| Clone Name | rbags32g16 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 428 bits (216), Expect = e-116 Identities = 368/419 (87%), Gaps = 6/419 (1%) Strand = Plus / Plus Query: 284 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 343 |||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| || Sbjct: 1929001 atcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgc 1929060 Query: 344 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 403 || ||||||| | ||||||||||| || ||||||||||||||||||||||||||| ||| Sbjct: 1929061 ggttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgc 1929120 Query: 404 ccctctgggagccggcg------atgtagtgggaggccggcaggtgggacaggtcggcga 457 ||||| | || | ||| |||||||||||| ||| ||||||||||||||||| | Sbjct: 1929121 ccctcggcgaccgcgcgttgacgatgtagtgggagttcgggaggtgggacaggtcggcca 1929180 Query: 458 gcgtgaactcgtcgccggcgaggtactggttcttggccaggatctcgtcgtagacgccga 517 | ||||||||||||||||||||||||| |||||| ||||||||||||||||| ||| | Sbjct: 1929181 gggtgaactcgtcgccggcgaggtacttgttcttcgccaggatctcgtcgtacacgttca 1929240 Query: 518 gcatctgctgcagcttcctctcgttctccgcgatgcgggcctcgtcggggatcatgttga 577 |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 1929241 gcatctgctgcagcttccgctcgttctccgcgatgcgggcctcgtcggccggtatgttga 1929300 Query: 578 gctgcggcgcgaaggccaggtggaagaccagctccgagctcggggcgtcgaagctctggg 637 ||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||| | Sbjct: 1929301 gctgcggcgcgaacgccaggtggaacaccagctccgagctcggcgcgtcgaagctctgcg 1929360 Query: 638 actccgcctggagccactgctctatggacgcgcgctccagcgaccccgtgccgtagatc 696 ||||||||| ||||||||||| || ||||| ||||||||||||||||| ||||||||| Sbjct: 1929361 cctccgcctgcagccactgctcgatcgacgcccgctccagcgaccccgtcccgtagatc 1929419 Score = 79.8 bits (40), Expect = 1e-11 Identities = 61/68 (89%) Strand = Plus / Plus Query: 623 cgtcgaagctctgggactccgcctggagccactgctctatggacgcgcgctccagcgacc 682 ||||||||||||| | ||||| ||| ||||||||||| ||||||||||||||||||| | Sbjct: 1919560 cgtcgaagctctgcgcctccgtctgcagccactgctcgatggacgcgcgctccagcgcgc 1919619 Query: 683 ccgtgccg 690 |||||||| Sbjct: 1919620 ccgtgccg 1919627 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 439 aggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtac 483 ||||||||||||||||||| ||||||| ||||||||| |||||| Sbjct: 1919214 aggtgggacaggtcggcgatggtgaacttgtcgccggccaggtac 1919258 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 312 ctgcatcttgaccacctgcttcca 335 |||||||||||||||||||||||| Sbjct: 1933021 ctgcatcttgaccacctgcttcca 1933044 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 210 aagattcatgcatgcatgcatgcatg 235 ||||| |||||||||||||||||||| Sbjct: 15347883 aagatgcatgcatgcatgcatgcatg 15347858 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 24914564 catgcatgcatgcatgcatgc 24914584 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 15347858 catgcatgcatgcatgcatgc 15347878 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 3538608 catgcatgcatgcatgcatgc 3538628 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068032 catgcatgcatgcatgcatgc 1068052 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068051 catgcatgcatgcatgcatgc 1068031 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068028 catgcatgcatgcatgcatgc 1068048 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068047 catgcatgcatgcatgcatgc 1068027 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068024 catgcatgcatgcatgcatgc 1068044 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068043 catgcatgcatgcatgcatgc 1068023 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 30839955 atgcatgcatgcatgcatgc 30839936 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 24914583 catgcatgcatgcatgcatg 24914564 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 23282505 catgcatgcatgcatgcatg 23282486 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 23282486 catgcatgcatgcatgcatg 23282505 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 15347880 atgcatgcatgcatgcatgc 15347861 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 8062239 atgcatgcatgcatgcatgc 8062220 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 3538627 catgcatgcatgcatgcatg 3538608 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 catgcatgcatgcatgctgc 239 |||||||||||||||||||| Sbjct: 200598 catgcatgcatgcatgctgc 200579
