggcgccgacttccgcgccgccttcgtcgccagctgcttcctcggcgccttcccgcc 2618025

                                                    
Query: 481     ggtggacttgcggngcggtctgcttggtacgggccat 517
               ||| ||||| | | || |||||||| || ||||||||
Sbjct: 2618026 ggtcgactt-ccgagccgtctgcttcgtgcgggccat 2618061

---

>gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds
          Length = 642

 Score =  392 bits (198), Expect = e-106
 Identities = 349/397 (87%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 466 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 407

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 406 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 347

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 346 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 287

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           || || |||||||| || |||||||||||||||||| |||||||||||||||||||||||
Sbjct: 286 acgagccgctggaaggggagcttgcggatcagcagc-tccgtgctcttctggtacttgcg 228

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           |||||| ||||| || ||||| || |||| | | ||||| ||||||||||||||||||||
Sbjct: 227 gatctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccgccggt 168

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || |||||||||||||| ||||||||| || || |||||||| |  |||||||| |||||
Sbjct: 167 ggccggcgccgacttccgcgccgccttcgtcgccagctgcttcctcggcgccttcccgcc 108

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
           ||| ||||| | | || |||||||| || ||||||||
Sbjct: 107 ggtcgactt-ccgagccgtctgcttcgtgcgggccat 72

---

>gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds
          Length = 711

 Score =  392 bits (198), Expect = e-106
 Identities = 349/397 (87%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 625 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 566

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||| ||||||||||| |||||||| ||||||  ||| || |||||||| || 
Sbjct: 565 gcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccgcggcctcctgcagc 506

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||  | ||||||   | |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 505 gcgcggacggcggacgtctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 446

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           || ||||||||||| || ||||||||||| |||||| |||||||||||||||||||||||
Sbjct: 445 acgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggtacttgcg 387

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           |||||| ||||| || ||||| || |||||| ||||||| ||||||||||||||||||||
Sbjct: 386 gatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccgccggt 327

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || |||||||||||| | |||||||||||| || |||||||| |  |||||||| |||||
Sbjct: 326 ggccggcgccgacttgcgcgccgccttggtcgccagctgcttcctcggcgccttcccgcc 267

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||||| | || |||||||| || ||||||||
Sbjct: 266 ggtggacttgc-gcgccgtctgcttcgtgcgggccat 231

---

>gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds
          Length = 568

 Score =  392 bits (198), Expect = e-106
 Identities = 349/397 (87%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 532 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 473

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||| ||||||||||| |||||||| ||||||  ||| || |||||||| || 
Sbjct: 472 gcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccgcggcctcctgcagc 413

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||  | ||||||   | |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 412 gcgcggacggcggacgtctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 353

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           || ||||||||||| || ||||||||||| |||||| |||||||||||||||||||||||
Sbjct: 352 acgaggcgctggaaggggagcttgcggatgagcagc-tccgtgctcttctggtacttgcg 294

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           |||||| ||||| || ||||| || |||||| ||||||| ||||||||||||||||||||
Sbjct: 293 gatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccgccggt 234

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || |||||||||||| | |||||||||||| || |||||||| |  |||||||| |||||
Sbjct: 233 ggccggcgccgacttgcgcgccgccttggtcgccagctgcttcctcggcgccttcccgcc 174

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||||| | || |||||||| || ||||||||
Sbjct: 173 ggtggacttgc-gcgccgtctgcttcgtgcgggccat 138

---

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score =  381 bits (192), Expect = e-102
 Identities = 353/404 (87%), Gaps = 2/404 (0%)
 Strand = Plus / Minus

                                                                        
Query: 118  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
            ||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||
Sbjct: 2539 ccacggatgcggcggaccaactggatgtccttgggcatgatggtgacgcgcttggcgtgg 2480

                                                                        
Query: 178  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 2479 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 2420

                                                                        
Query: 238  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 2419 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 2360

                                                                        
Query: 298  ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
            | ||||||||||||||||||||||||||||||||||||| || ||   |||||||||   
Sbjct: 2359 cgcaccaggcgctggaacggcagcttgcggatcagcagc-tcggtcgacttctggtagcg 2301

                                                                        
Query: 358  gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
             ||||||||||| || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 2300 ccggatctcgcgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 2241

                                                                        
Query: 418  ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
             |||||||| ||   ||| |  |||||||||||||| ||||||||||| || ||||||||
Sbjct: 2240 cgtggtcggggcgctcttgcgggccgccttggtggccagctgcttgcgcggggccttgcc 2181

                                                        
Query: 478  gccggtggacttgcggngcggtctgcttggtacgggccatggcg 521
            |||||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 2180 gccggtggacttgcgg-gcggtctgcttcgtacgggccatggcg 2138

---

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  371 bits (187), Expect = 2e-99
 Identities = 356/410 (86%), Gaps = 2/410 (0%)
 Strand = Plus / Plus

                                                                          
Query: 109    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
              |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 135592 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 135651

                                                                          
Query: 169    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
              |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 135652 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 135711

                                                                          
Query: 229    gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
              |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 135712 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 135771

                                                                          
Query: 289    gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
              |||||||| | |||||||||||||||||||||||||||||||||||| ||| ||   |||
Sbjct: 135772 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgactt 135830

                                                                          
Query: 349    ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
              ||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||||||
Sbjct: 135831 ctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttctt 135890

                                                                          
Query: 409    cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
              |||||||||||||| ||| ||   ||| |  || ||||||||||| ||||||||||| ||
Sbjct: 135891 cacgccgccggtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcgg 135950

                                                                
Query: 469    cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
               |||||||||||||||||||||| | ||||||||||| ||||| ||||||
Sbjct: 135951 ggccttgccgccggtggacttgc-gagcggtctgcttagtacgagccatg 135999



 Score =  353 bits (178), Expect = 4e-94
 Identities = 353/409 (86%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                          
Query: 109    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
              |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 143287 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 143228

                                                                          
Query: 169    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
              |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 143227 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 143168

                                                                          
Query: 229    gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
              |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 143167 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 143108

                                                                          
Query: 289    gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
              |||||||| | |||||||||||||||||||||||||||||||||||| ||| ||   |||
Sbjct: 143107 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgactt 143049

                                                                          
Query: 349    ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
              ||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||||||
Sbjct: 143048 ctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttctt 142989

                                                                          
Query: 409    cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
              |||||||||||||| ||| ||   ||| |  || || |||||||| ||||||||||| ||
Sbjct: 142988 cacgccgccggtggccggggcgctcttgcgggcggctttggtggccagctgcttgcgcgg 142929

                                                               
Query: 469    cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
               |||||||||||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 142928 ggccttgccgccggtggacttgc-gagcggtctgcttagtacgagccat 142881



 Score =  345 bits (174), Expect = 9e-92
 Identities = 355/413 (85%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                          
Query: 105    ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
              |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 126435 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 126376

                                                                          
Query: 165    gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
               ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 126375 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 126316

                                                                          
Query: 225    ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
                  |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 126315 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 126256

                                                                          
Query: 285    ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
              |||||||||||| | |||||||||||||||||||||||||||||||||||| ||| ||  
Sbjct: 126255 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcg 126197

                                                                          
Query: 345    tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
               |||||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||
Sbjct: 126196 acttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggct 126137

                                                                          
Query: 405    tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
              |||||||||||||||||| ||| ||   ||| |  || || |||||||| ||||||||||
Sbjct: 126136 tcttcacgccgccggtggccggggcgctcttgcgggcggctttggtggctagctgcttgc 126077

                                                                   
Query: 465    ggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
              | || |||||||||||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 126076 gcggggccttgccgccggtggacttgc-gagcggtctgcttagtacgagccat 126025

---

>gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, complete cds
          Length = 1411

 Score =  371 bits (187), Expect = 2e-99
 Identities = 356/410 (86%), Gaps = 2/410 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 788

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 728

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||||||||||||||||||||||||||||||||| ||| ||   |||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgactt 669

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||||||
Sbjct: 668 ctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttctt 609

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||| ||   ||| |  || ||||||||||| ||||||||||| ||
Sbjct: 608 cacgccgccggtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcgg 549

                                                             
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
            |||||||||||||||||||||| | ||||||||||| ||||| ||||||
Sbjct: 548 ggccttgccgccggtggacttgc-gagcggtctgcttagtacgagccatg 500

---

>gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), complete cds
          Length = 1264

 Score =  371 bits (187), Expect = 2e-99
 Identities = 358/410 (87%), Gaps = 4/410 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || | ||||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 932 gccctctctcccctgatgcggcgcgcgagctgaatgtccttgggcatgatggtgacgcgc 873

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||| |||||||| || ||||| |||||||| |||||||| 
Sbjct: 872 ttggcgtggatggcgcagaggttagtgtcctcaaagagccccacaaggtaggcctcggcg 813

                                                                       
Query: 229 gcctcctggagggccagc-acggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
           |||||||| || || ||| ||||||  ||||||||| | ||| |||||||||||||||||
Sbjct: 812 gcctcctgcagcgc-agcgacggcggaggactggaagcggagatcggtcttgaagtcctg 754

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
           ||||||||| |  || ||||||||||| |||| ||||||||| |||||| ||||||||||
Sbjct: 753 cgcgatctcacggacgaggcgctggaagggcaacttgcggatgagcagc-tccgtgctct 695

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||||| || ||||| ||||| || ||||| ||||| | | ||||||| |||||||
Sbjct: 694 tctggtacttacgaatctcccggagcgcgacggtgccggggcggaagcggtggggcttct 635

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           ||||||||||||||| |||||| ||||| | |||||||||||| || |||||||||||||
Sbjct: 634 tcacgccgccggtggccggcgcagacttgcgcgccgccttggtcgccagctgcttgcggg 575

                                                             
Query: 468 gcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||||||| || ||||||| | || |||||||| || ||||||||
Sbjct: 574 gcgccttgccgcccgttgacttgc-gcgccgtctgcttcgtgcgggccat 526

---

>ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA
          Length = 411

 Score =  369 bits (186), Expect = 6e-99
 Identities = 355/409 (86%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 407 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||||||||||||||||||||||||||||||||| ||| ||   |||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgactt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||||||
Sbjct: 168 ctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||| ||   ||| |  || ||||||||||| ||||||||||| ||
Sbjct: 108 cacgccgccggtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcgg 49

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            |||||||||||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 48  ggccttgccgccggtggacttgc-gagcggtctgcttagtacgagccat 1

---

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  369 bits (186), Expect = 6e-99
 Identities = 355/409 (86%), Gaps = 2/409 (0%)
 Strand = Plus / Plus

                                                                        
Query: 109  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
            |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3348 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 3407

                                                                        
Query: 169  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 3408 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 3467

                                                                        
Query: 229  gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
            |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 3468 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 3527

                                                                        
Query: 289  gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
            |||||||||| ||||||||||||||| |||||||||||||||||||| |||||||  |||
Sbjct: 3528 gcgatctcccgcaccaggcgctggaagggcagcttgcggatcagcag-ctccgtggactt 3586

                                                                        
Query: 349  ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
            ||||||    ||||||||||| || ||||| || ||||||| ||||||||| ||||||||
Sbjct: 3587 ctggtagcgccggatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttctt 3646

                                                                        
Query: 409  cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            ||||||||| |||| ||||||   ||| |  ||||||||||| |||||||||||||||||
Sbjct: 3647 cacgccgcccgtggccggcgcgctcttgcgggccgccttggtcgcgagctgcttgcgggg 3706

                                                             
Query: 469  cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            |||||| ||||| || ||||| | | || |||||||| ||||| |||||
Sbjct: 3707 cgccttcccgcccgtcgacttac-gcgccgtctgcttcgtacgcgccat 3754

---

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4
           (ch4-III), histone H2B (ch2b-III) and histone H2A
           (ch2a-III) genes, complete cds
          Length = 4582

 Score =  369 bits (186), Expect = 6e-99
 Identities = 353/404 (87%), Gaps = 5/404 (1%)
 Strand = Plus / Plus

                                                                       
Query: 114 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
           ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 473 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 532

                                                                       
Query: 174 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
           ||||||||||||||||||||||||||||||||| || || ||||| ||||| || |||||
Sbjct: 533 gtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcagcggcctc 592

                                                                       
Query: 234 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
           ||| || ||||||||||| |||  |||||| |  |||||||||||||||||||| || ||
Sbjct: 593 ctgcagcgccagcacggcctggctctggaagcgcaggtcggtcttgaagtcctgggcaat 652

                                                                       
Query: 294 ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
           ||| |  ||||||||||||||||||||||||||||| ||||| ||| ||   ||||||||
Sbjct: 653 ctcacggaccaggcgctggaacggcagcttgcggatgagcag-ctcagtcgacttctggt 711

                                                                       
Query: 354 acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
           ||||||||||||| || || |||||||| ||||| | |||||| ||||||||||||||||
Sbjct: 712 acttgcggatctcacgcagcgccacggtaccggggcggtagcgatgaggcttcttcacgc 771

                                                                       
Query: 414 cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
           |||| |||| ||| |  | ||| |  || ||||| ||||| |||||||||||||||||||
Sbjct: 772 cgcccgtgg-cgggg--gtcttacgagcggccttagtggccagctgcttgcggggcgcct 828

                                                       
Query: 474 tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||| ||||||||||||| | |||||||||||||| ||||||||
Sbjct: 829 tgccaccggtggacttgc-gagcggtctgcttggtgcgggccat 871

---

>ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618987), partial mRNA
          Length = 521

 Score =  363 bits (183), Expect = 4e-97
 Identities = 356/410 (86%), Gaps = 3/410 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 410 gccctctctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 351

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||| ||||||||||||||||| || || || || ||||| ||||||   
Sbjct: 350 ttggcgtggatggcacacaggttggtgtcctc-aagagtcccaccaggtaggcctcgcac 292

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 291 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 232

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||| ||||||||||||||||||||||||||||| |||||||  |||
Sbjct: 231 gcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcag-ctccgtggactt 173

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   |||||||||||| |||||||| || ||||| | ||||||||||||||||||
Sbjct: 172 ctggtagcggcggatctcgcgcagggccaccgtgccggggcggtagcggtgaggcttctt 113

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||| ||
Sbjct: 112 cacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgcgtgg 53

                                                             
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
           ||| ||||||||||||||||||| | ||||||||||| || || ||||||
Sbjct: 52  cgctttgccgccggtggacttgc-gagcggtctgcttagtgcgagccatg 4

---

>ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC613840), partial mRNA
          Length = 547

 Score =  363 bits (183), Expect = 4e-97
 Identities = 356/410 (86%), Gaps = 3/410 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 436 gccctctctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 377

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||| ||||||||||||||||| || || || || ||||| ||||||   
Sbjct: 376 ttggcgtggatggcacacaggttggtgtcctc-aagagtcccaccaggtaggcctcgcac 318

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 317 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 258

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||| ||||||||||||||||||||||||||||| |||||||  |||
Sbjct: 257 gcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcag-ctccgtggactt 199

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   |||||||||||| |||||||| || ||||| | ||||||||||||||||||
Sbjct: 198 ctggtagcggcggatctcgcgcagggccaccgtgccggggcggtagcggtgaggcttctt 139

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||| ||
Sbjct: 138 cacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgcgtgg 79

                                                             
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
           ||| ||||||||||||||||||| | ||||||||||| || || ||||||
Sbjct: 78  cgctttgccgccggtggacttgc-gagcggtctgcttagtgcgagccatg 30

---

>ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA
          Length = 480

 Score =  361 bits (182), Expect = 2e-96
 Identities = 354/409 (86%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 431 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 372

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 371 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 312

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 311 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 252

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||||||||||||||||||||||||||||||||| ||| ||   |||
Sbjct: 251 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgactt 193

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||||||
Sbjct: 192 ctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttctt 133

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||| ||   ||| |  || ||||||||||| ||||||||||| ||
Sbjct: 132 cacgccgccggtggccggggcgctcttgcgggcagccttggtggccagctgcttgcgcgg 73

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            |||||||||||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 72  ggccttgccgccggtggacttgc-gagcggtctgcttagtacgagccat 25

---

>ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC617888), mRNA
          Length = 714

 Score =  361 bits (182), Expect = 2e-96
 Identities = 345/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 710 gccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 651

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||| |||||||||||||||||||| || || || ||||| ||||||   
Sbjct: 650 ttggcgtggatggcacacaggttggtgtcctcgaagagtcccaccaggtaggcctcgcac 591

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 590 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 531

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||| ||||||||||||||||||||||||||||| |||||||  |||
Sbjct: 530 gcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcag-ctccgtggactt 472

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   |||||||||||| || || || || ||||| | ||||||||| ||||||||
Sbjct: 471 ctggtagcggcggatctcgcgcagagctaccgtgccggggcggtagcggtgcggcttctt 412

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||| ||
Sbjct: 411 cacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgcgtgg 352

                                                
Query: 469 cgccttgccgccggtggacttgcggngcggtctgctt 505
           ||||||||||||||||||||||| | |||||||||||
Sbjct: 351 cgccttgccgccggtggacttgc-gagcggtctgctt 316

---

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score =  361 bits (182), Expect = 2e-96
 Identities = 354/409 (86%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                        
Query: 109  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
            |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2267 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2208

                                                                        
Query: 169  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 2207 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 2148

                                                                        
Query: 229  gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
            |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 2147 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 2088

                                                                        
Query: 289  gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
            |||||||| | ||||||||||||||| |||||||||||||||||||| |||||||  |||
Sbjct: 2087 gcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag-ctccgtggactt 2029

                                                                        
Query: 349  ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
            ||||||    ||||||||||| || ||||| || ||||||| ||||||||| ||||||||
Sbjct: 2028 ctggtagcgccggatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttctt 1969

                                                                        
Query: 409  cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            ||||||||| |||| ||||||   ||| |  |||||||||||||| ||||||||||||||
Sbjct: 1968 cacgccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttgcgggg 1909

                                                             
Query: 469  cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            |||||| ||||| || ||||| | | || |||||||| ||||| |||||
Sbjct: 1908 cgccttcccgcccgtcgacttac-gcgccgtctgcttcgtacgcgccat 1861

---

>ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488277), mRNA
          Length = 411

 Score =  361 bits (182), Expect = 2e-96
 Identities = 357/413 (86%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||| 
Sbjct: 231 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctccgtgg 173

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    ||||||||||| |||||||| || ||||||| ||||||||| ||||
Sbjct: 172 acttctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggct 113

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||| ||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||
Sbjct: 112 tcttgacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgc 53

                                                                
Query: 465 ggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | || ||||||||||| || ||||||| | || |||||||| ||||| |||||
Sbjct: 52  gcggggccttgccgcccgtcgacttgc-gcgccgtctgcttcgtacgagccat 1

---

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score =  361 bits (182), Expect = 2e-96
 Identities = 354/409 (86%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                        
Query: 109  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
            |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 3041 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 2982

                                                                        
Query: 169  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
            |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 2981 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 2922

                                                                        
Query: 229  gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
            |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 2921 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 2862

                                                                        
Query: 289  gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
            |||||||| | |||||||||||||||||||||||||||||||||||| ||| ||   |||
Sbjct: 2861 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgactt 2803

                                                                        
Query: 349  ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
            ||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||||||
Sbjct: 2802 ctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttctt 2743

                                                                        
Query: 409  cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            |||||||||||||| ||| ||   ||| |  || ||||||||||| ||||||||||| ||
Sbjct: 2742 cacgccgccggtggccggggcgctcttgcgggcagccttggtggccagctgcttgcgcgg 2683

                                                             
Query: 469  cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
             |||||||||||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 2682 ggccttgccgccggtggacttgc-gagcggtctgcttagtacgagccat 2635

---

>ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC427890), mRNA
          Length = 600

 Score =  359 bits (181), Expect = 6e-96
 Identities = 347/400 (86%), Gaps = 2/400 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 525

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 524 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 465

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 464 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 405

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 404 accaggcgctggaagggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 346

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 345 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 286

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 285 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 226

                                                   
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccatggc 520
            || ||||| | | || |||||||| ||||| ||||||||
Sbjct: 225 cgtcgacttac-gcgccgtctgcttcgtacgcgccatggc 187

---

>gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds
          Length = 1271

 Score =  359 bits (181), Expect = 6e-96
 Identities = 347/400 (86%), Gaps = 2/400 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 679 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 620

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 619 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 560

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 559 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 500

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 499 accaggcgctggaagggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 441

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 440 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 381

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 380 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 321

                                                   
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccatggc 520
            || ||||| | | || |||||||| ||||| ||||||||
Sbjct: 320 cgtcgacttac-gcgccgtctgcttcgtacgcgccatggc 282

---

>ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611519), mRNA
          Length = 471

 Score =  357 bits (180), Expect = 2e-95
 Identities = 337/388 (86%), Gaps = 1/388 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 471 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 412

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 411 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 352

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 351 gcacgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 292

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||| 
Sbjct: 291 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctccgtgg 233

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    ||||||||||| |||||||| || ||||||| ||||||||| ||||
Sbjct: 232 acttctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggct 173

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||| ||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||
Sbjct: 172 tcttgacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgc 113

                                       
Query: 465 ggggcgccttgccgccggtggacttgcg 492
           | || ||||||||||| || ||||||||
Sbjct: 112 gcggggccttgccgcccgtcgacttgcg 85

---

>ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488275), mRNA
          Length = 459

 Score =  357 bits (180), Expect = 2e-95
 Identities = 337/388 (86%), Gaps = 1/388 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 459 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 400

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 399 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 340

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 339 gcacgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 280

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||| 
Sbjct: 279 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctccgtgg 221

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    ||||||||||| |||||||| || ||||||| ||||||||| ||||
Sbjct: 220 acttctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggct 161

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||| ||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||
Sbjct: 160 tcttgacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgc 101

                                       
Query: 465 ggggcgccttgccgccggtggacttgcg 492
           | || ||||||||||| || ||||||||
Sbjct: 100 gcggggccttgccgcccgtcgacttgcg 73

---

>ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488307), mRNA
          Length = 411

 Score =  357 bits (180), Expect = 2e-95
 Identities = 337/388 (86%), Gaps = 1/388 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||| 
Sbjct: 231 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctccgtgg 173

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    ||||||||||| |||||||| || ||||||| ||||||||| ||||
Sbjct: 172 acttctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggct 113

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||| ||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||
Sbjct: 112 tcttgacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgc 53

                                       
Query: 465 ggggcgccttgccgccggtggacttgcg 492
           | || ||||||||||| || ||||||||
Sbjct: 52  gcggggccttgccgcccgtcgacttgcg 25

---

>ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488263), mRNA
          Length = 411

 Score =  357 bits (180), Expect = 2e-95
 Identities = 337/388 (86%), Gaps = 1/388 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||| 
Sbjct: 231 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctccgtgg 173

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    ||||||||||| |||||||| || ||||||| ||||||||| ||||
Sbjct: 172 acttctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggct 113

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||| ||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||
Sbjct: 112 tcttgacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgc 53

                                       
Query: 465 ggggcgccttgccgccggtggacttgcg 492
           | || ||||||||||| || ||||||||
Sbjct: 52  gcggggccttgccgcccgtcgacttgcg 25

---

>gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence
          Length = 716

 Score =  353 bits (178), Expect = 4e-94
 Identities = 353/409 (86%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 467 gccctctctcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 408

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||||||| | |||||||| || ||||| || ||||| |||||||| 
Sbjct: 407 ttggcgtggatggcgcacagggtagtgtcctcaaagagccccacgaggtaggcctcggcg 348

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||    ||||||  ||||||||| | ||| |||||||||||| |||||
Sbjct: 347 gcctcctgcagcgcagagacggcggaggactggaagcggagatcggtcttgaagccctgc 288

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| |  || ||||||||||| |||| ||||||||| ||||| ||||||||||||
Sbjct: 287 gcgatctcacggacgaggcgctggaagggcaacttgcggatgagcag-ctccgtgctctt 229

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           |||| |||| || ||||| ||||| |||||||| ||||| | | ||||||| ||||||||
Sbjct: 228 ctgggacttacgaatctcccggagcgccacggtgccggggcggaagcggtggggcttctt 169

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| |||||| ||||| | |||||||| ||| || ||||||||||||||
Sbjct: 168 cacgccgccggtggccggcgcagacttgcgcgccgcctaggtcgccagctgcttgcgggg 109

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||| || ||||||| | || |||||||| || ||||||||
Sbjct: 108 cgccttgccgcccgttgacttgc-gcgccgtctgcttcgtgcgggccat 61

---

>ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417958),
           mRNA
          Length = 1512

 Score =  353 bits (178), Expect = 4e-94
 Identities = 344/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Plus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 643

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 644 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 703

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 704 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 763

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 764 accaggcgctggaagggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 822

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 823 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 882

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 883 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 942

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| | | || |||||||| ||||| |||||
Sbjct: 943 cgtcgacttac-gcgccgtctgcttcgtacgcgccat 978

---

>ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417949),
           mRNA
          Length = 752

 Score =  353 bits (178), Expect = 4e-94
 Identities = 344/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Plus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 388

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 389 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 448

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 449 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 508

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 509 accaggcgctggaagggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 567

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 568 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 627

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 628 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 687

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| | | || |||||||| ||||| |||||
Sbjct: 688 cgtcgacttac-gcgccgtctgcttcgtacgcgccat 723

---

>emb|X80326.1|MPMPH312 M.pahari mpH312 gene
          Length = 580

 Score =  353 bits (178), Expect = 4e-94
 Identities = 353/409 (86%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 452 gccctctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 393

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 392 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 333

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 332 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 273

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||| ||||||||||||||||||||||||||||| ||| ||   |||
Sbjct: 272 gcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcag-ctcggtcgactt 214

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| || |||||||| ||||| | ||||||||| ||||||||
Sbjct: 213 ctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtggggcttctt 154

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           ||||||||| |||| ||| ||   ||| |  || ||||||||||| ||||||||||| ||
Sbjct: 153 cacgccgcccgtggccggggcgctcttacgggcggccttggtggccagctgcttgcgcgg 94

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            |||||||||||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 93  agccttgccgccggtggacttgc-gagcggtctgctttgtacgagccat 46

---

>emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15
          Length = 578

 Score =  353 bits (178), Expect = 4e-94
 Identities = 344/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Plus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 207

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 208 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 267

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 268 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 327

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 328 accaggcgctggaagggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 386

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 387 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 446

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 447 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 506

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| | | || |||||||| ||||| |||||
Sbjct: 507 cgtcgacttac-gcgccgtctgcttcgtacgcgccat 542

---

>gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, complete cds
          Length = 1408

 Score =  353 bits (178), Expect = 4e-94
 Identities = 353/409 (86%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 788

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 728

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||||||||||||||||||||||||||||||||| ||| ||   |||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgactt 669

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||||||
Sbjct: 668 ctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttctt 609

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||| ||   ||| |  || || |||||||| ||||||||||| ||
Sbjct: 608 cacgccgccggtggccggggcgctcttgcgggcggctttggtggccagctgcttgcgcgg 549

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            |||||||||||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 548 ggccttgccgccggtggacttgc-gagcggtctgcttagtacgagccat 501

---

>emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV
          Length = 1094

 Score =  353 bits (178), Expect = 4e-94
 Identities = 344/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 809 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 750

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 749 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 690

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 689 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcacgc 630

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 629 accaggcgctggaagggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 571

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 570 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 511

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 510 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 451

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| | | || |||||||| ||||| |||||
Sbjct: 450 cgtcgacttac-gcgccgtctgcttcgtacgcgccat 415

---

>gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complete cds
          Length = 1809

 Score =  353 bits (178), Expect = 4e-94
 Identities = 344/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 866 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 807

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 806 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 747

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 746 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 687

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 686 accaggcgctggaagggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 628

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 627 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 568

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 567 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 508

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| | | || |||||||| ||||| |||||
Sbjct: 507 cgtcgacttac-gcgccgtctgcttcgtacgcgccat 472

---

>gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds
          Length = 784

 Score =  353 bits (178), Expect = 4e-94
 Identities = 344/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 748 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 689

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 688 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 629

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 628 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 569

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 568 accaggcgctggaagggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 510

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 509 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 450

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 449 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 390

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| | | || |||||||| ||||| |||||
Sbjct: 389 cgtcgacttac-gcgccgtctgcttcgtacgcgccat 354

---

>ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 2,
           mRNA
          Length = 546

 Score =  351 bits (177), Expect = 2e-93
 Identities = 350/405 (86%), Gaps = 2/405 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 533 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 474

                                                                       
Query: 178 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 473 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 414

                                                                       
Query: 238 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 413 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 354

                                                                       
Query: 298 ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
           | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 353 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 295

                                                                       
Query: 358 gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
            |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 294 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 235

                                                                       
Query: 418 ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
            |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 234 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 175

                                                        
Query: 478 gccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |||||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 174 gccggtggacttgcgg-gcagtctgcttcgtacgggccatggcga 131

---

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score =  351 bits (177), Expect = 2e-93
 Identities = 350/405 (86%), Gaps = 2/405 (0%)
 Strand = Plus / Minus

                                                                        
Query: 118  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1671

                                                                        
Query: 178  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 1670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 1611

                                                                        
Query: 238  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 1610 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 1551

                                                                        
Query: 298  ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
            | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 1550 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 1492

                                                                        
Query: 358  gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
             |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 1491 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 1432

                                                                        
Query: 418  ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
             |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 1431 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 1372

                                                         
Query: 478  gccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
            |||||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 1371 gccggtggacttgcgg-gcagtctgcttcgtacgggccatggcga 1328

---

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score =  351 bits (177), Expect = 2e-93
 Identities = 350/405 (86%), Gaps = 2/405 (0%)
 Strand = Plus / Minus

                                                                        
Query: 118  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1671

                                                                        
Query: 178  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 1670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 1611

                                                                        
Query: 238  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 1610 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 1551

                                                                        
Query: 298  ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
            | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 1550 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 1492

                                                                        
Query: 358  gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
             |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 1491 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 1432

                                                                        
Query: 418  ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
             |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 1431 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 1372

                                                         
Query: 478  gccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
            |||||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 1371 gccggtggacttgcgg-gcagtctgcttcgtacgggccatggcga 1328

---

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score =  351 bits (177), Expect = 2e-93
 Identities = 350/405 (86%), Gaps = 2/405 (0%)
 Strand = Plus / Minus

                                                                        
Query: 118  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 2713 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 2654

                                                                        
Query: 178  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 2653 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 2594

                                                                        
Query: 238  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 2593 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 2534

                                                                        
Query: 298  ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
            | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 2533 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 2475

                                                                        
Query: 358  gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
             |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 2474 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 2415

                                                                        
Query: 418  ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
             |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 2414 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 2355

