ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags32h23 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_468609.1| Oryza sativa (japonica cultivar-group), mRNA Length = 694 Score = 482 bits (243), Expect = e-133 Identities = 368/409 (89%), Gaps = 3/409 (0%) Strand = Plus / Minus Query: 215 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 274 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 452 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 393 Query: 275 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 331 ||||||||| ||| ||| |||||||||||||||||||||||| |||||||||||| Sbjct: 392 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 333 Query: 332 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 391 | |||||||| ||||||||||||| || |||||||||| ||||||||||||| |||||| Sbjct: 332 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 273 Query: 392 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 451 ||||||||||| | |||||||||||||| ||| || |||||||||||||||||||||| Sbjct: 272 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 213 Query: 452 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcgg 511 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| ||||| ||| Sbjct: 212 aagtagcgcatgccgaccttgccgaagtagcccgggtggtacttgtcgaacaggatccgg 153 Query: 512 tggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccaca 571 ||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 152 tggtggtgcatccctccggcgttaccgcggcctccggggtgcttgcggtgcttcccgatg 93 Query: 572 cgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 620 |||||||||||||| || ||||||||||||||||| ||||||||||||| Sbjct: 92 cgcccgtgcccggccgacacgtggccgcgcttcttccggttcttcttga 44
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 482 bits (243), Expect = e-133 Identities = 368/409 (89%), Gaps = 3/409 (0%) Strand = Plus / Minus Query: 215 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 274 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 16599921 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 16599862 Query: 275 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 331 ||||||||| ||| ||| |||||||||||||||||||||||| |||||||||||| Sbjct: 16599861 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 16599802 Query: 332 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 391 | |||||||| ||||||||||||| || |||||||||| ||||||||||||| |||||| Sbjct: 16599801 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 16599742 Query: 392 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 451 ||||||||||| | |||||||||||||| ||| || |||||||||||||||||||||| Sbjct: 16599741 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 16599682 Query: 452 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcgg 511 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| ||||| ||| Sbjct: 16599681 aagtagcgcatgccgaccttgccgaagtagcccgggtggtacttgtcgaacaggatccgg 16599622 Query: 512 tggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccaca 571 ||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 16599621 tggtggtgcatccctccggcgttaccgcggcctccggggtgcttgcggtgcttcccgatg 16599562 Query: 572 cgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 620 |||||||||||||| || ||||||||||||||||| ||||||||||||| Sbjct: 16599561 cgcccgtgcccggccgacacgtggccgcgcttcttccggttcttcttga 16599513 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 354 tgtcgccgccggcctccgcg 373 |||||||||||||||||||| Sbjct: 11143411 tgtcgccgccggcctccgcg 11143430 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 357 cgccgccggcctccgcggcc 376 |||||||||||||||||||| Sbjct: 1959636 cgccgccggcctccgcggcc 1959655
>gb|AC135559.4| Oryza sativa chromosome 3 BAC OSJNBa0030J19 genomic sequence, complete sequence Length = 133843 Score = 482 bits (243), Expect = e-133 Identities = 368/409 (89%), Gaps = 3/409 (0%) Strand = Plus / Plus Query: 215 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 274 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 54122 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 54181 Query: 275 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 331 ||||||||| ||| ||| |||||||||||||||||||||||| |||||||||||| Sbjct: 54182 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 54241 Query: 332 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 391 | |||||||| ||||||||||||| || |||||||||| ||||||||||||| |||||| Sbjct: 54242 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 54301 Query: 392 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 451 ||||||||||| | |||||||||||||| ||| || |||||||||||||||||||||| Sbjct: 54302 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 54361 Query: 452 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcgg 511 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| ||||| ||| Sbjct: 54362 aagtagcgcatgccgaccttgccgaagtagcccgggtggtacttgtcgaacaggatccgg 54421 Query: 512 tggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccaca 571 ||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 54422 tggtggtgcatccctccggcgttaccgcggcctccggggtgcttgcggtgcttcccgatg 54481 Query: 572 cgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 620 |||||||||||||| || ||||||||||||||||| ||||||||||||| Sbjct: 54482 cgcccgtgcccggccgacacgtggccgcgcttcttccggttcttcttga 54530
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 482 bits (243), Expect = e-133 Identities = 368/409 (89%), Gaps = 3/409 (0%) Strand = Plus / Minus Query: 215 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 274 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 16593554 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 16593495 Query: 275 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 331 ||||||||| ||| ||| |||||||||||||||||||||||| |||||||||||| Sbjct: 16593494 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 16593435 Query: 332 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 391 | |||||||| ||||||||||||| || |||||||||| ||||||||||||| |||||| Sbjct: 16593434 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 16593375 Query: 392 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 451 ||||||||||| | |||||||||||||| ||| || |||||||||||||||||||||| Sbjct: 16593374 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 16593315 Query: 452 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcgg 511 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| ||||| ||| Sbjct: 16593314 aagtagcgcatgccgaccttgccgaagtagcccgggtggtacttgtcgaacaggatccgg 16593255 Query: 512 tggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccaca 571 ||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 16593254 tggtggtgcatccctccggcgttaccgcggcctccggggtgcttgcggtgcttcccgatg 16593195 Query: 572 cgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 620 |||||||||||||| || ||||||||||||||||| ||||||||||||| Sbjct: 16593194 cgcccgtgcccggccgacacgtggccgcgcttcttccggttcttcttga 16593146 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 354 tgtcgccgccggcctccgcg 373 |||||||||||||||||||| Sbjct: 11140174 tgtcgccgccggcctccgcg 11140193 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 357 cgccgccggcctccgcggcc 376 |||||||||||||||||||| Sbjct: 1959634 cgccgccggcctccgcggcc 1959653
>gb|AY103571.1| Zea mays PCO153825 mRNA sequence Length = 725 Score = 470 bits (237), Expect = e-129 Identities = 392/444 (88%) Strand = Plus / Minus Query: 195 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 254 |||||||| ||||||||| || ||||| || |||||||||||||||||||||| ||||| Sbjct: 505 cctaggcggtgagcacgacggccccgcctgctgccttgatcttcttctcggcgaccttgg 446 Query: 255 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 314 |||||||||||||||||||||| |||||||| |||||||| |||||| |||||||||| Sbjct: 445 agatgagcttggccttgacgacaatgggcttgggcggcagcacccccttcccgagcacct 386 Query: 315 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccggcctccgcgg 374 |||||||||||||||||| |||||||| |||||||||||| |||||||||||| | Sbjct: 385 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgaggccggcctccgccg 326 Query: 375 ccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacc 434 |||| |||| |||||||| |||||||| | ||||| |||||| | ||| ||||||| Sbjct: 325 ccttttcggcgggcaccatcgaccagaggcgctcgatgttgaccgcggggcagtagaact 266 Query: 435 tgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggatggtact 494 |||||| ||||||||||||||| | ||| ||||| || |||||||||||||||||||||| Sbjct: 265 tgttgcggagcttgtggaagtagcgcatgccgaccttaccgaagtagccgggatggtact 206 Query: 495 tgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgct 554 ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| Sbjct: 205 tgtcgaagaggatgcggtggtggtgcatgccaccggcgttaccgcgacctccgggatgct 146 Query: 555 tgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttct 614 | ||||||||||| | || |||||||||||||| ||||||||||||||||||||||||| Sbjct: 145 tccggtgcttgccgatgcggccgtgcccggcggacacgtggccgcgcttcttgcggttct 86 Query: 615 tcttgaggcgggtcgtnatcgccg 638 |||||| ||| ||||| ||||||| Sbjct: 85 tcttgaagcgcgtcgtcatcgccg 62
>gb|BT017787.1| Zea mays clone EL01N0504C04.c mRNA sequence Length = 711 Score = 446 bits (225), Expect = e-122 Identities = 389/444 (87%) Strand = Plus / Minus Query: 195 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 254 |||||||| ||||||||| |||||||| || |||||||||||||||||||||| ||||| Sbjct: 497 cctaggcggtgagcacgacggcgccgcctgctgccttgatcttcttctcggcgaccttgg 438 Query: 255 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 314 |||||||||||||||||||||| |||||||| |||||||| |||||| |||||||||| Sbjct: 437 agatgagcttggccttgacgacaatgggctttggcggcagcacccccttcccgagcacct 378 Query: 315 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccggcctccgcgg 374 |||||||||||||||||| |||||||| |||||||||||||||||||||||||| | Sbjct: 377 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgccgccggcctccgccg 318 Query: 375 ccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacc 434 ||||||||| |||||||| |||||||| | ||||| |||||| | ||| ||||||| Sbjct: 317 ccttgtcggtgggcaccatcgaccagaggcgctcgatgttgaccgcggggcagtagaact 258 Query: 435 tgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggatggtact 494 |||||| |||||| |||||||| | ||| || || |||||||||||||| |||||||||| Sbjct: 257 tgttgcggagcttatggaagtaacgcatgccaaccttgccgaagtagcccggatggtact 198 Query: 495 tgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgct 554 ||||||||||||| ||||||||||||||||| |||||||||||||| ||||| || |||| Sbjct: 197 tgtcgaagaggatacggtggtggtgcatgccaccggcgttaccgcgacctcccgggtgct 138 Query: 555 tgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttct 614 | | ||||||||| | || |||||||||||||| ||||||||||||||||||||||||| Sbjct: 137 tcctgtgcttgccgatgcggccgtgcccggcggacacgtggccgcgcttcttgcggttct 78 Query: 615 tcttgaggcgggtcgtnatcgccg 638 |||||| ||| || || ||||||| Sbjct: 77 tcttgaagcgcgttgtcatcgccg 54
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 438 bits (221), Expect = e-119 Identities = 393/450 (87%), Gaps = 3/450 (0%) Strand = Plus / Plus Query: 192 aaccctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatct 251 ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| || Sbjct: 25183371 aaccctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgacct 25183430 Query: 252 tggagatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagca 311 ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| Sbjct: 25183431 tggagatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagca 25183490 Query: 312 ccttgaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcct 368 ||||||||||||||||||||| ||||| | | ||| ||||| | ||||| |||||| Sbjct: 25183491 ccttgaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcct 25183550 Query: 369 ccgcggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgt 428 |||| |||| |||| |||||||| |||||||||| ||| ||||| || | ||||| || Sbjct: 25183551 ccgccgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagt 25183610 Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||||| |||| |||||||||| | ||| ||||| |||||||||||||| || | Sbjct: 25183611 agaacttgttgcggagcctgtggaagtagcgcatgccgaccttgccgaagtagcccgggt 25183670 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 |||||||||||||||||||||||||||||||||||||||||||||| || |||||||| | Sbjct: 25183671 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttgccccggcctcccg 25183730 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 | ||||| |||||||| || | || ||||| |||||||| ||||||||||||||||||| Sbjct: 25183731 ggtgcttccggtgcttcccgatgcggccgtggccggcggacacgtggccgcgcttcttgc 25183790 Query: 609 ggttcttcttgaggcgggtcgtnatcgccg 638 |||||||| | |||| ||||| ||||||| Sbjct: 25183791 ggttcttcctcaggctcgtcgtcatcgccg 25183820
>dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0616D06 Length = 153800 Score = 438 bits (221), Expect = e-119 Identities = 393/450 (87%), Gaps = 3/450 (0%) Strand = Plus / Plus Query: 192 aaccctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatct 251 ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| || Sbjct: 42 aaccctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgacct 101 Query: 252 tggagatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagca 311 ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| Sbjct: 102 tggagatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagca 161 Query: 312 ccttgaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcct 368 ||||||||||||||||||||| ||||| | | ||| ||||| | ||||| |||||| Sbjct: 162 ccttgaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcct 221 Query: 369 ccgcggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgt 428 |||| |||| |||| |||||||| |||||||||| ||| ||||| || | ||||| || Sbjct: 222 ccgccgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagt 281 Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||||| |||| |||||||||| | ||| ||||| |||||||||||||| || | Sbjct: 282 agaacttgttgcggagcctgtggaagtagcgcatgccgaccttgccgaagtagcccgggt 341 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 |||||||||||||||||||||||||||||||||||||||||||||| || |||||||| | Sbjct: 342 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttgccccggcctcccg 401 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 | ||||| |||||||| || | || ||||| |||||||| ||||||||||||||||||| Sbjct: 402 ggtgcttccggtgcttcccgatgcggccgtggccggcggacacgtggccgcgcttcttgc 461 Query: 609 ggttcttcttgaggcgggtcgtnatcgccg 638 |||||||| | |||| ||||| ||||||| Sbjct: 462 ggttcttcctcaggctcgtcgtcatcgccg 491