>gb|AC099399.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1006F06, complete sequence Length = 122218 Score = 428 bits (216), Expect = e-116 Identities = 368/419 (87%), Gaps = 6/419 (1%) Strand = Plus / Minus Query: 284 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 343 |||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| || Sbjct: 46410 atcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgc 46351 Query: 344 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 403 || ||||||| | ||||||||||| || ||||||||||||||||||||||||||| ||| Sbjct: 46350 ggttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgc 46291 Query: 404 ccctctgggagccggcg------atgtagtgggaggccggcaggtgggacaggtcggcga 457 ||||| | || | ||| |||||||||||| ||| ||||||||||||||||| | Sbjct: 46290 ccctcggcgaccgcgcgttgacgatgtagtgggagttcgggaggtgggacaggtcggcca 46231 Query: 458 gcgtgaactcgtcgccggcgaggtactggttcttggccaggatctcgtcgtagacgccga 517 | ||||||||||||||||||||||||| |||||| ||||||||||||||||| ||| | Sbjct: 46230 gggtgaactcgtcgccggcgaggtacttgttcttcgccaggatctcgtcgtacacgttca 46171 Query: 518 gcatctgctgcagcttcctctcgttctccgcgatgcgggcctcgtcggggatcatgttga 577 |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 46170 gcatctgctgcagcttccgctcgttctccgcgatgcgggcctcgtcggccggtatgttga 46111 Query: 578 gctgcggcgcgaaggccaggtggaagaccagctccgagctcggggcgtcgaagctctggg 637 ||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||| | Sbjct: 46110 gctgcggcgcgaacgccaggtggaacaccagctccgagctcggcgcgtcgaagctctgcg 46051 Query: 638 actccgcctggagccactgctctatggacgcgcgctccagcgaccccgtgccgtagatc 696 ||||||||| ||||||||||| || ||||| ||||||||||||||||| ||||||||| Sbjct: 46050 cctccgcctgcagccactgctcgatcgacgcccgctccagcgaccccgtcccgtagatc 45992 Score = 79.8 bits (40), Expect = 1e-11 Identities = 61/68 (89%) Strand = Plus / Minus Query: 623 cgtcgaagctctgggactccgcctggagccactgctctatggacgcgcgctccagcgacc 682 ||||||||||||| | ||||| ||| ||||||||||| ||||||||||||||||||| | Sbjct: 55851 cgtcgaagctctgcgcctccgtctgcagccactgctcgatggacgcgcgctccagcgcgc 55792 Query: 683 ccgtgccg 690 |||||||| Sbjct: 55791 ccgtgccg 55784 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 439 aggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtac 483 ||||||||||||||||||| ||||||| ||||||||| |||||| Sbjct: 56197 aggtgggacaggtcggcgatggtgaacttgtcgccggccaggtac 56153 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 312 ctgcatcttgaccacctgcttcca 335 |||||||||||||||||||||||| Sbjct: 42390 ctgcatcttgaccacctgcttcca 42367
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 428 bits (216), Expect = e-116 Identities = 368/419 (87%), Gaps = 6/419 (1%) Strand = Plus / Plus Query: 284 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 343 |||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| || Sbjct: 1928999 atcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgc 1929058 Query: 344 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 403 || ||||||| | ||||||||||| || ||||||||||||||||||||||||||| ||| Sbjct: 1929059 ggttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgc 1929118 Query: 404 ccctctgggagccggcg------atgtagtgggaggccggcaggtgggacaggtcggcga 457 ||||| | || | ||| |||||||||||| ||| ||||||||||||||||| | Sbjct: 1929119 ccctcggcgaccgcgcgttgacgatgtagtgggagttcgggaggtgggacaggtcggcca 1929178 Query: 458 gcgtgaactcgtcgccggcgaggtactggttcttggccaggatctcgtcgtagacgccga 517 | ||||||||||||||||||||||||| |||||| ||||||||||||||||| ||| | Sbjct: 1929179 gggtgaactcgtcgccggcgaggtacttgttcttcgccaggatctcgtcgtacacgttca 1929238 Query: 518 gcatctgctgcagcttcctctcgttctccgcgatgcgggcctcgtcggggatcatgttga 577 |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 1929239 gcatctgctgcagcttccgctcgttctccgcgatgcgggcctcgtcggccggtatgttga 1929298 Query: 578 gctgcggcgcgaaggccaggtggaagaccagctccgagctcggggcgtcgaagctctggg 637 ||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||| | Sbjct: 1929299 gctgcggcgcgaacgccaggtggaacaccagctccgagctcggcgcgtcgaagctctgcg 1929358 Query: 638 actccgcctggagccactgctctatggacgcgcgctccagcgaccccgtgccgtagatc 696 ||||||||| ||||||||||| || ||||| ||||||||||||||||| ||||||||| Sbjct: 1929359 cctccgcctgcagccactgctcgatcgacgcccgctccagcgaccccgtcccgtagatc 1929417 Score = 79.8 bits (40), Expect = 1e-11 Identities = 61/68 (89%) Strand = Plus / Plus Query: 623 cgtcgaagctctgggactccgcctggagccactgctctatggacgcgcgctccagcgacc 682 ||||||||||||| | ||||| ||| ||||||||||| ||||||||||||||||||| | Sbjct: 1919558 cgtcgaagctctgcgcctccgtctgcagccactgctcgatggacgcgcgctccagcgcgc 1919617 Query: 683 ccgtgccg 690 |||||||| Sbjct: 1919618 ccgtgccg 1919625 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 439 aggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtac 483 ||||||||||||||||||| ||||||| ||||||||| |||||| Sbjct: 1919212 aggtgggacaggtcggcgatggtgaacttgtcgccggccaggtac 1919256 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 312 ctgcatcttgaccacctgcttcca 335 |||||||||||||||||||||||| Sbjct: 1933019 ctgcatcttgaccacctgcttcca 1933042 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 210 aagattcatgcatgcatgcatgcatg 235 ||||| |||||||||||||||||||| Sbjct: 15342417 aagatgcatgcatgcatgcatgcatg 15342392 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 25005839 catgcatgcatgcatgcatgc 25005859 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 15342392 catgcatgcatgcatgcatgc 15342412 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 3538719 catgcatgcatgcatgcatgc 3538739 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068030 catgcatgcatgcatgcatgc 1068050 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068049 catgcatgcatgcatgcatgc 1068029 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068026 catgcatgcatgcatgcatgc 1068046 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068045 catgcatgcatgcatgcatgc 1068025 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068022 catgcatgcatgcatgcatgc 1068042 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1068041 catgcatgcatgcatgcatgc 1068021 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 30930478 atgcatgcatgcatgcatgc 30930459 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 25005858 catgcatgcatgcatgcatg 25005839 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 23275533 catgcatgcatgcatgcatg 23275514 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 23275514 catgcatgcatgcatgcatg 23275533 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 15342414 atgcatgcatgcatgcatgc 15342395 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 8060074 atgcatgcatgcatgcatgc 8060055 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 3538738 catgcatgcatgcatgcatg 3538719 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 catgcatgcatgcatgctgc 239 |||||||||||||||||||| Sbjct: 200598 catgcatgcatgcatgctgc 200579
>dbj|AK059955.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-211-D02, full insert sequence Length = 951 Score = 428 bits (216), Expect = e-116 Identities = 368/419 (87%), Gaps = 6/419 (1%) Strand = Plus / Minus Query: 284 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 343 |||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| || Sbjct: 787 atcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgc 728 Query: 344 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 403 || ||||||| | ||||||||||| || ||||||||||||||||||||||||||| ||| Sbjct: 727 ggttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgc 668 Query: 404 ccctctgggagccggcg------atgtagtgggaggccggcaggtgggacaggtcggcga 457 ||||| | || | ||| |||||||||||| ||| ||||||||||||||||| | Sbjct: 667 