                                                         
Query: 478  gccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
            |||||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 2354 gccggtggacttgcgg-gcagtctgcttcgtacgggccatggcga 2311

---

>gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MGC:102454
           IMAGE:5099464), complete cds
          Length = 1831

 Score =  351 bits (177), Expect = 2e-93
 Identities = 350/405 (86%), Gaps = 2/405 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 599 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 540

                                                                       
Query: 178 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 539 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 480

                                                                       
Query: 238 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 479 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 420

                                                                       
Query: 298 ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
           | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 419 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 361

                                                                       
Query: 358 gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
            |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 360 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 301

                                                                       
Query: 418 ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
            |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 300 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 241

                                                        
Query: 478 gccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |||||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 240 gccggtggacttgcgg-gcagtctgcttcgtacgggccatggcga 197

---

>gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, complete cds
          Length = 1675

 Score =  351 bits (177), Expect = 2e-93
 Identities = 350/405 (86%), Gaps = 2/405 (0%)
 Strand = Plus / Minus

                                                                        
Query: 118  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1084 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1025

                                                                        
Query: 178  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 1024 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 965

                                                                        
Query: 238  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 964  agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 905

                                                                        
Query: 298  ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
            | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 904  cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 846

                                                                        
Query: 358  gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
             |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 845  ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 786

                                                                        
Query: 418  ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
             |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 785  cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 726

                                                         
Query: 478  gccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
            |||||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 725  gccggtggacttgcgg-gcagtctgcttcgtacgggccatggcga 682

---

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  351 bits (177), Expect = 2e-93
 Identities = 350/405 (86%), Gaps = 2/405 (0%)
 Strand = Plus / Minus

                                                                         
Query: 118   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 71922 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 71863

                                                                         
Query: 178   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
             |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 71862 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 71803

                                                                         
Query: 238   agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
             || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 71802 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 71743

                                                                         
Query: 298   ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
             | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 71742 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 71684

                                                                         
Query: 358   gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
              |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 71683 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 71624

                                                                         
Query: 418   ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
              |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 71623 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 71564

                                                          
Query: 478   gccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
             |||||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 71563 gccggtggacttgcgg-gcagtctgcttcgtacgggccatggcga 71520



 Score =  351 bits (177), Expect = 2e-93
 Identities = 350/405 (86%), Gaps = 2/405 (0%)
 Strand = Plus / Plus

                                                                         
Query: 118   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 63183 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 63242

                                                                         
Query: 178   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
             |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 63243 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 63302

                                                                         
Query: 238   agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
             || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 63303 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 63362

                                                                         
Query: 298   ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
             | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 63363 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 63421

                                                                         
Query: 358   gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
              |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 63422 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 63481

                                                                         
Query: 418   ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
              |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 63482 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 63541

                                                          
Query: 478   gccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
             |||||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 63542 gccggtggacttgcgg-gcagtctgcttcgtacgggccatggcga 63585



 Score =  349 bits (176), Expect = 6e-93
 Identities = 346/400 (86%), Gaps = 2/400 (0%)
 Strand = Plus / Minus

                                                                         
Query: 118   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 93730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 93671

                                                                         
Query: 178   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
             |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 93670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 93611

                                                                         
Query: 238   agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
             || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 93610 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 93551

                                                                         
Query: 298   ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
             | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 93550 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 93492

                                                                         
Query: 358   gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
              |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 93491 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 93432

                                                                         
Query: 418   ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
              |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 93431 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 93372

                                                     
Query: 478   gccggtggacttgcggngcggtctgcttggtacgggccat 517
             |||||||||||||||| ||||||||||| |||||||||||
Sbjct: 93371 gccggtggacttgcgg-gcggtctgcttcgtacgggccat 93333

---

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  351 bits (177), Expect = 2e-93
 Identities = 350/405 (86%), Gaps = 2/405 (0%)
 Strand = Plus / Minus

                                                                         
Query: 118   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 37510 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 37451

                                                                         
Query: 178   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
             |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 37450 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 37391

                                                                         
Query: 238   agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
             || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 37390 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 37331

                                                                         
Query: 298   ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
             | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 37330 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 37272

                                                                         
Query: 358   gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
              |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 37271 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 37212

                                                                         
Query: 418   ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
              |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 37211 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 37152

                                                          
Query: 478   gccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
             |||||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 37151 gccggtggacttgcgg-gcagtctgcttcgtacgggccatggcga 37108



 Score =  351 bits (177), Expect = 2e-93
 Identities = 350/405 (86%), Gaps = 2/405 (0%)
 Strand = Plus / Plus

                                                                         
Query: 118   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 28771 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 28830

                                                                         
Query: 178   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
             |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 28831 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 28890

                                                                         
Query: 238   agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
             || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 28891 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 28950

                                                                         
Query: 298   ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
             | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 28951 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 29009

                                                                         
Query: 358   gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
              |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 29010 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 29069

                                                                         
Query: 418   ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
              |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 29070 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 29129

                                                          
Query: 478   gccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
             |||||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 29130 gccggtggacttgcgg-gcagtctgcttcgtacgggccatggcga 29173



 Score =  349 bits (176), Expect = 6e-93
 Identities = 346/400 (86%), Gaps = 2/400 (0%)
 Strand = Plus / Plus

                                                                        
Query: 118  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 6963 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 7022

                                                                        
Query: 178  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 7023 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 7082

                                                                        
Query: 238  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 7083 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 7142

                                                                        
Query: 298  ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
            | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 7143 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 7201

                                                                        
Query: 358  gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
             |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 7202 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 7261

                                                                        
Query: 418  ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
             |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 7262 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 7321

                                                    
Query: 478  gccggtggacttgcggngcggtctgcttggtacgggccat 517
            |||||||||||||||| ||||||||||| |||||||||||
Sbjct: 7322 gccggtggacttgcgg-gcggtctgcttcgtacgggccat 7360

---

>gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds
          Length = 1110

 Score =  351 bits (177), Expect = 2e-93
 Identities = 350/405 (86%), Gaps = 2/405 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 737 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 678

                                                                       
Query: 178 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 677 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 618

                                                                       
Query: 238 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 617 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 558

                                                                       
Query: 298 ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
           | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 557 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 499

                                                                       
Query: 358 gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
            |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 498 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 439

                                                                       
Query: 418 ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
            |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 438 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 379

                                                        
Query: 478 gccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |||||||||||||||| || |||||||| ||||||||||||||||
Sbjct: 378 gccggtggacttgcgg-gcagtctgcttcgtacgggccatggcga 335

---

>ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488298), mRNA
          Length = 411

 Score =  349 bits (176), Expect = 6e-93
 Identities = 333/384 (86%), Gaps = 1/384 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||||||||||||||||||||||||||||||||| |||||||  |||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctccgtggactt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| |||||||| || ||||||| ||||||||| ||||||||
Sbjct: 168 ctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggcttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            ||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||| ||
Sbjct: 108 gacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgcgcgg 49

                                   
Query: 469 cgccttgccgccggtggacttgcg 492
            ||||||||||| || ||||||||
Sbjct: 48  ggccttgccgcccgtcgacttgcg 25

---

>ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611138), mRNA
          Length = 411

 Score =  349 bits (176), Expect = 6e-93
 Identities = 333/384 (86%), Gaps = 1/384 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||||||||||||||||||||||||||||||||| |||||||  |||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctccgtggactt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| |||||||| || ||||||| ||||||||| ||||||||
Sbjct: 168 ctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggcttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            ||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||| ||
Sbjct: 108 gacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgcgcgg 49

                                   
Query: 469 cgccttgccgccggtggacttgcg 492
            ||||||||||| || ||||||||
Sbjct: 48  ggccttgccgcccgtcgacttgcg 25

---

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  349 bits (176), Expect = 6e-93
 Identities = 333/384 (86%), Gaps = 1/384 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||||||||||||||||||||||||||||||||| |||||||  |||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctccgtggactt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| |||||||| || ||||||| ||||||||| ||||||||
Sbjct: 168 ctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggcttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            ||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||| ||
Sbjct: 108 gacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgcgcgg 49

                                   
Query: 469 cgccttgccgccggtggacttgcg 492
            ||||||||||| || ||||||||
Sbjct: 48  ggccttgccgcccgtcgacttgcg 25

---

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  349 bits (176), Expect = 6e-93
 Identities = 333/384 (86%), Gaps = 1/384 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||||||||||||||||||||||||||||||||| |||||||  |||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctccgtggactt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| |||||||| || ||||||| ||||||||| ||||||||
Sbjct: 168 ctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggcttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            ||||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||| ||
Sbjct: 108 gacgccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgcgcgg 49

                                   
Query: 469 cgccttgccgccggtggacttgcg 492
            ||||||||||| || ||||||||
Sbjct: 48  ggccttgccgcccgtcgacttgcg 25

---

>dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
            enriched library, clone:6430517B15
            product:unclassifiable, full insert sequence
          Length = 3217

 Score =  349 bits (176), Expect = 6e-93
 Identities = 346/400 (86%), Gaps = 2/400 (0%)
 Strand = Plus / Plus

                                                                        
Query: 118  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1200 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1259

                                                                        
Query: 178  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 1260 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 1319

                                                                        
Query: 238  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 1320 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 1379

                                                                        
Query: 298  ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
            | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 1380 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 1438

                                                                        
Query: 358  gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
             |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 1439 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 1498

                                                                        
Query: 418  ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
             |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 1499 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 1558

                                                    
Query: 478  gccggtggacttgcggngcggtctgcttggtacgggccat 517
            |||||||||||||||| ||||||||||| |||||||||||
Sbjct: 1559 gccggtggacttgcgg-gcggtctgcttcgtacgggccat 1597

---

>ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudogene on chromosome 1
          Length = 1411

 Score =  349 bits (176), Expect = 6e-93
 Identities = 346/400 (86%), Gaps = 2/400 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                                       
Query: 178 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 779

                                                                       
Query: 238 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 778 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 719

                                                                       
Query: 298 ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
           | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 718 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 660

                                                                       
Query: 358 gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
            |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 659 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 600

                                                                       
Query: 418 ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
            |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 599 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 540

                                                   
Query: 478 gccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||||||| ||||||||||| |||||||||||
Sbjct: 539 gccggtggacttgcgg-gcggtctgcttcgtacgggccat 501

---

>gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, complete sequence
          Length = 1411

 Score =  349 bits (176), Expect = 6e-93
 Identities = 346/400 (86%), Gaps = 2/400 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                                       
Query: 178 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 779

                                                                       
Query: 238 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 778 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 719

                                                                       
Query: 298 ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
           | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 718 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 660

                                                                       
Query: 358 gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
            |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 659 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 600

                                                                       
Query: 418 ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
            |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 599 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 540

                                                   
Query: 478 gccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||||||| ||||||||||| |||||||||||
Sbjct: 539 gccggtggacttgcgg-gcggtctgcttcgtacgggccat 501

---

>gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, complete cds
          Length = 1411

 Score =  349 bits (176), Expect = 6e-93
 Identities = 346/400 (86%), Gaps = 2/400 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                                       
Query: 178 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 779

                                                                       
Query: 238 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 778 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 719

                                                                       
Query: 298 ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
           | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 718 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 660

                                                                       
Query: 358 gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
            |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 659 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 600

                                                                       
Query: 418 ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
            |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 599 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 540

                                                   
Query: 478 gccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||||||| ||||||||||| |||||||||||
Sbjct: 539 gccggtggacttgcgg-gcggtctgcttcgtacgggccat 501

---

>ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA
          Length = 411

 Score =  349 bits (176), Expect = 6e-93
 Identities = 346/400 (86%), Gaps = 2/400 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 398 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 339

                                                                       
Query: 178 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 338 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 279

                                                                       
Query: 238 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 278 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 219

                                                                       
Query: 298 ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
           | |||||||||||||||||||||||||||||||||||| ||| ||   |||||||||   
Sbjct: 218 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgacttctggtagcg 160

                                                                       
Query: 358 gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
            |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 159 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 100

                                                                       
Query: 418 ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
            |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 99  cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 40

                                                   
Query: 478 gccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||||||| ||||||||||| |||||||||||
Sbjct: 39  gccggtggacttgcgg-gcggtctgcttcgtacgggccat 1

---

>ref|NM_185609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 432

 Score =  345 bits (174), Expect = 9e-92
 Identities = 301/342 (88%), Gaps = 1/342 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 357

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           |||||||||||||||||||||||||||||||| |||||||||||||| |||||||| || 
Sbjct: 356 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 297

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 296 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 237

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           || ||||||||||| || ||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 236 acgaggcgctggaaggggagcttgcggatgagcag-ctccgtgctcttctggtacttgcg 178

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           |||||| ||||| || ||||| || |||||| ||||||| ||||||||||||||||||||
Sbjct: 177 gatctcacggagcgcgacggtgcctggcctgaagcggtgcggcttcttcacgccgccggt 118

                                                     
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgctt 462
           || ||| || ||||| | ||  |||||||| || ||||||||
Sbjct: 117 ggccggagctgacttgcacgttgccttggtcgccagctgctt 76

---

>gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence
          Length = 638

 Score =  345 bits (174), Expect = 9e-92
 Identities = 292/330 (88%), Gaps = 1/330 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 337 cggatgcggcgggcgagctgaatgtccttgggcatgatggtgacgcgcttggcgtggatg 278

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||| ||||||||||||||||| || ||||| ||||| ||||| || |||||||| || 
Sbjct: 277 gcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctccgcggcctcctgcagc 218

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||    ||||||  ||||||||| | |||||||||||||||||||||||||||||| |  
Sbjct: 217 gcggcgacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcgcgg 158

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| || ||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 157 accaggcgctggaaggggagcttgcggatgagcag-ctccgtgctcttctggtacttgcg 99

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           |||||||||||| |||||||| || || | | ||||||| ||||||||||||||||||||
Sbjct: 98  gatctcgcggagcgccacggtgcccgggcggaagcggtgcggcttcttcacgccgccggt 39

                                         
Query: 421 ggtcggcgccgacttcctcgccgccttggt 450
            | ||| |||||||| | ||| ||||||||
Sbjct: 38  tgccggggccgacttgcgcgctgccttggt 9

---

>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945),
           mRNA
          Length = 972

 Score =  345 bits (174), Expect = 9e-92
 Identities = 343/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Plus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 392 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 451

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 452 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 511

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 512 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 571

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| ||||| |||||||||||||| |||||||  |||||||||    ||
Sbjct: 572 accaggcgctggaagggcagtttgcggatcagcag-ctccgtggacttctggtagcgccg 630

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 631 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 690

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 691 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 750

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| | | || |||||||| ||||| |||||
Sbjct: 751 cgtcgacttac-gcgccgtctgcttcgtacgcgccat 786

---

>dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700049H14 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 514

 Score =  345 bits (174), Expect = 9e-92
 Identities = 355/413 (85%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 424 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 365

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 364 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 305

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
               |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 304 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 245

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||||||||||||||||||||||||||||||||| ||| ||  
Sbjct: 244 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcg 186

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||
Sbjct: 185 acttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggct 126

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||||||||||||||||| ||| ||   ||| |  || || |||||||| ||||||||||
Sbjct: 125 tcttcacgccgccggtggccggggcgctcttgcgggcggctttggtggctagctgcttgc 66

                                                                
Query: 465 ggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | || |||||||||||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 65  gcggggccttgccgccggtggacttgc-gagcggtctgcttagtacgagccat 14

---

>gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, complete cds
          Length = 1408

 Score =  345 bits (174), Expect = 9e-92
 Identities = 355/413 (85%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 911 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 852

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 851 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 792

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
               |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 791 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 732

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||||||||||||||||||||||||||||||||| ||| ||  
Sbjct: 731 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcg 673

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||
Sbjct: 672 acttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggct 613

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||||||||||||||||| ||| ||   ||| |  || || |||||||| ||||||||||
Sbjct: 612 tcttcacgccgccggtggccggggcgctcttgcgggcggctttggtggctagctgcttgc 553

                                                                
Query: 465 ggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | || |||||||||||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 552 gcggggccttgccgccggtggacttgc-gagcggtctgcttagtacgagccat 501

---

>emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V
          Length = 1107

 Score =  345 bits (174), Expect = 9e-92
 Identities = 343/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 809 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcatggatg 750

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 749 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 690

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 689 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 630

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 629 accaggcgctggaagggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 571

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 570 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 511

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 510 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 451

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| | | || |||||||| ||||| |||||
Sbjct: 450 cgtcgacttac-gcgccgtctgcttcgtacgcgccat 415

---

>gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete cds
          Length = 1204

 Score =  345 bits (174), Expect = 9e-92
 Identities = 343/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 883 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 824

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 823 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 764

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||| ||||||||||||||||| | |
Sbjct: 763 gccatgacggccgagctctggaagcgcaggtcggtcttaaagtcctgcgcgatctcgcgc 704

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 703 accaggcgctggaagggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 645

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 644 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 585

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 584 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 525

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| | | || |||||||| ||||| |||||
Sbjct: 524 cgtcgacttac-gcgccgtctgcttcgtacgcgccat 489

---

>emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12
          Length = 1920

 Score =  345 bits (174), Expect = 9e-92
 Identities = 301/342 (88%), Gaps = 1/342 (0%)
 Strand = Plus / Minus

                                                                        
Query: 121  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
            ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1515 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 1456

                                                                        
Query: 181  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
            |||||||||||||||||||||||||||||||| |||||||||||||| |||||||| || 
Sbjct: 1455 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 1396

                                                                        
Query: 241  gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
            ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 1395 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 1336

                                                                        
Query: 301  accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
            || ||||||||||| || ||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 1335 acgaggcgctggaaggggagcttgcggatgagcag-ctccgtgctcttctggtacttgcg 1277

                                                                        
Query: 361  gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
            |||||| ||||| || ||||| || |||||| ||||||| ||||||||||||||||||||
Sbjct: 1276 gatctcacggagcgcgacggtgcctggcctgaagcggtgcggcttcttcacgccgccggt 1217

                                                      
Query: 421  ggtcggcgccgacttcctcgccgccttggtggcgagctgctt 462
            || ||| || ||||| | ||  |||||||| || ||||||||
Sbjct: 1216 ggccggagctgacttgcacgttgccttggtcgccagctgctt 1175

---

>gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds
          Length = 1017

 Score =  345 bits (174), Expect = 9e-92
 Identities = 343/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 555 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgcatg 496

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 495 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 436

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 435 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 376

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           |||||||||||||| |||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 375 accaggcgctggaagggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 317

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 316 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 257

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| |||||||||||||||||||| |||||
Sbjct: 256 ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcggggcgccttcccgcc 197

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| | | || |||||||| ||||| |||||
Sbjct: 196 cgtcgacttac-gcgccgtctgcttcgtacgcgccat 161

---

>ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611167), mRNA
          Length = 504

 Score =  343 bits (173), Expect = 4e-91
 Identities = 330/381 (86%), Gaps = 1/381 (0%)
 Strand = Plus / Minus

                                                                       
Query: 112 ctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 171
           ||||| || ||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 497 ctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 438

                                                                       
Query: 172 gcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcc 231
           |||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   |||
Sbjct: 437 gcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcc 378

                                                                       
Query: 232 tcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcg 291
           ||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||||||
Sbjct: 377 tcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 318

                                                                       
Query: 292 atctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctg 351
           ||||| | |||||||||||||||||||||||||||||||||||| |||||||  ||||||
Sbjct: 317 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctccgtggacttctg 259

                                                                       
Query: 352 gtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcac 411
           |||    ||||||||||| |||||||| || ||||||| ||||||||| |||||||| ||
Sbjct: 258 gtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggcttcttgac 199

                                                                       
Query: 412 gccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgc 471
           ||||||||||| ||||||   ||| |  |||||||||||||| ||||||||||| || ||
Sbjct: 198 gccgccggtggccggcgcgctcttgcgggccgccttggtggccagctgcttgcgcggggc 139

                                
Query: 472 cttgccgccggtggacttgcg 492
           ||||||||| || ||||||||
Sbjct: 138 cttgccgcccgtcgacttgcg 118

---

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  343 bits (173), Expect = 4e-91
 Identities = 321/369 (86%), Gaps = 1/369 (0%)
 Strand = Plus / Minus

                                                                        
Query: 121  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3230 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3171

                                                                        
Query: 181  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
            ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 3170 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 3111

                                                                        
Query: 241  gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
            |||| ||||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 3110 gccatcacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 3051

                                                                        
Query: 301  accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
            ||||| |||||||| |||||||||||||||||||| ||||||   |||||||||   |||
Sbjct: 3050 accagccgctggaagggcagcttgcggatcagcag-ctccgtcgacttctggtagcggcg 2992

                                                                        
Query: 361  gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
            ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 2991 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 2932

                                                                        
Query: 421  ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
            || ||||||   ||| |  ||||| |||||||| |||||||||||||||||||| |||||
Sbjct: 2931 ggccggcgcgctcttgcgggccgctttggtggccagctgcttgcggggcgccttcccgcc 2872

                     
Query: 481  ggtggactt 489
             || |||||
Sbjct: 2871 cgtcgactt 2863



 Score =  343 bits (173), Expect = 4e-91
 Identities = 321/369 (86%), Gaps = 1/369 (0%)
 Strand = Plus / Plus

                                                                        
Query: 121  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1491 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 1550

                                                                        
Query: 181  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
            ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 1551 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 1610

                                                                        
Query: 241  gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
            |||| ||||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 1611 gccatcacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 1670

                                                                        
Query: 301  accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
            ||||| |||||||| |||||||||||||||||||| ||||||   |||||||||   |||
Sbjct: 1671 accagccgctggaagggcagcttgcggatcagcag-ctccgtcgacttctggtagcggcg 1729

                                                                        
Query: 361  gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
            ||||||||| || ||||| || ||||||| ||||||||| ||||||||||||||||| ||
Sbjct: 1730 gatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccgcccgt 1789

                                                                        
Query: 421  ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
            || ||||||   ||| |  ||||| |||||||| |||||||||||||||||||| |||||
Sbjct: 1790 ggccggcgcgctcttgcgggccgctttggtggccagctgcttgcggggcgccttcccgcc 1849

                     
Query: 481  ggtggactt 489
             || |||||
Sbjct: 1850 cgtcgactt 1858

---

>ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488306), mRNA
          Length = 411

 Score =  341 bits (172), Expect = 1e-90
 Identities = 323/372 (86%), Gaps = 1/372 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 335 gcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctcctgcagc 276

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 275 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 216

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           ||||||||||||||||||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 215 accaggcgctggaacggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 157

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| |||||||| || ||||||| ||||||||| |||||||| |||||||||||
Sbjct: 156 gatctcgcgcagggccaccgtgccgggccggtagcggtgcggcttcttgacgccgccggt 97

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| ||||||||||| || |||||||||||
Sbjct: 96  ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcgcggggccttgccgcc 37

                       
Query: 481 ggtggacttgcg 492
            || ||||||||
Sbjct: 36  cgtcgacttgcg 25

---

>gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and histone H2b-616
           (H2b-616) genes, complete cds
          Length = 2371

 Score =  341 bits (172), Expect = 1e-90
 Identities = 345/400 (86%), Gaps = 2/400 (0%)
 Strand = Plus / Minus

                                                                       
Query: 118 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 978 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 919

                                                                       
Query: 178 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 918 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 859

                                                                       
Query: 238 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 858 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 799

                                                                       
Query: 298 ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
           | |||||||||||||||||||||||||||||||||||| ||| ||    ||||||||   
Sbjct: 798 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgatttctggtagcg 740

                                                                       
Query: 358 gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
            |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 739 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 680

                                                                       
Query: 418 ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
            |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 679 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 620

                                                   
Query: 478 gccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||||||| ||||||||||| |||||||||||
Sbjct: 619 gccggtggacttgcgg-gcggtctgcttcgtacgggccat 581

---

>gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, complete cds
          Length = 1500

 Score =  341 bits (172), Expect = 1e-90
 Identities = 345/400 (86%), Gaps = 2/400 (0%)
 Strand = Plus / Plus

                                                                       
Query: 118 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 177
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 523 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 582

                                                                       
Query: 178 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 237
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 583 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 642

                                                                       
Query: 238 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 297
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 643 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 702

                                                                       
Query: 298 ctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtactt 357
           | |||||||||||||||||||||||||||||||||||| ||| ||    ||||||||   
Sbjct: 703 cgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgatttctggtagcg 761

                                                                       
Query: 358 gcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgcc 417
            |||||||| || || |||||||| ||||||| ||||||||| |||||||||||||||||
Sbjct: 762 ccggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccgcc 821

                                                                       
Query: 418 ggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgcc 477
            |||| ||| ||   ||| |  || ||||||||||| ||||||||||| || ||||||||
Sbjct: 822 cgtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcggggccttgcc 881

                                                   
Query: 478 gccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||||||| ||||||||||| |||||||||||
Sbjct: 882 gccggtggacttgcgg-gcggtctgcttcgtacgggccat 920

---

>gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds
          Length = 693

 Score =  339 bits (171), Expect = 6e-90
 Identities = 352/410 (85%), Gaps = 2/410 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 557 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 498

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 497 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 438

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 437 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 378

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||||||||||||||||||||||||||||||||| ||| ||   |||
Sbjct: 377 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgactt 319

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||||||
Sbjct: 318 ctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttctt 259

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||| ||   ||| |  || ||||||||||| |||||||| || ||
Sbjct: 258 cacgccgccggtggccggggcgctcttgcgggcggccttggtggccagctgcttacgcgg 199

                                                             
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
            |||||||| ||||||||||| | | ||||||||||| ||||| ||||||
Sbjct: 198 ggccttgccaccggtggacttac-gagcggtctgcttagtacgagccatg 150

---

>ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA
          Length = 1851

 Score =  337 bits (170), Expect = 2e-89
 Identities = 351/409 (85%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 927 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 868

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 867 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 808

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 807 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 748

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||||||||||||||||||||||||||||||||| ||| ||   |||
Sbjct: 747 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcgactt 689

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| || |||||||| ||||| | |||||||||||| |||||
Sbjct: 688 ctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggtttctt 629

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||| ||   ||| |  || ||||||||||| ||||||||||| ||
Sbjct: 628 cacgccgccggtggccggggcgctcttgcgggcggccttggtggccagctgcttgcgcgg 569

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            ||||||||||| |||||||||| | ||||||||||| ||||| |||||
Sbjct: 568 ggccttgccgccagtggacttgc-gagcggtctgcttagtacgagccat 521

---

>ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483172), mRNA
          Length = 525

 Score =  337 bits (170), Expect = 2e-89
 Identities = 346/402 (86%), Gaps = 2/402 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 450

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 449 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 390

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| | |
Sbjct: 389 gccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcgcgc 330

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           ||||| ||||||||||||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 329 accagccgctggaacggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 271

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| |||||||| || || |||| ||||||||| |||||||| |||||||| ||
Sbjct: 270 gatctcgcgcagggccaccgtgcccggccggtagcggtgcggcttcttgacgccgcccgt 211

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| ||||| ||||| || |||||||||||
Sbjct: 210 ggccggcgcgctcttgcgggccgccttggtggccagctgtttgcgcggggccttgccgcc 151

                                                     
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           ||| ||||||||| |||||||| || ||||| ||||||||||
Sbjct: 150 ggtcgacttgcgg-gcggtctgtttcgtacgagccatggcga 110

---

>ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483167), mRNA
          Length = 525

 Score =  337 bits (170), Expect = 2e-89
 Identities = 346/402 (86%), Gaps = 2/402 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 450

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 449 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 390

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| | |
Sbjct: 389 gccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcgcgc 330

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           ||||| ||||||||||||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 329 accagccgctggaacggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 271

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| |||||||| || || |||| ||||||||| |||||||| |||||||| ||
Sbjct: 270 gatctcgcgcagggccaccgtgcccggccggtagcggtgcggcttcttgacgccgcccgt 211

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| ||||| ||||| || |||||||||||
Sbjct: 210 ggccggcgcgctcttgcgggccgccttggtggccagctgtttgcgcggggccttgccgcc 151

                                                     
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           ||| ||||||||| |||||||| || ||||| ||||||||||
Sbjct: 150 ggtcgacttgcgg-gcggtctgtttcgtacgagccatggcga 110

---

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score =  337 bits (170), Expect = 2e-89
 Identities = 343/398 (86%), Gaps = 2/398 (0%)
 Strand = Plus / Plus

                                                                          
Query: 121    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
              |||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 102364 cggatgcggcgggccagctggatgtctttgggcatgatggtgacccgcttggcgtggatg 102423

                                                                          
Query: 181    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
              |||||||||||||||||||||||||| || || ||||| ||||||   | |||||| |||
Sbjct: 102424 gcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctcgctggactcctgcagg 102483

                                                                          
Query: 241    gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
              ||||  ||||||  |  |||||| |  ||||||||||||||||||||||||||||||| |
Sbjct: 102484 gccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcccgc 102543

                                                                          
Query: 301    accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
              || ||||||||||| |||||||||||||||||||| ||| |||  |||||||||   |||
Sbjct: 102544 acgaggcgctggaagggcagcttgcggatcagcag-ctcggtggacttctggtagcggcg 102602

                                                                          
Query: 361    gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
              |||||| |  ||||||||||| ||||||| ||| ||||| ||||||||||||||||||||
Sbjct: 102603 gatctccctcagggccacggtgccgggccggtaacggtgcggcttcttcacgccgccggt 102662

                                                                          
Query: 421    ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
              || ||| ||   ||| |  || |||||||||||||||||||| | |||||| ||||| ||
Sbjct: 102663 ggccggggcgctcttgcgggcggccttggtggcgagctgcttcctgggcgctttgcctcc 102722

                                                    
Query: 481    ggtggacttgcggngcggtctgcttggtacgggccatg 518
              ||||||||| ||| |||||||||||||| | |||||||
Sbjct: 102723 ggtggacttccgg-gcggtctgcttggttctggccatg 102759



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 373   ggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggtgg 422
             |||| |||| ||||||| ||||||| | ||| ||||||||||||||||||
Sbjct: 98525 ggccccggtgccgggccggtagcggcgcggcctcttcacgccgccggtgg 98476

---

>ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (predicted)
           (Hist1h4a_predicted), mRNA
          Length = 428

 Score =  337 bits (170), Expect = 2e-89
 Identities = 351/409 (85%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||| || |||
Sbjct: 408 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 349

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||| ||||||||||| ||||| || |||||||| ||||||   
Sbjct: 348 ttggcgtggatggcgcacagattggtgtcctcaaacagacccacaaggtaggcctcgctg 289

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| |||||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 288 gcctcctgaagggccatgaccgccgagctctggaagcgaaggtcggtcttgaagtcctgc 229