>dbj|AP003700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1003_H02 Length = 124043 Score = 438 bits (221), Expect = e-119 Identities = 393/450 (87%), Gaps = 3/450 (0%) Strand = Plus / Plus Query: 192 aaccctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatct 251 ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| || Sbjct: 103858 aaccctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgacct 103917 Query: 252 tggagatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagca 311 ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| Sbjct: 103918 tggagatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagca 103977 Query: 312 ccttgaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcct 368 ||||||||||||||||||||| ||||| | | ||| ||||| | ||||| |||||| Sbjct: 103978 ccttgaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcct 104037 Query: 369 ccgcggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgt 428 |||| |||| |||| |||||||| |||||||||| ||| ||||| || | ||||| || Sbjct: 104038 ccgccgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagt 104097 Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||||| |||| |||||||||| | ||| ||||| |||||||||||||| || | Sbjct: 104098 agaacttgttgcggagcctgtggaagtagcgcatgccgaccttgccgaagtagcccgggt 104157 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 |||||||||||||||||||||||||||||||||||||||||||||| || |||||||| | Sbjct: 104158 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttgccccggcctcccg 104217 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 | ||||| |||||||| || | || ||||| |||||||| ||||||||||||||||||| Sbjct: 104218 ggtgcttccggtgcttcccgatgcggccgtggccggcggacacgtggccgcgcttcttgc 104277 Query: 609 ggttcttcttgaggcgggtcgtnatcgccg 638 |||||||| | |||| ||||| ||||||| Sbjct: 104278 ggttcttcctcaggctcgtcgtcatcgccg 104307
>gb|BT016384.1| Zea mays clone Contig217 mRNA sequence Length = 696 Score = 430 bits (217), Expect = e-117 Identities = 387/444 (87%) Strand = Plus / Minus Query: 195 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 254 |||||||| ||||||||| |||||||| || |||||||||||||||||||||| ||||| Sbjct: 483 cctaggcggtgagcacgacggcgccgcctgctgccttgatcttcttctcggcgaccttgg 424 Query: 255 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 314 |||||||||||||||||||||| |||||||| |||||||| |||||| |||||||||| Sbjct: 423 agatgagcttggccttgacgacaatgggctttggcggcagcacccccttcccgagcacct 364 Query: 315 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccggcctccgcgg 374 |||||||||||||||||| |||||||| |||||||||||||||||||||||||| | Sbjct: 363 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgccgccggcctccgccg 304 Query: 375 ccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacc 434 ||||||||| |||||||| |||||||| | ||||| |||||| | ||| ||||||| Sbjct: 303 ccttgtcggtgggcaccatcgaccagaggcgctcgatgttgaccgcggggcagtagaact 244 Query: 435 tgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggatggtact 494 |||||| |||||| |||||||| | ||| || || |||||||||||||| |||||||||| Sbjct: 243 tgttgcggagcttatggaagtaacgcatgccaaccttgccgaagtagcccggatggtact 184 Query: 495 tgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgct 554 ||||| |||||| ||||||||||||||||| |||||||||||||| ||||| || |||| Sbjct: 183 tgtcgccgaggatacggtggtggtgcatgccaccggcgttaccgcgacctcccgggtgct 124 Query: 555 tgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttct 614 | | ||||||||| | || |||||||||||||| ||||||||||||||||||||||||| Sbjct: 123 tcctgtgcttgccgatgcggccgtgcccggcggacacgtggccgcgcttcttgcggttct 64 Query: 615 tcttgaggcgggtcgtnatcgccg 638 |||||| ||| || || ||||||| Sbjct: 63 tcttgaagcgcgttgtcatcgccg 40
>ref|XM_479144.1| Oryza sativa (japonica cultivar-group), mRNA Length = 441 Score = 424 bits (214), Expect = e-115 Identities = 372/424 (87%), Gaps = 3/424 (0%) Strand = Plus / Minus Query: 196 ctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgga 255 ||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||| Sbjct: 441 ctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgaccttgga 382 Query: 256 gatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacctt 315 ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 381 gatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagcacctt 322 Query: 316 gaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcctccgc 372 ||||||||||||||||| ||||| | | ||| ||||| | ||||| |||||||||| Sbjct: 321 gaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcctccgc 262 Query: 373 ggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaa 432 |||| |||| |||||||| |||||||||| ||| ||||| || | ||||| |||||| Sbjct: 261 cgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagtagaa 202 Query: 433 cctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggatggta 492 | |||||| |||| |||||||||| | ||| ||||| |||||||||||||| || ||||| Sbjct: 201 cttgttgcggagcctgtggaagtagcgcatgccgaccttgccgaagtagcccgggtggta 142 Query: 493 cttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatg 552 |||||||||||||||||||||||||||||||||||||||||| || |||||||| || || Sbjct: 141 cttgtcgaagaggatgcggtggtggtgcatgcctccggcgttgccccggcctcccgggtg 82 Query: 553 cttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggtt 612 ||| |||||||| || | || ||||| |||||||| ||||||||||||||||||||||| Sbjct: 81 cttccggtgcttcccgatgcggccgtggccggcggacacgtggccgcgcttcttgcggtt 22 Query: 613 cttc 616 |||| Sbjct: 21 cttc 18
>gb|AY103771.1| Zea mays PCO152633 mRNA sequence Length = 740 Score = 394 bits (199), Expect = e-106 Identities = 377/436 (86%), Gaps = 3/436 (0%) Strand = Plus / Minus Query: 206 agcacgacagcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttg 265 |||| ||| ||||| ||||| |||||||||||||||||||||| |||||||||||||||| Sbjct: 499 agcaggacggcgcctccggcagccttgatcttcttctcggcgaccttggagatgagcttg 440 Query: 266 gccttgacgacgatgggcttctccggcagcatccccttgccgagcaccttgaagtagccg 325 |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 439 gccttgacgacgatgggcctggacggcagcatccccttgccgagcaccttgaagtagccg 380 Query: 326 aactgcgagacgtcgacgacgggggccttgtcgccgccggcc---tccgcggccttgtcg 382 ||||||| |||||||||| ||||||| ||| |||||||| |||||||||||| || Sbjct: 379 aactgcgtcacgtcgacgagcggggcctggtccgcgccggccgcctccgcggccttgccg 320 Query: 383 gacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctg 442 | |||||||| |||||||||| ||| |||||||| | |||| || |||| |||||| | Sbjct: 319 gcgggcaccatcgaccagagccgctccacgttgaccgacgggcagtggaacttgttgcgg 260 Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||| |||||||||| | ||| || || |||||||||||||| || |||||||| |||||| Sbjct: 259 agcctgtggaagtagcgcatgcccaccttgccgaagtagcccgggtggtacttatcgaag 200 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||||||||||||||||||||| |||||||| ||||||||||| || ||||| |||||| Sbjct: 199 aggatgcggtggtggtgcatgccgccggcgttgccgcggcctcccgggtgcttccggtgc 140 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttgagg 622 ||||| | || |||||||| || || ||||| ||||||||||| ||||||||||| ||| Sbjct: 139 ttgccgatgcggccgtgccccgccgacacgtgcccgcgcttcttccggttcttcttcagg 80 Query: 623 cgggtcgtnatcgccg 638 | ||||| ||||||| Sbjct: 79 ctcgtcgtcatcgccg 64
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 379 bits (191), Expect = e-102 Identities = 356/409 (87%), Gaps = 9/409 (2%) Strand = Plus / Minus Query: 215 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 274 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 4135369 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 4135310 Query: 275 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 331 ||||||||| |||| || |||||||||||||||||||||||| ||||||||||||| Sbjct: 4135309 acgatgggcctctctggggggagcatccccttgccgagcaccttggtgtagccgaactgc 4135250 Query: 332 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 391 | |||||||| ||||||||||||| || ||||||| | ||||| | ||| ||||| Sbjct: 4135249 gtgacgtcgatgacgggggccttgccggcgccggcgcc---ggcctcggcgg---gcacc 4135196 Query: 392 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 451 ||||||||||| | |||||||||||||| ||| || |||||||||||||||| ||||| Sbjct: 4135195 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcctgtgg 4135136 Query: 452 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcgg 511 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| ||||||||| Sbjct: 4135135 aagtagcgcatcccgaccttgccgaagtagcccgggtggtacttgtcgaacaggatgcgg 4135076 Query: 512 tggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccaca 571 ||||||||||| || |||||||| ||||| ||||| || ||||| |||||||| || | Sbjct: 4135075 tggtggtgcatcccgccggcgttcccgcgccctcccgggtgcttccggtgcttcccgatc 4135016 Query: 572 cgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 620 |||||||||||||| || ||||| ||||||||||| ||||||||||||| Sbjct: 4135015 cgcccgtgcccggccgacacgtgcccgcgcttcttccggttcttcttga 4134967 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 354 tgtcgccgccggcctccgcg 373 |||||||||||||||||||| Sbjct: 8040518 tgtcgccgccggcctccgcg 8040499
>dbj|AP003992.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1077_E05 Length = 116305 Score = 379 bits (191), Expect = e-102 Identities = 356/409 (87%), Gaps = 9/409 (2%) Strand = Plus / Minus Query: 215 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 274 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 45383 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 45324 Query: 275 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 331 ||||||||| |||| || |||||||||||||||||||||||| ||||||||||||| Sbjct: 45323 acgatgggcctctctggggggagcatccccttgccgagcaccttggtgtagccgaactgc 45264 Query: 332 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 391 | |||||||| ||||||||||||| || ||||||| | ||||| | ||| ||||| Sbjct: 45263 gtgacgtcgatgacgggggccttgccggcgccggcgcc---ggcctcggcgg---gcacc 45210 Query: 392 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 451 ||||||||||| | |||||||||||||| ||| || |||||||||||||||| ||||| Sbjct: 45209 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcctgtgg 45150 Query: 452 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcgg 511 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| ||||||||| Sbjct: 45149 aagtagcgcatcccgaccttgccgaagtagcccgggtggtacttgtcgaacaggatgcgg 45090 Query: 512 tggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccaca 571 ||||||||||| || |||||||| ||||| ||||| || ||||| |||||||| || | Sbjct: 45089 tggtggtgcatcccgccggcgttcccgcgccctcccgggtgcttccggtgcttcccgatc 45030 Query: 572 cgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 620 |||||||||||||| || ||||| ||||||||||| ||||||||||||| Sbjct: 45029 cgcccgtgcccggccgacacgtgcccgcgcttcttccggttcttcttga 44981
>dbj|AK121069.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061G23, full insert sequence Length = 727 Score = 379 bits (191), Expect = e-102 Identities = 356/409 (87%), Gaps = 9/409 (2%) Strand = Plus / Minus Query: 215 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 274 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 471 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 412 Query: 275 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 331 ||||||||| |||| || |||||||||||||||||||||||| ||||||||||||| Sbjct: 411 acgatgggcctctctggggggagcatccccttgccgagcaccttggtgtagccgaactgc 352 Query: 332 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 391 | |||||||| ||||||||||||| || ||||||| | ||||| | ||| ||||| Sbjct: 351 gtgacgtcgatgacgggggccttgccggcgccggcgcc---ggcctcggcgg---gcacc 298 Query: 392 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 451 ||||||||||| | |||||||||||||| ||| || |||||||||||||||| ||||| Sbjct: 297 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcctgtgg 238 Query: 452 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcgg 511 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| ||||||||| Sbjct: 237 aagtagcgcatcccgaccttgccgaagtagcccgggtggtacttgtcgaacaggatgcgg 178 Query: 512 tggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccaca 571 ||||||||||| || |||||||| ||||| ||||| || ||||| |||||||| || | Sbjct: 177 tggtggtgcatcccgccggcgttcccgcgccctcccgggtgcttccggtgcttcccgatc 118 Query: 572 cgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 620 |||||||||||||| || ||||| ||||||||||| ||||||||||||| Sbjct: 117 cgcccgtgcccggccgacacgtgcccgcgcttcttccggttcttcttga 69
>dbj|AB077113.1| Prunus persica mRNA, microsatellite marker M9a Length = 630 Score = 246 bits (124), Expect = 8e-62 Identities = 208/236 (88%) Strand = Plus / Minus Query: 395 gaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtggaag 454 ||||||||| | |||||||||||| | ||| ||||||| |||||| ||||||||||||| Sbjct: 289 gaccagagcttgtcgacgttgacgatggggcagtagaacttgttgcggagcttgtggaag 230 Query: 455 tacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtgg 514 || | |||||| ||||| || || || || |||||||||||||||||||||||||||||| Sbjct: 229 tagcgcataccaactttaccaaaataccccggatggtacttgtcgaagaggatgcggtgg 170 Query: 515 tggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccacacgc 574 |||||||||||||||||||||||||| ||||| |||||||||||||||||||| | ||| Sbjct: 169 tggtgcatgcctccggcgttaccgcgacctccaggatgcttgcggtgcttgccgatacga 110 Query: 575 ccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttgaggcgggtcgt 630 || ||||||||| ||||||||| | |||||||||||||||||||| |||||||| Sbjct: 109 ccatgcccggcgctgacgtggcctctcttcttgcggttcttcttgaatcgggtcgt 54 Score = 67.9 bits (34), Expect = 4e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 228 ccttgatcttcttctcggcgatcttggagatgagcttggccttgac 273 |||||||||||||||| || ||||||||||||||||||||||||| Sbjct: 459 ccttgatcttcttctcagctgtcttggagatgagcttggccttgac 414
>dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT39H01, TM0172, complete sequence Length = 127731 Score = 218 bits (110), Expect = 2e-53 Identities = 197/226 (87%) Strand = Plus / Plus Query: 395 gaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtggaag 454 ||||||||| | |||| ||||||||| ||| ||||| ||||| ||||||||||||| Sbjct: 97486 gaccagagcttgtcgatgttgacggtggggcaaaagaactggttgcggagcttgtggaag 97545 Query: 455 tacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtgg 514 || | |||||| || ||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 97546 tagcgcataccaaccttgccgaagtaaccgggatggtacttgtcgaagaggatgcggtgg 97605 Query: 515 tggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccacacgc 574 |||||||||||||||||||||||||| ||||| |||||||||||||||||||| | || Sbjct: 97606 tggtgcatgcctccggcgttaccgcgacctcctggatgcttgcggtgcttgccgattcga 97665 Query: 575 ccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 620 ||||| |||||| ||||||||| | |||||| | ||||||||||| Sbjct: 97666 ccgtggccggcgctgacgtggcctctcttcttcctgttcttcttga 97711 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Plus Query: 228 ccttgatcttcttctcggcgatcttggagatgagcttggcctt 270 |||||||||||||||| || ||||| || |||||||| ||||| Sbjct: 97310 ccttgatcttcttctcagcaatcttcgaaatgagcttcgcctt 97352
>gb|BT016406.1| Zea mays clone Contig239 mRNA sequence Length = 1257 Score = 194 bits (98), Expect = 2e-46 Identities = 152/170 (89%) Strand = Plus / Plus Query: 195 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 254 |||||||| ||||||||| |||||||| || |||||||||||||||||||||| ||||| Sbjct: 199 cctaggcggtgagcacgacggcgccgcctgctgccttgatcttcttctcggcgaccttgg 258 Query: 255 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 314 |||||||||||||||||||||| |||||||| |||||||| |||||| |||||||||| Sbjct: 259 agatgagcttggccttgacgacaatgggctttggcggcagcacccccttcccgagcacct 318 Query: 315 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccg 364 |||||||||||||||||| |||||||| |||||||||||||||||| Sbjct: 319 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgccgccg 368
>gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete sequence Length = 117437 Score = 172 bits (87), Expect = 9e-40 Identities = 156/179 (87%) Strand = Plus / Minus Query: 442 gagcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaa 501 ||||||||| ||||| | |||||| ||||| |||||||| || ||||||||||||||||| Sbjct: 7081 gagcttgtgaaagtaacgcataccaactttaccgaagtaacctggatggtacttgtcgaa 7022 Query: 502 gaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtg 561 ||||||||| ||||| ||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 7021 gaggatgcgatggtgatgcatacctccggcgttaccacgacctccgggatgcttgcggtg 6962 Query: 562 cttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 620 || || | ||| ||||| ||||| |||||||||||||||||| | ||||||||||| Sbjct: 6961 ttttccgatacgaccgtgaccggcactgacgtggccgcgcttcttcctgttcttcttga 6903
>ref|NM_105728.2| Arabidopsis thaliana structural constituent of ribosome AT1G70600 mRNA, complete cds Length = 737 Score = 151 bits (76), Expect = 3e-33 Identities = 163/192 (84%) Strand = Plus / Minus Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 256 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 197 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 ||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||| Sbjct: 196 ggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccgg 137 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 ||||||| |||||||| || | ||| || || |||||| |||||| || | |||||| | Sbjct: 136 gatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttcc 77 Query: 609 ggttcttcttga 620 ||||||||||| Sbjct: 76 tgttcttcttga 65
>gb|AY091706.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds Length = 441 Score = 151 bits (76), Expect = 3e-33 Identities = 163/192 (84%) Strand = Plus / Minus Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 205 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 146 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 ||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||| Sbjct: 145 ggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccgg 86 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 ||||||| |||||||| || | ||| || || |||||| |||||| || | |||||| | Sbjct: 85 gatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttcc 26 Query: 609 ggttcttcttga 620 ||||||||||| Sbjct: 25 tgttcttcttga 14
>gb|AY048228.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds Length = 665 Score = 151 bits (76), Expect = 3e-33 Identities = 163/192 (84%) Strand = Plus / Minus Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 254 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 195 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 ||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||| Sbjct: 194 ggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccgg 135 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 ||||||| |||||||| || | ||| || || |||||| |||||| || | |||||| | Sbjct: 134 gatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttcc 75 Query: 609 ggttcttcttga 620 ||||||||||| Sbjct: 74 tgttcttcttga 63
>gb|AY039519.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds Length = 644 Score = 151 bits (76), Expect = 3e-33 Identities = 163/192 (84%) Strand = Plus / Minus Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 254 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 195 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 ||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||| Sbjct: 194 ggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccgg 135 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 ||||||| |||||||| || | ||| || || |||||| |||||| || | |||||| | Sbjct: 134 gatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttcc 75 Query: 609 ggttcttcttga 620 ||||||||||| Sbjct: 74 tgttcttcttga 63
>emb|BX813428.1|CNS0AARB Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB17ZA01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 682 Score = 151 bits (76), Expect = 3e-33 Identities = 163/192 (84%) Strand = Plus / Minus Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 248 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 189 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 ||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||| Sbjct: 188 ggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccgg 129 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 ||||||| |||||||| || | ||| || || |||||| |||||| || | |||||| | Sbjct: 128 gatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttcc 69 Query: 609 ggttcttcttga 620 ||||||||||| Sbjct: 68 tgttcttcttga 57
>emb|BX827775.1|CNS0A4FW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH20ZA08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 633 Score = 151 bits (76), Expect = 3e-33 Identities = 163/192 (84%) Strand = Plus / Plus Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 394 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 453 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 ||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||| Sbjct: 454 ggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccgg 513 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 ||||||| |||||||| || | ||| || || |||||| |||||| || | |||||| | Sbjct: 514 gatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttcc 573 Query: 609 ggttcttcttga 620 ||||||||||| Sbjct: 574 tgttcttcttga 585
>gb|AC010796.7|AC010796 Arabidopsis thaliana chromosome 1 BAC F24J13 genomic sequence, complete sequence Length = 87400 Score = 151 bits (76), Expect = 3e-33 Identities = 163/192 (84%) Strand = Plus / Plus Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 71317 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 71376 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 ||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||| Sbjct: 71377 ggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccgg 71436 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 ||||||| |||||||| || | ||| || || |||||| |||||| || | |||||| | Sbjct: 71437 gatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttcc 71496 Query: 609 ggttcttcttga 620 ||||||||||| Sbjct: 71497 tgttcttcttga 71508
>gb|AC011663.7|AC011663 Arabidopsis thaliana chromosome 1 BAC F5A18 genomic sequence, complete sequence Length = 108582 Score = 151 bits (76), Expect = 3e-33 Identities = 163/192 (84%) Strand = Plus / Minus Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 83185 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 83126 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 ||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||| Sbjct: 83125 ggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccgg 83066 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 ||||||| |||||||| || | ||| || || |||||| |||||| || | |||||| | Sbjct: 83065 gatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttcc 83006 Query: 609 ggttcttcttga 620 ||||||||||| Sbjct: 83005 tgttcttcttga 82994
>gb|AY085573.1| Arabidopsis thaliana clone 15789 mRNA, complete sequence Length = 628 Score = 151 bits (76), Expect = 3e-33 Identities = 163/192 (84%) Strand = Plus / Minus Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 256 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 197 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 ||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||| Sbjct: 196 ggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccgg 137 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 ||||||| |||||||| || | ||| || || |||||| |||||| || | |||||| | Sbjct: 136 gatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttcc 77 Query: 609 ggttcttcttga 620 ||||||||||| Sbjct: 76 tgttcttcttga 65
>emb|X91959.1|AT60SRL27 A.thaliana mRNA for 60S ribosomal protein L27a Length = 641 Score = 151 bits (76), Expect = 3e-33 Identities = 163/192 (84%) Strand = Plus / Minus Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 237 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 178 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 ||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||| Sbjct: 177 ggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccgg 118 Query: 549 gatgcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgc 608 ||||||| |||||||| || | ||| || || |||||| |||||| || | |||||| | Sbjct: 117 gatgcttacggtgcttaccgatacgtccatgtccggcgctgacgtgacctctcttcttcc 58 Query: 609 ggttcttcttga 620 ||||||||||| Sbjct: 57 tgttcttcttga 46
>gb|AY804547.1| Drosophila yakuba strain Tai18 ribosomal protein L27A (RpL27A) gene, partial cds Length = 866 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 407 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 348 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 347 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 289
>gb|AY804546.1| Drosophila santomea strain STO.4 ribosomal protein L27A (RpL27A) gene, partial cds Length = 862 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 403 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 344 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 343 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 285
>gb|AY804956.1| Drosophila yakuba isolate 1250_4 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804955.1| Drosophila yakuba isolate 1250_3 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804953.1| Drosophila yakuba isolate 1250_1 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804952.1| Drosophila santomea isolate 1250_3 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804951.1| Drosophila santomea isolate 1250_2 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804950.1| Drosophila santomea isolate 1250_1 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804949.1| Drosophila santomea isolate 1566_4 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804948.1| Drosophila santomea isolate 1566_3 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804947.1| Drosophila santomea isolate 1566_2 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804946.1| Drosophila santomea isolate 1566_1 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804944.1| Drosophila yakuba isolate SaoT_2 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804943.1| Drosophila yakuba isolate SaoT_1 RpL27A gene, partial sequence Length = 822 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY232080.1| Drosophila yakuba clone yak-ad_RpL27A mRNA sequence Length = 432 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 173 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 114 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 113 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 55
>gb|AY231794.1| Drosophila yakuba clone yak-em_RpL27A mRNA sequence Length = 444 Score = 149 bits (75), Expect = 1e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 185 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 126 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 125 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 67
>gb|AY804954.1| Drosophila yakuba isolate 1250_2 RpL27A gene, partial sequence Length = 822 Score = 145 bits (73), Expect = 2e-31 Identities = 107/119 (89%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||| ||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcraagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| |||||||||||||||||||||||||| Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 291
>gb|AY804945.1| Drosophila yakuba isolate SaoT_3 RpL27A gene, partial sequence Length = 822 Score = 145 bits (73), Expect = 2e-31 Identities = 107/119 (89%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| |||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 350 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||||||||||| || || ||||||||||| ||||||||||||||||||||||| || Sbjct: 349 cggtggtggtgcataccaccagcgttaccgcgacctccgggatgcttgcggtgcttrcc 291
>gb|AC147877.10| Medicago truncatula clone mth2-9b13, complete sequence Length = 122251 Score = 145 bits (73), Expect = 2e-31 Identities = 162/192 (84%) Strand = Plus / Plus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 |||||||| ||||| | |||||| || || |||||||| || ||||| |||||||||||| Sbjct: 105837 agcttgtgaaagtagcgcataccaaccttaccgaagtaacctggatgatacttgtcgaag 105896 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| || ||||||||||| |||||||||||||| || ||||||||||||||||| ||| Sbjct: 105897 aggatacgatggtggtgcattcctccggcgttaccacgacctccgggatgcttgcgatgc 105956 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttgagg 622 || || | ||| ||||| |||||| ||||| || | |||||| | ||||||||||| | Sbjct: 105957 tttccgatacgaccgtgaccggcgctcacgtgacctctcttcttcctgttcttcttgaag 106016 Query: 623 cgggtcgtnatc 634 |||||||| ||| Sbjct: 106017 cgggtcgtcatc 106028