ccctcggcgaccgcgcgttgacgatgtagtgggagttcgggaggtgggacaggtcggcca 608 Query: 458 gcgtgaactcgtcgccggcgaggtactggttcttggccaggatctcgtcgtagacgccga 517 | ||||||||||||||||||||||||| |||||| ||||||||||||||||| ||| | Sbjct: 607 gggtgaactcgtcgccggcgaggtacttgttcttcgccaggatctcgtcgtacacgttca 548 Query: 518 gcatctgctgcagcttcctctcgttctccgcgatgcgggcctcgtcggggatcatgttga 577 |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 547 gcatctgctgcagcttccgctcgttctccgcgatgcgggcctcgtcggccggtatgttga 488 Query: 578 gctgcggcgcgaaggccaggtggaagaccagctccgagctcggggcgtcgaagctctggg 637 ||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||| | Sbjct: 487 gctgcggcgcgaacgccaggtggaacaccagctccgagctcggcgcgtcgaagctctgcg 428 Query: 638 actccgcctggagccactgctctatggacgcgcgctccagcgaccccgtgccgtagatc 696 ||||||||| ||||||||||| || ||||| ||||||||||||||||| ||||||||| Sbjct: 427 cctccgcctgcagccactgctcgatcgacgcccgctccagcgaccccgtcccgtagatc 369
>ref|XM_470191.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 678 Score = 426 bits (215), Expect = e-116 Identities = 367/418 (87%), Gaps = 6/418 (1%) Strand = Plus / Minus Query: 285 tcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggcg 344 ||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| ||| Sbjct: 678 tcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgcg 619 Query: 345 gctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgcc 404 | ||||||| | ||||||||||| || ||||||||||||||||||||||||||| |||| Sbjct: 618 gttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgcc 559 Query: 405 cctctgggagccggcg------atgtagtgggaggccggcaggtgggacaggtcggcgag 458 |||| | || | ||| |||||||||||| ||| ||||||||||||||||| || Sbjct: 558 cctcggcgaccgcgcgttgacgatgtagtgggagttcgggaggtgggacaggtcggccag 499 Query: 459 cgtgaactcgtcgccggcgaggtactggttcttggccaggatctcgtcgtagacgccgag 518 ||||||||||||||||||||||||| |||||| ||||||||||||||||| ||| || Sbjct: 498 ggtgaactcgtcgccggcgaggtacttgttcttcgccaggatctcgtcgtacacgttcag 439 Query: 519 catctgctgcagcttcctctcgttctccgcgatgcgggcctcgtcggggatcatgttgag 578 ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 438 catctgctgcagcttccgctcgttctccgcgatgcgggcctcgtcggccggtatgttgag 379 Query: 579 ctgcggcgcgaaggccaggtggaagaccagctccgagctcggggcgtcgaagctctggga 638 |||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||| | Sbjct: 378 ctgcggcgcgaacgccaggtggaacaccagctccgagctcggcgcgtcgaagctctgcgc 319 Query: 639 ctccgcctggagccactgctctatggacgcgcgctccagcgaccccgtgccgtagatc 696 ||||||||| ||||||||||| || ||||| ||||||||||||||||| ||||||||| Sbjct: 318 ctccgcctgcagccactgctcgatcgacgcccgctccagcgaccccgtcccgtagatc 261
>gb|AY533123.1| Oryza sativa (japonica cultivar-group) glutathione S-transferase GSTF15 mRNA, complete cds Length = 678 Score = 426 bits (215), Expect = e-116 Identities = 367/418 (87%), Gaps = 6/418 (1%) Strand = Plus / Minus Query: 285 tcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggcg 344 ||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| ||| Sbjct: 678 tcactcgaacgcgccagggtgctcgctctgcatcttgaccacctgcttccaggaggcgcg 619 Query: 345 gctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgcc 404 | ||||||| | ||||||||||| || ||||||||||||||||||||||||||| |||| Sbjct: 618 gttggagatctcctcgtaccacctcgcgacgtgcttcttggaggtgaagagcttcttgcc 559 Query: 405 cctctgggagccggcg------atgtagtgggaggccggcaggtgggacaggtcggcgag 458 |||| | || | ||| |||||||||||| ||| ||||||||||||||||| || Sbjct: 558 cctcggcgaccgcgcgttgacgatgtagtgggagttcgggaggtgggacaggtcggccag 499 Query: 459 cgtgaactcgtcgccggcgaggtactggttcttggccaggatctcgtcgtagacgccgag 518 ||||||||||||||||||||||||| |||||| ||||||||||||||||| ||| || Sbjct: 498 ggtgaactcgtcgccggcgaggtacttgttcttcgccaggatctcgtcgtacacgttcag 439 Query: 519 catctgctgcagcttcctctcgttctccgcgatgcgggcctcgtcggggatcatgttgag 578 ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 438 catctgctgcagcttccgctcgttctccgcgatgcgggcctcgtcggccggtatgttgag 379 Query: 579 ctgcggcgcgaaggccaggtggaagaccagctccgagctcggggcgtcgaagctctggga 638 |||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||| | Sbjct: 378 ctgcggcgcgaacgccaggtggaacaccagctccgagctcggcgcgtcgaagctctgcgc 319 Query: 639 ctccgcctggagccactgctctatggacgcgcgctccagcgaccccgtgccgtagatc 696 ||||||||| ||||||||||| || ||||| ||||||||||||||||| ||||||||| Sbjct: 318 ctccgcctgcagccactgctcgatcgacgcccgctccagcgaccccgtcccgtagatc 261