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           ||||| || | |||||||||||||||||||||||||||||||||||| ||| |||  |||
Sbjct: 228 gcgatttcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtggactt 170

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    ||||||||||| || || ||||| ||||| | ||||||||| ||||||||
Sbjct: 169 ctggtagcgccggatctcgcgcagagcaacggtgccgggacggtagcggtggggcttctt 110

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           |||||||||||||| ||| ||   ||| |  || ||||||||||||||||||||||| ||
Sbjct: 109 cacgccgccggtggccggggcgctcttgcgggcagccttggtggcgagctgcttgcgcgg 50

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||||||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 49  ggctttgccgccggtggacttgc-gagcggtctgcttagtacgagccat 2

---

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
           histone H2A genes, complete cds
          Length = 4358

 Score =  337 bits (170), Expect = 2e-89
 Identities = 349/404 (86%), Gaps = 5/404 (1%)
 Strand = Plus / Plus

                                                                       
Query: 114 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
           ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 275 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 334

                                                                       
Query: 174 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
           |  |||||||||||||||||||||||||||||| || || ||||| ||||| || |||||
Sbjct: 335 ggtgatggcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctcagcggcctc 394

                                                                       
Query: 234 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
           ||| || ||||  ||||| |||  |||||| |  |||||||||||||||||||| || ||
Sbjct: 395 ctgcagcgccacgacggcctggctctggaagcgcaggtcggtcttgaagtcctgggcaat 454

                                                                       
Query: 294 ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
           ||| |  ||||||||||||||||||||||||||||| ||||| ||| ||   ||||||||
Sbjct: 455 ctcacggaccaggcgctggaacggcagcttgcggatgagcag-ctcagtcgacttctggt 513

                                                                       
Query: 354 acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
           ||||||| ||||| || || |||||||| ||||| | |||||| |||||||||||||| |
Sbjct: 514 acttgcgaatctcacgcagcgccacggtaccggggcggtagcgatgaggcttcttcacac 573

                                                                       
Query: 414 cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
           ||||||||| ||| |  | ||| |  || ||||||||||| |||||||||||||||||||
Sbjct: 574 cgccggtgg-cgggg--gtcttacgagcggccttggtggccagctgcttgcggggcgcct 630

                                                       
Query: 474 tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||| ||||||||||||| | |||||||||||||| ||||||||
Sbjct: 631 tgccaccggtggacttgc-gagcggtctgcttggtgcgggccat 673

---

>ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618948), mRNA
          Length = 484

 Score =  335 bits (169), Expect = 9e-89
 Identities = 354/413 (85%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           |||||||||||||||||| || ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||| ||||||||||||||||||||||||||||| ||||||| 
Sbjct: 231 ctgcgcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcag-ctccgtgg 173

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||   ||||||||| |  |||||||| || ||||| | ||||||||| ||||
Sbjct: 172 acttctggtaacggcggatctctctcagggccaccgtgccggggcggtagcggtgcggct 113

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           ||||||| |||||||||| ||| ||   ||| |  |||||||||||||| |||||||| |
Sbjct: 112 tcttcacaccgccggtggccggggcgctcttgcgggccgccttggtggccagctgcttac 53

                                                                
Query: 465 ggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | |||||||| |||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 52  gcggcgccttaccgccggtggacttgcgg-gcagtctgcttagtacgagccat 1

---

>ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC521581), mRNA
          Length = 411

 Score =  335 bits (169), Expect = 9e-89
 Identities = 351/409 (85%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||| || ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||| ||||||||||||||||||||||||||||| |||||||  |||
Sbjct: 227 gcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcag-ctccgtggactt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   ||||||||| |  |||||||| || ||||| | ||||||||| ||||||||
Sbjct: 168 ctggtaacggcggatctctctcagggccaccgtgccggggcggtagcggtgcggcttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           ||| |||||||||| ||| ||   ||| |  |||||||||||||| |||||||| || ||
Sbjct: 108 cacaccgccggtggccggggcgctcttgcgggccgccttggtggccagctgcttacgcgg 49

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||| |||||||||||||||||| || |||||||| ||||| |||||
Sbjct: 48  cgccttaccgccggtggacttgcgg-gcagtctgcttagtacgagccat 1

---

>ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-PA (LOC608586), mRNA
          Length = 411

 Score =  335 bits (169), Expect = 9e-89
 Identities = 342/397 (86%), Gaps = 2/397 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 335 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 276

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| | |
Sbjct: 275 gccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcgcgc 216

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           ||||| ||||||||||||||||||||||||||||| |||||||  |||||||||    ||
Sbjct: 215 accagccgctggaacggcagcttgcggatcagcag-ctccgtggacttctggtagcgccg 157

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| |||||||| || || |||| ||||||||| |||||||| |||||||| ||
Sbjct: 156 gatctcgcgcagggccaccgtgcccggccggtagcggtgcggcttcttgacgccgcccgt 97

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
           || ||||||   ||| |  |||||||||||||| ||||||||||| || |||||||||||
Sbjct: 96  ggccggcgcgctcttgcgggccgccttggtggccagctgcttgcgcggggccttgccgcc 37

                                                
Query: 481 ggtggacttgcggngcggtctgcttggtacgggccat 517
           ||| ||||||||| |||||||| || ||||| |||||
Sbjct: 36  ggtcgacttgcgg-gcggtctgtttcgtacgagccat 1

---

>gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds
          Length = 372

 Score =  331 bits (167), Expect = 1e-87
 Identities = 319/367 (86%), Gaps = 2/367 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| 
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaag 309

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||||||||| ||||||   |||||||| || ||||  ||||||  |  |||||||
Sbjct: 308 aggccgacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaac 249

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           | |||||| ||||||||||||||||| ||||| | ||||||||||||||| |||||||||
Sbjct: 248 cggaggtccgtcttgaagtcctgcgctatctcgcgcaccaggcgctggaagggcagcttg 189

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| ||||| ||||||||||||||||||    ||||||||||| ||||| ||||| ||
Sbjct: 188 cggatgagcag-ctccgtgctcttctggtagcgacggatctcgcgcagggcgacggtgcc 130

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||||||||||||||| || ||||| || || ||||||| ||| ||   ||| | ||| ||
Sbjct: 129 gggcctgtagcggtggggtttcttgactcccccggtggccggggcgctcttgcgcgcggc 70

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           |||||| || ||||||||||||||||||||||| ||||||||||||||| || |||||||
Sbjct: 69  cttggtcgccagctgcttgcggggcgccttgcctccggtggacttgcgg-gccgtctgct 11

                  
Query: 505 tggtacg 511
           |||||||
Sbjct: 10  tggtacg 4

---

>ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA
          Length = 535

 Score =  329 bits (166), Expect = 6e-87
 Identities = 353/413 (85%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 445 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 386

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 385 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 326

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
               |||||||| |  ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 325 acaggcctcctgcaaagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 266

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||||||||||||||||||||||||||||||||| ||| ||  
Sbjct: 265 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcg 207

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||
Sbjct: 206 acttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggct 147

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||||||||||||||||| ||| ||   ||| |  || || |||||||| ||||||||||
Sbjct: 146 tcttcacgccgccggtggccggggcgctcttgcgggcggctttggtggctagctgcttgc 87

                                                                
Query: 465 ggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | || |||||||||||||||||||||| | ||||| ||||| ||||| |||||
Sbjct: 86  gcggggccttgccgccggtggacttgc-gagcggtttgcttagtacgagccat 35

---

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  329 bits (166), Expect = 6e-87
 Identities = 353/413 (85%), Gaps = 2/413 (0%)
 Strand = Plus / Plus

                                                                        
Query: 105  ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
            |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 2126 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 2185

                                                                        
Query: 165  gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
             ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 2186 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 2245

                                                                        
Query: 225  ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
                |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 2246 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 2305

                                                                        
Query: 285  ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
            |||||||||||| | |||||||||||||||||||||||||||||||||||| ||| ||  
Sbjct: 2306 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcg 2364

                                                                        
Query: 345  tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
             |||||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||
Sbjct: 2365 acttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggct 2424

                                                                        
Query: 405  tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
            |||||||||||||||||| ||| ||   ||| |  || |||||||| || |||||||| |
Sbjct: 2425 tcttcacgccgccggtggccggggcgctcttgcgggcggccttggtagccagctgcttac 2484

                                                                 
Query: 465  ggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            | || |||||||| ||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 2485 gcggggccttgccaccggtggacttgc-gagcggtctgcttagtacgagccat 2536

---

>emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene
          Length = 990

 Score =  329 bits (166), Expect = 6e-87
 Identities = 344/401 (85%), Gaps = 2/401 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 851 ttacgccctctccccgcggatgcggcgggccagctggatgtccttaggcatgatggtgac 792

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 791 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 732

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
               |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 731 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 672

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           ||| |||||||| | |||||||||||||||||||||||||||||||||||| ||| ||  
Sbjct: 671 ctgtgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcg 613

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    ||||||||||| || |||||||| ||||| | ||||||||| ||||
Sbjct: 612 acttctggtagcgtcggatctcgcgcagcgccacggtgccgggacggtagcggtggggct 553

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||||||||||||||||| ||| ||   ||| |  || ||||||||||| ||||||||||
Sbjct: 552 tcttcacgccgccggtggccggggcgctcttgcgggcggccttggtggccagctgcttgc 493

                                                    
Query: 465 ggggcgccttgccgccggtggacttgcggngcggtctgctt 505
           | || |||||||||||||||||||||| | |||||||||||
Sbjct: 492 gcggggccttgccgccggtggacttgc-gagcggtctgctt 453

---

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
           complete cds
          Length = 2321

 Score =  329 bits (166), Expect = 6e-87
 Identities = 353/413 (85%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 762 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 703

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 702 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 643

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
               |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 642 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 583

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||||||||||||||||||||||||||||||||| ||| ||  
Sbjct: 582 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcg 524

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||
Sbjct: 523 acttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggct 464

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||||||||||||||||| ||| ||   ||| |  || |||||||| || |||||||| |
Sbjct: 463 tcttcacgccgccggtggccggggcgctcttgcgggcggccttggtagccagctgcttac 404

                                                                
Query: 465 ggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | || |||||||| ||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 403 gcggggccttgccaccggtggacttgc-gagcggtctgcttagtacgagccat 352

---

>dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700111A06 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 535

 Score =  329 bits (166), Expect = 6e-87
 Identities = 353/413 (85%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 445 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 386

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 385 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 326

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
               |||||||| |  ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 325 acaggcctcctgcaaagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 266

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||||||||||||||||||||||||||||||||| ||| ||  
Sbjct: 265 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag-ctcggtcg 207

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    ||||||||||| || |||||||| ||||| | ||||||||||||||
Sbjct: 206 acttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggct 147

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||||||||||||||||| ||| ||   ||| |  || || |||||||| ||||||||||
Sbjct: 146 tcttcacgccgccggtggccggggcgctcttgcgggcggctttggtggctagctgcttgc 87

                                                                
Query: 465 ggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | || |||||||||||||||||||||| | ||||| ||||| ||||| |||||
Sbjct: 86  gcggggccttgccgccggtggacttgc-gagcggtttgcttagtacgagccat 35

---

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
           genes, complete cds
          Length = 1338

 Score =  329 bits (166), Expect = 6e-87
 Identities = 348/404 (86%), Gaps = 5/404 (1%)
 Strand = Plus / Plus

                                                                       
Query: 114 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
           ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 209 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 268

                                                                       
Query: 174 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
           |||||||||||||||||| |||||||||||||| || || ||||| ||||| || |||||
Sbjct: 269 gtggatggcgcacaggttcgtgtcctcgaacaggcccaccaggtaggcctcagcggcctc 328

                                                                       
Query: 234 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
           ||| || ||||||||||| |||  |||||| |  |||||||||||||||||||| || ||
Sbjct: 329 ctgcagcgccagcacggcctggctctggaagcgcaggtcggtcttgaagtcctgggcaat 388

                                                                       
Query: 294 ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
           ||| |  ||||||||||||||||||||||||||||| |  || ||| ||   ||||||||
Sbjct: 389 ctcacggaccaggcgctggaacggcagcttgcggatgacgag-ctcagtcgacttctggt 447

                                                                       
Query: 354 acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
           ||||||||||||| || || |||||||| ||||| | ||| || |||||||||||||| |
Sbjct: 448 acttgcggatctcacgcagcgccacggtaccggggcggtaccgatgaggcttcttcacac 507

                                                                       
Query: 414 cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
           ||||||| | ||| |  | ||| |  || ||||||||||| |||||||||||||||||||
Sbjct: 508 cgccggtcg-cgggg--gtcttacgagcggccttggtggccagctgcttgcggggcgcct 564

                                                       
Query: 474 tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||| || |||||||||| | |||||||||||||| ||||||||
Sbjct: 565 tgccaccagtggacttgc-gagcggtctgcttggtgcgggccat 607

---

>gb|AY749708.1| Baetis tricaudatus histone H3 (H3) gene, partial cds
          Length = 375

 Score =  327 bits (165), Expect = 2e-86
 Identities = 323/373 (86%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||| ||||| ||||||   |||||||| ||||||| ||||||   |  |||||| 
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatcacggccgagctctggaag 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  |||||||||||||||||||| |||||||| | |||||| |||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatctcacgcaccagacgctggaagggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| |||||| || ||||||||||||||    |||||||| || || |||||||| ||
Sbjct: 191 cggatgagcagc-tcggtgctcttctggtagcgacggatctcacgcagagccacggtgcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||||||||| || || |||||||| || ||||||||||  ||||||||||| |  || ||
Sbjct: 132 gggcctgtaacgatggggcttcttgactccgccggtggcgggcgccgacttgcgagcggc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           ||||||||| |||||||||||||| |||||||| ||||| ||||||||| ||||||||||
Sbjct: 72  cttggtggccagctgcttgcggggagccttgcctccggtcgacttgcgg-gcggtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds
          Length = 372

 Score =  323 bits (163), Expect = 3e-85
 Identities = 318/367 (86%), Gaps = 2/367 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 309

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||| ||||| ||||||   |||||||| || ||||  ||||||  |  |||||| 
Sbjct: 308 aggccgacgaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaag 249

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  ||||||||||||||||||||||||||||| | ||| ||||||||||| |||||||||
Sbjct: 248 cgcaggtcggtcttgaagtcctgcgcgatctcgcgcactaggcgctggaagggcagcttg 189

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| ||||| ||| ||||||||||||||   |||||| ||||||||||| || || ||
Sbjct: 188 cggatgagcag-ctcggtgctcttctggtagcggcggatttcgcggagggcgactgtgcc 130

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||||||||||||||| |||||||| |||||||||||||  |||||   ||| |  || ||
Sbjct: 129 gggcctgtagcggtggggcttcttgacgccgccggtggcgggcgcgctcttgcgagcggc 70

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           |||||||||||||||||| || |||||||| |||||||||||||||||| || |||||||
Sbjct: 69  cttggtggcgagctgctttcgcggcgcctttccgccggtggacttgcgg-gccgtctgct 11

                  
Query: 505 tggtacg 511
           |||||||
Sbjct: 10  tggtacg 4

---

>emb|X80325.1|MPMPH315 M.pahari mpH315 gene
          Length = 974

 Score =  323 bits (163), Expect = 3e-85
 Identities = 353/414 (85%), Gaps = 2/414 (0%)
 Strand = Plus / Minus

                                                                       
Query: 104 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
           |||| |||||||| || |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 593 cttaagccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtga 534

                                                                       
Query: 164 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
           | ||||||||||||||||||||||||||||||||||| ||||| || |||||||| ||||
Sbjct: 533 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcct 474

                                                                       
Query: 224 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
           |    |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||
Sbjct: 473 cacaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagt 414

                                                                       
Query: 284 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
           ||||||||||||| | ||| || ||||||||||||||||||||||||||||| ||| || 
Sbjct: 413 cctgcgcgatctcgcgcactagccgctggaacggcagcttgcggatcagcag-ctcggtc 355

                                                                       
Query: 344 ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
             |||||||||    ||||||||||| || |||||||| ||||| | ||||||||| |||
Sbjct: 354 gacttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtggggc 295

                                                                       
Query: 404 ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
           ||||||||||||||||||| ||| ||   ||| |  || ||||||||||| |||||||||
Sbjct: 294 ttcttcacgccgccggtggccggggcgctcttgcgggcggccttggtggccagctgcttg 235

                                                                 
Query: 464 cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           || || || ||||||||||||||||||| | ||||||||||| ||||| |||||
Sbjct: 234 cgcggagctttgccgccggtggacttgc-gagcggtctgcttagtacgagccat 182

---

>emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score =  319 bits (161), Expect = 5e-84
 Identities = 330/385 (85%), Gaps = 1/385 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || ||||||||||| || ||||||||||| ||||||||||||||||| | |
Sbjct: 644 gccctctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtgaccctc 585

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||||||||| || || ||||| ||||||   
Sbjct: 584 ttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcgctc 525

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| ||||||| ||| ||   |  |||||| |  ||||| |||||||||||||||
Sbjct: 524 gcctcctgcagggccatcacagccgagctctggaagcgcaggtccgtcttgaagtcctgc 465

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||||||||||||||||||||| |||||||||||||| ||||| |||||||  |||
Sbjct: 464 gcgatctccctcaccaggcgctggaagggcagcttgcggatgagcag-ctccgtggactt 406

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    |||||||| || |||||||| || ||||||| ||||||||||||||||||
Sbjct: 405 ctggtagcgccggatctcccgcagggccaccgtgccgggccggtagcggtgaggcttctt 346

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           ||||||||| |||| ||| ||   ||| | ||||||||||||||| |||||||| |||||
Sbjct: 345 cacgccgcccgtggccggggcgctcttgcgcgccgccttggtggccagctgcttccgggg 286

                                    
Query: 469 cgccttgccgccggtggacttgcgg 493
            || || || |||||||| ||||||
Sbjct: 285 agcttttccaccggtggatttgcgg 261

---

>gb|AY338619.1| Baetis sp. Eph11 histone 3 gene, partial cds
          Length = 345

 Score =  317 bits (160), Expect = 2e-83
 Identities = 299/344 (86%), Gaps = 1/344 (0%)
 Strand = Plus / Minus

                                                                       
Query: 150 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 209
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaagagacc 286

                                                                       
Query: 210 gacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgag 269
           ||| ||||| ||||||   |||||||| |||||||  |||||   |  |||||| |  ||
Sbjct: 285 gacgaggtaggcctcgctggcctcctgcagggccatgacggccgagctctggaagcgcag 226

                                                                       
Query: 270 gtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggat 329
           |||||||||||||||||||||||| || | |||||| |||||||| ||||||||||||||
Sbjct: 225 gtcggtcttgaagtcctgcgcgatttcacgcaccagacgctggaagggcagcttgcggat 166

                                                                       
Query: 330 cagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcc 389
           ||||||| || ||||||||||||||    ||||||||||||||||| || || ||||| |
Sbjct: 165 cagcagc-tcagtgctcttctggtagcgacggatctcgcggagggcgaccgtgccgggac 107

                                                                       
Query: 390 tgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgccttgg 449
            |||||| || |||||||| |||||||||||||  ||||||||||| |  || |||||||
Sbjct: 106 ggtagcgatggggcttcttgacgccgccggtggcgggcgccgacttgcgggcggccttgg 47

                                                       
Query: 450 tggcgagctgcttgcggggcgccttgccgccggtggacttgcgg 493
           |||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 46  tggcgagctgcttgcggggcgccttgcctccggtggacttgcgg 3

---

>ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC525511), mRNA
          Length = 448

 Score =  315 bits (159), Expect = 8e-83
 Identities = 346/406 (85%), Gaps = 2/406 (0%)
 Strand = Plus / Minus

                                                                       
Query: 112 ctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 171
           ||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 404 ctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttg 345

                                                                       
Query: 172 gcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcc 231
           ||||||||||| ||||||||||||||||| || ||||| || ||||| ||||||   |||
Sbjct: 344 gcgtggatggcacacaggttggtgtcctcaaagagccccaccaggtaggcctcgcacgcc 285

                                                                       
Query: 232 tcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcg 291
           ||||| || |||| ||| ||   |  |||||| |  | ||||||||||||||||||||| 
Sbjct: 284 tcctgcagcgccatcaccgcagagctctggaaacgcaagtcggtcttgaagtcctgcgca 225

                                                                       
Query: 292 atctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctg 351
           ||||| | |||||| ||||||||||||||||||||||||||||| |||||||  ||||||
Sbjct: 224 atctcgcgcaccagccgctggaacggcagcttgcggatcagcag-ctccgtggacttctg 166

                                                                       
Query: 352 gtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcac 411
           |||   |||||||||||| || || || || ||||| | ||||||||| |||||||||||
Sbjct: 165 gtagcggcggatctcgcgcagagctaccgtgccggggcggtagcggtgcggcttcttcac 106

                                                                       
Query: 412 gccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgc 471
           ||||||||||| ||||||   ||| |  |||||||| ||||| ||||||||||| |||||
Sbjct: 105 gccgccggtggccggcgcgctcttgcgggccgccttagtggccagctgcttgcgtggcgc 46

                                                         
Query: 472 cttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||| ||||||||||| | | || |||||||| ||||| |||||
Sbjct: 45  cttgccaccggtggactt-ccgagcagtctgcttagtacgagccat 1

---

>ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC540148), mRNA
          Length = 484

 Score =  311 bits (157), Expect = 1e-81
 Identities = 351/413 (84%), Gaps = 2/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           |||||||||||||||||| || ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           |||||||||||| | |||||| ||||||||||||||||||||||||||||| ||||||| 
Sbjct: 231 ctgcgcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcag-ctccgtgg 173

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||   ||||||||| |  |||||||| || || || | ||||||||| ||||
Sbjct: 172 acttctggtaacggcggatctctctcagggccaccgtgccagggcggtagcggtgcggct 113

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           ||||||||||||||||||  |||||   ||| |  ||||||||||| || ||||||||||
Sbjct: 112 tcttcacgccgccggtggctggcgcgctcttgcgggccgccttggtagccagctgcttgc 53

                                                                
Query: 465 ggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | || || || || ||||||||||||||| || |||||||| ||||| |||||
Sbjct: 52  gcggtgctttaccaccggtggacttgcgg-gctgtctgcttagtacgagccat 1

---

>ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC523214), mRNA
          Length = 1459

 Score =  311 bits (157), Expect = 1e-81
 Identities = 317/369 (85%), Gaps = 1/369 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 180
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 915 cggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 856

                                                                       
Query: 181 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 240
           || || ||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 855 gcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctcctgcagc 796

                                                                       
Query: 241 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 300
           |||| ||| ||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 795 gccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 736

                                                                       
Query: 301 accaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcg 360
           ||||| ||||||||||||||||||||||||||||| ||||||   |||||||||   |||
Sbjct: 735 accagccgctggaacggcagcttgcggatcagcag-ctccgtagacttctggtagcggcg 677

                                                                       
Query: 361 gatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggt 420
           ||||||||| || ||||| || || || | ||||||||| ||||||||||||||||||||
Sbjct: 676 gatctcgcgcagagccaccgtgcccgggcggtagcggtggggcttcttcacgccgccggt 617

                                                                       
Query: 421 ggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgcc 480
            | ||||||   ||| |  ||||||||||| || || |||||||| ||||||||||||||
Sbjct: 616 agccggcgcgctcttacgggccgccttggtagccagttgcttgcgcggcgccttgccgcc 557

                    
Query: 481 ggtggactt 489
           |||||||||
Sbjct: 556 ggtggactt 548

---

>gb|AY749737.1| Platybaetis probus histone H3 (H3) gene, partial cds
          Length = 376

 Score =  311 bits (157), Expect = 1e-81
 Identities = 321/373 (86%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaag 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||| ||||| ||||||   |||||||| ||||||| ||||||   |  |||||| 
Sbjct: 311 aggccgacgaggtaggcctcgctggcctcctgcagggccatcacggccgagctctggaag 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  |||||||||||||||||||| |||||||| | ||| || ||||||||||||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgagcgatctcacgcacgagccgctggaacggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| |||||| || ||||||||||||||    |||||||| || || ||||| || ||
Sbjct: 191 cggatgagcagc-tcggtgctcttctggtagcgacggatctcacgcagcgccaccgtgcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||| | |||||| || |||||||| |||||||||||||  ||||||||||| |  || ||
Sbjct: 132 ggggcggtagcgatggggcttcttgacgccgccggtggcgggcgccgacttgcgggcggc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           ||||||||| ||||||||||||||||||||||| ||||| ||||||||| || |||||||
Sbjct: 72  cttggtggccagctgcttgcggggcgccttgcctccggtcgacttgcgg-gccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC539875), mRNA
          Length = 411

 Score =  309 bits (156), Expect = 5e-81
 Identities = 349/411 (84%), Gaps = 2/411 (0%)
 Strand = Plus / Minus

                                                                       
Query: 107 acgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 166
           |||||||||| || ||||||||||| || |||||||||||||||||||||||||||||||
Sbjct: 409 acgccctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatggtgacgc 350

                                                                       
Query: 167 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcgg 226
           ||||||||||||||||||| || |||||||||||||| || || || ||||| |||||| 
Sbjct: 349 gcttggcgtggatggcgcagagattggtgtcctcgaagaggcccaccaggtaggcctcgc 290

                                                                       
Query: 227 cagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcct 286
             |||||||| || |||| ||| ||   |  ||| || |  |||||||||||||||||||
Sbjct: 289 acgcctcctgcagcgccatcaccgccgagctctgaaagcgcaggtcggtcttgaagtcct 230

                                                                       
Query: 287 gcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctc 346
           | |||||||| | |||||| |||||||||||||||||||| ||||| ||| || |||  |
Sbjct: 229 gagcgatctcgcgcaccagccgctggaacggcagcttgcgaatcagtagc-tcagtggac 171

                                                                       
Query: 347 ttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttc 406
           ||||||||   |||||||||||| || || || || |||||||  |||||||| ||||||
Sbjct: 170 ttctggtaacggcggatctcgcgcagagctaccgtgccgggccgatagcggtgcggcttc 111

                                                                       
Query: 407 ttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgg 466
           |||||||||||||||| ||||||   |||||  |||||||||||||||||||||||||| 
Sbjct: 110 ttcacgccgccggtggccggcgcgctcttccgagccgccttggtggcgagctgcttgcgc 51

                                                              
Query: 467 ggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||||| || |||||||| | | || |||||||||||||| |||||
Sbjct: 50  ggcgccttgccacccgtggactt-ccgagcagtctgcttggtacgagccat 1

---

>gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  309 bits (156), Expect = 5e-81
 Identities = 298/344 (86%), Gaps = 1/344 (0%)
 Strand = Plus / Minus

                                                                       
Query: 150 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 209
           |||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaagaggcc 295

                                                                       
Query: 210 gacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgag 269
           ||||||||| ||||||   |||||||| || ||||  ||||||  |  |||||||| |||
Sbjct: 294 gacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaaccggag 235

                                                                       
Query: 270 gtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggat 329
           ||| ||||||||||||||||| ||||| | ||||||||||||||| ||||||||||||||
Sbjct: 234 gtccgtcttgaagtcctgcgctatctcgcgcaccaggcgctggaagggcagcttgcggat 175

                                                                       
Query: 330 cagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcc 389
            ||||| ||||||||||||||||||    ||||||||||| ||||| ||||| |||||||
Sbjct: 174 gagcag-ctccgtgctcttctggtagcgacggatctcgcgcagggcgacggtgccgggcc 116

                                                                       
Query: 390 tgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgccttgg 449
           |||||||||| || ||||| || || ||||||| ||| ||   ||| | ||| |||||||
Sbjct: 115 tgtagcggtggggtttcttgactcccccggtggccggggcgctcttgcgcgcggccttgg 56

                                                       
Query: 450 tggcgagctgcttgcggggcgccttgccgccggtggacttgcgg 493
           | || ||||||||||||||||||||||| |||||||||||||||
Sbjct: 55  tcgccagctgcttgcggggcgccttgcctccggtggacttgcgg 12

---

>gb|AY521718.1| Romalea sp. BYU_ACOR015 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  307 bits (155), Expect = 2e-80
 Identities = 297/343 (86%), Gaps = 1/343 (0%)
 Strand = Plus / Minus

                                                                       
Query: 150 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 209
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaagaggcc 295

                                                                       
Query: 210 gacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgag 269
           ||| ||||||||||||   |||||||| |||||||  || ||   |  |||||| |  ||
Sbjct: 294 gacgaggtacgcctcgctggcctcctgcagggccatgaccgccgagctctggaagcgcag 235

                                                                       
Query: 270 gtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggat 329
           ||||||||||||||||||||||||||| | ||| ||||||||||| ||||||||||||||
Sbjct: 234 gtcggtcttgaagtcctgcgcgatctcgcgcacgaggcgctggaagggcagcttgcggat 175

                                                                       
Query: 330 cagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcc 389
            |||||  || |||||||| |||||    |||||||| || ||||| ||||| || ||||
Sbjct: 174 gagcagt-tcggtgctcttttggtagcgtcggatctctcgcagggcgacggtgcccggcc 116

                                                                       
Query: 390 tgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgccttgg 449
           |||||||||| |||||||| |||||||||||||  |||||   |||||||||||||||||
Sbjct: 115 tgtagcggtggggcttcttgacgccgccggtggcgggcgcgctcttcctcgccgccttgg 56

                                                      
Query: 450 tggcgagctgcttgcggggcgccttgccgccggtggacttgcg 492
           |||||||||||||||| |||||||| |||||||| ||||||||
Sbjct: 55  tggcgagctgcttgcgcggcgcctttccgccggtcgacttgcg 13

---

>gb|AY338631.1| Anthopotamus sp. EP022 histone 3 gene, partial cds
          Length = 345

 Score =  307 bits (155), Expect = 2e-80
 Identities = 297/343 (86%), Gaps = 1/343 (0%)
 Strand = Plus / Minus

                                                                       
Query: 150 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 209
           |||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcaaacagacc 286

                                                                       
Query: 210 gacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgag 269
            || ||||| ||||||   | |||||| |||||||  ||||||  |  |||||| |  ||
Sbjct: 285 caccaggtaggcctcgctggactcctgcagggccatgacggcggagctctggaagcgcag 226

                                                                       
Query: 270 gtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggat 329
           |||||||||||||||||| |||||||| |  |||||||||||||| ||||||||||||||
Sbjct: 225 gtcggtcttgaagtcctgggcgatctcgcgaaccaggcgctggaagggcagcttgcggat 166