>emb|CT573365.4| M.truncatula DNA sequence from clone MTH2-89E15 on chromosome 3, complete sequence Length = 123679 Score = 145 bits (73), Expect = 2e-31 Identities = 162/192 (84%) Strand = Plus / Plus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 |||||||| ||||| | |||||| || || |||||||| || ||||| |||||||||||| Sbjct: 18919 agcttgtgaaagtagcgcataccaaccttaccgaagtaacctggatgatacttgtcgaag 18978 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| || ||||||||||| |||||||||||||| || ||||||||||||||||| ||| Sbjct: 18979 aggatacgatggtggtgcattcctccggcgttaccacgacctccgggatgcttgcgatgc 19038 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttgagg 622 || || | ||| ||||| |||||| ||||| || | |||||| | ||||||||||| | Sbjct: 19039 tttccgatacgaccgtgaccggcgctcacgtgacctctcttcttcctgttcttcttgaag 19098 Query: 623 cgggtcgtnatc 634 |||||||| ||| Sbjct: 19099 cgggtcgtcatc 19110
>emb|BX817859.1|CNS0AEEA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL45ZD07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 646 Score = 143 bits (72), Expect = 8e-31 Identities = 120/136 (88%) Strand = Plus / Minus Query: 429 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 488 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 243 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 184 Query: 489 ggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgg 548 ||||||||||||||||||| | |||||| ||||| ||||| |||||||| || ||||||| Sbjct: 183 ggtacttgtcgaagaggatcctgtggtgatgcatacctccagcgttaccacgacctccgg 124 Query: 549 gatgcttgcggtgctt 564 ||||||| |||||||| Sbjct: 123 gatgcttacggtgctt 108
>gb|DQ191629.1| Solanum tuberosum ribosomal protein L27a-like protein mRNA, complete cds Length = 649 Score = 139 bits (70), Expect = 1e-29 Identities = 151/178 (84%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| || | |||||| ||||| |||||||| || ||||||||||||||||| Sbjct: 243 agcttgtggaaataacgcatacctactttaccgaagtaaccaggatggtacttgtcgaaa 184 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | ||| |||||||| |||||||||||||| | ||||| |||||||| | |||| Sbjct: 183 aggatcctgtgatggtgcatacctccggcgttacctcttcctcctggatgcttcctgtgc 124 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 620 || |||||||| || || |||||| ||||||||| |||||||| | ||||||||||| Sbjct: 123 tttcccacacgaccatgtccggcgctgacgtggccacgcttcttcctgttcttcttga 66
>ref|NM_102178.2| Arabidopsis thaliana RPL27A (RIBOSOMAL PROTEIN L27A); structural constituent of ribosome AT1G23290 (RPL27A) mRNA, complete cds Length = 604 Score = 135 bits (68), Expect = 2e-28 Identities = 149/176 (84%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 214 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 155 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||| Sbjct: 154 aggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtgc 95 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 618 || || | ||| || || |||||| |||||| || | |||||| | ||||||||| Sbjct: 94 ttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 39
>gb|AF349525.1| Arabidopsis thaliana putative 60s ribosomal protein l27a (At1g23290) mRNA, complete cds Length = 491 Score = 135 bits (68), Expect = 2e-28 Identities = 149/176 (84%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 191 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 132 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||| Sbjct: 131 aggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtgc 72 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 618 || || | ||| || || |||||| |||||| || | |||||| | ||||||||| Sbjct: 71 ttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 16
>gb|AF324716.2| Arabidopsis thaliana At1g23290 (At1g23290/F26F24_23) mRNA, complete cds Length = 572 Score = 135 bits (68), Expect = 2e-28 Identities = 149/176 (84%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 215 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 156 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||| Sbjct: 155 aggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtgc 96 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 618 || || | ||| || || |||||| |||||| || | |||||| | ||||||||| Sbjct: 95 ttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 40
>emb|BX814201.1|CNS0AC9G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB60ZF02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 568 Score = 135 bits (68), Expect = 2e-28 Identities = 149/176 (84%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 196 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 137 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||| Sbjct: 136 aggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtgc 77 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 618 || || | ||| || || |||||| |||||| || | |||||| | ||||||||| Sbjct: 76 ttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 21
>emb|BX814197.1|CNS0AC79 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB60ZD12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 568 Score = 135 bits (68), Expect = 2e-28 Identities = 149/176 (84%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 196 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 137 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||| Sbjct: 136 aggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtgc 77 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 618 || || | ||| || || |||||| |||||| || | |||||| | ||||||||| Sbjct: 76 ttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 21
>emb|BX814930.1|CNS0ABGE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS19ZG02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 545 Score = 135 bits (68), Expect = 2e-28 Identities = 149/176 (84%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 203 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 144 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||| Sbjct: 143 aggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtgc 84 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 618 || || | ||| || || |||||| |||||| || | |||||| | ||||||||| Sbjct: 83 ttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 28
>gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana BAC F26F24 from chromosome I, complete sequence Length = 99053 Score = 135 bits (68), Expect = 2e-28 Identities = 149/176 (84%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 39553 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 39494 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||| Sbjct: 39493 aggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtgc 39434 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttctt 618 || || | ||| || || |||||| |||||| || | |||||| | ||||||||| Sbjct: 39433 ttaccgatacgtccatgtccggcgctgacgtgacctctcttctttctgttcttctt 39378
>gb|BT022137.2| Drosophila melanogaster IP01552 full insert cDNA Length = 2992 Score = 133 bits (67), Expect = 8e-28 Identities = 106/119 (89%) Strand = Plus / Plus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||| || || ||||||||||| || |||||||| ||||||||| |||| Sbjct: 407 tggaagttcctcatgcccaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 466 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||||| ||||||||||| || ||||||||||| |||||||||||||||||||||||||| Sbjct: 467 cggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 525
>ref|NM_057615.3| Drosophila melanogaster Ribosomal protein L27A CG15442-RA (RpL27A), mRNA Length = 643 Score = 133 bits (67), Expect = 8e-28 Identities = 106/119 (89%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||| || || ||||||||||| || |||||||| ||||||||| |||| Sbjct: 261 tggaagttcctcatgcccaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 202 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||||| ||||||||||| || ||||||||||| |||||||||||||||||||||||||| Sbjct: 201 cggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 143
>gb|AY071144.1| Drosophila melanogaster RE17991 full length cDNA Length = 649 Score = 133 bits (67), Expect = 8e-28 Identities = 106/119 (89%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||| || || ||||||||||| || |||||||| ||||||||| |||| Sbjct: 261 tggaagttcctcatgcccaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 202 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||||| ||||||||||| || ||||||||||| |||||||||||||||||||||||||| Sbjct: 201 cggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 143
>gb|AC092232.1|AC092232 Drosophila melanogaster, chromosome 2L, region 24E-24F, BAC clone BACR28K16, complete sequence Length = 182897 Score = 133 bits (67), Expect = 8e-28 Identities = 106/119 (89%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||| || || ||||||||||| || |||||||| ||||||||| |||| Sbjct: 71046 tggaagttcctcatgcccaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 70987 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||||| ||||||||||| || ||||||||||| |||||||||||||||||||||||||| Sbjct: 70986 cggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 70928
>gb|AE003576.5| Drosophila melanogaster chromosome 2L, section 15 of 83 of the complete sequence Length = 289893 Score = 133 bits (67), Expect = 8e-28 Identities = 106/119 (89%) Strand = Plus / Plus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||| || || ||||||||||| || |||||||| ||||||||| |||| Sbjct: 136621 tggaagttcctcatgcccaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 136680 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||||| ||||||||||| || ||||||||||| |||||||||||||||||||||||||| Sbjct: 136681 cggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 136739
>gb|U66357.1|DMU66357 Drosophila melanogaster ribosomal protein RpL27a gene, complete cds Length = 1099 Score = 133 bits (67), Expect = 8e-28 Identities = 106/119 (89%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||| || || ||||||||||| || |||||||| ||||||||| |||| Sbjct: 431 tggaagttcctcatgcccaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 372 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||||| ||||||||||| || ||||||||||| |||||||||||||||||||||||||| Sbjct: 371 cggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 313
>gb|U66358.1|DMU66358 Drosophila melanogaster ribosomal protein L27a homolog mRNA, complete cds Length = 565 Score = 133 bits (67), Expect = 8e-28 Identities = 106/119 (89%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||| || || ||||||||||| || |||||||| ||||||||| |||| Sbjct: 201 tggaagttcctcatgcccaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 142 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||||| ||||||||||| || ||||||||||| |||||||||||||||||||||||||| Sbjct: 141 cggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 83
>gb|AC004267.1|AC004267 Drosophila melanogaster DNA sequence (P1 DS07968 (D117)), complete sequence Length = 31557 Score = 133 bits (67), Expect = 8e-28 Identities = 106/119 (89%) Strand = Plus / Plus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||| || || ||||||||||| || |||||||| ||||||||| |||| Sbjct: 10842 tggaagttcctcatgcccaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 10901 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||||| ||||||||||| || ||||||||||| |||||||||||||||||||||||||| Sbjct: 10902 cggtgatggtgcatgccaccagcgttaccgcgacctccgggatgcttgcggtgcttgcc 10960
>gb|DQ191661.1| Solanum tuberosum ribosomal protein L27a-like protein mRNA, complete cds Length = 665 Score = 131 bits (66), Expect = 3e-27 Identities = 150/178 (84%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| || | |||||| ||||| |||||||| || ||||||||||||||||| Sbjct: 240 agcttgtggaaataacgcatacctactttaccgaagtaaccaggatggtacttgtcgaaa 181 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | ||| |||||||| |||||||||||||| | ||||| |||||||| | |||| Sbjct: 180 aggatcctgtgatggtgcatacctccggcgttacctcttcctcctggatgcttcctgtgc 121 Query: 563 ttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggttcttcttga 620 || || ||||| || || |||||| ||||||||| |||||||| | ||||||||||| Sbjct: 120 tttccgacacgaccatgtccggcgctgacgtggccacgcttcttcctgttcttcttga 63
>gb|BT000542.1| Arabidopsis thaliana 60s ribosomal protein l27a. (At1g23290/F26F24_23) mRNA, complete cds Length = 441 Score = 131 bits (66), Expect = 3e-27 Identities = 108/122 (88%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 191 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 132 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||| Sbjct: 131 aggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtgc 72 Query: 563 tt 564 || Sbjct: 71 tt 70
>gb|AF410280.1|AF410280 Arabidopsis thaliana At1g23290/F26F24_23 mRNA, complete cds Length = 571 Score = 131 bits (66), Expect = 3e-27 Identities = 108/122 (88%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 215 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 156 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||| Sbjct: 155 aggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtgc 96 Query: 563 tt 564 || Sbjct: 95 tt 94
>gb|AY086256.1| Arabidopsis thaliana clone 23092 mRNA, complete sequence Length = 570 Score = 131 bits (66), Expect = 3e-27 Identities = 108/122 (88%) Strand = Plus / Minus Query: 443 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 502 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 216 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 157 Query: 503 aggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgc 562 ||||| | |||||| ||||| ||||| ||||| || || |||||||||||||| |||||| Sbjct: 156 aggatcctgtggtgatgcatacctcctgcgtttccacgacctccgggatgcttacggtgc 97 Query: 563 tt 564 || Sbjct: 96 tt 95