>gb|AF244677.1|AF244677 Zea mays glutathione S-transferase GST 12 mRNA, complete cds Length = 1198 Score = 341 bits (172), Expect = 2e-90 Identities = 358/416 (86%), Gaps = 8/416 (1%) Strand = Plus / Minus Query: 284 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 343 |||||||||| | |||||||||||| ||||||||| | |||||| |||||||| || Sbjct: 782 atcactcgaacgcgccggggtgctccctctgcatcttcatgacctgcctccaggagtcgc 723 Query: 344 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 403 || ||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||| Sbjct: 722 gggtggagatcttgtcgtaccacctggccacgtgcttcctggcggtgaagagcttcctgc 663 Query: 404 ccctctgggagccgg---cgatgtagtgggaggccggcaggtgggacaggtcggcgagcg 460 |||| | |||| | |||||||||||||| ||||||||||| |||||||| || | Sbjct: 662 ccctgtcggaggagttgacgatgtagtgggagtttggcaggtgggagaggtcggccagtg 603 Query: 461 tgaactcgtcgccggcgaggtactggttcttggccaggatctcgtcgtagacgccgagca 520 |||| ||||||||||||||||||| |||||||| ||||| |||||||||||||| |||| Sbjct: 602 tgaagtcgtcgccggcgaggtactcgttcttggagaggatgtcgtcgtagacgcccagca 543 Query: 521 t-ctgctgcagcttcctctcgttctccgcgatgcgggcctcgtcggggatcatgt---tg 576 | ||| ||||||||| ||||||||||||||| ||||||||||||||| || || || Sbjct: 542 tgctg-tgcagcttcttctcgttctccgcgacgcgggcctcgtcgggccgcacgtccttg 484 Query: 577 agctgcggcgcgaaggccaggtggaagaccagctccgagctcggggcgtcgaagctctgg 636 || ||||||||||| ||||| ||||| |||||||||||||||| |||||||||||||| Sbjct: 483 aggtgcggcgcgaacgccagctggaacgccagctccgagctcggcgcgtcgaagctctgc 424 Query: 637 gactccgcctggagccactgctctatggacgcgcgctccagcgaccccgtgccgta 692 | ||||||||| |||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 423 gcctccgcctgcagccactgctctatggacgcccgctccagcgaccccgtgccgta 368
>gb|AY103863.1| Zea mays PCO132785 mRNA sequence Length = 959 Score = 341 bits (172), Expect = 2e-90 Identities = 358/416 (86%), Gaps = 8/416 (1%) Strand = Plus / Minus Query: 284 atcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggaggggc 343 |||||||||| | |||||||||||| ||||||||| | |||||| |||||||| || Sbjct: 805 atcactcgaacgcgccggggtgctccctctgcatcttcatgacctgcctccaggagtcgc 746 Query: 344 ggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgc 403 || ||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||| Sbjct: 745 gggtggagatcttgtcgtaccacctggccacgtgcttcctggcggtgaagagcttcctgc 686 Query: 404 ccctctgggagccgg---cgatgtagtgggaggccggcaggtgggacaggtcggcgagcg 460 |||| | |||| | |||||||||||||| ||||||||||| |||||||| || | Sbjct: 685 ccctgtcggaggagttgacgatgtagtgggagtttggcaggtgggagaggtcggccagtg 626 Query: 461 tgaactcgtcgccggcgaggtactggttcttggccaggatctcgtcgtagacgccgagca 520 |||| ||||||||||||||||||| |||||||| ||||| |||||||||||||| |||| Sbjct: 625 tgaagtcgtcgccggcgaggtactcgttcttggagaggatgtcgtcgtagacgcccagca 566 Query: 521 t-ctgctgcagcttcctctcgttctccgcgatgcgggcctcgtcggggatcatgt---tg 576 | ||| ||||||||| ||||||||||||||| ||||||||||||||| || || || Sbjct: 565 tgctg-tgcagcttcttctcgttctccgcgacgcgggcctcgtcgggccgcacgtccttg 507 Query: 577 agctgcggcgcgaaggccaggtggaagaccagctccgagctcggggcgtcgaagctctgg 636 || ||||||||||| ||||| ||||| |||||||||||||||| |||||||||||||| Sbjct: 506 aggtgcggcgcgaacgccagctggaacgccagctccgagctcggcgcgtcgaagctctgc 447 Query: 637 gactccgcctggagccactgctctatggacgcgcgctccagcgaccccgtgccgta 692 | ||||||||| |||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 446 gcctccgcctgcagccactgctctatggacgcccgctccagcgaccccgtgccgta 391