                                                                       
Query: 330 cagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcc 389
           |||||| ||||||||||||||||||    |||||||| || || |||||||| |||||||
Sbjct: 165 cagcag-ctccgtgctcttctggtagcgacggatctctcgcagagccacggtgccgggcc 107

                                                                       
Query: 390 tgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgccttgg 449
           |||||||||||||||||||||||||||||||||  || ||   ||| |  || |||||||
Sbjct: 106 tgtagcggtgaggcttcttcacgccgccggtggcgggggcgctcttgcgagcggccttgg 47

                                                      
Query: 450 tggcgagctgcttgcggggcgccttgccgccggtggacttgcg 492
           ||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 46  tggcgagctgcttgcggggagccttgcctccggtggacttgcg 4

---

>ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618149), mRNA
          Length = 411

 Score =  305 bits (154), Expect = 8e-80
 Identities = 326/382 (85%), Gaps = 1/382 (0%)
 Strand = Plus / Minus

                                                                       
Query: 105 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 164
           |||||||||||| || ||||| |||||||| ||||||||||| |||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatccggcgggcaagctggatgtctttgggcatgatggtgac 352

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           |||||||||||||||||| |||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcacacaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatcaccgcagagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           ||| |||||||| | |||||| ||||||||||| ||||||||||||||||| ||| ||  
Sbjct: 231 ctgtgcgatctcgcgcaccagccgctggaacggtagcttgcggatcagcag-ctctgtag 173

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||   |||||||||||| ||||||||||| || |||| ||||||||||||||
Sbjct: 172 acttctggtagcggcggatctcgcgcagggccacggtgccaggccggtagcggtgaggct 113

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           ||||||| |||||||||| ||||||   ||| |  || || |||||||| ||||||||||
Sbjct: 112 tcttcacaccgccggtggccggcgcactcttacgggctgctttggtggccagctgcttgc 53

                                 
Query: 465 ggggcgccttgccgccggtgga 486
           | || ||||||||||| |||||
Sbjct: 52  gcggggccttgccgccagtgga 31

---

>gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  305 bits (154), Expect = 8e-80
 Identities = 320/373 (85%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcaaag 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||| ||||| ||||||   ||||||||||||||||  || ||   |  |||||| 
Sbjct: 311 agaccgacgaggtaggcctcgctggcctcctggagggccatgactgccgagctctggaag 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           | ||||||||||||||||||||||||||| || | ||||||||||||||| |||||||||
Sbjct: 251 cggaggtcggtcttgaagtcctgcgcgatttcacgcaccaggcgctggaagggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| ||||| ||| ||||||||||||||    |||||||| || |||||||| || ||
Sbjct: 191 cggatgagcag-ctcagtgctcttctggtagcgacggatctcacgaagggccacagtgcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||||||||| || |||||||||||||||||||||||||  || ||   ||| |  || ||
Sbjct: 132 gggcctgtaacgatgaggcttcttcacgccgccggtggcgggtgcgctcttgcgagctgc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           |||||||||||| || ||||||||||||||||| ||||||||||||| | || |||||||
Sbjct: 72  cttggtggcgagttgtttgcggggcgccttgccaccggtggacttgc-gagccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>gb|AY749709.1| Mystaxiops venatoris histone H3 (H3) gene, partial cds
          Length = 375

 Score =  303 bits (153), Expect = 3e-79
 Identities = 320/373 (85%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||| ||||| ||||||   |||||||| |||||||  |||||   |  |||||| 
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatgacggccgagctctggaag 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  |||||||||||||||||||| ||||| || | |||||| |||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatttcacgcaccagacgctggaagggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| |||||| |||||||||||||||||    |||||||| || || |||||||| ||
Sbjct: 191 cggatgagcagc-tccgtgctcttctggtagcgacggatctcacgcagagccacggttcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||||||||| || || ||||||||||| || |||||||  ||||||||||| |  || ||
Sbjct: 132 gggcctgtaacgatggggcttcttcactcctccggtggcgggcgccgacttgcgagcggc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           ||||||||| |||||||||||||| ||||| || ||||| ||||||||| || |||||||
Sbjct: 72  cttggtggccagctgcttgcggggagcctttcctccggtcgacttgcgg-gccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA
          Length = 507

 Score =  301 bits (152), Expect = 1e-78
 Identities = 354/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Minus

                                                                       
Query: 104 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 448 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 389

                                                                       
Query: 164 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 388 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 329

                                                                       
Query: 224 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
           ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 328 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 269

                                                                       
Query: 284 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
           ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||
Sbjct: 268 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtg 210

                                                                       
Query: 344 ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
             |||||||||    |||||||| || ||||| ||||| ||||||| ||||||||| |||
Sbjct: 209 gacttctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggc 150

                                                                       
Query: 404 ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
           |||||||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| 
Sbjct: 149 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttc 90

                                                                      
Query: 464 cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |  || |||||||||||||| ||||||| | || |||||||| ||||||||||| ||||
Sbjct: 89  ctcggggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccatagcga 32

---

>gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds
          Length = 1227

 Score =  301 bits (152), Expect = 1e-78
 Identities = 354/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Minus

                                                                       
Query: 104 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 821 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 762

                                                                       
Query: 164 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 761 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 702

                                                                       
Query: 224 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
           ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 701 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 642

                                                                       
Query: 284 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
           ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||
Sbjct: 641 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtg 583

                                                                       
Query: 344 ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
             |||||||||    |||||||| || ||||| ||||| ||||||| ||||||||| |||
Sbjct: 582 gacttctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggc 523

                                                                       
Query: 404 ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
           |||||||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| 
Sbjct: 522 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttc 463

                                                                      
Query: 464 cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |  || |||||||||||||| ||||||| | || |||||||| ||||||||||| ||||
Sbjct: 462 ctcggggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccatagcga 405

---

>gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNING: chimeric clone
           ****
          Length = 1047

 Score =  301 bits (152), Expect = 1e-78
 Identities = 354/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Minus

                                                                       
Query: 104 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 425 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 366

                                                                       
Query: 164 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 365 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 306

                                                                       
Query: 224 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
           ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 305 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 246

                                                                       
Query: 284 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
           ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||
Sbjct: 245 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtg 187

                                                                       
Query: 344 ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
             |||||||||    |||||||| || ||||| ||||| ||||||| ||||||||| |||
Sbjct: 186 gacttctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggc 127

                                                                       
Query: 404 ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
           |||||||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| 
Sbjct: 126 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttc 67

                                                                      
Query: 464 cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |  || |||||||||||||| ||||||| | || |||||||| ||||||||||| ||||
Sbjct: 66  ctcggggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccatagcga 9

---

>gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMAGE:3913365)
          Length = 1672

 Score =  301 bits (152), Expect = 1e-78
 Identities = 354/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Minus

                                                                       
Query: 104 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 448 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 389

                                                                       
Query: 164 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 388 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 329

                                                                       
Query: 224 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
           ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 328 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 269

                                                                       
Query: 284 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
           ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||
Sbjct: 268 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtg 210

                                                                       
Query: 344 ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
             |||||||||    |||||||| || ||||| ||||| ||||||| ||||||||| |||
Sbjct: 209 gacttctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggc 150

                                                                       
Query: 404 ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
           |||||||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| 
Sbjct: 149 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttc 90

                                                                      
Query: 464 cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |  || |||||||||||||| ||||||| | || |||||||| ||||||||||| ||||
Sbjct: 89  ctcggggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccatagcga 32

---

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score =  301 bits (152), Expect = 1e-78
 Identities = 354/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Minus

                                                                          
Query: 104    cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
              |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 114788 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 114729

                                                                          
Query: 164    cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
              |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 114728 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 114669

                                                                          
Query: 224    cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
              ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 114668 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 114609

                                                                          
Query: 284    cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
              ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||
Sbjct: 114608 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtg 114550

                                                                          
Query: 344    ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
                |||||||||    |||||||| || ||||| ||||| ||||||| ||||||||| |||
Sbjct: 114549 gacttctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggc 114490

                                                                          
Query: 404    ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
              |||||||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| 
Sbjct: 114489 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttc 114430

                                                                         
Query: 464    cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
              |  || |||||||||||||| ||||||| | || |||||||| ||||||||||| ||||
Sbjct: 114429 ctcggggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccatagcga 114372



 Score =  301 bits (152), Expect = 1e-78
 Identities = 354/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Plus

                                                                          
Query: 104    cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
              |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 102478 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 102537

                                                                          
Query: 164    cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
              |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 102538 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 102597

                                                                          
Query: 224    cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
              ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 102598 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 102657

                                                                          
Query: 284    cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
              ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||
Sbjct: 102658 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtg 102716

                                                                          
Query: 344    ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
                |||||||||    |||||||| || ||||| ||||| ||||||| ||||||||| |||
Sbjct: 102717 gacttctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggc 102776

                                                                          
Query: 404    ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
              |||||||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| 
Sbjct: 102777 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttc 102836

                                                                         
Query: 464    cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
              |  || |||||||||||||| ||||||| | || |||||||| ||||||||||| ||||
Sbjct: 102837 ctcggggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccatagcga 102894



 Score =  268 bits (135), Expect = 2e-68
 Identities = 347/415 (83%), Gaps = 2/415 (0%)
 Strand = Plus / Plus

                                                                         
Query: 104   cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
             |||| |||| ||| || |||||||||||||| | |||||||||||||||||||||||| |
Sbjct: 74985 cttaggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtca 75044

                                                                         
Query: 164   cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
             |||||||||| ||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 75045 cgcgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 75104

                                                                         
Query: 224   cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
             ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 75105 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 75164

                                                                         
Query: 284   cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
             ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||| 
Sbjct: 75165 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgta 75223

                                                                         
Query: 344   ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
               |||||||||    |||||||| || || |||||||| ||||||| ||||||||| |||
Sbjct: 75224 gacttctggtagcgccggatctcccgcagagccacggtgccgggccggtagcggtgcggc 75283

                                                                         
Query: 404   ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
             |||||||| ||||| |||| ||||||   ||| |  ||||| ||||| || |||||||| 
Sbjct: 75284 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgctttggtagccagctgcttc 75343

                                                                    
Query: 464   cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
             |  || |||||||||||||| ||||||||| || |||||||| ||||||||||||
Sbjct: 75344 ctcggggccttgccgccggtcgacttgcgg-gcagtctgcttagtacgggccatg 75397

---

>ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (LOC653611), mRNA
          Length = 824

 Score =  301 bits (152), Expect = 1e-78
 Identities = 354/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Minus

                                                                       
Query: 104 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 701 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 642

                                                                       
Query: 164 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 641 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 582

                                                                       
Query: 224 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
           ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 581 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 522

                                                                       
Query: 284 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
           ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||
Sbjct: 521 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtg 463

                                                                       
Query: 344 ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
             |||||||||    |||||||| || ||||| ||||| ||||||| ||||||||| |||
Sbjct: 462 gacttctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggc 403

                                                                       
Query: 404 ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
           |||||||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| 
Sbjct: 402 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttc 343

                                                                      
Query: 464 cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |  || |||||||||||||| ||||||| | || |||||||| ||||||||||| ||||
Sbjct: 342 ctcggggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccatagcga 285

---

>ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudogene on chromosome 1
          Length = 1323

 Score =  301 bits (152), Expect = 1e-78
 Identities = 354/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Minus

                                                                       
Query: 104 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 935 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 876

                                                                       
Query: 164 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 875 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 816

                                                                       
Query: 224 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
           ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 815 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 756

                                                                       
Query: 284 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
           ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||
Sbjct: 755 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtg 697

                                                                       
Query: 344 ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
             |||||||||    |||||||| || ||||| ||||| ||||||| ||||||||| |||
Sbjct: 696 gacttctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggc 637

                                                                       
Query: 404 ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
           |||||||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| 
Sbjct: 636 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttc 577

                                                                      
Query: 464 cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |  || |||||||||||||| ||||||| | || |||||||| ||||||||||| ||||
Sbjct: 576 ctcggggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccatagcga 519

---

>gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE:30915509),
           partial cds
          Length = 481

 Score =  301 bits (152), Expect = 1e-78
 Identities = 354/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Minus

                                                                       
Query: 104 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 440 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 381

                                                                       
Query: 164 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 380 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 321

                                                                       
Query: 224 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
           ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 320 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 261

                                                                       
Query: 284 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
           ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||
Sbjct: 260 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtg 202

                                                                       
Query: 344 ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
             |||||||||    |||||||| || ||||| ||||| ||||||| ||||||||| |||
Sbjct: 201 gacttctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggc 142

                                                                       
Query: 404 ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
           |||||||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| 
Sbjct: 141 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttc 82

                                                                      
Query: 464 cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |  || |||||||||||||| ||||||| | || |||||||| ||||||||||| ||||
Sbjct: 81  ctcggggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccatagcga 24

---

>gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete cds
          Length = 1227

 Score =  301 bits (152), Expect = 1e-78
 Identities = 354/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Minus

                                                                       
Query: 104 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 821 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 762

                                                                       
Query: 164 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 761 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 702

                                                                       
Query: 224 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
           ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 701 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 642

                                                                       
Query: 284 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
           ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||
Sbjct: 641 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtg 583

                                                                       
Query: 344 ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
             |||||||||    |||||||| || ||||| ||||| ||||||| ||||||||| |||
Sbjct: 582 gacttctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggc 523

                                                                       
Query: 404 ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
           |||||||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| 
Sbjct: 522 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttc 463

                                                                      
Query: 464 cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |  || |||||||||||||| ||||||| | || |||||||| ||||||||||| ||||
Sbjct: 462 ctcggggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccatagcga 405

---

>gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, complete sequence
          Length = 1323

 Score =  301 bits (152), Expect = 1e-78
 Identities = 354/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Minus

                                                                       
Query: 104 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
           |||| |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| |
Sbjct: 935 cttaagcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtca 876

                                                                       
Query: 164 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
           |||||||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||
Sbjct: 875 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 816

                                                                       
Query: 224 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
           ||   |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| ||||
Sbjct: 815 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 756

                                                                       
Query: 284 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
           ||||||||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||
Sbjct: 755 cctgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtg 697

                                                                       
Query: 344 ctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggc 403
             |||||||||    |||||||| || ||||| ||||| ||||||| ||||||||| |||
Sbjct: 696 gacttctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggc 637

                                                                       
Query: 404 ttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg 463
           |||||||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| 
Sbjct: 636 ttcttcaccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttc 577

                                                                      
Query: 464 cggggcgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
           |  || |||||||||||||| ||||||| | || |||||||| ||||||||||| ||||
Sbjct: 576 ctcggggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccatagcga 519

---

>gb|AY749722.1| Adenophlebia peringueyella histone H3 (H3) gene, partial cds
          Length = 355

 Score =  301 bits (152), Expect = 1e-78
 Identities = 300/348 (86%), Gaps = 1/348 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 351 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaac 292

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || || || ||||| ||||||   |||||||| |||||||  ||||||  |  |||||| 
Sbjct: 291 agaccaaccaggtaggcctcgctggcctcctgcagggccatgacggcgctgctctggaaa 232

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  |||||||||||||||||||| |||||||| | ||||||||||||||| |||||||||
Sbjct: 231 cgcaggtcggtcttgaagtcctgagcgatctcacgcaccaggcgctggaagggcagcttg 172

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| ||||  ||| ||||||||||||||    |||||||| ||||||||||| || ||
Sbjct: 171 cggatgagca-actcagtgctcttctggtaacgacggatctcacggagggccactgtgcc 113

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           |||||||||||| || |||||||| ||||| |||||||  || ||   ||| |  |||||
Sbjct: 112 gggcctgtagcgatggggcttcttgacgcctccggtggcgggtgcgctcttgcgagccgc 53

                                                           
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcg 492
           ||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 52  cttggtggcgagctgcttgcggggcgccttgccaccggtggatttgcg 5

---

>ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616800), mRNA
          Length = 411

 Score =  297 bits (150), Expect = 2e-77
 Identities = 346/409 (84%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||||||| || ||||||||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||| |||||||||||||| ||||| ||||| || || || ||||||   
Sbjct: 347 ttggcgtggatggcacacaggttggtgtcttcgaagagccccaccagataggcctcgcac 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcactgccgagctctggaaacgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||  |||
Sbjct: 227 gcgatctcgcgtaccagccgctggaaaggcagcttgcggatcagcag-ctccgtggactt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   ||| |||||||| || || || || ||||||| ||||||||| ||||||||
Sbjct: 168 ctggtaacggcgaatctcgcgcagagctaccgtgccgggccggtagcggtgcggcttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           ||||||||| |||| ||| ||   ||| |  |||||||||||||||||||| ||||| ||
Sbjct: 108 cacgccgccagtggccggagcgctcttgcgagccgccttggtggcgagctgtttgcgcgg 49

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           |||||||||||| |||||||||| | || |||||||| ||||| |||||
Sbjct: 48  cgccttgccgccagtggacttgc-gagccgtctgctttgtacgagccat 1

---

>ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA
          Length = 411

 Score =  297 bits (150), Expect = 2e-77
 Identities = 346/409 (84%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||| ||| ||||||||||||||||| |||||||||||||||||||| ||||| ||||||
Sbjct: 407 gcccgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           ||||||||||||||||||||||| ||||| ||||||||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctg 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || |||| ||||||   |  |||||| |  ||||| ||||| |||||||||
Sbjct: 287 gcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgc 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| |  ||||| |||||||| |||||||||||||||||||| |||||||  |||
Sbjct: 227 gcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag-ctccgtggactt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    |||||||| || ||||| ||||| ||||||| ||||||||| ||||||||
Sbjct: 168 ctggtagcgccggatctcccgcagggctacggtgccgggccggtagcggtgcggcttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           ||| ||||| |||| ||||||   ||| |  |||||||||||||| |||||||| |  ||
Sbjct: 108 caccccgcccgtggccggcgcgctcttgcgggccgccttggtggccagctgcttcctcgg 49

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            |||||||||||||| ||||||| | || |||||||| |||||||||||
Sbjct: 48  ggccttgccgccggtcgacttgc-gagcagtctgcttagtacgggccat 1

---

>gb|AY749702.1| Thraulodes sp. EP014 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  297 bits (150), Expect = 2e-77
 Identities = 319/373 (85%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||| ||||| ||||||   |||||||| |||||||  |||||   |  |||||| 
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatgacggccgagctctggaaa 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  |||||||||||||||||||| ||||| || | ||| ||||||||||| || ||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatttcacgcacgaggcgctggaaggggagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| |||||| || ||||||||||||||    |||||||| ||||| |||||||| ||
Sbjct: 191 cggatgagcagc-tcagtgctcttctggtagcgacggatctcacggagagccacggtgcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           |||||||||||| || |||||||| ||||| ||||||| ||| ||   ||| |  |||||
Sbjct: 132 gggcctgtagcgatggggcttcttgacgccaccggtggccggggcgctcttgcgggccgc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           |||||||||||||||||| ||||| |||||||| ||||||||||||| | || |||||||
Sbjct: 72  cttggtggcgagctgcttacggggggccttgcctccggtggacttgc-gagccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>gb|AY749738.1| Jubabaetis sp. EP139 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  293 bits (148), Expect = 3e-76
 Identities = 318/373 (85%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaag 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||| | ||| ||||||   |||||||| |||||||  |||||   |  |||||| 
Sbjct: 311 aggccgaccaagtaggcctcgctggcctcctgcagggccatgacggccgagctctggaaa 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  ||||||||||||||||||||||||||||| | ||| ||||||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgcgcgatctcgcgcacgaggcgctggaagggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| || ||| || ||||||||||||||    |||||||| || || ||||| || ||
Sbjct: 191 cggatgagnagc-tcagtgctcttctggtagcgacggatctcacgcagagccaccgtgcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||| | |||||| || |||||||| |||||||||||||  ||||||||||| |  || ||
Sbjct: 132 ggggcggtagcgatggggcttcttgacgccgccggtggcgggcgccgacttgcgggcggc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           ||||||||| ||||||||||||||||||||||| ||||| ||||||| | || |||||||
Sbjct: 72  cttggtggccagctgcttgcggggcgccttgccaccggtngacttgc-gagccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 protein mRNA,
           complete cds
          Length = 610

 Score =  291 bits (147), Expect = 1e-75
 Identities = 336/394 (85%), Gaps = 5/394 (1%)
 Strand = Plus / Minus

                                                                       
Query: 127 cggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcac 186
           ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 490 cggcgtgcgagctgaatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcac 431

                                                                       
Query: 187 aggttggtgtcctcgaacag--cccgac-aaggtacgcctcggcagcctcctggagggcc 243
           | ||||||||||||||||||  ||| || |||||| |||||||| ||||| || || || 
Sbjct: 430 aagttggtgtcctcgaacagtcccccacgaaggtaggcctcggcggcctcttgcagcgcg 371

                                                                       
Query: 244 agcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcacc 303
           ||||||||   |  |||||| |  ||||||| |||||||||||| |||||||| |  || 
Sbjct: 370 agcacggccgagctctggaagcgcaggtcggacttgaagtcctgggcgatctcacggacg 311

                                                                       
Query: 304 aggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcggat 363
           |||||||||||||| ||||||||||| || ||  ||||||||||||||| ||||||||||
Sbjct: 310 aggcgctggaacggaagcttgcggatgaggagg-tccgtgctcttctggaacttgcggat 252

                                                                       
Query: 364 ctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggt 423
            || ||||| || ||||| |||||||||||||| || |||||||| |||||||| ||| |
Sbjct: 251 ttcacggagcgcgacggttccgggcctgtagcgatgcggcttcttgacgccgccagtgat 192

                                                                       
Query: 424 cggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgccggt 483
            || |||||||| |  || |||||||||||||||||||||||||| ||||| ||||| ||
Sbjct: 191 gggagccgacttgcgagcggccttggtggcgagctgcttgcggggggcctttccgcccgt 132

                                             
Query: 484 ggacttgcggngcggtctgcttggtacgggccat 517
            || || ||| || |||||||||||||| |||||
Sbjct: 131 agatttacgg-gctgtctgcttggtacgagccat 99

---

>gb|AY749739.1| Stygifloris sp. EP141 histone H3 (H3) gene, partial cds
          Length = 376

 Score =  291 bits (147), Expect = 1e-75
 Identities = 318/373 (85%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           |||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacacgcttggcgtggatngcgcacaagttggtgtcctcgaac 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || || || ||||| ||||||  || |||||| |||||||  ||||||  |  |||||| 
Sbjct: 311 agacccacgaggtaagcctcgctagactcctgcagggccatgacggcggagctctggaag 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  |||||||||||||||||||| |||||||| |  |||||||||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatctcacgaaccaggcgctggaagggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| ||||| ||| ||||||||||||||    |||||||| || || |||||||| ||
Sbjct: 191 cggatgagcag-ctcggtgctcttctggtagcgacggatctcacgcagagccacggttcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||||||||| || || ||||||||||||||||||||||  || ||   ||| |  || ||
Sbjct: 132 gggcctgtaacgatggggcttcttcacgccgccggtggcgggtgcgctcttgcgagcggc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           |||||||||||||||||||||||| |||||||| ||||||||||||| | || |||||||
Sbjct: 72  cttggtggcgagctgcttgcggggagccttgcctccggtggacttgc-gagccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>gb|AY749713.1| Penaphlebia sp. EP076 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  289 bits (146), Expect = 5e-75
 Identities = 318/373 (85%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacacgcttggcgtggatggcgcacaagttggtgtcctcgaaa 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||| ||||| ||||||   |||||||| ||||||| |||||||  |  |||||| 
Sbjct: 311 aggccgaccaggtaggcctcgctggcctcctgcagggccatcacggcggagctctggaaa 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  |||||||||||||||||||| ||||| || | ||||||||||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatttcacgcaccaggcgctggaagggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           |||||||| || ||| ||||||||||||||    |||||||| || |||||||| || ||
Sbjct: 191 cggatcaggag-ctcggtgctcttctggtagcgacggatctcacgcagggccactgtgcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           |||||||||||| || ||||||||||| ||||||||||  || ||   ||| |  || ||
Sbjct: 132 gggcctgtagcgatggggcttcttcacaccgccggtggcgggtgcgctcttgcgagcagc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           |||||||||||| || ||||||||||||||||| |||||||| |||| | || |||||||
Sbjct: 72  cttggtggcgagttgtttgcggggcgccttgcctccggtggatttgc-gagccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11
          Length = 538

 Score =  287 bits (145), Expect = 2e-74
 Identities = 345/409 (84%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 425 gccctctcgcctcggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 366

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| || || ||||| || || ||||||   
Sbjct: 365 ttggcgtggatggcgcacaggttggtgtcctcaaagagaccgaccagataagcctcgctg 306

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||| 
Sbjct: 305 gcctcctgcagagccatgacggctgagctctggaagcgcaggtcggtcttgaagtcctga 246

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           ||||||||||  |||||||||||||| ||||| |||||||| |||||| || |||   ||
Sbjct: 245 gcgatctcccggaccaggcgctggaaaggcagtttgcggatgagcagc-tcggtggattt 187

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   ||||||||| ||||| || || || ||||||| ||| |||||||| |||||
Sbjct: 186 ctggtagcggcggatctcccggagagcgactgtgccgggccggtaacggtgaggtttctt 127

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            || |||||||||| ||| ||   |||||| || ||||||||||||||||||||||||||
Sbjct: 126 gactccgccggtggccggggcgctcttcctggctgccttggtggcgagctgcttgcgggg 67

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            || || || |||||||| |||||| |||||||||||||||||||||||
Sbjct: 66  agctttccctccggtggatttgcgg-gcggtctgcttggtacgggccat 19

---

>ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611340), mRNA
          Length = 573

 Score =  285 bits (144), Expect = 7e-74
 Identities = 256/292 (87%), Gaps = 1/292 (0%)
 Strand = Plus / Minus

                                                                       
Query: 138 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtc 197
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 450 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtc 391

                                                                       
Query: 198 ctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtggga 257
           |||||| ||||| || ||||| ||||||   |||||||| || ||||  |||||   |  
Sbjct: 390 ctcgaagagccccaccaggtaggcctcgcacgcctcctgcagcgccatgacggccgagct 331

                                                                       
Query: 258 ctggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacgg 317
           |||||| |  ||||||||||||||||||||||||||||| | ||||||||||||||||||
Sbjct: 330 ctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgcaccaggcgctggaacgg 271

                                                                       
Query: 318 cagcttgcggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggcca 377
           |||||||||||||||||| |||||||  |||||||||    ||||||||||| |||||||
Sbjct: 270 cagcttgcggatcagcag-ctccgtggacttctggtagcgccggatctcgcgcagggcca 212

                                                               
Query: 378 cggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgc 429
           | || ||||||| ||||||||| |||||||| ||||||||||||| ||||||
Sbjct: 211 ccgtgccgggccggtagcggtgcggcttcttgacgccgccggtggccggcgc 160

---

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
           histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
           complete cds
          Length = 3777

 Score =  285 bits (144), Expect = 7e-74
 Identities = 265/304 (87%), Gaps = 1/304 (0%)
 Strand = Plus / Plus

                                                                       
Query: 114 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
           ||||||||||||||||||||| ||||||||||||||||||||||| || || ||||||||
Sbjct: 253 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtcacacgcttggc 312

                                                                       
Query: 174 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
           ||||||||||||||||||||||||||||||||| || || ||||| |||||||| |||||
Sbjct: 313 gtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcggcggcctc 372

                                                                       
Query: 234 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
           ||| || ||||||||||| |||   ||||| |  |||||||||||||||||||| || ||
Sbjct: 373 ctgtagcgccagcacggcctggctttggaaacgcaggtcggtcttgaagtcctgggcaat 432

                                                                       
Query: 294 ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
           ||| |  ||||||||||||||||||||||||||||| ||||| ||| ||   |||||| |
Sbjct: 433 ctcacggaccaggcgctggaacggcagcttgcggatgagcag-ctctgtcgacttctgat 491

                                                                       
Query: 354 acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
           | ||||||||||| || || |||||||| ||||| | |||||| |||||||||||||| |
Sbjct: 492 atttgcggatctcacgcagcgccacggtaccggggcggtagcgatgaggcttcttcacac 551

               
Query: 414 cgcc 417
           ||||
Sbjct: 552 cgcc 555



 Score =  103 bits (52), Expect = 6e-19
 Identities = 70/75 (93%), Gaps = 1/75 (1%)
 Strand = Plus / Plus

                                                                       
Query: 443 gccttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctg 502
           ||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||
Sbjct: 578 gccttggtggcgagctgcttgcggggcgccttgccaccggtggacttgc-gagcggtctg 636

                          
Query: 503 cttggtacgggccat 517
           |||||| || |||||
Sbjct: 637 cttggtgcgagccat 651

---

>gb|AY520709.1| Chthamalus stellatus histone H3 gene, partial cds
          Length = 328

 Score =  283 bits (143), Expect = 3e-73
 Identities = 282/327 (86%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           ||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
             |||||||||||||||||  || |||  |  |||||| |  |||||||||||||| |||
Sbjct: 267 ctagcctcctggagggccatgactgcgctgctctggaaacgcaggtcggtcttgaaatcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| |  |||||||||||||| |||||||||||||| |||||| ||||||||
Sbjct: 207 tgagcgatctcgcggaccaggcgctggaaaggcagcttgcggatgagcagc-tccgtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 148 cttctggtagcgacggatctcacggagggcaacggttccgggcctgtagcggtggggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           |||||| |||||||| | ||||||   ||| |  || ||||||||||| |||||||| ||
Sbjct: 88  cttcacaccgccggttgccggcgcgctcttgcgagctgccttggtggccagctgcttccg 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
            ||||||||||||||||| ||||||||
Sbjct: 28  cggcgccttgccgccggtcgacttgcg 2

---

>emb|AJ556872.1|XLA556872 Expression vector pET3-H3 H3 gene for Xenopus laevis-like histone
           H3
          Length = 509

 Score =  283 bits (143), Expect = 3e-73
 Identities = 346/411 (84%), Gaps = 2/411 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 448 gccctctcgcctcggattctgcgggccagctggatgtccttgggcatgatggtgaccctc 389

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| || ||  |||| || || ||||||   
Sbjct: 388 ttggcgtggatggcgcacaggttggtgtcctcaaagagagcgaccagataagcctcgctg 329

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||| 
Sbjct: 328 gcctcctgcagagccataacggccgagctctggaagcgcaggtcggtcttgaagtcctga 269

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           ||||||||||  |||||||||||||| ||||| |||||||| |||||| || |||   ||
Sbjct: 268 gcgatctcccggaccaggcgctggaaaggcagtttgcggatgagcagc-tcggtggattt 210