>dbj|AB042856.1| Panax ginseng mRNA for 60S ribosomal protein L27a, complete cds Length = 590 Score = 127 bits (64), Expect = 5e-26 Identities = 136/160 (85%) Strand = Plus / Minus Query: 427 gtagaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccggg 486 ||||||| |||||| |||| | ||||| |||||||| || || || || || || || || Sbjct: 223 gtagaacttgttgcggagcctatggaaatacctcattcccaccttcccaaaataacccgg 164 Query: 487 atggtacttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctcc 546 ||||||||||||||| | ||| |||||||||||||| ||||||||||| ||||| ||||| Sbjct: 163 atggtacttgtcgaacaagatccggtggtggtgcattcctccggcgtttccgcgacctcc 104 Query: 547 gggatgcttgcggtgcttgcccacacgcccgtgcccggcg 586 ||||||||| ||||||||||| | ||| ||||| |||||| Sbjct: 103 gggatgcttacggtgcttgccgatacggccgtgaccggcg 64 Score = 48.1 bits (24), Expect = 0.036 Identities = 45/52 (86%) Strand = Plus / Minus Query: 228 ccttgatcttcttctcggcgatcttggagatgagcttggccttgacgacgat 279 |||||||||||||||| || ||||||| | |||||||||||| || ||||| Sbjct: 425 ccttgatcttcttctccgcagtcttggacacgagcttggccttcacaacgat 374
>gb|AF459726.1| Elaeocarpus angustifolius clone scu22Eg microsatellite sequence Length = 229 Score = 121 bits (61), Expect = 3e-24 Identities = 112/129 (86%) Strand = Plus / Plus Query: 492 acttgtcgaagaggatgcggtggtggtgcatgcctccggcgttaccgcggcctccgggat 551 |||||||||||||||| | |||||||||||| ||||||||||||||||| ||||| |||| Sbjct: 1 acttgtcgaagaggatcctgtggtggtgcatacctccggcgttaccgcgacctcctggat 60 Query: 552 gcttgcggtgcttgcccacacgcccgtgcccggcggagacgtggccgcgcttcttgcggt 611 | || ||||||||||| | ||| ||||| || ||| ||||| ||||||||||| |||| Sbjct: 61 gttttcggtgcttgccgatacgaccgtgtcctgcgctcacgtgcccgcgcttcttacggt 120 Query: 612 tcttcttga 620 ||||||||| Sbjct: 121 tcttcttga 129
>emb|X74484.1|DMRPL27A D.melanogaster mRNA for ribosomal protein L27a Length = 456 Score = 117 bits (59), Expect = 5e-23 Identities = 104/119 (87%) Strand = Plus / Minus Query: 449 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatg 508 ||||||| |||||| || || ||||||||||| || |||||||| ||||||||| |||| Sbjct: 188 tggaagttcctcatgcccaccttgccgaagtaaccaggatggtatttgtcgaagttgatg 129 Query: 509 cggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||||| ||||||||||| || ||||||||| |||||||||||||||||||||||||| Sbjct: 128 cggtgatggtgcatgccacccaggttaccgcgacctccgggatgcttgcggtgcttgcc 70
>gb|AY432710.1| Aedes aegypti ASAP ID: 34035 cytosolic large ribosomal subunit L27A mRNA sequence Length = 658 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 448 gtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggat 507 |||||||| |||||||||||| ||||||||||| || || ||||| ||||||||| ||| Sbjct: 273 gtggaagttcctcataccgaccttgccgaagtatccagggtggtatttgtcgaagttgat 214 Query: 508 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||| ||||||||||| || ||||||||||| || || || ||||| ||||||||||| Sbjct: 213 gcggtgatggtgcatgccaccagcgttaccgcgaccaccagggtgcttacggtgcttgcc 154
>gb|DQ440054.1| Aedes aegypti clone AE-306 60S ribosomal protein L15/L27 mRNA, complete cds Length = 450 Score = 111 bits (56), Expect = 3e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 448 gtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggat 507 |||||||| |||||||||||| ||||||||||| || || ||||| ||||||||| ||| Sbjct: 192 gtggaagttcctcataccgaccttgccgaagtatccagggtggtatttgtcgaagttgat 133 Query: 508 gcggtggtggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 |||||| ||||||||||| || ||||||||||| || || || ||||| ||||||||||| Sbjct: 132 gcggtgatggtgcatgccaccagcgttaccgcgaccaccagggtgcttacggtgcttgcc 73
>gb|AY961477.1| Phytophthora infestans clone MY-19-H-09 ribosomal protein L27 mRNA, complete cds Length = 545 Score = 103 bits (52), Expect = 7e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| || |||||||| || || ||| ||||||| | ||||| ||||||||||| Sbjct: 181 cataccgaccttaccgaagtaaccagggtggaacttgtccataaggatacggtggtggtg 122 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcccacacgcccgtg 579 | ||| |||||||||||||| || || || ||||||||||||||||| | ||| ||||| Sbjct: 121 ctggccaccggcgttaccgcgaccacccgggtgcttgcggtgcttgccgatacgaccgtg 62 Query: 580 cccggcggagacgtggccgcgcttcttgcggttctt 615 |||||| ||||| ||||| |||||||||||||| Sbjct: 61 gccggcgctcacgtgtccgcgtttcttgcggttctt 26 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 299 cccttgccgagcaccttgaagtagccg 325 ||||||||||||||||||||||||||| Sbjct: 351 cccttgccgagcaccttgaagtagccg 325
>emb|BX071844.1|CNS09RLK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 615 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 674 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 675 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 722
>emb|BX071644.1|CNS09RG0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 870 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 265 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 206 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 205 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 158
>emb|BX071615.1|CNS09RF7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 625 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 684 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 685 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 732
>emb|BX071614.1|CNS09RF6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 249 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 190 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 189 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 142
>emb|BX071463.1|CNS09RAZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 260 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 201 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 200 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 153
>emb|BX071150.1|CNS09R2A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 763 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 631 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 690 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 691 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 738
>emb|BX071149.1|CNS09R29 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 238 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 179 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 178 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 131
>emb|BX071048.1|CNS09QZG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 616 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 675 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 676 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 723
>emb|BX071325.1|CNS09R75 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8DC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 608 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 667 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 668 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 715
>emb|BX071324.1|CNS09R74 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 243 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 184 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 183 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 136
>emb|BX070859.1|CNS09QU7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 264 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 205 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 204 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 157
>emb|BX070688.1|CNS09QPG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 907 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 604 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 663 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 664 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 711
>emb|BX070687.1|CNS09QPF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 246 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 187 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 186 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 139
>emb|BX070669.1|CNS09QOX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 188 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 187 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140
>emb|BX070195.1|CNS09QBR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7AG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 252 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 193 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 192 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 145
>emb|BX070000.1|CNS09Q6C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 868 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 637 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 696 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 697 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 744
>emb|BX069999.1|CNS09Q6B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 936 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 246 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 187 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 186 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 139
>emb|BX069998.1|CNS09Q6A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 618 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 677 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 678 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 725
>emb|BX069997.1|CNS09Q69 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 282 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 223 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 222 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 175
>emb|BX069926.1|CNS09Q4A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 634 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 260 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 201 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 200 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 153
>emb|BX069763.1|CNS09PZR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 245 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 186 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 185 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 138
>emb|BX069694.1|CNS09PXU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 442 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 257 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 198 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 197 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150
>emb|BX069346.1|CNS09PO6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 277 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 218 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 217 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 170
>emb|BX069225.1|CNS09PKT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 765 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 554 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 613 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 614 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 661
>emb|BX069118.1|CNS09PHU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 246 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 187 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 186 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 139
>emb|BX069067.1|CNS09PGF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 625 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 684 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 685 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 732
>emb|BX069066.1|CNS09PGE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 259 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 200 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 199 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 152
>emb|BX068786.1|CNS09P8M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 261 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 202 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 201 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 154
>emb|BX068729.1|CNS09P71 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 252 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 193 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 192 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 145
>emb|BX068402.1|CNS09OXY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52CD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 639 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 698 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 699 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 746
>emb|BX068401.1|CNS09OXX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 331 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 272 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 271 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 224
>emb|BX068341.1|CNS09OW9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 642 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 701 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 702 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 749
>emb|BX068158.1|CNS09OR6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 253 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 194 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 193 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 146
>emb|BX067962.1|CNS09OLQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 241 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 182 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 181 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 134
>emb|BX067750.1|CNS09OFU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 383 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 267 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 208 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 207 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 160
>emb|BX067375.1|CNS09O5F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 864 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 618 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 677 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 678 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 725
>emb|BX067374.1|CNS09O5E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 245 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 186 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 185 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 138