>gb|AF244678.1|AF244678 Zea mays glutathione S-transferase GST 13 mRNA, complete cds Length = 1134 Score = 329 bits (166), Expect = 7e-87 Identities = 356/418 (85%), Gaps = 6/418 (1%) Strand = Plus / Minus Query: 281 ccgatcactcgaaggtgccggggtgctcgtgctgcatcttgaccacctgcttccaggagg 340 ||||||||||||| | |||||||||||| ||||||||||| |||||| |||| ||| Sbjct: 742 ccgatcactcgaacgcgccggggtgctccctctgcatcttgatgacctgcctccacgagt 683 Query: 341 ggcggctggagatggcgtcgtaccacctggccacgtgcttcttggaggtgaagagcttcc 400 |||| ||||||| ||||||||||||||| ||||||||| ||| |||||||||||| | Sbjct: 682 cgcgggtggagatcttgtcgtaccacctggcgacgtgcttcctggcggtgaagagctttc 623 Query: 401 tgcccctctgggagccgg---cgatgtagtgggaggccggcaggtgggacaggtcggcga 457 ||||||| | |||| | |||||||||||||| ||||||||||| |||||||| | Sbjct: 622 tgcccctgtcggaggagttgacgatgtagtgggagttgggcaggtgggagaggtcggcca 563 Query: 458 gcgtgaactcgtcgccggcgaggtactggttcttggccaggatctcgtcgtagacgccga 517 | ||||| ||||||||||||||||||| |||||||| ||||| |||||||||||||| | Sbjct: 562 gggtgaagtcgtcgccggcgaggtactcgttcttggagaggatgtcgtcgtagacgccca 503 Query: 518 gcatctgctgcagcttcctctcgttctccgcgatgcgggcctcgtcggggatcatgtt-- 575 |||| |||||||||||||||||||||||| ||||||||||||||| || ||| Sbjct: 502 gcatgccgtgcagcttcctctcgttctccgcggcgcgggcctcgtcgggccgcacgttct 443 Query: 576 -gagctgcggcgcgaaggccaggtggaagaccagctccgagctcggggcgtcgaagctct 634 ||| ||||||||||| ||||| ||||| |||||||||||||||| ||||||||||||| Sbjct: 442 tgaggtgcggcgcgaacgccagctggaacgccagctccgagctcggcgcgtcgaagctct 383 Query: 635 gggactccgcctggagccactgctctatggacgcgcgctccagcgaccccgtgccgta 692 ||| ||||||||| |||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 382 gggcctccgcctgcagccactgctctatggacgcccgctccagcgaccccgtcccgta 325 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 761 atgcatgcatgcatgcatgc 780
>gb|AY111699.1| Zea mays CL1117_-2 mRNA sequence Length = 633 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 358 tcgtaccacctggccacgtgcttcttggaggtgaagagcttcctgcccctctgggagccg 417 ||||||||| ||||||||| ||||||| |||||||||||||| || |||| || | Sbjct: 364 tcgtaccacttggccacgttcttcttgttagtgaagagcttccttcctctctcggtgttc 305 Query: 418 gcgatgtagtgggaggccggcaggtgggacaggtcggcgagcgtgaactcgtcgccggcg 477 |||||||||| ||| ||| |||||||| |||||||| || |||||||||||||| || Sbjct: 304 acgatgtagtgcgagttcgggaggtgggagaggtcggccagggtgaactcgtcgccagcc 245 Query: 478 aggtactggttcttggccaggatctcgtcgtagac 512 ||||||| |||| | | || |||||||||||||| Sbjct: 244 aggtactcgttcctcgagagtatctcgtcgtagac 210
>ref|XM_470189.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 960 Score = 79.8 bits (40), Expect = 1e-11 Identities = 61/68 (89%) Strand = Plus / Minus Query: 623 cgtcgaagctctgggactccgcctggagccactgctctatggacgcgcgctccagcgacc 682 ||||||||||||| | ||||| ||| ||||||||||| ||||||||||||||||||| | Sbjct: 337 cgtcgaagctctgcgcctccgtctgcagccactgctcgatggacgcgcgctccagcgcgc 278 Query: 683 ccgtgccg 690 |||||||| Sbjct: 277 ccgtgccg 270 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 439 aggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtac 483 ||||||||||||||||||| ||||||| ||||||||| |||||| Sbjct: 683 aggtgggacaggtcggcgatggtgaacttgtcgccggccaggtac 639
>gb|AY533122.1| Oryza sativa (japonica cultivar-group) glutathione S-transferase GSTF14 mRNA, partial cds Length = 825 Score = 79.8 bits (40), Expect = 1e-11 Identities = 61/68 (89%) Strand = Plus / Minus Query: 623 cgtcgaagctctgggactccgcctggagccactgctctatggacgcgcgctccagcgacc 682 ||||||||||||| | ||||| ||| ||||||||||| ||||||||||||||||||| | Sbjct: 337 cgtcgaagctctgcgcctccgtctgcagccactgctcgatggacgcgcgctccagcgcgc 278 Query: 683 ccgtgccg 690 |||||||| Sbjct: 277 ccgtgccg 270 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 439 aggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtac 483 ||||||||||||||||||| ||||||| ||||||||| |||||| Sbjct: 683 aggtgggacaggtcggcgatggtgaacttgtcgccggccaggtac 639
>dbj|AK102889.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033112M16, full insert sequence Length = 1300 Score = 79.8 bits (40), Expect = 1e-11 Identities = 61/68 (89%) Strand = Plus / Minus Query: 623 cgtcgaagctctgggactccgcctggagccactgctctatggacgcgcgctccagcgacc 682 ||||||||||||| | ||||| ||| ||||||||||| ||||||||||||||||||| | Sbjct: 429 cgtcgaagctctgcgcctccgtctgcagccactgctcgatggacgcgcgctccagcgcgc 370 Query: 683 ccgtgccg 690 |||||||| Sbjct: 369 ccgtgccg 362 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 439 aggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtac 483 ||||||||||||||||||| ||||||| ||||||||| |||||| Sbjct: 775 aggtgggacaggtcggcgatggtgaacttgtcgccggccaggtac 731