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   ||||||||||||||| || || || ||||||| ||| |||||||| |||||
Sbjct: 209 ctggtagcggcggatctcgcggagagcgactgtgccgggccggtaacggtgaggtttctt 150

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            || |||||||| |  || || |||||||| || ||||||||||| ||||||||||||||
Sbjct: 149 gactccgccggtagcaggagcggacttcctggctgccttggtggccagctgcttgcgggg 90

                                                              
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatgg 519
            ||||| || |||||||| || ||| |||||||||||||||||||||||||
Sbjct: 89  agccttccctccggtggatttacgg-gcggtctgcttggtacgggccatgg 40

---

>ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616819), mRNA
          Length = 411

 Score =  281 bits (142), Expect = 1e-72
 Identities = 320/378 (84%), Gaps = 1/378 (0%)
 Strand = Plus / Minus

                                                                       
Query: 112 ctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 171
           ||||| || ||||||||||| || ||||||||||||||||||||||| ||||||||||||
Sbjct: 404 ctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttg 345

                                                                       
Query: 172 gcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcc 231
           ||||||||||| |||||||||||||| ||||| ||||| || || || ||||||   |||
Sbjct: 344 gcgtggatggcacacaggttggtgtcttcgaagagccccaccagataggcctcgcacgcc 285

                                                                       
Query: 232 tcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcg 291
           ||||| || |||| ||||||   |  |||||| |  ||||| ||||||||||||||||||
Sbjct: 284 tcctgcagcgccatcacggccgagctctggaagcgcaggtcagtcttgaagtcctgcgcg 225

                                                                       
Query: 292 atctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctg 351
           ||||| |  ||||| ||||||||||||||||||||||||||||| |||||||  ||||||
Sbjct: 224 atctcgcgtaccagccgctggaacggcagcttgcggatcagcag-ctccgtggacttctg 166

                                                                       
Query: 352 gtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcac 411
           |||   ||| ||||| || || || || || || |||| ||| || || |||||||||||
Sbjct: 165 gtaacggcgaatctcacgcagagctaccgtgccaggccggtaccgatgcggcttcttcac 106

                                                                       
Query: 412 gccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgc 471
           ||||||||||| ||||||   ||| |  |||||||||||||||||||| ||||| |||||
Sbjct: 105 gccgccggtggccggcgcgctcttgcgggccgccttggtggcgagctgtttgcgcggcgc 46

                             
Query: 472 cttgccgccggtggactt 489
           ||||||||||||||||||
Sbjct: 45  cttgccgccggtggactt 28

---

>gb|AY749714.1| Meridialaris diguillina histone H3 (H3) gene, partial cds
          Length = 357

 Score =  281 bits (142), Expect = 1e-72
 Identities = 297/348 (85%), Gaps = 1/348 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 353 tccttgggcatratggtgacacgcttggcgtggatggcgcacaggttggtgtcctcgaac 294

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || || || ||||| ||||||   |||||||| |||||||  ||||||  |  |||||| 
Sbjct: 293 aggccaaccaggtaggcctcgctggcctcctgcagggccatgacggcggagctctggaaa 234

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  |||||||||||||||||||| ||||| || | ||||||||||||||| |||||||||
Sbjct: 233 cgcaggtcggtcttgaagtcctgggcgatttcacgcaccaggcgctggaagggcagcttg 174

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||||||||| ||| ||||||||||||||    |||||||| || |||||||| || ||
Sbjct: 173 cggatcagcag-ctcagtgctcttctggtagcgacggatctcacgcagggccactgtgcc 115

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           |||||||||||| || ||||||||||| ||||||||||  || ||   ||| |  || ||
Sbjct: 114 gggcctgtagcgatggggcttcttcactccgccggtggcgggtgcgctcttgcgagcagc 55

                                                           
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcg 492
           |||||||||||| || ||||||||||||||||| |||||||| |||||
Sbjct: 54  cttggtggcgagttgtttgcggggcgccttgccaccggtggatttgcg 7

---

>emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant
          Length = 772

 Score =  280 bits (141), Expect = 5e-72
 Identities = 344/409 (84%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 504 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 445

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||||   
Sbjct: 444 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctcgctg 385

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| |||||    | |||    |||||||| |  || ||||||||||||||||| 
Sbjct: 384 gcctcctgtagggctccaatggccgccgactggaagcgcagatcggtcttgaagtcctgg 325

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           || ||||| | |||||| ||||||||||||||||||||||| |||||| ||||||  |||
Sbjct: 324 gctatctcgcgcaccagacgctggaacggcagcttgcggatgagcagc-tccgtggactt 266

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    || ||||| || |||||||| || || || | |||||| || ||||||||
Sbjct: 265 ctggtagcgacgaatctcacgcagggccaccgttccaggacggtagcgatgtggcttctt 206

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           ||| ||||||||||  |||||||| || |  |||||||||||||| ||||||||||||||
Sbjct: 205 cactccgccggtggatggcgccgatttacgggccgccttggtggccagctgcttgcgggg 146

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||| ||||| || || ||| || || ||||||||||| |||||
Sbjct: 145 cgccttgcctccggtcgatttacgg-gctgtttgcttggtacgtgccat 98

---

>gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA
          Length = 824

 Score =  280 bits (141), Expect = 5e-72
 Identities = 344/409 (84%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 569 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 510

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||||   
Sbjct: 509 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctcgctg 450

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| |||||    | |||    |||||||| |  || ||||||||||||||||| 
Sbjct: 449 gcctcctgtagggctccaatggccgccgactggaagcgcagatcggtcttgaagtcctgg 390

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           || ||||| | |||||| ||||||||||||||||||||||| |||||| ||||||  |||
Sbjct: 389 gctatctcgcgcaccagacgctggaacggcagcttgcggatgagcagc-tccgtggactt 331

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    || ||||| || |||||||| || || || | |||||| || ||||||||
Sbjct: 330 ctggtagcgacgaatctcacgcagggccaccgttccaggacggtagcgatgtggcttctt 271

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           ||| ||||||||||  |||||||| || |  |||||||||||||| ||||||||||||||
Sbjct: 270 cactccgccggtggatggcgccgatttacgggccgccttggtggccagctgcttgcgggg 211

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||| ||||| || || ||| || || ||||||||||| |||||
Sbjct: 210 cgccttgcctccggtcgatttacgg-gctgtttgcttggtacgtgccat 163

---

>ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA, transcript variant
           A (His3.3A), mRNA
          Length = 853

 Score =  280 bits (141), Expect = 5e-72
 Identities = 344/409 (84%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 608 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 549

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||||   
Sbjct: 548 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctcgctg 489

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| |||||    | |||    |||||||| |  || ||||||||||||||||| 
Sbjct: 488 gcctcctgtagggctccaatggccgccgactggaagcgcagatcggtcttgaagtcctgg 429

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           || ||||| | |||||| ||||||||||||||||||||||| |||||| ||||||  |||
Sbjct: 428 gctatctcgcgcaccagacgctggaacggcagcttgcggatgagcagc-tccgtggactt 370

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    || ||||| || |||||||| || || || | |||||| || ||||||||
Sbjct: 369 ctggtagcgacgaatctcacgcagggccaccgttccaggacggtagcgatgtggcttctt 310

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           ||| ||||||||||  |||||||| || |  |||||||||||||| ||||||||||||||
Sbjct: 309 cactccgccggtggatggcgccgatttacgggccgccttggtggccagctgcttgcgggg 250

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||| ||||| || || ||| || || ||||||||||| |||||
Sbjct: 249 cgccttgcctccggtcgatttacgg-gctgtttgcttggtacgtgccat 202

---

>gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA
          Length = 824

 Score =  280 bits (141), Expect = 5e-72
 Identities = 344/409 (84%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 569 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 510

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||||   
Sbjct: 509 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctcgctg 450

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| |||||    | |||    |||||||| |  || ||||||||||||||||| 
Sbjct: 449 gcctcctgtagggctccaatggccgccgactggaagcgcagatcggtcttgaagtcctgg 390

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           || ||||| | |||||| ||||||||||||||||||||||| |||||| ||||||  |||
Sbjct: 389 gctatctcgcgcaccagacgctggaacggcagcttgcggatgagcagc-tccgtggactt 331

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||    || ||||| || |||||||| || || || | |||||| || ||||||||
Sbjct: 330 ctggtagcgacgaatctcacgcagggccaccgttccaggacggtagcgatgtggcttctt 271

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           ||| ||||||||||  |||||||| || |  |||||||||||||| ||||||||||||||
Sbjct: 270 cactccgccggtggatggcgccgatttacgggccgccttggtggccagctgcttgcgggg 211

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           ||||||||| ||||| || || ||| || || ||||||||||| |||||
Sbjct: 210 cgccttgcctccggtcgatttacgg-gctgtttgcttggtacgtgccat 163

---

>gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial cds
          Length = 375

 Score =  280 bits (141), Expect = 5e-72
 Identities = 317/373 (84%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || || || ||||| ||||||   |||||||| || |||| |||||||  |  |||||| 
Sbjct: 311 agacccacgaggtaagcctcgctggcctcctgcagagccatcacggcggagctctggaaa 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           | ||||||||||||||||||||| ||||| || | ||||||||| ||||| ||||| |||
Sbjct: 251 cggaggtcggtcttgaagtcctgtgcgatttcacgcaccaggcgttggaagggcagtttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||||||||| ||| || |||||||||||    |||||||| || || |||||||| ||
Sbjct: 191 cggatcagcag-ctcggtactcttctggtagcgacggatctcacgcagagccacggtgcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           |||||||||||| || ||||||||||||||||||||||  || ||   ||| |  || ||
Sbjct: 132 gggcctgtagcgatggggcttcttcacgccgccggtggcgggtgcgctcttgcgggctgc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           |||||| |||||||||||||| || |||||||| ||||| || |||||| || |||||||
Sbjct: 72  cttggtagcgagctgcttgcgaggagccttgcctccggtagatttgcgg-gccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>gb|DQ284405.1| Arthroleptis tanneri histone H3a gene, partial cds
          Length = 328

 Score =  278 bits (140), Expect = 2e-71
 Identities = 279/326 (85%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagagcccgaccaggtaggcctcgct 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| |||||||  ||||||  |  |||||| |  | ||||||||||||||||||
Sbjct: 265 ggcctcctgcagggccatracggcggagctctggaagcgcargtcggtcttgaagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||||||||| ||||||||| |||||||||||||| || || ||| |||  ||
Sbjct: 205 ggcgatctccctcaccaagcgctggaagggcagcttgcggatgaggag-ctcggtggact 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||||||||| |||||||| ||||||| |||||||||||||||||
Sbjct: 146 tctggtascggcggatctcgcggagagccacggtgccgggccggtagcggtgaggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           | || ||||||||||  |||||   ||| |  || ||||||||||| ||||||||||| |
Sbjct: 86  tgaccccgccggtggcaggcgcgctcttgcgggcagccttggtggccagctgcttgcgag 27

                                     
Query: 468 gcgccttgccgccggtggacttgcgg 493
           |||| ||||||||||| |||||||||
Sbjct: 26  gcgctttgccgccggtrgacttgcgg 1

---

>gb|AY520720.1| Capitulum mitella histone H3 gene, partial cds
          Length = 328

 Score =  276 bits (139), Expect = 7e-71
 Identities = 281/327 (85%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaacaggccgacaaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| |||||||  ||||||  |  |||||| |  ||||| ||||||||||||
Sbjct: 267 ctcgcctcctgcagggccatgacggcgctgctctggaagcgcaggtccgtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| | |||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 207 tgagcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcag-ctccgtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    |||||||| || || ||||| || || || | ||||||||| |||||
Sbjct: 148 cttctggtagcgacggatctcacgcagcgccaccgtgcccggacggtagcggtggggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| ||||||||||||| ||||||   ||| |  |||||||||||||| |||||||| ||
Sbjct: 88  cttgacgccgccggtggccggcgcgctcttgcgagccgccttggtggccagctgcttccg 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
            ||||||||||| ||||||||||||||
Sbjct: 28  tggcgccttgccaccggtggacttgcg 2

---

>gb|AY520703.1| Elminius modestus histone H3 gene, partial cds
          Length = 328

 Score =  276 bits (139), Expect = 7e-71
 Identities = 281/327 (85%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           ||||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagaccaaccaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| |||||||  ||||||  |  |||||| |  ||||||||||||||||||
Sbjct: 267 ctggcctcctgcagggccatgacggcgctgctctggaagcgcaggtcggtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| | |||||| ||||||||||||||||||||||||||||| ||| |||||
Sbjct: 207 tgagcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcag-ctcggtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    |||||||| |||||||| || || ||||| | |||||||||||||||
Sbjct: 148 cttctggtagcgacggatctcacggagggcgaccgtgccgggacggtagcggtgaggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| ||||||||||||| ||||||   ||| |  || ||||| ||||| |||||||||||
Sbjct: 88  cttgacgccgccggtggccggcgcgctcttgcgagcggcctttgtggccagctgcttgcg 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
            ||||||||||| ||||||||||||||
Sbjct: 28  cggcgccttgccaccggtggacttgcg 2

---

>emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for histones H3 and H4
          Length = 1504

 Score =  276 bits (139), Expect = 7e-71
 Identities = 233/263 (88%), Gaps = 1/263 (0%)
 Strand = Plus / Minus

                                                                        
Query: 104  cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 163
            ||||||| | ||||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 1162 cttacgcgcgctcgccacggatgcgacgggccagctggatgtccttgggcatgatggtga 1103

                                                                        
Query: 164  cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 223
            |||||||||||||||||||||| ||||| |||||||||||||  || || ||||| ||||
Sbjct: 1102 cgcgcttggcgtggatggcgcaaaggttagtgtcctcgaacaagcccaccaggtaggcct 1043

                                                                        
Query: 224  cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 283
            | ||||||||||| || |||||||| || |||  |||||| |  || |||||||||||||
Sbjct: 1042 cagcagcctcctgcagcgccagcaccgcctggctctggaagcgcagatcggtcttgaagt 983

                                                                        
Query: 284  cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtg 343
            |||| |||||||| | |||||| |||||||| || ||||||||||| ||||| |||||||
Sbjct: 982  cctgagcgatctcgcgcaccagccgctggaaggggagcttgcggatgagcag-ctccgtg 924

                                   
Query: 344  ctcttctggtacttgcggatctc 366
            |||||||||||||||||||||||
Sbjct: 923  ctcttctggtacttgcggatctc 901



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 69/75 (92%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                       
Query: 443 gccttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctg 502
           ||||||||||| ||||||||||||||||||||||||||||| ||||||| | || |||||
Sbjct: 726 gccttggtggccagctgcttgcggggcgccttgccgccggtcgacttgc-gcgcagtctg 668

                          
Query: 503 cttggtacgggccat 517
           ||| |||||||||||
Sbjct: 667 cttagtacgggccat 653

---

>gb|DQ284420.1| Pleurodeles waltl histone H3a gene, partial cds
          Length = 328

 Score =  274 bits (138), Expect = 3e-70
 Identities = 280/326 (85%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||||| |||||||||||| || |||||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcgcacaagttggtgtcctcaaagagcccgaccaggtaggcctcgct 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| |||||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagggccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
           ||||||||||| ||||||||||||||| |||||||||||||| ||||| ||| |||  ||
Sbjct: 205 cgcgatctcccgcaccaggcgctggaagggcagcttgcggatgagcag-ctcggtggact 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 146 tctggtagcggcggatctcgcggagagccacggtcccgggcctgtagcggtgaggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           | || || |||||||  |||||   ||| |  || ||||||||||| ||||||||||| |
Sbjct: 86  tgactcctccggtggcaggcgcgctcttgcgggcagccttggtggccagctgcttgcgag 27

                                     
Query: 468 gcgccttgccgccggtggacttgcgg 493
           ||||||| || |||||||||||||||
Sbjct: 26  gcgccttccctccggtggacttgcgg 1

---

>gb|DQ284249.1| Iguana iguana histone H3a gene, partial cds
          Length = 328

 Score =  274 bits (138), Expect = 3e-70
 Identities = 280/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           ||||||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 328 gcgcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtargcctc 269

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| || |||| ||||||   |  |||||| |  |||||||||||||||||
Sbjct: 268 gctggcctcctgcagagccatcacggccgagctctggaagcgcaggtcggtcttgaagtc 209

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           ||| |||||||| | ||||| ||||||||| ||||||||||||||||||||| || ||| 
Sbjct: 208 ctgggcgatctcscgcaccaagcgctggaaaggcagcttgcggatcagcagc-tcggtgg 150

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
            |||||||||    |||||||| || ||||||||||| || || | ||||||||| ||||
Sbjct: 149 acttctggtagcgscggatctcccgcagggccacggtgcccgggcggtagcggtgrggct 90

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||||||||||||||||| ||| ||   ||||| |||||||||||| || ||||||||||
Sbjct: 89  tcttcacgccgccggtggccggagcgctcttccgcgccgccttggtcgccagctgcttgc 30

                                       
Query: 465 ggggcgccttgccgccggtggacttgcg 492
           | |||||||| |||||||||||||||||
Sbjct: 29  gaggcgccttcccgccggtggacttgcg 2

---

>gb|DQ284094.1| Synapturanus mirandaribeiroi histone H3a gene, partial cds
          Length = 328

 Score =  274 bits (138), Expect = 3e-70
 Identities = 280/326 (85%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtccgaccaggtaagcctcgct 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            ||||||||||| || ||||||||||| ||||||||||||||||||||| || |||  ||
Sbjct: 205 ggcgatctccctgacgaggcgctggaagggcagcttgcggatcagcagc-tcggtggact 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||||||||| || ||||| ||||||| |||||| ||||||||||
Sbjct: 146 tctggtagcggcggatctcgcggagagcgacggtgccgggccggtagcgatgaggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           |||| |||||||||| ||| ||   |||||| || ||||||||||| |||||||||||||
Sbjct: 86  tcactccgccggtggccggggcgctcttcctggcggccttggtggccagctgcttgcggg 27

                                     
Query: 468 gcgccttgccgccggtggacttgcgg 493
           | ||||| ||||||||||||||||||
Sbjct: 26  gagccttcccgccggtggacttgcgg 1

---

>gb|AY749741.1| Rhoenanthus sp. EP143 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  274 bits (138), Expect = 3e-70
 Identities = 315/373 (84%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaag 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || || || ||||| ||||||   | |||||| |||||||  ||||||  |  |||||| 
Sbjct: 311 agacccacgaggtaggcctcgctcgactcctgcagggccatgacggcggagctctggaag 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  | |||||||||||||||||| |||||||| |  || ||||||||||| |||||||||
Sbjct: 251 cgcargtcggtcttgaagtcctgggcgatctcacgaacsaggcgctggaagggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| ||||| ||| ||||||||||||||    |||||||| || || |||||||| ||
Sbjct: 191 cggatgagcag-ctcagtgctcttctggtaacgacggatctcacgcagagccacggtacc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           |||||||||||| || |||||||| || ||||||||||  || ||   ||| |  || ||
Sbjct: 132 gggcctgtagcgatggggcttcttgactccgccggtggcgggtgcgctcttgcgagcggc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           |||||||||||||||||||||||| |||||||| ||||||||||||| | || |||||||
Sbjct: 72  cttggtggcgagctgcttgcggggagccttgcctccggtggacttgc-gagccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds
          Length = 377

 Score =  274 bits (138), Expect = 3e-70
 Identities = 316/373 (84%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatcgcgcacaggttggtgtcctcgaac 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || || || ||||| ||||||   |||||||| || ||||  ||||||  |  |||||| 
Sbjct: 311 agacccaccaggtaagcctcgctggcctcctgcagagccatgacggcggagctctggaag 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  |||||||||||||||||||| |||||||| | |||||| |||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatctcacgcaccagacgctggaagggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| || || ||| ||||||||||||||    |||||||| || || ||||| || ||
Sbjct: 191 cggatgaggag-ctcagtgctcttctggtagcgacggatctcacgcagagccactgtgcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           |||||||||||| || ||||||||||| || |||||||  |||||   ||| |  || ||
Sbjct: 132 gggcctgtagcgatggggcttcttcactccaccggtggcgggcgcgctcttgcgagcggc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           ||||||||| ||||||||||||||||||||||| ||||| ||||||| | || |||||||
Sbjct: 72  cttggtggccagctgcttgcggggcgccttgcctccggtcgacttgc-gagccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>gb|AY749710.1| Centroptilum luteolum histone H3 (H3) gene, partial cds
          Length = 375

 Score =  274 bits (138), Expect = 3e-70
 Identities = 316/373 (84%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| 
Sbjct: 371 tccttgggcataatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaag 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||| | ||| ||||||   |||||||| || |||| |||||||   |||||||| 
Sbjct: 311 agtccgaccaagtaggcctcgctngcctcctgcagagccatcacggcggacgactggaag 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  |||||||||||||||||||| ||||| || |  |||||||||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatttcacggaccaggcgctggaaaggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||| || || ||| ||||||||||||||    |||||||| || |||||||| || ||
Sbjct: 191 cggatgaggag-ctcagtgctcttctggtagcgacggatctcacgaagggccactgtgcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||| |||||||| || ||||||||||| || ||||||| ||| ||   ||| |  || ||
Sbjct: 132 gggtctgtagcgatggggcttcttcactcctccggtggccggggcgctcttgcgagcggc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           ||||||||| ||||||||||||||||||||||| ||||| ||||||||| || |||||||
Sbjct: 72  cttggtggccagctgcttgcggggcgccttgcctccggtcgacttgcgg-gccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>gb|AY749701.1| Paraleptophlebia vaciva histone H3 (H3) gene, partial cds
          Length = 375

 Score =  274 bits (138), Expect = 3e-70
 Identities = 316/373 (84%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcatggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || || || ||||| ||||||   |||||||| || |||| |||||||  |  |||||| 
Sbjct: 311 agacccaccaggtaggcctcgctggcctcctgcagagccatcacggcgctgctctggaag 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           | ||||||||||||||||||||| |||||||| |  |||||||||||||| |||||||||
Sbjct: 251 cggaggtcggtcttgaagtcctgagcgatctcacggaccaggcgctggaagggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           ||||||||||| ||| ||||||||||||||    |||||||| || |||||||| || ||
Sbjct: 191 cggatcagcag-ctcagtgctcttctggtagcgacggatctcacgcagggccactgtgcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||| |  ||||| || ||||||||||||||||||||||  || ||   ||| |  || ||
Sbjct: 132 ggggcgatagcgatggggcttcttcacgccgccggtggcgggtgcgctcttgcgagcggc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           ||||||||| |||||||||||||| |||||||| || || ||||||| | || |||||||
Sbjct: 72  cttggtggccagctgcttgcggggagccttgcctcccgtcgacttgc-gagccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>gb|DQ284386.1| Elachistocleis ovalis histone H3a gene, partial cds
          Length = 328

 Score =  272 bits (137), Expect = 1e-69
 Identities = 279/325 (85%), Gaps = 1/325 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||||||||||||||||||||| || ||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagagaccgacgaggtaggcctcgct 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
           ||||||||| |||||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 265 agcctcctgcagggccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            ||||| || |  |||||||||||||| |||||||||||||| |||||| || |||  ||
Sbjct: 205 ggcgatttctcggaccaggcgctggaagggcagcttgcggatgagcagc-tcggtggact 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   |||||||||||| || |||||||| ||||||||||| ||||| |||||||
Sbjct: 146 tctggtagcggcggatctcgcgcagagccacggtgccgggcctgtaacggtgcggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           | || |||||||||| ||| ||   |||||| |||||||||||||| |||||||||||||
Sbjct: 86  tgactccgccggtggccggggcgctcttcctggccgccttggtggccagctgcttgcggg 27

                                    
Query: 468 gcgccttgccgccggtggacttgcg 492
           | || ||||||||||||||||||||
Sbjct: 26  gagctttgccgccggtggacttgcg 2

---

>gb|AY520708.1| Tetraclita japonica histone H3 gene, partial cds
          Length = 328

 Score =  270 bits (136), Expect = 4e-69
 Identities = 281/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           ||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcaaacagaccgaccaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| |||||||  ||||||  |  |||||| | ||| |||||||||||||||
Sbjct: 267 ctggcctcctgcagggccatgacggcgctgctctggaaacggagatcggtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || || ||||| | |||||| ||||||||||||||||||||||||||||| ||| |||||
Sbjct: 207 tgggcaatctcacgcaccagacgctggaacggcagcttgcggatcagcag-ctcagtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    ||||||||||| |||||||| || ||||| | ||||||||| |||||
Sbjct: 148 cttctggtagcgacggatctcgcgcagggccaccgtgccggggcggtagcggtggggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| ||||||||||||| ||||||   ||| |  || ||||| ||||| |||||||||||
Sbjct: 88  cttgacgccgccggtggccggcgcgctcttgcgagcggccttcgtggccagctgcttgcg 29

                                       
Query: 466 gggcgccttgccgccggtggacttgcgg 493
            ||||||||||| |||||||||||||||
Sbjct: 28  tggcgccttgccaccggtggacttgcgg 1

---

>gb|AY520695.1| Semibalanus cariosus histone H3 gene, partial cds
          Length = 328

 Score =  270 bits (136), Expect = 4e-69
 Identities = 281/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           |||||||||||||||||||||||||||||||||||||||||| || || ||||| |||||
Sbjct: 328 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagaccaaccaggtaggcctc 269

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |  ||||||||| ||||||| |||||||  |  |||||| | ||| || |||||||||||
Sbjct: 268 gctagcctcctgaagggccatcacggcgctgctctggaagcggagatccgtcttgaagtc 209

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           ||| |||||||| | |||||| ||||||||||||||||||||||||||||| ||| ||||
Sbjct: 208 ctgggcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcag-ctcagtgc 150

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
           ||||||||||   ||||||||| || || ||||| || ||||| | ||| ||||| ||||
Sbjct: 149 tcttctggtagcggcggatctcacgcagcgccaccgtgccgggacggtaacggtggggct 90

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||| |||||||| |||| ||||||   ||| |  || ||||||||||| ||||||||||
Sbjct: 89  tcttgacgccgccagtggccggcgcgctcttacgagcggccttggtggccagctgcttgc 30

                                       
Query: 465 ggggcgccttgccgccggtggacttgcg 492
           | ||||||||||| ||||||||||||||
Sbjct: 29  gtggcgccttgccaccggtggacttgcg 2

---

>dbj|AB195652.1| Lilium longiflorum soH3-2 mRNA for histone soH3-2, complete cds,
           clone: GC1661
          Length = 699

 Score =  270 bits (136), Expect = 4e-69
 Identities = 339/404 (83%), Gaps = 2/404 (0%)
 Strand = Plus / Minus

                                                                       
Query: 114 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
           ||||||||||||||| || || |||||||||||||| |||||||| || |||||||||||
Sbjct: 585 ctcgccacggatgcgacgtgcaagctggatgtccttcggcatgatcgtcacgcgcttggc 526

                                                                       
Query: 174 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
            || ||||||||||| || || ||||| ||||| || || ||||| ||||| || |||||
Sbjct: 525 atgaatggcgcacagatttgtatcctcaaacagtcccaccaggtaagcctccgccgcctc 466

                                                                       
Query: 234 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
           |||||| || ||||| || |||  |||||| | ||| |||| |||| | ||||| |||||
Sbjct: 465 ctggagagctagcacagcatggctctggaaacggagatcggccttgtaatcctgagcgat 406

                                                                       
Query: 294 ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
           ||||||||| || | |||||| |||||||| | ||| || ||  || |||||||||||||
Sbjct: 405 ctccctcacaagcctctggaagggcagcttcctgataagaaga-tcagtgctcttctggt 347

                                                                       
Query: 354 acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
           ||||||||||||| || |  ||||| || |||||||||||||| || ||||| ||||| |
Sbjct: 346 acttgcggatctcacgcaacgccaccgtaccgggcctgtagcgatggggctttttcactc 287

                                                                       
Query: 414 cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
           ||||||| ||||| |||||||| |  || |||||||||||||||||||| || || ||||
Sbjct: 286 cgccggtcgtcggtgccgacttacgagcagccttggtggcgagctgcttacgaggggcct 227

                                                       
Query: 474 tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | |||||||||||||||||| || |||||||| |||||||||||
Sbjct: 226 taccgccggtggacttgcgg-gcagtctgcttcgtacgggccat 184

---

>dbj|AB195974.1| Lilium longiflorum MPH3 mRNA for histone H3, complete cds
          Length = 631

 Score =  270 bits (136), Expect = 4e-69
 Identities = 339/404 (83%), Gaps = 2/404 (0%)
 Strand = Plus / Minus

                                                                       
Query: 114 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
           ||||||||||||||| || || |||||||||||||| |||||||| || |||||||||||
Sbjct: 487 ctcgccacggatgcgacgtgcaagctggatgtccttcggcatgatcgtcacgcgcttggc 428

                                                                       
Query: 174 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 233
            || ||||||||||| || || ||||| ||||| || || ||||| ||||| || |||||
Sbjct: 427 atgaatggcgcacagatttgtatcctcaaacagtcccaccaggtaagcctccgccgcctc 368

                                                                       
Query: 234 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 293
           |||||| || ||||| || |||  |||||| | ||| |||| |||| | ||||| |||||
Sbjct: 367 ctggagagctagcacagcatggctctggaaacggagatcggccttgtaatcctgagcgat 308

                                                                       
Query: 294 ctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggt 353
           ||||||||| || | |||||| |||||||| | ||| || ||  || |||||||||||||
Sbjct: 307 ctccctcacaagcctctggaagggcagcttcctgataagaaga-tcagtgctcttctggt 249

                                                                       
Query: 354 acttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgc 413
           ||||||||||||| || |  ||||| || |||||||||||||| || ||||| ||||| |
Sbjct: 248 acttgcggatctcacgcaacgccaccgtaccgggcctgtagcgatggggctttttcactc 189

                                                                       
Query: 414 cgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcct 473
           ||||||| ||||| |||||||| |  || |||||||||||||||||||| || || ||||
Sbjct: 188 cgccggtcgtcggtgccgacttacgagcagccttggtggcgagctgcttacgaggggcct 129

                                                       
Query: 474 tgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
           | |||||||||||||||||| || |||||||| |||||||||||
Sbjct: 128 taccgccggtggacttgcgg-gcagtctgcttcgtacgggccat 86

---

>gb|AY218163.1| Echinorhynchus gadi histone H3 gene, partial cds
          Length = 327

 Score =  270 bits (136), Expect = 4e-69
 Identities = 276/322 (85%), Gaps = 1/322 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 324 cttggcgtggatggcgcacaggttggtgtcctcgaacagrccgaccaggtaagcctcgct 265

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 264 ggcctcctgaagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 205