>emb|BX067204.1|CNS09O0O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 617 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 676 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 677 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 724
>emb|BX067203.1|CNS09O0N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 250 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 191 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 190 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 143
>emb|BX066717.1|CNS09NN5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 246 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 187 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 186 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 139
>emb|BX066486.1|CNS09NGQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 610 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 669 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 670 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 717
>emb|BX066485.1|CNS09NGP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 251 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 192 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 191 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 144
>emb|BX066475.1|CNS09NGF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 610 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 669 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 670 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 717
>emb|BX066474.1|CNS09NGE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 248 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 189 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 188 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141
>emb|BX066450.1|CNS09NFQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 621 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 680 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 681 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 728
>emb|BX066388.1|CNS09NE0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 263 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 204 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 203 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 156
>emb|BX065859.1|CNS09MZB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 577 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 256 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 197 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 196 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 149
>emb|BX065576.1|CNS09MRG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 807 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 127 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 68 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 67 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20
>emb|BX065497.1|CNS09MP9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 252 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 193 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 192 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 145
>emb|BX064955.1|CNS09MA7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 615 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 674 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 675 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 722
>emb|BX064954.1|CNS09MA6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 278 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 219 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 218 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 171
>emb|BX064810.1|CNS09M66 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 229 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 127 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 68 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 67 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20
>emb|BX064779.1|CNS09M5B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 607 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 666 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 667 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 714
>emb|BX064778.1|CNS09M5A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 215 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 156 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 155 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 108
>emb|BX064611.1|CNS09M0N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 188 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 187 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140
>emb|BX064509.1|CNS09LXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46DC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 633 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 692 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 693 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 740
>emb|BX064049.1|CNS09LL1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 188 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 187 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140
>emb|BX063943.1|CNS09LI3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 643 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 702 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 703 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 750
>emb|BX063942.1|CNS09LI2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 288 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 229 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 228 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 181
>emb|BX063825.1|CNS09LET Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 594 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 412 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 471 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 472 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 519
>emb|BX063744.1|CNS09LCK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 724 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 267 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 208 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 207 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 160
>emb|BX063729.1|CNS09LC5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 255 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 196 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 195 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 148
>emb|BX063616.1|CNS09L90 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 248 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 189 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 188 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141
>emb|BX063581.1|CNS09L81 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 892 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 245 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 186 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 185 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 138
>emb|BX063323.1|CNS09L0V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 634 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 693 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 694 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 741
>emb|BX062743.1|CNS09KKR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 840 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 380 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 321 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 320 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 273
>emb|BX062645.1|CNS09KI1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 870 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 238 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 179 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 178 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 131
>emb|BX062417.1|CNS09KBP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 870 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 628 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 687 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 688 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 735
>emb|BX062386.1|CNS09KAU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 636 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 695 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 696 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 743
>emb|BX061846.1|CNS09JVU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 251 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 192 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 191 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 144
>emb|BX061653.1|CNS09JQH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 906 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 606 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 665 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 666 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 713
>emb|BX061652.1|CNS09JQG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 244 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 185 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 184 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 137
>emb|BX061533.1|CNS09JN5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 243 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 184 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 183 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 136
>emb|BX061500.1|CNS09JM8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 250 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 191 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 190 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 143
>emb|BX061418.1|CNS09JJY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 241 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 182 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 181 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 134
>emb|BX061372.1|CNS09JIO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42AF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 871 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 586 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 645 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 646 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 693
>emb|BX061371.1|CNS09JIN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 225 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 166 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 165 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 118
>emb|BX060850.1|CNS09J46 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41BF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 629 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 258 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 199 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 198 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 151
>emb|BX060762.1|CNS09J1Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 257 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 198 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 197 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150
>emb|BX060638.1|CNS09IYA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 846 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 242 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 183 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 182 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 135
>emb|BX060485.1|CNS09IU1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 611 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 670 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 671 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 718
>emb|BX060484.1|CNS09IU0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 239 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 180 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 179 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 132
>emb|BX060483.1|CNS09ITZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 768 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 617 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 676 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 677 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 724
>emb|BX060482.1|CNS09ITY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 244 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 185 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 184 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 137
>emb|BX060103.1|CNS09IJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 258 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 199 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 198 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 151
>emb|BX060038.1|CNS09IHM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 188 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 187 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140
>emb|BX059961.1|CNS09IFH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 256 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 197 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 196 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 149
>emb|BX059617.1|CNS09I5X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 294 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 251 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 192 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 191 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 144