>gb|AF244676.1|AF244676 Zea mays glutathione S-transferase GST 11 mRNA, complete cds Length = 1279 Score = 71.9 bits (36), Expect = 3e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 622 gcgtcgaagctctgggactccgcctggagccactgctctatggacgcgcgctccagcgac 681 |||||||||||||| | ||||| ||| ||||||||||| |||||||| |||||||||| Sbjct: 370 gcgtcgaagctctgcgcctccgtctgcagccactgctcgatggacgcccgctccagcgcg 311 Query: 682 cccgtgcc 689 |||||||| Sbjct: 310 cccgtgcc 303 Score = 42.1 bits (21), Expect = 2.4 Identities = 36/41 (87%) Strand = Plus / Minus Query: 436 ggcaggtgggacaggtcggcgagcgtgaactcgtcgccggc 476 |||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 700 ggcaggtgcgacaggtcggcgatggtgaagttgtcgccggc 660
>gb|AY103672.1| Zea mays PCO064413 mRNA sequence Length = 1195 Score = 71.9 bits (36), Expect = 3e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 622 gcgtcgaagctctgggactccgcctggagccactgctctatggacgcgcgctccagcgac 681 |||||||||||||| | ||||| ||| ||||||||||| |||||||| |||||||||| Sbjct: 375 gcgtcgaagctctgcgcctccgtctgcagccactgctcgatggacgcccgctccagcgcg 316 Query: 682 cccgtgcc 689 |||||||| Sbjct: 315 cccgtgcc 308 Score = 42.1 bits (21), Expect = 2.4 Identities = 36/41 (87%) Strand = Plus / Minus Query: 436 ggcaggtgggacaggtcggcgagcgtgaactcgtcgccggc 476 |||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 705 ggcaggtgcgacaggtcggcgatggtgaagttgtcgccggc 665
>gb|BT009137.1| Triticum aestivum clone wl1n.pk0040.b1:fis, full insert mRNA sequence Length = 920 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 450 gtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||||||||||||||||||| ||||||||||||| Sbjct: 559 gtcggcgagcgtgaactcgtccccggcgaggtact 525
>emb|X04455.1|ZMGGST3B Maize mRNA for glutathione-S-transferase GSTIII (clone GSTIIIB) Length = 859 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 450 gtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||||||||||||||||||| ||||||||||||| Sbjct: 524 gtcggcgagcgtgaactcgtccccggcgaggtact 490
>emb|X06755.1|ZMGST3 Maize mRNA for GSH gluthathione S-transferase III (GST;EC 2.5.1.18) Length = 913 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 450 gtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||||||||||||||||||| ||||||||||||| Sbjct: 572 gtcggcgagcgtgaactcgtccccggcgaggtact 538
>emb|X04375.1|ZMGST3A Maize mRNA for glutathione-S-transferase GSTIII (clone GSTIIIA) Length = 840 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 450 gtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||||||||||||||||||| ||||||||||||| Sbjct: 505 gtcggcgagcgtgaactcgtccccggcgaggtact 471
>emb|AJ010296.1|ZMA010296 Zea mays mRNA for glutathione transferase III(b) Length = 944 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 450 gtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||||||||||||||||||| ||||||||||||| Sbjct: 563 gtcggcgagcgtgaactcgtccccggcgaggtact 529
>gb|AF244679.1|AF244679 Zea mays glutathione S-transferase GST 14 mRNA, complete cds Length = 1007 Score = 61.9 bits (31), Expect = 3e-06 Identities = 31/31 (100%) Strand = Plus / Minus Query: 436 ggcaggtgggacaggtcggcgagcgtgaact 466 ||||||||||||||||||||||||||||||| Sbjct: 665 ggcaggtgggacaggtcggcgagcgtgaact 635 Score = 58.0 bits (29), Expect = 4e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 623 cgtcgaagctctgggactccgcctggagccactgctctatggacgcgcgctccagcg 679 ||||||||||||| | ||||| ||| ||||||||||| ||||| || |||||||||| Sbjct: 406 cgtcgaagctctgcgcctccgtctgcagccactgctcgatggaggcccgctccagcg 350
>emb|AJ010295.1|ZMA010295 Zea mays mRNA for glutathione transferase III(a) Length = 906 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 450 gtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||||||||||||||||||| ||||||||||||| Sbjct: 574 gtcggcgagcgtgaactcgtccccggcgaggtact 540