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||||||||||||||||||| |||||||||||||||||||| ||| |||  ||
Sbjct: 204 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcag-ctcggtggact 146

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||| | |||||||| |  |||||||||| |||||||||||| || || |||||||
Sbjct: 145 tctggtacctacggatctctctcagggccacggwcccgggcctgtaacgatggggcttct 86

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           ||||||||||||||| ||| ||   ||| |  || |||||||||||||||||||| | ||
Sbjct: 85  tcacgccgccggtggccggggcgctcttacgggcagccttggtggcgagctgcttcctgg 26

                                 
Query: 468 gcgccttgccgccggtggactt 489
           | || ||||| |||||||||||
Sbjct: 25  gggctttgccaccggtggactt 4

---

>gb|AY520711.1| Chthamalus challengeri histone H3 gene, partial cds
          Length = 328

 Score =  268 bits (135), Expect = 2e-68
 Identities = 280/327 (85%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           |||||||||||||||||||||||||||||||| |||||||| ||||| ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcttcgaacagaccgaccaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
             ||||||||| |||||||  || |||  |  |||||| |  |||||||||||||| |||
Sbjct: 267 ctagcctcctgcagggccatgacagcgctgctctggaaacgcaggtcggtcttgaaatcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| |  ||||| ||||||||||||||||||||||| |||||| ||||||||
Sbjct: 207 tgagcgatctcacggaccagacgctggaacggcagcttgcggatgagcagc-tccgtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    |||||||| |||||||| || || ||||||||||| ||||| |||||
Sbjct: 148 cttctggtagcgacggatctcacggagggcaacagttccgggcctgtaacggtggggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||||||||||||||||| ||||||   ||| |  || ||||||||||| |||||||| ||
Sbjct: 88  cttcacgccgccggtggccggcgcgctcttacgagcggccttggtggccagctgcttccg 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
           |||||||||||| || |||||||||||
Sbjct: 28  gggcgccttgccacccgtggacttgcg 2

---

>gb|AY520694.1| Semibalanus balanoides histone H3 gene, partial cds
          Length = 328

 Score =  268 bits (135), Expect = 2e-68
 Identities = 280/327 (85%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           ||||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagaccaaccaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
             ||||||||| ||||||| |||||||  |  |||||| | ||| || ||||||||||||
Sbjct: 267 ctagcctcctgaagggccatcacggcgctgctctggaagcggagatccgtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| | |||||| ||||||||||||||||||||||||||||| ||| |||||
Sbjct: 207 tgggcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcag-ctcagtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||   ||||||||| || || ||||| || ||||| | ||| ||||| |||||
Sbjct: 148 cttctggtagcggcggatctcacgcagcgccaccgtgccgggacggtaacggtggggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| |||||||| |||| ||||||   ||| |  || ||||||||||| |||||||||||
Sbjct: 88  cttgacgccgccagtggccggcgcgctcttgcgagcggccttggtggccagctgcttgcg 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
            ||||||||||| ||||||||||||||
Sbjct: 28  tggcgccttgccaccggtggacttgcg 2

---

>gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequence
          Length = 517

 Score =  268 bits (135), Expect = 2e-68
 Identities = 298/351 (84%), Gaps = 1/351 (0%)
 Strand = Plus / Plus

                                                                       
Query: 136 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 195
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 147 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 206

                                                                       
Query: 196 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 255
           |||||||| || ||||| ||||| ||||||   ||||||||||| ||||  ||||||  |
Sbjct: 207 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 266

                                                                       
Query: 256 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 315
             |||||| |  |||||||||||||||||||| |||||||| |  ||||| |||||||| 
Sbjct: 267 ctctggaagcgcaggtcggtcttgaagtcctgagcgatctcacggaccagacgctggaag 326

                                                                       
Query: 316 ggcagcttgcggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggc 375
           ||||||||||||||||| || ||| ||||||||||||||    |||||||| || |||||
Sbjct: 327 ggcagcttgcggatcagaag-ctcagtgctcttctggtagcgacggatctcacgtagggc 385

                                                                       
Query: 376 cacggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgactt 435
            ||||| ||||| |||||||| || || ||||| || ||||||||||  |||||   |||
Sbjct: 386 tacggtgccgggtctgtagcgatggggtttcttgacaccgccggtggcgggcgcactctt 445

                                                              
Query: 436 cctcgccgccttggtggcgagctgcttgcggggcgccttgccgccggtgga 486
            |  |||||||||||||||||||| ||||||||||| || || ||||||||
Sbjct: 446 acgggccgccttggtggcgagctgtttgcggggcgctttaccaccggtgga 496

---

>gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence
          Length = 517

 Score =  268 bits (135), Expect = 2e-68
 Identities = 298/351 (84%), Gaps = 1/351 (0%)
 Strand = Plus / Minus

                                                                       
Query: 136 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 195
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 371 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 312

                                                                       
Query: 196 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 255
           |||||||| || ||||| ||||| ||||||   ||||||||||| ||||  ||||||  |
Sbjct: 311 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 252

                                                                       
Query: 256 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 315
             |||||| |  |||||||||||||||||||| |||||||| |  ||||| |||||||| 
Sbjct: 251 ctctggaagcgcaggtcggtcttgaagtcctgagcgatctcacggaccagacgctggaag 192

                                                                       
Query: 316 ggcagcttgcggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggc 375
           ||||||||||||||||| || ||| ||||||||||||||    |||||||| || |||||
Sbjct: 191 ggcagcttgcggatcagaag-ctcagtgctcttctggtagcgacggatctcacgtagggc 133

                                                                       
Query: 376 cacggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgactt 435
            ||||| ||||| |||||||| || || ||||| || ||||||||||  |||||   |||
Sbjct: 132 tacggtgccgggtctgtagcgatggggtttcttgacaccgccggtggcgggcgcactctt 73

                                                              
Query: 436 cctcgccgccttggtggcgagctgcttgcggggcgccttgccgccggtgga 486
            |  |||||||||||||||||||| ||||||||||| || || ||||||||
Sbjct: 72  gcgggccgccttggtggcgagctgtttgcggggcgctttaccaccggtgga 22

---

>gb|BC084311.1| Xenopus laevis cDNA clone IMAGE:6865011
          Length = 1959

 Score =  266 bits (134), Expect = 7e-68
 Identities = 346/414 (83%), Gaps = 2/414 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 440 gccctctcgccccggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 381

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| ||||  ||||| || || ||||||   
Sbjct: 380 ttggcgtggatggcgcacaggttggtgtcctcaaacaaaccgaccagataagcctcgctg 321

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||| 
Sbjct: 320 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctga 261

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| |  |||||||||||||| ||||| |||||||| |||||| || |||   ||
Sbjct: 260 gcgatctcacggaccaggcgctggaaaggcagtttgcggatgagcagc-tcggtggattt 202

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   ||||||||||||||| || || || ||||||| ||| |||||||| |||||
Sbjct: 201 ctggtagcggcggatctcgcggagagcgactgtgccgggccggtaacggtgaggtttctt 142

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            || ||||| |||| ||| ||   |||||| || ||||||||||| ||||||||||||||
Sbjct: 141 gactccgcctgtggccggagcgctcttcctggctgccttggtggccagctgcttgcgggg 82

                                                                 
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatggcga 522
            ||||| || |||||||| || ||| ||||||||||||||||| ||||| ||||
Sbjct: 81  agccttccctccggtggatttacgg-gcggtctgcttggtacgagccattgcga 29

---

>gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequence
          Length = 438

 Score =  266 bits (134), Expect = 7e-68
 Identities = 297/350 (84%), Gaps = 1/350 (0%)
 Strand = Plus / Plus

                                                                       
Query: 136 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 195
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 68  agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 127

                                                                       
Query: 196 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 255
           |||||||| || ||||| ||||| ||||||   ||||||||||| ||||  ||||||  |
Sbjct: 128 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 187

                                                                       
Query: 256 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 315
             |||||| |  |||||||||||||||||||| |||||||| |  ||||| |||||||| 
Sbjct: 188 ctctggaagcgcaggtcggtcttgaagtcctgagcgatctcacggaccagacgctggaag 247

                                                                       
Query: 316 ggcagcttgcggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggc 375
           ||||||||||||||||| || ||| ||||||||||||||    |||||||| || |||||
Sbjct: 248 ggcagcttgcggatcagaag-ctcagtgctcttctggtagcgacggatctcacgtagggc 306

                                                                       
Query: 376 cacggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgactt 435
            ||||| ||||| |||||||| || || ||||| || ||||||||||  |||||   |||
Sbjct: 307 tacggtgccgggtctgtagcgatggggtttcttgacaccgccggtggcgggcgcactctt 366

                                                             
Query: 436 cctcgccgccttggtggcgagctgcttgcggggcgccttgccgccggtgg 485
            |  |||||||||||||||||||| ||||||||||| || || |||||||
Sbjct: 367 acgggccgccttggtggcgagctgtttgcggggcgctttaccaccggtgg 416

---

>gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequence
          Length = 490

 Score =  264 bits (133), Expect = 3e-67
 Identities = 296/349 (84%), Gaps = 1/349 (0%)
 Strand = Plus / Plus

                                                                       
Query: 136 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 195
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 121 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 180

                                                                       
Query: 196 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 255
           |||||||| || ||||| ||||| ||||||   ||||||||||| ||||  ||||||  |
Sbjct: 181 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 240

                                                                       
Query: 256 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 315
             |||||| |  |||||||||||||||||||| |||||||| |  ||||| |||||||| 
Sbjct: 241 ctctggaagcgcaggtcggtcttgaagtcctgagcgatctcacggaccagacgctggaag 300

                                                                       
Query: 316 ggcagcttgcggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggc 375
           ||||||||||||||||| || ||| ||||||||||||||    |||||||| || |||||
Sbjct: 301 ggcagcttgcggatcagaag-ctcagtgctcttctggtagcgacggatctcacgtagggc 359

                                                                       
Query: 376 cacggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgactt 435
            ||||| ||||| |||||||| || || ||||| || ||||||||||  |||||   |||
Sbjct: 360 tacggtgccgggtctgtagcgatggggtttcttgacaccgccggtggcgggcgcactctt 419

                                                            
Query: 436 cctcgccgccttggtggcgagctgcttgcggggcgccttgccgccggtg 484
            |  |||||||||||||||||||| ||||||||||| || || ||||||
Sbjct: 420 gcgggccgccttggtggcgagctgtttgcggggcgctttaccaccggtg 468

---

>gb|AY555567.1| Heterojapyx sp. GG-2001 histone H3 gene, partial cds
          Length = 327

 Score =  264 bits (133), Expect = 3e-67
 Identities = 279/327 (85%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           |||||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||
Sbjct: 326 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagccccacgaggtaggcctcg 267

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| ||||||| ||||||   |  |||||| |  ||||||||||||||||||
Sbjct: 266 ctcgcctcctgcagggccatcacggcagagctctggaagcgcaggtcggtcttgaagtcc 207

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           ||||||||||| | ||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 206 tgcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag-ctccgtgct 148

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    |||||||| || |||||||| || |||||||||||||| || |||||
Sbjct: 147 cttctggtagcgacggatctcccgcagggccaccgtgccgggcctgtagcgatgcggctt 88

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           |||||| ||||| ||||  || ||   ||| |  |||||||| ||||| |||||||||||
Sbjct: 87  cttcactccgcccgtggcgggmgcgctcttgcgggccgccttcgtggccagctgcttgcg 28

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
            || |||||||| ||||| ||||||||
Sbjct: 27  aggggccttgccaccggtcgacttgcg 1

---

>gb|AF093108.1|AF093108 Tortula ruralis histone H3 (rnp49) mRNA, partial cds
          Length = 401

 Score =  264 bits (133), Expect = 3e-67
 Identities = 278/325 (85%), Gaps = 1/325 (0%)
 Strand = Plus / Minus

                                                                       
Query: 129 gcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacag 188
           |||||| |||||||||||||| ||||||||||| || | ||| ||||||||||| |||| 
Sbjct: 331 gcgggccagctggatgtccttcggcatgatggtcaccctcttcgcgtggatggcacacaa 272

                                                                       
Query: 189 gttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcac 248
           |||||||||||||||||| || || ||||||||||| || |||||||| || ||||||||
Sbjct: 271 gttggtgtcctcgaacagacccaccaggtacgcctccgccgcctcctgcagcgccagcac 212

                                                                       
Query: 249 ggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcg 308
           |||||||  |||||| |  || ||||||||||||||||| |||||||| |  ||||| | 
Sbjct: 211 ggcgtggctctggaaacgcagatcggtcttgaagtcctgggcgatctcacgaaccagcct 152

                                                                       
Query: 309 ctggaacggcagcttgcggatcagcagcctccgtgctcttctggtacttgcggatctcgc 368
           |||||| |||||||||||||||||||  ||| || ||||||||||||||||||||||| |
Sbjct: 151 ctggaagggcagcttgcggatcagca-actcggtactcttctggtacttgcggatctcac 93

                                                                       
Query: 369 ggagggccacggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggtcggcg 428
           | || || ||||| || ||||||||||| || ||||||||||| || ||||| || || |
Sbjct: 92  gaagagcgacggttcccggcctgtagcgatggggcttcttcactcctccggtcgtggggg 33

                                    
Query: 429 ccgacttcctcgccgccttggtggc 453
           ||||||||||||| ||||| |||||
Sbjct: 32  ccgacttcctcgcagccttcgtggc 8

---

>gb|AY520706.1| Tetraclitella purpurascens histone H3 gene, partial cds
          Length = 328

 Score =  262 bits (132), Expect = 1e-66
 Identities = 279/327 (85%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           ||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcaaacaggccgaccaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| |||||||  ||||||  |  |||||| |  ||||||||||||||||||
Sbjct: 267 ctggcctcctgcagggccatnacggcgctgctctggaagcgcaggtcggtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || || ||||| | |||||| ||||||||||||||||||||||||||||| ||| |||||
Sbjct: 207 tgggcaatctcgcgcaccagacgctggaacggcagcttgcggatcagcag-ctcggtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    |||||||| || ||||| || || ||||| | ||||||||| |||||
Sbjct: 148 cttctggtagcgacggatctcacgcagggcgaccgtgccgggacggtagcggtggggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| ||||||||||||| ||||||   ||| |  || ||||||||||| |||||||||||
Sbjct: 88  cttgacgccgccggtggccggcgcgctcttgcgagcggccttggtggccagctgcttgcg 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
            ||||||||||| ||||||||||||||
Sbjct: 28  cggcgccttgccaccggtggacttgcg 2

---

>gb|AY521731.1| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  262 bits (132), Expect = 1e-66
 Identities = 292/344 (84%), Gaps = 1/344 (0%)
 Strand = Plus / Minus

                                                                       
Query: 150 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 209
           |||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatcgcgcacaggttcgtgtcctcgaacaggcc 295

                                                                       
Query: 210 gacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgag 269
           ||| ||||||||||||   |||||||| |||||||  |||||   |  |||||| | |||
Sbjct: 294 gacgaggtacgcctcgctggcctcctgcagggccatgacggccgagctctggaagcggag 235

                                                                       
Query: 270 gtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggat 329
           |||||||||||||||||| |||||||| | |||||| |||||||| ||||||||||||||
Sbjct: 234 gtcggtcttgaagtcctgggcgatctcgcgcaccagacgctggaagggcagcttgcggat 175

                                                                       
Query: 330 cagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcc 389
           ||| || ||| ||||||||||||||   ||||||||| | ||| || || || || ||||
Sbjct: 174 caggag-ctcggtgctcttctggtagcggcggatctccctgagcgcgaccgttcccggcc 116

                                                                       
Query: 390 tgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgccttgg 449
           ||||||| || |||||||| ||||| ||||||| ||| ||   ||| | |||||||||||
Sbjct: 115 tgtagcgatggggcttcttgacgcctccggtggccggggcgctcttgcgcgccgccttgg 56

                                                       
Query: 450 tggcgagctgcttgcggggcgccttgccgccggtggacttgcgg 493
           |||| |||||||| | ||||||||| || |||||||| ||||||
Sbjct: 55  tggccagctgcttcctgggcgccttacctccggtggatttgcgg 12

---

>gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462
          Length = 2706

 Score =  260 bits (131), Expect = 4e-66
 Identities = 342/410 (83%), Gaps = 2/410 (0%)
 Strand = Plus / Minus

                                                                        
Query: 109  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
            ||||||||||| ||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 2289 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 2230

                                                                        
Query: 169  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
            |||||||||||||||||||||||||||||||| || ||||| || ||||| ||||||   
Sbjct: 2229 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 2170

                                                                        
Query: 229  gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
            ||||| || || |||| ||| |||  |  |||||| |  | |||||||||||||||||||
Sbjct: 2169 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 2110

                                                                        
Query: 289  gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
            |||||||| | |||||| ||||| || |||||||| | |||||||||| || |||  |||
Sbjct: 2109 gcgatctcacgcaccagacgctgaaaaggcagctttctgatcagcagc-tcggtggactt 2051

                                                                        
Query: 349  ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
            ||||||   ||| ||||||||||| ||||| || || ||||  ||||| || ||||||||
Sbjct: 2050 ctggtagcggcgaatctcgcggagagccactgtaccaggccgatagcgatggggcttctt 1991

                                                                        
Query: 409  cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
             || |||||||||| ||| ||   |||||  |||||||||||||| ||||||||||| ||
Sbjct: 1990 gacaccgccggtggccggagcgctcttccgagccgccttggtggccagctgcttgcgcgg 1931

                                                              
Query: 469  cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
             |||||||||||||||||||||| | || |||||||| ||||| ||||||
Sbjct: 1930 agccttgccgccggtggacttgc-gagcagtctgcttcgtacgcgccatg 1882

---

>gb|BC007518.2| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:4577
           IMAGE:3030790), complete cds
          Length = 1387

 Score =  260 bits (131), Expect = 4e-66
 Identities = 342/410 (83%), Gaps = 2/410 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| ||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 545 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 486

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| || ||||| || ||||| ||||||   
Sbjct: 485 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 426

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           ||||| || || |||| ||| |||  |  |||||| |  | |||||||||||||||||||
Sbjct: 425 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 366

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||| ||||| || |||||||| | |||||||||| || |||  |||
Sbjct: 365 gcgatctcacgcaccagacgctgaaaaggcagctttctgatcagcagc-tcggtggactt 307

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   ||| ||||||||||| ||||| || || ||||  ||||| || ||||||||
Sbjct: 306 ctggtagcggcgaatctcgcggagagccactgtaccaggccgatagcgatggggcttctt 247

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            || |||||||||| ||| ||   |||||  |||||||||||||| ||||||||||| ||
Sbjct: 246 gacaccgccggtggccggagcgctcttccgagccgccttggtggccagctgcttgcgcgg 187

                                                             
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
            |||||||||||||||||||||| | || |||||||| ||||| ||||||
Sbjct: 186 agccttgccgccggtggacttgc-gagcagtctgcttcgtacgcgccatg 138

---

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  260 bits (131), Expect = 4e-66
 Identities = 342/410 (83%), Gaps = 2/410 (0%)
 Strand = Plus / Plus

                                                                         
Query: 109   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
             ||||||||||| ||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 83972 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 84031

                                                                         
Query: 169   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
             |||||||||||||||||||||||||||||||| || ||||| || ||||| ||||||   
Sbjct: 84032 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 84091

                                                                         
Query: 229   gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
             ||||| || || |||| ||| |||  |  |||||| |  | |||||||||||||||||||
Sbjct: 84092 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 84151

                                                                         
Query: 289   gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
             |||||||| | |||||| ||||| || |||||||| | |||||||||| || |||  |||
Sbjct: 84152 gcgatctcacgcaccagacgctgaaaaggcagctttctgatcagcagc-tcggtggactt 84210

                                                                         
Query: 349   ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
             ||||||   ||| ||||||||||| ||||| || || ||||  ||||| || ||||||||
Sbjct: 84211 ctggtagcggcgaatctcgcggagagccactgtaccaggccgatagcgatggggcttctt 84270

                                                                         
Query: 409   cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
              || |||||||||| ||| ||   |||||  |||||||||||||| ||||||||||| ||
Sbjct: 84271 gacaccgccggtggccggagcgctcttccgagccgccttggtggccagctgcttgcgcgg 84330

                                                               
Query: 469   cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
              |||||||||||||||||||||| | || |||||||| ||||| ||||||
Sbjct: 84331 agccttgccgccggtggacttgc-gagcagtctgcttcgtacgcgccatg 84379



 Score =  222 bits (112), Expect = 9e-55
 Identities = 317/384 (82%), Gaps = 1/384 (0%)
 Strand = Plus / Minus

                                                                         
Query: 109   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
             |||||||| || ||||||||||| || ||||||||||| || ||||| || |||||||| 
Sbjct: 22543 gccctctcccctcggatgcggcgcgcaagctggatgtctttaggcataatagtgacgcgt 22484

                                                                         
Query: 169   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
             |||||||| ||||||||||||||||| ||||| || ||||| || ||||| ||||||  |
Sbjct: 22483 ttggcgtgaatggcgcacaggttggtatcctcaaatagccccaccaggtaggcctcgcaa 22424

                                                                         
Query: 229   gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
             |||||||| || |||| ||| ||   |  |||||| |  || |||||||| |||||||| 
Sbjct: 22423 gcctcctgcagcgccatcaccgccgagctctggaagcgcagatcggtcttaaagtcctgt 22364

                                                                         
Query: 289   gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
             ||||||||||  |||| |||||| || || ||||| ||||| |||||| || ||   |||
Sbjct: 22363 gcgatctcccgtaccaagcgctgaaaaggtagcttccggattagcagc-tcggtcgactt 22305

                                                                         
Query: 349   ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
             ||||||   |||||||||||| ||||||||||| ||||| | ||||||||| ||||||||
Sbjct: 22304 ctggtagcggcggatctcgcgcagggccacggtgccggggcggtagcggtggggcttctt 22245

                                                                         
Query: 409   cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
              ||||| ||||||| ||| ||   ||| |  |||||||||||||| ||||||||||| ||
Sbjct: 22244 gacgccaccggtggccggagcgctcttgcgagccgccttggtggccagctgcttgcgcgg 22185

                                     
Query: 469   cgccttgccgccggtggacttgcg 492
             ||| ||||||||||||||||||||
Sbjct: 22184 cgctttgccgccggtggacttgcg 22161



 Score =  109 bits (55), Expect = 1e-20
 Identities = 203/250 (81%), Gaps = 2/250 (0%)
 Strand = Plus / Minus

                                                                        
Query: 268  aggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcgg 327
            |||||||| ||||| ||||||||||| || | |||||||||||| || ||||| ||||||
Sbjct: 3907 aggtcggttttgaaatcctgcgcgatttctcgcaccaggcgctgaaatggcagtttgcgg 3848

                                                                        
Query: 328  atcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccggg 387
            || ||||| ||| ||   |||||| ||   ||||||||| || | ||||||||| || ||
Sbjct: 3847 atgagcag-ctcagtcgacttctgataacggcggatctcacgcaaggccacggtgcctgg 3789

                                                                        
Query: 388  cctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgcctt 447
            |||||||||||| ||||||||||| ||||| || |  || ||    || | ||| |||||
Sbjct: 3788 cctgtagcggtggggcttcttcacaccgccagtcgctggagcgcttttgcgcgctgcctt 3729

                                                                        
Query: 448  ggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgcttgg 507
            |||||| |||||||| || || |||||||||||||| ||||||| | || |||||||| |
Sbjct: 3728 ggtggccagctgcttccgcggtgccttgccgccggtagacttgc-gagctgtctgcttcg 3670

                      
Query: 508  tacgggccat 517
            | ||||||||
Sbjct: 3669 tccgggccat 3660



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Minus

                                                                        
Query: 114  ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 173
            |||||||||||| || || || |||||||||||||| ||||| || ||||| ||||||||
Sbjct: 4061 ctcgccacggatacgacgcgcaagctggatgtccttaggcataatagtgacacgcttggc 4002

                                    
Query: 174  gtggatggcgcacaggttggtgtc 197
            ||| || || || |||||||||||
Sbjct: 4001 gtgaatagcacagaggttggtgtc 3978

---

>ref|NM_003536.2| Homo sapiens histone 1, H3h (HIST1H3H), mRNA
          Length = 473

 Score =  260 bits (131), Expect = 4e-66
 Identities = 342/410 (83%), Gaps = 2/410 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| ||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 417 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 358

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| || ||||| || ||||| ||||||   
Sbjct: 357 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 298

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           ||||| || || |||| ||| |||  |  |||||| |  | |||||||||||||||||||
Sbjct: 297 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 238

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||| ||||| || |||||||| | |||||||||| || |||  |||
Sbjct: 237 gcgatctcacgcaccagacgctgaaaaggcagctttctgatcagcagc-tcggtggactt 179

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   ||| ||||||||||| ||||| || || ||||  ||||| || ||||||||
Sbjct: 178 ctggtagcggcgaatctcgcggagagccactgtaccaggccgatagcgatggggcttctt 119

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            || |||||||||| ||| ||   |||||  |||||||||||||| ||||||||||| ||
Sbjct: 118 gacaccgccggtggccggagcgctcttccgagccgccttggtggccagctgcttgcgcgg 59

                                                             
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
            |||||||||||||||||||||| | || |||||||| ||||| ||||||
Sbjct: 58  agccttgccgccggtggacttgc-gagcagtctgcttcgtacgcgccatg 10

---

>gb|AY520704.1| Elminius kingii histone H3 gene, partial cds
          Length = 328

 Score =  260 bits (131), Expect = 4e-66
 Identities = 279/327 (85%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           ||||| ||||| ||||||||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 327 cgcttagcgtgaatggcgcacaggttggtgtcctcgaacagaccaaccaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| |||||||  ||||||  |  |||||| |  ||||||||||||||||||
Sbjct: 267 ctggcctcctgcagggccatgacggcgctgctctggaagcgcaggtcggtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| | |||||| ||||||||||||||||||||||||||||| ||| |||||
Sbjct: 207 tgggcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcag-ctcggtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    |||||||| || ||||| ||||| ||||| | ||||||||| |||||
Sbjct: 148 cttctggtagcgacggatctcacgcagggcgacggtaccgggacggtagcggtggggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| ||||||||||||| ||||||   ||| |  || ||||||||||| |||||||||||
Sbjct: 88  cttgacgccgccggtggccggcgcgctcttgcgagcggccttggtggccagctgcttgcg 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
            ||||||||||| ||||||||||||||
Sbjct: 28  tggcgccttgccaccggtggacttgcg 2

---

>gb|AF531281.1| Homo sapiens histone H3 (HIST1H3H) gene, complete cds
          Length = 1227

 Score =  260 bits (131), Expect = 4e-66
 Identities = 342/410 (83%), Gaps = 2/410 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| ||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 817 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 758

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| || ||||| || ||||| ||||||   
Sbjct: 757 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 698

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           ||||| || || |||| ||| |||  |  |||||| |  | |||||||||||||||||||
Sbjct: 697 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 638

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||| ||||| || |||||||| | |||||||||| || |||  |||
Sbjct: 637 gcgatctcacgcaccagacgctgaaaaggcagctttctgatcagcagc-tcggtggactt 579

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   ||| ||||||||||| ||||| || || ||||  ||||| || ||||||||
Sbjct: 578 ctggtagcggcgaatctcgcggagagccactgtaccaggccgatagcgatggggcttctt 519

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            || |||||||||| ||| ||   |||||  |||||||||||||| ||||||||||| ||
Sbjct: 518 gacaccgccggtggccggagcgctcttccgagccgccttggtggccagctgcttgcgcgg 459

                                                             
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
            |||||||||||||||||||||| | || |||||||| ||||| ||||||
Sbjct: 458 agccttgccgccggtggacttgc-gagcagtctgcttcgtacgcgccatg 410

---

>gb|AY125233.1| Isoperla davisi histone 3 gene, partial cds
          Length = 372

 Score =  260 bits (131), Expect = 4e-66
 Identities = 288/339 (84%), Gaps = 1/339 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttcgtgtcctcgaac 309

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||| ||||| ||||||  ||||||||| ||||||| |||||||  |  |||||| 
Sbjct: 308 agaccgacgaggtaggcctcgctagcctcctgcagggccatcacggcggagctctggaaa 249

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           | |||||||||||| ||||||||||||||||| |  || || |||||||| |||| ||| 
Sbjct: 248 cggaggtcggtcttaaagtcctgcgcgatctcgcgaacgagacgctggaagggcaacttc 189

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           | ||| || || ||| || |||||||||||    ||||||||||| || || || || ||
Sbjct: 188 ctgatgagtag-ctcggtactcttctggtagcgacggatctcgcgaagtgcgaccgtgcc 130

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||| |  || ||||| |||||||| |||||||||||||  |||||   ||||||||||||
Sbjct: 129 gggacgataacggtggggcttcttaacgccgccggtggcgggcgcgctcttcctcgccgc 70

                                                  
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggt 483
           ||||||||||||||||||||| || ||||||||||||||
Sbjct: 69  cttggtggcgagctgcttgcgcggtgccttgccgccggt 31

---

>gb|AY125229.1| Argia vivida histone 3 gene, partial cds
          Length = 372

 Score =  260 bits (131), Expect = 4e-66
 Identities = 310/367 (84%), Gaps = 2/367 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 309

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || ||||| ||||| |||||||  |||||||| || ||||  ||||||  |  |||||| 
Sbjct: 308 agaccgacgaggtaggcctcggacgcctcctgcagagccatgacggcggagctctggaag 249

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           | ||||||||||||||||||||| |||||||| |  |||||||||||||| |||||||||
Sbjct: 248 cggaggtcggtcttgaagtcctgggcgatctcgcggaccaggcgctggaagggcagcttg 189

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           |||||||| || ||| ||||||||||||||  | | |||||| |||||||||||||| ||
Sbjct: 188 cggatcagaag-ctcggtgctcttctggtatctcctgatctcacggagggccacggtacc 130

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
           ||| |  || | ||| ||||||||||| || ||||| | ||||||   ||| |  || ||
Sbjct: 129 gggacgatacctgtggggcttcttcacaccaccggttgccggcgcgctcttgcgagcggc 70

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           ||||||||| |||||||| | ||| || ||||| ||||| ||||| ||| || |||||||
Sbjct: 69  cttggtggccagctgcttcctgggggctttgcctccggtcgacttacgg-gccgtctgct 11