>emb|BX059580.1|CNS09I4W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 264 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 205 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 204 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 157
>emb|BX059462.1|CNS09I1M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 617 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 676 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 677 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 724
>emb|BX059461.1|CNS09I1L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 256 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 197 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 196 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 149
>emb|BX059340.1|CNS09HY8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 265 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 206 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 205 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 158
>emb|BX059085.1|CNS09HR5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 188 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 187 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140
>emb|BX058666.1|CNS09HFI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 239 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 180 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 179 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 132
>emb|BX058616.1|CNS09HE4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 889 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 597 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 656 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 657 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 704
>emb|BX058582.1|CNS09HD6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 268 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 209 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 208 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 161
>emb|BX058544.1|CNS09HC4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39AA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 631 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 690 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 691 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 738
>emb|BX058454.1|CNS09H9M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 600 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 263 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 204 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 203 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 156
>emb|BX058452.1|CNS09H9K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38DE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 834 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 618 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 677 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 678 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 725
>emb|BX058451.1|CNS09H9J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38DE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 257 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 198 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 197 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150
>emb|BX058229.1|CNS09H3D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 269 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 210 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 209 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 162
>emb|BX056605.1|CNS09FU9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36AB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 850 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 608 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 667 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 668 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 715
>emb|BX056604.1|CNS09FU8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 903 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 249 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 190 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 189 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 142
>emb|BX057878.1|CNS09GTM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 609 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 668 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 669 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 716
>emb|BX057784.1|CNS09GR0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 593 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 266 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 207 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 206 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 159
>emb|BX057633.1|CNS09GMT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 618 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 253 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 194 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 193 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 146
>emb|BX057505.1|CNS09GJ9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 537 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 257 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 198 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 197 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150
>emb|BX057495.1|CNS09GIZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 469 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 248 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 189 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 188 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141
>emb|BX055833.1|CNS09F8T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34CE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 271 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 212 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 211 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 164
>emb|BX055484.1|CNS09EZ4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 257 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 198 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 197 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150
>emb|BX053216.1|CNS09D84 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30DB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 240 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 181 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 180 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 133
>emb|BX053162.1|CNS09D6M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 188 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 129 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 128 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 81
>emb|BX053144.1|CNS09D64 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 863 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 189 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 130 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 129 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 82
>emb|BX055141.1|CNS09EPL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33CF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 783 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 248 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 189 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 188 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141
>emb|BX054882.1|CNS09EIE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 212 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 153 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 152 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 105
>emb|BX053068.1|CNS09D40 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 863 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 187 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 128 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 127 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 80
>emb|BX054081.1|CNS09DW5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32AD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 250 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 191 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 190 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 143
>emb|BX053881.1|CNS09DQL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 269 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 210 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 209 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 162
>emb|BX053707.1|CNS09DLR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 788 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 643 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 702 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 703 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 750
>emb|BX053706.1|CNS09DLQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 269 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 210 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 209 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 162
>emb|BX053663.1|CNS09DKJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31BH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 421 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 250 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 191 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 190 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 143
>emb|BX052674.1|CNS09CT2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 835 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 253 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 194 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 193 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 146
>emb|BX052301.1|CNS09CIP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3BD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 908 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 244 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 185 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 184 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 137
>emb|BX051916.1|CNS09C80 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC29CF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 818 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 609 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 668 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 669 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 716
>emb|BX051464.1|CNS09BVG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC28DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 252 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 193 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 192 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 145
>emb|BX051169.1|CNS09BN9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC28BC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 266 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 127 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 68 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 67 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20
>emb|BX050918.1|CNS09BGA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 312 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 127 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 68 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 67 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20
>emb|BX050847.1|CNS09BEB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 869 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 618 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 677 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 678 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 725
>emb|BX050846.1|CNS09BEA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 231 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 172 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 171 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 124
>emb|BX050735.1|CNS09BB7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 260 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 201 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 200 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 153
>emb|BX050637.1|CNS09B8H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27BA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 231 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 172 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 171 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 124
>emb|BX050473.1|CNS09B3X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 662 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 264 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 205 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 204 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 157
>emb|BX050285.1|CNS09AYP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26CG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 414 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 127 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 68 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 67 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20
>emb|BX049853.1|CNS09AMP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC26AA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 854 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 610 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 669 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 670 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 717
