>gb|AC124918.5| Rattus norvegicus 4 BAC CH230-4H1 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 228052

 Score = 42.1 bits (21), Expect = 0.35
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 55     tgaacagcataccatgcaaacaagt 79
              |||||| ||||||||||||||||||
Sbjct: 194726 tgaacaacataccatgcaaacaagt 194750

>gb|AC108835.8| Mus musculus chromosome 6, clone RP23-274E24, complete sequence
          Length = 173365

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 98    gcctggtctctatttccagc 117
             ||||||||||||||||||||
Sbjct: 36916 gcctggtctctatttccagc 36935

>gb|AY616759.1| Chlamydomonas reinhardtii dynein 1b light intermediate chain (D1bLIC)
            gene, complete cds
          Length = 5692

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 54   ctgaacagcataccatgca 72
            |||||||||||||||||||
Sbjct: 1714 ctgaacagcataccatgca 1696

>gb|AF547995.1| Chlamydomonas reinhardtii dynein light intermediate chain gene,
            complete cds
          Length = 5513

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 54   ctgaacagcataccatgca 72
            |||||||||||||||||||
Sbjct: 1936 ctgaacagcataccatgca 1918

>gb|AC025187.6| Homo sapiens chromosome 5 clone CTD-2383I20, complete sequence
          Length = 137219

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    tgaacagcataccatgcaa 73
             |||||||||||||||||||
Sbjct: 97360 tgaacagcataccatgcaa 97342

>gb|AC034218.3| Homo sapiens chromosome 5 clone CTD-2008N3, complete sequence
          Length = 134907

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 55     tgaacagcataccatgcaa 73
              |||||||||||||||||||
Sbjct: 111622 tgaacagcataccatgcaa 111640


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 658,693
Number of Sequences: 3902068
Number of extensions: 658693
Number of successful extensions: 37410
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37404
Number of HSP's gapped (non-prelim): 6
length of query: 120
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 99
effective length of database: 17,151,101,840
effective search space: 1697959082160
effective search space used: 1697959082160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)