                  
Query: 505 tggtacg 511
           |||||||
Sbjct: 10  tggtacg 4

---

>emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 on chromosome 6p21.3-22.2
              Contains a novel pseudogene, a 60S Ribosomal protein L30
              (RPL30) pseudogene, H4 histone family member F pseudogene
              H4FFP and histone genes H2BFC, H2AFC, H3FK. Contains ESTs,
              STSs, GSSs and two CpG islands, complete sequence
          Length = 139904

 Score =  260 bits (131), Expect = 4e-66
 Identities = 342/410 (83%), Gaps = 2/410 (0%)
 Strand = Plus / Minus

                                                                          
Query: 109    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
              ||||||||||| ||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 138631 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 138572

                                                                          
Query: 169    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
              |||||||||||||||||||||||||||||||| || ||||| || ||||| ||||||   
Sbjct: 138571 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 138512

                                                                          
Query: 229    gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
              ||||| || || |||| ||| |||  |  |||||| |  | |||||||||||||||||||
Sbjct: 138511 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 138452

                                                                          
Query: 289    gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
              |||||||| | |||||| ||||| || |||||||| | |||||||||| || |||  |||
Sbjct: 138451 gcgatctcacgcaccagacgctgaaaaggcagctttctgatcagcagc-tcggtggactt 138393

                                                                          
Query: 349    ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
              ||||||   ||| ||||||||||| ||||| || || ||||  ||||| || ||||||||
Sbjct: 138392 ctggtagcggcgaatctcgcggagagccactgtaccaggccgatagcgatggggcttctt 138333

                                                                          
Query: 409    cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
               || |||||||||| ||| ||   |||||  |||||||||||||| ||||||||||| ||
Sbjct: 138332 gacaccgccggtggccggagcgctcttccgagccgccttggtggccagctgcttgcgcgg 138273

                                                                
Query: 469    cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
               |||||||||||||||||||||| | || |||||||| ||||| ||||||
Sbjct: 138272 agccttgccgccggtggacttgc-gagcagtctgcttcgtacgcgccatg 138224

---

>emb|Z83735.1|HSZ83735 H.sapiens hH3/k gene
          Length = 819

 Score =  260 bits (131), Expect = 4e-66
 Identities = 342/410 (83%), Gaps = 2/410 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| ||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 726 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 667

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| || ||||| || ||||| ||||||   
Sbjct: 666 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 607

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           ||||| || || |||| ||| |||  |  |||||| |  | |||||||||||||||||||
Sbjct: 606 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 547

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| | |||||| ||||| || |||||||| | |||||||||| || |||  |||
Sbjct: 546 gcgatctcacgcaccagacgctgaaaaggcagctttctgatcagcagc-tcggtggactt 488

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   ||| ||||||||||| ||||| || || ||||  ||||| || ||||||||
Sbjct: 487 ctggtagcggcgaatctcgcggagagccactgtaccaggccgatagcgatggggcttctt 428

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            || |||||||||| ||| ||   |||||  |||||||||||||| ||||||||||| ||
Sbjct: 427 gacaccgccggtggccggagcgctcttccgagccgccttggtggccagctgcttgcgcgg 368

                                                             
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccatg 518
            |||||||||||||||||||||| | || |||||||| ||||| ||||||
Sbjct: 367 agccttgccgccggtggacttgc-gagcagtctgcttcgtacgcgccatg 319

---

>gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence
          Length = 517

 Score =  260 bits (131), Expect = 4e-66
 Identities = 297/351 (84%), Gaps = 1/351 (0%)
 Strand = Plus / Minus

                                                                       
Query: 136 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 195
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 370 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 311

                                                                       
Query: 196 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 255
           ||||||||  | ||||| ||||| ||||||   ||||||||||| ||||  ||||||  |
Sbjct: 310 tcctcgaagggaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 251

                                                                       
Query: 256 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 315
             |||||| |  |||||||||||||||||||| |||||||| |  ||||| |||||||| 
Sbjct: 250 ctctggaagcgcaggtcggtcttgaagtcctgagcgatctcacggaccagacgctggaag 191

                                                                       
Query: 316 ggcagcttgcggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggc 375
           ||||||||||||||||| ||| || ||||||||||||||    |||||||| || |||||
Sbjct: 190 ggcagcttgcggatcagaagc-tcagtgctcttctggtagcgacggatctcacgtagggc 132

                                                                       
Query: 376 cacggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgactt 435
            ||||| ||||| |||||||| || || ||||| || ||||||||||  |||||   |||
Sbjct: 131 tacggtgccgggtctgtagcgatggggtttcttgacaccgccggtggcgggcgcactctt 72

                                                              
Query: 436 cctcgccgccttggtggcgagctgcttgcggggcgccttgccgccggtgga 486
            |  |||||||||||||||||||| ||||||||||| || || ||||||||
Sbjct: 71  acgggccgccttggtggcgagctgtttgcggggcgctttaccaccggtgga 21

---

>gb|AY655591.1| Cololabis saira histone H3a gene, partial cds
          Length = 333

 Score =  258 bits (130), Expect = 2e-65
 Identities = 274/322 (85%), Gaps = 1/322 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtargcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| |||||||  ||||||  |  |||||| |  ||||||||||||||| ||||
Sbjct: 269 ggcctcctgcagggccatgacggcggagctctggaagcgcaggtcggtcttgaagycctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||| |||||||| |||||||| |||||||||||||||||||| || ||||  ||
Sbjct: 209 agcgatctctctcaccagmcgctggaagggcagcttgcggatcagcag-ctmcgtggact 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| |  || |||||||| |||||||||||||||||||||||||
Sbjct: 150 tctggtagcggcggatctccctcagagccacggtaccgggcctgtagcggtgaggcttct 91

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           |||| |||||||||| ||| ||   |||||  || ||||||||||| |||||||| | ||
Sbjct: 90  tcactccgccggtggccggggcgctcttccgggcggccttggtggccagctgcttcctgg 31

                                 
Query: 468 gcgccttgccgccggtggactt 489
           | || ||||| |||||||||||
Sbjct: 30  gggctttgcctccggtggactt 9

---

>gb|AY655588.1| Menidia menidia histone H3a gene, partial cds
          Length = 333

 Score =  258 bits (130), Expect = 2e-65
 Identities = 274/322 (85%), Gaps = 1/322 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
           |||||||||||| |||||||||||||| |||||||||||||||||||| ||| |||  ||
Sbjct: 209 cgcgatctccctgaccaggcgctggaagggcagcttgcggatcagcag-ctcggtggact 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| || || |||||||| ||||||||||| ||||| |||||||
Sbjct: 150 tctggtagcggcggatctcccgcagagccacggttccgggcctgtaacggtggggcttct 91

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           | ||||||||||||| ||| ||   ||| |  || ||||||||||| |||||||| | ||
Sbjct: 90  tsacgccgccggtggccggmgcgctcttacgggcagccttggtggccagctgcttcctgg 31

                                 
Query: 468 gcgccttgccgccggtggactt 489
           | || ||||| |||||||||||
Sbjct: 30  gggctttgcctccggtggactt 9

---

>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4
          Length = 1898

 Score =  258 bits (130), Expect = 2e-65
 Identities = 236/270 (87%), Gaps = 1/270 (0%)
 Strand = Plus / Minus

                                                                        
Query: 109  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
            |||| ||||||||| |||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 1510 gcccgctcgccacgaatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 1451

                                                                        
Query: 169  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
            |||||||||||||||||||||||||| ||||||||||| || || ||||| |||||||||
Sbjct: 1450 ttggcgtggatggcgcacaggttggtatcctcgaacaggcccaccaggtaggcctcggca 1391

                                                                        
Query: 229  gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
            |||||||| || ||||||||||| |||  |||||| |  || || |||||||||||||| 
Sbjct: 1390 gcctcctgcagcgccagcacggcctggctctggaagcgcagatccgtcttgaagtcctgg 1331

                                                                        
Query: 289  gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
            || ||||| | |||||| |||||||| || |||||||| || ||||| ||| || |||||
Sbjct: 1330 gcaatctcgcgcaccagccgctggaaaggaagcttgcgaataagcag-ctcagtactctt 1272

                                          
Query: 349  ctggtacttgcggatctcgcggagggccac 378
            ||||||||| || ||||||||||| |||||
Sbjct: 1271 ctggtacttacgaatctcgcggagagccac 1242



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 68/75 (90%), Gaps = 1/75 (1%)
 Strand = Plus / Minus

                                                                       
Query: 443 gccttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctg 502
           ||||||||||| ||||||||||||||||||||||| ||||||||||||| | || || ||
Sbjct: 927 gccttggtggcaagctgcttgcggggcgccttgccaccggtggacttgc-gagcagtttg 869

                          
Query: 503 cttggtacgggccat 517
           |||||| ||||||||
Sbjct: 868 cttggtgcgggccat 854

---

>gb|DQ284421.1| Pachytriton brevipes histone H3a gene, partial cds
          Length = 328

 Score =  258 bits (130), Expect = 2e-65
 Identities = 277/326 (84%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagagcccgaccaggtaggcctcgct 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| |||||||  || |||  |  |||||| |  ||||||||||| ||||||||
Sbjct: 265 ggcctcctgcagggccatgackgcggagctctggaagcgcaggtcggtcttraagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||||||||| ||||||||| |||||||||||||| || || ||| |||  ||
Sbjct: 205 ggcgatctccctcaccaagcgctggaagggcagcttgcggatgaggag-ctcggtggact 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| ||||| |||||||| ||||||| |||||||||||||||||
Sbjct: 146 tctggtagcggcggatctcwcggagagccacggtgccgggccggtagcggtgaggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           | || ||||||||||  |||||    || |  || ||||||||||| ||||||||||| |
Sbjct: 86  tgaccccgccggtggcaggcgcgcttttgcgagcagccttggtggccagctgcttgcgag 27

                                     
Query: 468 gcgccttgccgccggtggacttgcgg 493
           |||| |||||||||||||||||||||
Sbjct: 26  gcgctttgccgccggtggacttgcgg 1

---

>gb|DQ284081.1| Leptobrachium chapaense histone H3a gene, partial cds
          Length = 328

 Score =  258 bits (130), Expect = 2e-65
 Identities = 277/326 (84%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||| |||||||||||||||||||| || ||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcacacaggttggtgtcctcgaagagkccgaccaggtaagcctcgct 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
           |||||||||||  |||||||||||||| |||||||||||||| ||||| ||| |||  ||
Sbjct: 205 cgcgatctcccggaccaggcgctggaagggcagcttgcggatgagcag-ctcggtggact 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| |||||||||||||| ||||||| |||||||||||||||||
Sbjct: 146 tctggtagcggcggatctctcggagggccacggtgccgggccggtagcggtgaggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           | ||||||||||||| ||| ||   ||| |  || || |||||||| | |||||||||||
Sbjct: 86  tgacgccgccggtggccggggcgctcttgcgggcggctttggtggccarctgcttgcggg 27

                                     
Query: 468 gcgccttgccgccggtggacttgcgg 493
           |||| ||||| |||||||| ||||||
Sbjct: 26  gcgctttgcctccggtggayttgcgg 1

---

>gb|AY520705.1| Tetraclitella divisa histone H3 gene, partial cds
          Length = 328

 Score =  256 bits (129), Expect = 7e-65
 Identities = 277/325 (85%), Gaps = 1/325 (0%)
 Strand = Plus / Minus

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           |||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||
Sbjct: 328 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccaggtaggcctc 269

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| ||||||| |||||||  |  |||||| | ||||||||||||||||||
Sbjct: 268 gctggcctcctgcagggccatcacggcgctgctctggaaacggaggtcggtcttgaagtc 209

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           ||| || ||||| |  ||||| ||||||||||||||||||||||||||||| ||| ||||
Sbjct: 208 ctgagcaatctcgcggaccagacgctggaacggcagcttgcggatcagcag-ctcggtgc 150

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
           ||||||||||    |||||||| || ||||| || || ||||| | |||||||||||| |
Sbjct: 149 tcttctggtagcgacggatctcacgcagggcgaccgtgccgggacggtagcggtgaggtt 90

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||| ||||||||||||| ||||||   ||| |  || ||||| ||||| ||||||||||
Sbjct: 89  tcttgacgccgccggtggccggcgcgctcttgcgagcggccttagtggccagctgcttgc 30

                                    
Query: 465 ggggcgccttgccgccggtggactt 489
           | ||||||||||| ||||| |||||
Sbjct: 29  gcggcgccttgccaccggtcgactt 5

---

>gb|AY520702.1| Austromegabalanus psittacus histone H3 gene, partial cds
          Length = 328

 Score =  256 bits (129), Expect = 7e-65
 Identities = 277/325 (85%), Gaps = 1/325 (0%)
 Strand = Plus / Minus

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           |||||||||||| ||||||||||||||||||||||||||||| ||||| ||||| |||||
Sbjct: 328 gcgcttggcgtgaatggcgcacaggttggtgtcctcgaacaggccgaccaggtaggcctc 269

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| || ||||  || |||  |  |||||| |  |||||||||||||||||
Sbjct: 268 gctggcctcctgcagcgccatgacagcgctgctctggaagcgcaggtcggtcttgaagtc 209

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           ||| |||||||| | |||||| ||||||||||||||||||||||||||||| ||| ||||
Sbjct: 208 ctgggcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcag-ctcggtgc 150

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
           ||||||||||    |||||||| ||||| |||||||| ||||| | |||||| || ||||
Sbjct: 149 tcttctggtagcgacggatctcacggagcgccacggtgccgggacggtagcgatggggct 90

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||| ||||||||||||| ||||||   ||| |  || ||||||||||| ||||||||||
Sbjct: 89  tcttgacgccgccggtggccggcgcgctcttgcgagcggccttggtggccagctgcttgc 30

                                    
Query: 465 ggggcgccttgccgccggtggactt 489
           | ||||||||||||||||| |||||
Sbjct: 29  gcggcgccttgccgccggtagactt 5

---

>gb|AY555569.1| Choroterpes sp. GG-2004 histone H3 gene, partial cds
          Length = 327

 Score =  256 bits (129), Expect = 7e-65
 Identities = 279/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           ||||||||||||||| ||||||||||| |||||||||||||| || || ||||| |||||
Sbjct: 327 gcgcttggcgtggatcgcgcacaggttcgtgtcctcgaacagacccaccaggtaggcctc 268

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| ||||||| |||||||  |  |||||| |  |||||||||||||||||
Sbjct: 267 gctggcctcctgcagggccatcacggcgctgctctggaaacgaaggtcggtcttgaagtc 208

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           ||| |||||||| | |||||| |||||||| ||||||||||||||||| || ||| ||||
Sbjct: 207 ctgggcgatctcacgcaccagncgctggaagggcagcttgcggatcagaag-ctcggtgc 149

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
           ||||||||||    |||||||| || ||||||||||| ||||| |  ||||| || ||||
Sbjct: 148 tcttctggtagcgacggatctcacgcagggccacggtgccggggcgatagcgatggggct 89

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           ||||||||||||||||||  |||||   ||| |  || ||||||||||||||||||||||
Sbjct: 88  tcttcacgccgccggtggcgggcgcgctcttgcgagcggccttggtggcgagctgcttgc 29

                                       
Query: 465 ggggcgccttgccgccggtggacttgcg 492
           ||||||||||||| ||||| ||||||||
Sbjct: 28  ggggcgccttgcctccggtagacttgcg 1

---

>gb|DQ079673.1| Emerita brasiliensis voucher KCembr histone H3 (H3) gene, partial
           cds
          Length = 333

 Score =  254 bits (128), Expect = 3e-64
 Identities = 282/332 (84%), Gaps = 1/332 (0%)
 Strand = Plus / Minus

                                                                       
Query: 162 gacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgc 221
           ||||||||||||||||||||||||||||||||||||||| || || || || ||||| ||
Sbjct: 333 gacgcgcttggcgtggatggcgcacaggttggtgtcctcaaagagacccaccaggtaggc 274

                                                                       
Query: 222 ctcggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaa 281
           |||||  |||||||| |||||||  || ||    |||||||| |  ||||| ||||||||
Sbjct: 273 ctcggaggcctcctgcagggccatgacagccgaagactggaagcgcaggtccgtcttgaa 214

                                                                       
Query: 282 gtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccg 341
           |||||| |||||||| | |||||| |||||||| |||||||| | ||| |||||| || |
Sbjct: 213 gtcctgggcgatctcacgcaccagccgctggaaaggcagcttcctgatgagcagc-tcgg 155

                                                                       
Query: 342 tgctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgag 401
           |||||||||||||   ||||||||| || ||||||||||| ||||||||||||||||| |
Sbjct: 154 tgctcttctggtagcggcggatctcacgcagggccacggtgccgggcctgtagcggtggg 95

                                                                       
Query: 402 gcttcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgct 461
           ||||||| ||||| |||||||  || || ||||||||||||||||||||||| |||||||
Sbjct: 94  gcttcttgacgcccccggtggcgggagcggacttcctcgccgccttggtggccagctgct 35

                                           
Query: 462 tgcggggcgccttgccgccggtggacttgcgg 493
           | |  || |||||||| || ||||||||||||
Sbjct: 34  tcctcggggccttgccccccgtggacttgcgg 3

---

>gb|AY520716.1| Catomerus polymerus histone H3 gene, partial cds
          Length = 328

 Score =  254 bits (128), Expect = 3e-64
 Identities = 279/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           ||||||||| |||||||||||||||||||| ||||||||||| ||||| || ||||||||
Sbjct: 328 gcgcttggcatggatggcgcacaggttggtatcctcgaacaggccgaccagatacgcctc 269

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   |||||||| |||||||  ||||||  |  |||||| |  ||||| ||||| |||||
Sbjct: 268 gctcgcctcctgcagggccatgacggcgctgctctggaaacgcaggtcagtcttaaagtc 209

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           ||| |||||||| | |||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 208 ctgagcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcag-ctccgtgc 150

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
           ||||||||||    || ||||| || || ||||| || || |||||||||||||||||||
Sbjct: 149 tcttctggtagcgacgaatctcacgcagagccaccgttcccggcctgtagcggtgaggct 90

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           ||||||| || ||||||| ||||||   ||| |  |||||||||||||| ||||||||||
Sbjct: 89  tcttcacacctccggtggccggcgcgctcttgcgagccgccttggtggccagctgcttgc 30

                                       
Query: 465 ggggcgccttgccgccggtggacttgcg 492
           ||||||||||||| || || ||||||||
Sbjct: 29  ggggcgccttgccacccgtcgacttgcg 2

---

>ref|XM_789723.1| PREDICTED: Strongylocentrotus purpuratus similar to H3 histone,
           family 2 isoform 2 (LOC590106), mRNA
          Length = 438

 Score =  254 bits (128), Expect = 3e-64
 Identities = 336/403 (83%), Gaps = 2/403 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 tcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 174
           ||||||||||| |||||||| |||||||||||||| |||||||||||||| |||||||||
Sbjct: 428 tcgccacggatacggcgggccagctggatgtcctttggcatgatggtgacacgcttggcg 369

                                                                       
Query: 175 tggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcc 234
           ||||||||||||||||||||||||||||| || ||||| | ||| || |||  |||||||
Sbjct: 368 tggatggcgcacaggttggtgtcctcgaagagaccgaccaagtaagcttcgctagcctcc 309

                                                                       
Query: 235 tggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatc 294
           || || ||||  |||||   |  |||||| | ||| ||||||||||| ||||| ||||||
Sbjct: 308 tgaagagccataacggcagagctctggaatcggagctcggtcttgaaatcctgagcgatc 249

                                                                       
Query: 295 tccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggta 354
           || |  ||||| |||||||| || ||||||||||| || || ||| ||||||||||||||
Sbjct: 248 tcacggaccagacgctggaaggggagcttgcggatgagaag-ctcggtgctcttctggta 190

                                                                       
Query: 355 cttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgcc 414
               |||||||| ||||| || ||||| ||||||||||| || || |||||||| || ||
Sbjct: 189 acgacggatctcacggagagcgacggtaccgggcctgtaacgatggggcttcttgactcc 130

                                                                       
Query: 415 gccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcctt 474
           ||||||||  || || ||||| |  || ||||||||||| ||||||||||| || |||||
Sbjct: 129 gccggtggctggggcggacttgcgagctgccttggtggccagctgcttgcgaggagcctt 70

                                                      
Query: 475 gccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| || |||| | ||||||||||||||||| |||||
Sbjct: 69  tcctccggtagatttgc-gagcggtctgcttggtacgtgccat 28

---

>gb|DQ284378.1| Tylototriton shanjing histone H3a gene, partial cds
          Length = 328

 Score =  254 bits (128), Expect = 3e-64
 Identities = 277/326 (84%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||||||||||||||||||||| || |||||||| ||||| |||||   
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcaaagagcccgaccaggtaggcctcact 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| |||||||  || ||   |  |||||| |  | ||||||||||||||||||
Sbjct: 265 ggcctcctgcagggccatgaccgccgagctctggaagcgcaagtcggtcttgaagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
           ||||||||||| ||||||||||||||| |||||||||||||| ||||| ||| |||  ||
Sbjct: 205 cgcgatctcccgcaccaggcgctggaagggcagcttgcggatgagcag-ctcagtggact 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||||||||| |||||||||||||||| |||||||||||||||||
Sbjct: 146 tctggtaacggcggatctcgcggagagccacggtcccgggccggtagcggtgaggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           | || ||||||||||  |||||   ||| |  || ||||||||||| ||||||||||| |
Sbjct: 86  tsacyccgccggtggcaggcgcgctcttgcgggcagccttggtggccagctgcttgcgag 27

                                     
Query: 468 gcgccttgccgccggtggacttgcgg 493
           |||| || || |||||||||||||||
Sbjct: 26  gcgctttccctccggtggacttgcgg 1

---

>gb|AY428836.1| Pycnophyes greenlandicus histone H3 gene, partial cds
          Length = 327

 Score =  252 bits (127), Expect = 1e-63
 Identities = 278/327 (85%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           |||||||||||||||||||||| |||||||||||||||||| ||||| ||||| ||||||
Sbjct: 326 cgcttggcgtggatggcgcacaagttggtgtcctcgaacaggccgaccaggtaggcctcg 267

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| ||||||| |||||||  |  |||||| |  || |||||||||||||||
Sbjct: 266 ctggcctcctgcagggccatcacggcggagctctggaagcgcagatcggtcttgaagtcc 207

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| |  ||||| |||||||| |||||||||||||| || ||| || |||||
Sbjct: 206 tgggcgatctcacggaccagacgctggaagggcagcttgcggatgaggagc-tcggtgct 148

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    |||||||| ||||| || ||||| ||||| ||||| || || |||||
Sbjct: 147 cttctggtaacgacggatctcacggagagcgacggtaccgggtctgtaccgatggggctt 88

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           |||||| |||||||||| ||| |||||||| |  || ||||||||||| |||||||||||
Sbjct: 87  cttcactccgccggtggccggtgccgacttgcgggcagccttggtggccagctgcttgcg 28

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
           ||| |||||||| ||||||||||||||
Sbjct: 27  gggagccttgcctccggtggacttgcg 1

---

>gb|DQ284417.1| Triturus cristatus histone H3a gene, partial cds
          Length = 328

 Score =  250 bits (126), Expect = 4e-63
 Identities = 276/326 (84%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagagcccgaccaggtaggcctcgct 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            ||||| || |||||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcttgcagggccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||||||||| ||||||||| |||||||||||||| || || ||| |||  ||
Sbjct: 205 ggcgatctccctcaccaagcgctggaagggcagcttgcggatgaggag-ctcggtggact 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||||||||| ||||| || || || | |||||||||||||||||
Sbjct: 146 tctggtagcggcggatctcgcggagagccacrgtgcccggtcggtagcggtgaggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           | || || |||||||  |||||   ||| |  || ||||||||||| ||||||||||| |
Sbjct: 86  tgackccaccggtggcaggcgcgctcttgcgggcagccttggtggccagctgcttgcgag 27

                                     
Query: 468 gcgccttgccgccggtggacttgcgg 493
           |||| |||||||||||||||||||||
Sbjct: 26  gcgctttgccgccggtggacttgcgg 1

---

>gb|AY539178.1| Menidia menidia histone H3 gene, partial cds
          Length = 333

 Score =  250 bits (126), Expect = 4e-63
 Identities = 270/322 (83%), Gaps = 1/322 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
           |||||||||||| |||||||||||||| |||||||||||||||||||| ||| |||  ||
Sbjct: 209 cgcgatctccctsaccaggcgctggaagggcagcttgcggatcagcag-ctcggtggact 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| |  || |||||||| ||||||| ||| ||||| |||||||
Sbjct: 150 tctggtagcggcggatctccckcagagccacggtgccgggcckgtaacggtgrggcttct 91

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           | || |||||||||| ||| ||   ||| |  || || |||||||| |||||||| | ||
Sbjct: 90  tsackccgccggtggccggrgcgctcttrcgggcrgcyttggtggcsagctgcttcctgg 31

                                 
Query: 468 gcgccttgccgccggtggactt 489
           | || ||||| |||||||||||
Sbjct: 30  gggctttgcctccggtggactt 9

---

>gb|DQ284201.1| Bufo regularis histone H3a gene, partial cds
          Length = 328

 Score =  248 bits (125), Expect = 2e-62
 Identities = 273/321 (85%), Gaps = 1/321 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           |||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcagaggttggtgtcctcgaagaggccgaccaggtaagcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| |||||||  |||||   |  |||||| |  ||||||||||||||||||
Sbjct: 267 ctggcctcctgcagggccatgacggccgagctctggaagcgaaggtcggtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| ||||||||||||||||| |||||||| ||||||||||| ||| |||  
Sbjct: 207 tgggcgatctctctcaccaggcgctggaagggcagcttccggatcagcag-ctcggtgga 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||   ||||||||| || || |||||||||||||||| |||||||||||||||
Sbjct: 148 cttctggtagcggcggatctcccgcagagccacggtcccgggccggtagcggtgaggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| || ||||||||||  || ||   |||||| || ||||| ||||| |||||||||||
Sbjct: 88  cttgactccgccggtggcgggagcgctcttcctggcggccttagtggccagctgcttgcg 29

                                
Query: 466 gggcgccttgccgccggtgga 486
           ||| ||||| |||||||||||
Sbjct: 28  gggagccttcccgccggtgga 8

---

>gb|J00984.1|XELHIS3LB x.laevis histone gene h3 and flanks
          Length = 488

 Score =  248 bits (125), Expect = 2e-62
 Identities = 340/409 (83%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 407 gccctctcgcctcggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 348

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           |||||||||||||||||||||||||||||||| || ||  |||| || || ||||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaagagagcgaccagataagcctcgctg 288

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || ||||  |||||      |||||| |  |||||||||||||||||||| 
Sbjct: 287 gcctcctgcagagccataacggccgacctctggaagcgcaggtcggtcttgaagtcctga 228

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           ||||||||||  |||||||||||||| ||||| |||||||| ||||| ||| |||   ||
Sbjct: 227 gcgatctcccggaccaggcgctggaaaggcagtttgcggatgagcag-ctcggtggattt 169

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||   ||||||||||||||| || || || ||||||| ||| |||||||| |||||
Sbjct: 168 ctggtagcggcggatctcgcggagagcgactgtgccgggccggtaacggtgaggtttctt 109

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
            || |||||||| |  || ||  ||||| | || ||||||||| | ||||||||||||||
Sbjct: 108 gactccgccggtagcaggagcgcacttcttggctgccttggtgaccagctgcttgcgggg 49

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            ||||| || |||||||| || ||| |||||||||||||||||||||||
Sbjct: 48  agccttccctccggtggatttacgg-gcggtctgcttggtacgggccat 1

---

>gb|DQ028079.1| Velifer hypselopterus histone H3 gene, partial cds
          Length = 333

 Score =  246 bits (124), Expect = 6e-62
 Identities = 272/322 (84%), Gaps = 1/322 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaggcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            | |||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||||||||||||||||||| |||||||||||||||||||| ||| |||  ||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcag-ctcggtggact 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| |  || |||||||| ||||||||||| ||||| |||||||
Sbjct: 150 tctggtagcggcggatctccctcagagccacggtaccgggcctgtaacggtgrggcttct 91

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           ||||||||||||| | ||| ||   ||| |  || ||||||| ||| |||||||| | ||
Sbjct: 90  tcacgccgccggtsgccggggcgctcttacgagcagccttggwggccagctgcttcctgg 31

                                 
Query: 468 gcgccttgccgccggtggactt 489
           | |||||||| |||||||||||
Sbjct: 30  gagccttgcctccggtggactt 9

---

>ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC581030), mRNA
          Length = 411

 Score =  246 bits (124), Expect = 6e-62
 Identities = 335/403 (83%), Gaps = 2/403 (0%)
 Strand = Plus / Minus

                                                                       
Query: 115 tcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 174
           ||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 401 tcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcg 342

                                                                       
Query: 175 tggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcc 234
           ||||||||||||||||||||||||||||| || ||||| | ||| || |||  |||||||
Sbjct: 341 tggatggcgcacaggttggtgtcctcgaagagaccgaccaagtaggcttcgctagcctcc 282

                                                                       
Query: 235 tggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatc 294
           || || ||||  |||||   |  |||||| | ||| ||||||||||||||||| ||||||
Sbjct: 281 tgaagagccatgacggcagagctctggaatcggagctcggtcttgaagtcctgagcgatc 222

                                                                       
Query: 295 tccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctcttctggta 354
           || |  ||||| |||||||| || ||||||||||| || || ||| ||||||||||||||
Sbjct: 221 tcacggaccagacgctggaaggggagcttgcggatgagaag-ctcggtgctcttctggta 163

                                                                       
Query: 355 cttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttcttcacgcc 414
               |||||||| ||||| || ||||| || ||||| || || || |||||||| || ||
Sbjct: 162 gcgacggatctcacggagagcgacggttccaggcctataacgatggggcttcttgactcc 103

                                                                       
Query: 415 gccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggggcgcctt 474
           ||||||||  || || ||||| |  || ||||||||||| ||||||||||| || |||||
Sbjct: 102 gccggtggctggggcggacttgcgagctgccttggtggccagctgcttgcgaggagcctt 43

                                                      
Query: 475 gccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            || ||||| || || | | || ||||||||||||||||||||
Sbjct: 42  tcctccggtagatttac-gtgctgtctgcttggtacgggccat 1

---

>gb|AF370817.1|AF370817 Locusta migratoria histone H3 gene, partial cds
          Length = 327

 Score =  246 bits (124), Expect = 6e-62
 Identities = 278/328 (84%), Gaps = 1/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           ||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||||
Sbjct: 327 gcgcttggcgtggatggcgcacaggttggtgtcttcgaagaggccgacgaggtaggcctc 268