>emb|BX049852.1|CNS09AMO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26AA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 876 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 229 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 170 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 169 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 122
>emb|BX049352.1|CNS09A8S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 610 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 264 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 205 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 204 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 157
>emb|BX049279.1|CNS09A6R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC25AD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 629 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 688 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 689 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 736
>emb|BX049134.1|CNS09A2Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC24DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 521 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 257 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 198 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 197 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 150
>emb|BX048838.1|CNS099UI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC24BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 547 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 242 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 183 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 182 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 135
>emb|BX048660.1|CNS099PK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 908 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 244 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 185 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 184 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 137
>emb|BX046531.1|CNS0982F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC20AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 908 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 188 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 187 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140
>emb|BX046527.1|CNS0982B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC20AH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 251 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 192 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 191 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 144
>emb|BX048302.1|CNS099FM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23BF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 272 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 213 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 212 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 165
>emb|BX048147.1|CNS099BB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC23AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 774 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 645 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 704 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 705 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 752
>emb|BX048146.1|CNS099BA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 876 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 270 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 211 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 210 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 163
>emb|BX048050.1|CNS0998M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 699 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 290 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 231 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 230 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 183
>emb|BX047926.1|CNS09956 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 645 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 188 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 187 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 140
>emb|BX047906.1|CNS0994M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22CH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 244 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 185 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 184 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 137
>emb|BX047760.1|CNS0990K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 267 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 208 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 149 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 148 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 101
>emb|BX047689.1|CNS098YL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22BD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 766 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 252 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 193 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 192 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 145
>emb|BX047677.1|CNS098Y9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC22BC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 665 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 724 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 725 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 772
>emb|BX047676.1|CNS098Y8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22BC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 267 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 208 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 207 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 160
>emb|BX047547.1|CNS098UN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22AB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 700 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 160 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 101 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 100 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 53
>emb|BX047520.1|CNS098TW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21DG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 738 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 274 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 215 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 214 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 167
>emb|BX047255.1|CNS098MJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 290 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 127 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 68 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 67 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 20
>emb|BX047102.1|CNS098IA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21AE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 264 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 205 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 204 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 157
>emb|BX046950.1|CNS098E2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC20DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 276 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 217 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 216 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 169
>emb|BX046739.1|CNS09887 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC20CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 248 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 189 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 188 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141
>emb|BX046675.1|CNS0986F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC20BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 248 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 189 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 188 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141
>emb|BX046022.1|CNS097OA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC2BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 630 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 689 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 690 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 737
>emb|BX046021.1|CNS097O9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 271 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 212 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 211 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 164
>emb|BX045808.1|CNS097IC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2AE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 248 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 189 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 188 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 141
>emb|BX045791.1|CNS097HV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2AD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 883 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 255 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 196 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 195 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 148
>emb|BX045765.1|CNS097H5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC2AC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 626 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 685 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 686 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 733
>emb|BX045764.1|CNS097H4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2AC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 254 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 195 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 194 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 147
>emb|BX045565.1|CNS097BL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC19DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 798 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 288 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 229 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 228 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 181
>emb|BX043029.1|CNS095D5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 267 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 208 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 207 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 160
>emb|BX044717.1|CNS096O1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC18CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Plus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 632 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 691 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 692 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 739
>emb|BX044716.1|CNS096O0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC18CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 268 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 209 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 208 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 161
>emb|BX044419.1|CNS096FR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC18AC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 243 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 184 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 183 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 136
>emb|BX044308.1|CNS096CO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC17DD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 791 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 236 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 177 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 176 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 129
>emb|BX044225.1|CNS096AD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC17CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 275 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 216 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 215 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 168
>emb|BX044005.1|CNS09649 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC17BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 264 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 205 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 204 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 157
>emb|BX043494.1|CNS095Q2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC16AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 460 cataccgactttgccgaagtagccgggatggtacttgtcgaagaggatgcggtggtggtg 519 ||||||||| ||||||||||| || |||||||| ||||||||| ||| ||||| ||||| Sbjct: 254 cataccgaccttgccgaagtaacccggatggtatttgtcgaagttgatacggtgatggtg 195 Query: 520 catgcctccggcgttaccgcggcctccgggatgcttgcggtgcttgcc 567 ||| || || ||||||||||| || || |||||||| ||||||||||| Sbjct: 194 cataccaccagcgttaccgcgaccaccaggatgcttacggtgcttgcc 147 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,379,738 Number of Sequences: 3902068 Number of extensions: 4379738 Number of successful extensions: 172635 Number of sequences better than 10.0: 795 Number of HSP's better than 10.0 without gapping: 799 Number of HSP's successfully gapped in prelim test: 4 Number of HSP's that attempted gapping in prelim test: 168534 Number of HSP's gapped (non-prelim): 4033 length of query: 638 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 615 effective length of database: 17,143,297,704 effective search space: 10543128087960 effective search space used: 10543128087960 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