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |   || ||||| || ||||  ||||||  |  |||||| |  |||||||||||||||||
Sbjct: 267 gctggcttcctgcagcgccatgacggcggagctctggaagcgcaggtcggtcttgaagtc 208

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           ||| |||||||| | ||| ||||||||||| |||||||||||||| |||||| || ||||
Sbjct: 207 ctgtgcgatctctcgcacgaggcgctggaagggcagcttgcggatgagcagc-tcggtgc 149

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
           |||| |||||    | ||| || ||||| || ||||| ||||||| ||||||||| ||||
Sbjct: 148 tcttttggtagcgcctgatttctcggagcgcgacggttccgggccggtagcggtggggct 89

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           |||| |||||||||||||  |||||   ||||||||||||||||||||||||||| ||||
Sbjct: 88  tcttgacgccgccggtggcgggcgcgctcttcctcgccgccttggtggcgagctgtttgc 29

                                       
Query: 465 ggggcgccttgccgccggtggacttgcg 492
           | |||||||| |||||||||||||||||
Sbjct: 28  gcggcgcctttccgccggtggacttgcg 1

---

>gb|AY539186.1| Sebastes matsubarae histone H3 gene, partial cds
          Length = 333

 Score =  246 bits (124), Expect = 6e-62
 Identities = 273/322 (84%), Gaps = 1/322 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            | |||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagagccatgacggcrgagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||||||||||||||||||| |||||||||||||||||||| ||| |||  ||
Sbjct: 209 ggcgatctccctcaccaggcgctggaagggcagcttgcggatcagcag-ctcggtggact 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||    |||||||| |  ||||||||||| ||||||||||| |||||||||||||
Sbjct: 150 tctggtagcgacggatctctctcagggccacggtaccgggcctgtaacggtgaggcttct 91

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           ||||||||||||||| ||| ||   ||| |  || ||||||||||| |||||||| | ||
Sbjct: 90  tcacgccgccggtggccggggcgctcttacgagcggccttggtggccagctgctttctgg 31

                                 
Query: 468 gcgccttgccgccggtggactt 489
           | || ||||| |||||||||||
Sbjct: 30  gggctttgcctccggtggactt 9

---

>gb|DQ028081.1| Trachipterus trachypterus histone H3 gene, partial cds
          Length = 333

 Score =  244 bits (123), Expect = 3e-61
 Identities = 271/322 (84%), Gaps = 1/322 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcaaacagacccaccaggtaggcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||| ||||||||||||||||| ||||| |||||||||||||| ||| |||  ||
Sbjct: 209 agcgatctcwctcaccaggcgctggaarggcagyttgcggatcagcag-ctcagtggact 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| | ||| |||||||| |||||||||||||||||||||||||
Sbjct: 150 tctggtagyggcggatctccctgagrgccacggtaccgggcctgtagcggtgaggcttct 91

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           ||||||||||||||| ||| ||   ||| |  ||  |||||||||| |||||||| | ||
Sbjct: 90  tcacgccgccggtggccggggcgctcttacgggcnrccttggtggccagctgcttcctgg 31

                                 
Query: 468 gcgccttgccgccggtggactt 489
           | || ||||| || ||||||||
Sbjct: 30  gagctttgcctccagtggactt 9

---

>gb|AY520718.1| Pollicipes pollicipes histone H3 gene, partial cds
          Length = 328

 Score =  244 bits (123), Expect = 3e-61
 Identities = 277/327 (84%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           ||||||||||||||||| |||||||| |||||||||||||| ||||| ||||||||||||
Sbjct: 327 cgcttggcgtggatggcacacaggttcgtgtcctcgaacagaccgaccaggtacgcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| || ||||  || |||  |  |||||| |  ||||| ||||||||||||
Sbjct: 267 ctggcctcctgcagagccatgacagcgctgctctggaagcgcaggtccgtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           ||||| ||||| | |||||| |||||||||||||||||||| || ||||| |||||||||
Sbjct: 207 tgcgcaatctcgcgcaccagccgctggaacggcagcttgcgaatgagcag-ctccgtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    ||||||||||| || ||||| || || || | |||||||||||||||
Sbjct: 148 cttctggtagcgacggatctcgcgaagagccaccgtgcccggacggtagcggtgaggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| ||||||||||||| ||||||   ||| |  |||||||| ||||| |||||||||||
Sbjct: 88  cttgacgccgccggtggccggcgcgctcttgcgagccgccttagtggccagctgcttgcg 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
            ||||||||||||||||| ||||||||
Sbjct: 28  cggcgccttgccgccggtagacttgcg 2

---

>gb|AY520693.1| Balanus glandula histone H3 gene, partial cds
          Length = 328

 Score =  244 bits (123), Expect = 3e-61
 Identities = 277/327 (84%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           ||||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaacaggccaaccaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
             ||||||||| ||||||| |||||||  |  |||||| | ||| || ||||||||||||
Sbjct: 267 ctagcctcctgcagggccatcacggcgctgctctggaagcggagatccgtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| | |||||| |||||||| ||||| |||||||||||||| ||| |||||
Sbjct: 207 tgggcgatctcgcgcaccagacgctggaatggcagtttgcggatcagcag-ctcagtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||   ||||||||| || || ||||| || ||||| | |||||| || |||||
Sbjct: 148 cttctggtagcggcggatctcacgcagcgccaccgtgccgggacggtagcgatggggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| |||||||| |||| ||||||   ||| |  || ||||||||||| |||||||||||
Sbjct: 88  cttgacgccgccagtggccggcgcgctcttacgagcggccttggtggccagctgcttgcg 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
            ||||||||||| |||||||| |||||
Sbjct: 28  cggcgccttgccaccggtggatttgcg 2

---

>gb|AY520692.1| Balanus crenatus histone H3 gene, partial cds
          Length = 328

 Score =  244 bits (123), Expect = 3e-61
 Identities = 277/327 (84%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           ||||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaacaggccaaccaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
             ||||||||| ||||||| |||||||  |  |||||| | ||| || ||||||||||||
Sbjct: 267 ctagcctcctgcagggccatcacggcgctgctctggaagcggagatccgtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| | |||||| |||||||| ||||| |||||||||||||| ||| |||||
Sbjct: 207 tgggcgatctcgcgcaccagacgctggaatggcagtttgcggatcagcag-ctcagtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||   ||||||||| || || ||||| || ||||| | |||||| || |||||
Sbjct: 148 cttctggtagcggcggatctcacgcagcgccaccgtgccgggacggtagcgatggggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| |||||||| |||| ||||||   ||| |  || ||||||||||| |||||||||||
Sbjct: 88  cttgacgccgccagtggccggcgcgctcttacgagcggccttggtggccagctgcttgcg 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
            ||||||||||| |||||||| |||||
Sbjct: 28  cggcgccttgccaccggtggatttgcg 2

---

>gb|DQ284374.1| Bufo maculatus histone H3a gene, partial cds
          Length = 328

 Score =  244 bits (123), Expect = 3e-61
 Identities = 272/321 (84%), Gaps = 1/321 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           |||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcagaggttggtgtcctcgaagaggccgaccaggtaagcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| |||||||  |||||   |  |||||| |  ||||||||||||||||||
Sbjct: 267 ctggcctcctgcagggccatgacggccgagctctggaagcgaaggtcggtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| ||||||||||||||||| |||||||| | ||||||||| ||| |||  
Sbjct: 207 tgggcgatctctctcaccaggcgctggaagggcagcttccsgatcagcag-ctcggtgga 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||   ||||||||| ||||| || ||||||||||||| |||||||||||||||
Sbjct: 148 cttctggtaacggcggatctcccggagagcgacggtcccgggccggtagcggtgaggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| || ||||||||||  || ||   |||||| || ||||| ||||| |||||||||||
Sbjct: 88  cttgactccgccggtggctggrgcgctcttcctggcggccttagtggccagctgcttgcg 29

                                
Query: 466 gggcgccttgccgccggtgga 486
           ||| ||||| |||||||||||
Sbjct: 28  gggagccttcccgccggtgga 8

---

>gb|DQ284325.1| Thorius sp. JAC 21291 histone H3a gene, partial cds
          Length = 328

 Score =  244 bits (123), Expect = 3e-61
 Identities = 277/327 (84%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           |||||||||||||||||||||||||||||||||||||| || || || ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagacccaccaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| |||||||  |||||   |  |||||| |  ||||||||||||||||||
Sbjct: 267 ctggcctcctgcagggccatgacggccgagctctggaagcgcaggtcggtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || |||||||| | ||||||||||||||| |||||||||||||||||||| ||| |||  
Sbjct: 207 tgggcgatctctcgcaccaggcgctggaagggcagcttgcggatcagcag-ctcggtgga 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    |||||||| | ||| |||||||| ||||||||||| |||||||||||
Sbjct: 148 cttctggtagcgccggatctccctgagcgccacggtgccgggcctgtaacggtgaggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||||||||||||||||| ||| ||   ||| |  || ||||||||||| |||||||| | 
Sbjct: 88  cttcacgccgccggtggccggggcgctcttacgggcggccttggtggccagctgcttcct 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
           ||| |||||||| ||||||||||||||
Sbjct: 28  gggagccttgcctccggtggacttgcg 2

---

>gb|AY662888.1| Embiotoca jacksoni histone H3a gene, partial cds
          Length = 333

 Score =  244 bits (123), Expect = 3e-61
 Identities = 270/319 (84%), Gaps = 1/319 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||||||||||||||||||||| ||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcraacaggccgaccaggtaggcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagmgccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||| || |||||||||||||| |||||||||||||||||||| |||||||  ||
Sbjct: 209 agcgatctctctsaccaggcgctggaagggcagcttgcggatcagcag-ctccgtggact 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| |  || |||||||| ||||||||||| |||||||||||||
Sbjct: 150 tctggtagcggcggatctctctcagagccacggtaccgggcctgtaacggtgaggcttct 91

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           ||||||||||||||| ||| ||   ||| |  || ||||||||||| |||||||| | ||
Sbjct: 90  tcacgccgccggtggccggggcgctcttacgggcggccttggtggccagctgcttcctgg 31

                              
Query: 468 gcgccttgccgccggtgga 486
           | || ||||| ||||||||
Sbjct: 30  grgctttgcctccggtgga 12

---

>gb|AY539253.1| Careproctus melanurus histone H3 gene, partial cds
          Length = 333

 Score =  244 bits (123), Expect = 3e-61
 Identities = 271/319 (84%), Gaps = 1/319 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            | |||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagcgccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||||||||||||||||||| |||||||||||||||||||| ||| |||  ||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcag-ctcggtggact 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| |  || |||||||| |||||||||||||| || |||||||
Sbjct: 150 tctggtagcggcggatctccctcagagccacggtaccgggcctgtagcgatggggcttct 91

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           ||||||||||||||| ||| ||   |||||  || ||||||||||| |||||||| | ||
Sbjct: 90  tcacgccgccggtggccggggcgctcttccgggcagccttggtggccagctgcttmctgg 31

                              
Query: 468 gcgccttgccgccggtgga 486
           | ||||| || ||||||||
Sbjct: 30  gagcctttcctccggtgga 12

---

>gb|DQ284413.1| Kassina senegalensis histone H3a gene, partial cds
          Length = 328

 Score =  242 bits (122), Expect = 1e-60
 Identities = 276/326 (84%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||||||||||||||||||||| || ||||| || || ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagaggccgaccagataagcctcgct 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||| ||||||||||||||| |||||||||||||||||||| ||| |||   |
Sbjct: 205 ggcgatctcccgcaccaggcgctggaagggcagcttgcggatcagcag-ctcggtggatt 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| ||||| ||||| || ||||||| |||||||||||||||||
Sbjct: 146 tctggtagcggcggatctctcggagagccactgtaccgggccggtagcggtgaggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           |||| |||||||||| ||| ||   |||||  || || |||||||| |||||||||||||
Sbjct: 86  tcactccgccggtggccggggcgctcttccgggcggctttggtggccagctgcttgcggg 27

                                     
Query: 468 gcgccttgccgccggtggacttgcgg 493
           | || || ||||||||||||||||||
Sbjct: 26  gagctttcccgccggtggacttgcgg 1

---

>gb|DQ284411.1| Dyscophus guineti histone H3a gene, partial cds
          Length = 328

 Score =  242 bits (122), Expect = 1e-60
 Identities = 276/326 (84%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||| |||||||||||||||||||| || ||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcacacaggttggtgtcctcgaagaggccgaccaggtaagcctcgct 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            ||||||||||| |||||||||||||| |||||||||||||| ||||| ||| |||  ||
Sbjct: 205 tgcgatctccctgaccaggcgctggaagggcagcttgcggatgagcag-ctcggtggact 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| | |||||||||||| ||||||| |||||||||||||||||
Sbjct: 146 tctggtagcggcggatctccctgagggccacggtgccgggccggtagcggtgaggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           | || |||||||||| ||| ||   ||| |  || || |||||||| |||||||||||||
Sbjct: 86  tgactccgccggtggccggggcgctcttgcgggcggctttggtggccagctgcttgcggg 27

                                     
Query: 468 gcgccttgccgccggtggacttgcgg 493
           |||| ||||| |||||||| ||||||
Sbjct: 26  gcgctttgcctccggtggatttgcgg 1

---

>gb|DQ284397.1| Breviceps mossambicus histone H3a gene, partial cds
          Length = 328

 Score =  242 bits (122), Expect = 1e-60
 Identities = 276/326 (84%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||||||||||||||||||||| || ||||| || || ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagaggccgaccagataagcctcgct 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||| ||||||||||||||| |||||||||||||||||||| ||| |||   |
Sbjct: 205 ggcgatctcccgcaccaggcgctggaagggcagcttgcggatcagcag-ctcggtggatt 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| ||||| ||||| || ||||||| |||||||||||||||||
Sbjct: 146 tctggtagcggcggatctctcggagagccactgtaccgggccggtagcggtgaggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           |||| |||||||||| ||| ||   |||||  || || |||||||| |||||||||||||
Sbjct: 86  tcactccgccggtggccggggcgctcttccgggcggctttggtggccagctgcttgcggg 27

                                     
Query: 468 gcgccttgccgccggtggacttgcgg 493
           | || || ||||||||||||||||||
Sbjct: 26  gagctttcccgccggtggacttgcgg 1

---

>gb|DQ284343.1| Phlyctimantis leonardi histone H3a gene, partial cds
          Length = 328

 Score =  242 bits (122), Expect = 1e-60
 Identities = 276/326 (84%), Gaps = 1/326 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||||||||||||||||||||| || ||||| || || ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagaggccgaccagataagcctcgct 266

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||| ||||||||||||||| |||||||||||||||||||| ||| |||   |
Sbjct: 205 ggcgatctcccgcaccaggcgctggaagggcagcttgcggatcagcag-ctcggtggatt 147

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| ||||| ||||| || ||||||| |||||||||||||||||
Sbjct: 146 tctggtagcggcggatctctcggagagccactgtaccgggccggtagcggtgaggcttct 87

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           |||| |||||||||| ||| ||   |||||  || || |||||||| |||||||||||||
Sbjct: 86  tcactccgccggtggccggggcgctcttccgggcggctttggtggccagctgcttgcggg 27

                                     
Query: 468 gcgccttgccgccggtggacttgcgg 493
           | || || ||||||||||||||||||
Sbjct: 26  gagctttcccgccggtggacttgcgg 1

---

>dbj|AB195975.1| Lilium longiflorum YAH3 mRNA for histone H3, complete cds
          Length = 463

 Score =  242 bits (122), Expect = 1e-60
 Identities = 339/409 (82%), Gaps = 2/409 (0%)
 Strand = Plus / Minus

                                                                       
Query: 109 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 168
           ||||||||||| ||||| |  | |||||||||||||||||| |||||||| || || | |
Sbjct: 414 gccctctcgccgcggatcctcctggcgagctggatgtccttcggcatgatagtcaccctc 355

                                                                       
Query: 169 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 228
           || ||||| |||||||||||||||||||||||||||||||| || ||||| | ||| |  
Sbjct: 354 ttagcgtgaatggcgcacaggttggtgtcctcgaacagccccaccaggtaagactccgac 295

                                                                       
Query: 229 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 288
           |||||||| || |||   |||||   |  |||||| | |||||||| |||||||||||| 
Sbjct: 294 gcctcctgcagcgccgctacggccgagctctggaagcggaggtcggccttgaagtcctga 235

                                                                       
Query: 289 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctctt 348
           |||||||| |  || |||||||||||||| ||||||||||| || ||| || || |||||
Sbjct: 234 gcgatctcgcggacaaggcgctggaacggaagcttgcggataagaagc-tctgtactctt 176

                                                                       
Query: 349 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttctt 408
           ||||||||| |||||||| ||||| ||||| || ||||| | | ||||||| ||||||||
Sbjct: 175 ctggtacttccggatctcacggagcgccaccgtaccgggacggaagcggtggggcttctt 116

                                                                       
Query: 409 cacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcgggg 468
           ||| |||||||||| ||| || ||||| |  || |||||||| || |||||||| |  ||
Sbjct: 115 cactccgccggtggccggagcggacttgcgggctgccttggttgcaagctgcttcctagg 56

                                                            
Query: 469 cgccttgccgccggtggacttgcggngcggtctgcttggtacgggccat 517
            |||||||||||||||||||||| | || ||||||||||| ||||||||
Sbjct: 55  ggccttgccgccggtggacttgc-gcgcagtctgcttggtgcgggccat 8

---

>gb|AY662903.1| Paretroplus polyactis 'South' histone H3a gene, partial cds
          Length = 333

 Score =  242 bits (122), Expect = 1e-60
 Identities = 272/322 (84%), Gaps = 1/322 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           |||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcasaggttggtgtcctcgaasagcccgaccaggtaagcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||| || |||||||||||||| |||||||||||||| ||||| ||| |||   |
Sbjct: 209 agcgatctcgctgaccaggcgctggaagggcagcttgcggatgagcag-ctcggtggatt 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| | ||| |||||||| |||||||||||||||||||||||||
Sbjct: 150 tctggtagcggcggatctctctgagagccacggtaccgggcctgtagcggtgaggcttct 91

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           ||||||||||||||| ||| ||   ||| |  || ||||||||||| |||||||| | ||
Sbjct: 90  tcacgccgccggtggccggggcgctcttgcgggcggccttggtggccagctgcttcctgg 31

                                 
Query: 468 gcgccttgccgccggtggactt 489
           | || ||||| |||||||||||
Sbjct: 30  gggctttgcctccggtggactt 9

---

>gb|AY749717.1| Siphlonella sp. EP083 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  242 bits (122), Expect = 1e-60
 Identities = 312/373 (83%), Gaps = 2/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 145 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 204
           ||||||||||||||||||||||||||||||||||| ||||||| ||| |||||||| || 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggattgcgcacaagttcgtgtcctcaaag 312

                                                                       
Query: 205 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 264
           || || || ||||| ||||||  ||||||||| || ||||  ||||||  |  |||||| 
Sbjct: 311 agacccacgaggtaagcctcgctagcctcctgcagagccatgacggcggagctctggaag 252

                                                                       
Query: 265 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 324
           |  |||||||||||||||||||| || ||||| |  |||||||||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcaatctcgcgaaccaggcgctggaagggcagcttg 192

                                                                       
Query: 325 cggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggccacggtccc 384
           |||||||| || ||| ||||||||||||||    |||||||| || || |||||||| ||
Sbjct: 191 cggatcaggag-ctcagtgctcttctggtaacgacggatctcacgcagagccacggtgcc 133

                                                                       
Query: 385 gggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcctcgccgc 444
            || |  || || || ||||||||||||||||||||||  |||||   ||| |  || ||
Sbjct: 132 agggcgataacgatggggcttcttcacgccgccggtggcgggcgcgctcttgcgagcggc 73

                                                                       
Query: 445 cttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcggtctgct 504
           ||||||||||||||||||||||||||||||||| ||||| || |||||| || |||||||
Sbjct: 72  cttggtggcgagctgcttgcggggcgccttgccaccggtaganttgcgg-gccgtctgct 14

                        
Query: 505 tggtacgggccat 517
           ||||||| |||||
Sbjct: 13  tggtacgagccat 1

---

>gb|AY520719.1| Pollicipes polymerus histone H3 gene, partial cds
          Length = 328

 Score =  240 bits (121), Expect = 4e-60
 Identities = 276/327 (84%), Gaps = 1/327 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           |||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttcgtgtcctcgaacagaccgaccaggtacgcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| || ||||  || |||  |  |||||| |  ||||| ||||||||||||
Sbjct: 267 ctggcctcctgcagagccatgacagcgctgctctggaagcgcaggtccgtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           ||||| ||||| | |||||| |||||||||||||||||||| || ||||| |||||||||
Sbjct: 207 tgcgcaatctcgcgcaccagccgctggaacggcagcttgcgaatgagcag-ctccgtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    |||||||| || || ||||| || || || | |||||||||||||||
Sbjct: 148 cttctggtagcgacggatctcrcgaagagccaccgtgcccggacggtagcggtgaggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| ||||||||||||| ||||||   ||| |  |||||||| ||||| |||||||||||
Sbjct: 88  cttgacgccgccggtggccggcgcgctcttgcgagccgccttcgtggccagctgcttgcg 29

                                      
Query: 466 gggcgccttgccgccggtggacttgcg 492
            ||||||||||| ||||| ||||||||
Sbjct: 28  cggcgccttgcctccggtagacttgcg 2

---

>gb|AY662887.1| Cymatogaster aggregata histone H3a gene, partial cds
          Length = 333

 Score =  240 bits (121), Expect = 4e-60
 Identities = 270/319 (84%), Gaps = 1/319 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaggcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaarcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||| ||||||||||||||||| |||||||||||||||||||| |||||||  ||
Sbjct: 209 agcgatctctctcaccaggcgctggaagggcagcttgcggatcagcag-ctccgtggact 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||    |||||||| |  || |||||||| ||||||||||| |||||||||||||
Sbjct: 150 tctggtagcgacggatctctctcagagccacggtaccgggcctgtaacggtgaggcttct 91

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           ||||||||||||||| ||| ||   ||| |  || |||||||| || |||||||| | ||
Sbjct: 90  tcacgccgccggtggccggggcgctcttrcgggcggccttggtrgccagctgcttyctgg 31

                              
Query: 468 gcgccttgccgccggtgga 486
           | || ||||| ||||||||
Sbjct: 30  gagctttgcctccggtgga 12

---

>gb|AY655592.1| Fundulus heteroclitus histone H3a-like gene, partial sequence
          Length = 333

 Score =  238 bits (120), Expect = 2e-59
 Identities = 253/295 (85%), Gaps = 2/295 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaagcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcagagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||| |||||| |||||||| |||||||||||||||||||| |||||||  ||
Sbjct: 209 agcgatctcccgcaccagncgctggaagggcagcttgcggatcagcag-ctccgtggact 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||||||   ||||||||| |  || |||||||| |||||||||||||||||||||||||
Sbjct: 150 tctggtagcggcggatctctctcagagccacggtaccgggcctgtagcggtgaggcttct 91

                                                                  
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgctt 462
           ||||||||||||||| ||| ||   ||| || |||||||||||||| ||||||||
Sbjct: 90  tcacgccgccggtggccggggcgctctt-ctggccgccttggtggccagctgctt 37

---

>gb|DQ028083.1| Lota lota histone H3 gene, partial cds
          Length = 333

 Score =  238 bits (120), Expect = 2e-59
 Identities = 271/322 (84%), Gaps = 1/322 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 227
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccaggtaagcctcgct 270

                                                                       
Query: 228 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 287
            |||||||| || |||| ||| |||  |  |||||| | |||||||||||||||||||||
Sbjct: 269 ggcctcctgaagagccatcacagcggagctctggaagcggaggtcggtcttgaagtcctg 210

                                                                       
Query: 288 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgctct 347
            |||||||||||||||||||||||||| |||||||||||||||||||| ||| |||   |
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcag-ctcrgtggatt 151

                                                                       
Query: 348 tctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggcttct 407
           |||| ||    |||||||| | ||| |||||||| ||||||||||| || || |||||||
Sbjct: 150 tctgataacgacggatctctctgagagccacggtgccgggcctgtarcgatggggcttct 91

                                                                       
Query: 408 tcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcggg 467
           ||||||| ||||||| ||| ||   ||| |  || |||||||||||||||||||| | ||
Sbjct: 90  tcacgccrccggtggccggggcgctcttacgggcagccttggtggcgagctgcttcctgg 31

                                 
Query: 468 gcgccttgccgccggtggactt 489
           | || ||||| |||||||| ||
Sbjct: 30  gggctttgccaccggtggaytt 9

---

>gb|AY520707.1| Tetraclita squamosa histone H3 gene, partial cds
          Length = 328

 Score =  238 bits (120), Expect = 2e-59
 Identities = 277/328 (84%), Gaps = 1/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 225
           ||||||||||| ||||||||||||||||||||||| || || ||||| ||||| ||||||
Sbjct: 327 cgcttggcgtgaatggcgcacaggttggtgtcctcaaaaagaccgaccaggtaggcctcg 268

                                                                       
Query: 226 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 285
              |||||||| |||||||  ||||||  |  |||||| |  ||||||||||||||||||
Sbjct: 267 ctggcctcctgcagggccatgacggcgctgctctggaagcgcaggtcggtcttgaagtcc 208

                                                                       
Query: 286 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgct 345
           || || ||||| | |||||| ||||||||||||||||||||||||||||| ||| |||||
Sbjct: 207 tgggcaatctcgcgcaccagacgctggaacggcagcttgcggatcagcag-ctcagtgct 149

                                                                       
Query: 346 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggctt 405
           |||||||||    ||||||||||| ||||| || || ||||| | ||||||||| |||||
Sbjct: 148 cttctggtagcgacggatctcgcgcagggcgaccgtgccgggacggtagcggtggggctt 89

                                                                       
Query: 406 cttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgcg 465
           ||| ||||||||||||| ||||||   ||| |  || ||||| ||||| |||||||||||
Sbjct: 88  cttgacgccgccggtggccggcgcgctcttgcgagcggccttagtggccagctgcttgcg 29

                                       
Query: 466 gggcgccttgccgccggtggacttgcgg 493
            ||||||||||| |||||||| ||||||
Sbjct: 28  tggcgccttgccaccggtggatttgcgg 1

---

>gb|AY870291.1| Ameletus costalis histone H3 gene, partial cds
          Length = 328

 Score =  238 bits (120), Expect = 2e-59
 Identities = 277/328 (84%), Gaps = 1/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 165 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 224
           ||||||||||||||||||||||| |||||||||||||||||| ||||| ||||| |||||
Sbjct: 328 gcgcttggcgtggatggcgcacaagttggtgtcctcgaacagaccgacgaggtaggcctc 269

                                                                       
Query: 225 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 284
           |  ||||||||| |||||||  ||||||  |  ||||||||  | |||||||||||||||
Sbjct: 268 gctagcctcctgcagggccatgacggcggagctctggaaccgcaagtcggtcttgaagtc 209

                                                                       
Query: 285 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagcctccgtgc 344
           ||| |||||||| | ||| || |||||||| |||||||||||||||||||| ||| ||||
Sbjct: 208 ctgggcgatctcgcgcactagacgctggaagggcagcttgcggatcagcag-ctcggtgc 150

                                                                       
Query: 345 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtagcggtgaggct 404
           ||||||||||    |||||||| || || ||||| || ||||| | |||||| || ||||
Sbjct: 149 tcttctggtaacgacggatctcacgcagagccactgtgccgggacggtagcgatggggct 90

                                                                       
Query: 405 tcttcacgccgccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttgc 464
           ||||||| || |||||||  |||||   ||| |  || ||||||||||||||||||||||
Sbjct: 89  tcttcactccaccggtggcgggcgcgctcttgcgagcggccttggtggcgagctgcttgc 30

                                       
Query: 465 ggggcgccttgccgccggtggacttgcg 492
           |||| |||||||| || |||||||||||
Sbjct: 29  ggggagccttgcctcctgtggacttgcg 2

---

>gb|AY064472.1| Aplysia californica histone H3 (His.H3) gene, complete cds
          Length = 878

 Score =  238 bits (120), Expect = 2e-59
 Identities = 317/380 (83%), Gaps = 2/380 (0%)
 Strand = Plus / Minus

                                                                       
Query: 138 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtc 197
           ||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||
Sbjct: 488 ctggatgtccttgggcatgatcgtcacacgcttggcgtggatggcgcacaggttggtgtc 429

                                                                       
Query: 198 ctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtggga 257
           ||| ||||| || || ||||| ||||||  ||||||||| || ||||  |||||   |  
Sbjct: 428 ctcaaacagacccacgaggtaagcctcgctagcctcctgcagagccatgacggcagagct 369

                                                                       
Query: 258 ctggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacgg 317
           ||||||||  | ||||||||||||||| || |||||||| |  || ||||||||||||||
Sbjct: 368 ctggaaccgcaagtcggtcttgaagtcttgtgcgatctcacgaacaaggcgctggaacgg 309

                                                                       
Query: 318 cagcttgcggatcagcagcctccgtgctcttctggtacttgcggatctcgcggagggcca 377
           || ||||||||||||||| ||| ||||||||||||||    |||||||| || || ||||
Sbjct: 308 caacttgcggatcagcag-ctcggtgctcttctggtaacgacggatctcacgcagagcca 250

                                                                       
Query: 378 cggtcccgggcctgtagcggtgaggcttcttcacgccgccggtggtcggcgccgacttcc 437
           |||| ||||||||||| || ||||| |||||||| || |||||||  || |||||||| |
Sbjct: 249 cggtaccgggcctgtaacgatgaggtttcttcacacctccggtggcaggggccgacttac 190

                                                                       
Query: 438 tcgccgccttggtggcgagctgcttgcggggcgccttgccgccggtggacttgcggngcg 497
             || || ||||| || ||||||||||| || |||||||| || ||||| |||||| |||
Sbjct: 189 gagcagctttggtagcaagctgcttgcgaggggccttgccaccagtggatttgcgg-gcg 131

                               
Query: 498 gtctgcttggtacgggccat 517
           || || |||||||| |||||
Sbjct: 130 gtttgtttggtacgtgccat 111


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,124,582
Number of Sequences: 3902068
Number of extensions: 3124582
Number of successful extensions: 78486
Number of sequences better than 10.0: 3762
Number of HSP's better than 10.0 without gapping: 3742
Number of HSP's successfully gapped in prelim test: 22
Number of HSP's that attempted gapping in prelim test: 63573
Number of HSP's gapped (non-prelim): 11608
length of query: 543
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 520
effective length of database: 17,143,297,704
effective search space: 8914514806080
effective search space used: 8914514806080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---