>gb|AY105647.1| Zea mays PCO132886 mRNA sequence Length = 1003 Score = 61.9 bits (31), Expect = 3e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 450 gtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||||||||||||||||||| ||||||||||||| Sbjct: 642 gtcggcgagcgtgaactcgtccccggcgaggtact 608
>ref|NM_197602.1| Oryza sativa (japonica cultivar-group) putative glutathione S-transferase (OSJNBb0015I11.25), mRNA Length = 1206 Score = 60.0 bits (30), Expect = 1e-05 Identities = 42/46 (91%) Strand = Plus / Minus Query: 439 aggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||| || ||||||||||| ||||||| ||||||||||||||||| Sbjct: 767 aggtgcgaaaggtcggcgagggtgaacttgtcgccggcgaggtact 722 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 623 cgtcgaagctctgggactccgcctggagccactgctc 659 ||||||||||||| | ||||| ||| ||||||||||| Sbjct: 421 cgtcgaagctctgcgcctccgtctgcagccactgctc 385
>gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 genomic sequence, complete sequence Length = 138824 Score = 60.0 bits (30), Expect = 1e-05 Identities = 42/46 (91%) Strand = Plus / Plus Query: 439 aggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||| || ||||||||||| ||||||| ||||||||||||||||| Sbjct: 114314 aggtgcgaaaggtcggcgagggtgaacttgtcgccggcgaggtact 114359 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Plus Query: 623 cgtcgaagctctgggactccgcctggagccactgctc 659 ||||||||||||| | ||||| ||| ||||||||||| Sbjct: 114660 cgtcgaagctctgcgcctccgtctgcagccactgctc 114696
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 60.0 bits (30), Expect = 1e-05 Identities = 42/46 (91%) Strand = Plus / Plus Query: 439 aggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||| || ||||||||||| ||||||| ||||||||||||||||| Sbjct: 20712862 aggtgcgaaaggtcggcgagggtgaacttgtcgccggcgaggtact 20712907 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 22031378 catgcatgcatgcatgcatgc 22031358 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Plus Query: 623 cgtcgaagctctgggactccgcctggagccactgctc 659 ||||||||||||| | ||||| ||| ||||||||||| Sbjct: 20713208 cgtcgaagctctgcgcctccgtctgcagccactgctc 20713244 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 22031359 catgcatgcatgcatgcatg 22031378
>dbj|AB103350.1| Oryza sativa (japonica cultivar-group) GST mRNA for glutathione S-transferase, complete cd Length = 1238 Score = 60.0 bits (30), Expect = 1e-05 Identities = 42/46 (91%) Strand = Plus / Minus Query: 439 aggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||| || ||||||||||| ||||||| ||||||||||||||||| Sbjct: 767 aggtgcgaaaggtcggcgagggtgaacttgtcgccggcgaggtact 722 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 623 cgtcgaagctctgggactccgcctggagccactgctc 659 ||||||||||||| | ||||| ||| ||||||||||| Sbjct: 421 cgtcgaagctctgcgcctccgtctgcagccactgctc 385
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 60.0 bits (30), Expect = 1e-05 Identities = 42/46 (91%) Strand = Plus / Plus Query: 439 aggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtact 484 ||||| || ||||||||||| ||||||| ||||||||||||||||| Sbjct: 20724134 aggtgcgaaaggtcggcgagggtgaacttgtcgccggcgaggtact 20724179 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 22043041 catgcatgcatgcatgcatgc 22043021 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Plus Query: 623 cgtcgaagctctgggactccgcctggagccactgctc 659 ||||||||||||| | ||||| ||| ||||||||||| Sbjct: 20724480 cgtcgaagctctgcgcctccgtctgcagccactgctc 20724516 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 22043022 catgcatgcatgcatgcatg 22043041
>gb|AF244674.1|AF244674 Zea mays glutathione S-transferase GST 9 mRNA, complete cds Length = 999 Score = 56.0 bits (28), Expect = 2e-04 Identities = 94/116 (81%) Strand = Plus / Minus Query: 378 cttcttggaggtgaagagcttcctgcccctctgggagccggcgatgtagtgggaggccgg 437 ||||||| ||||||||||||||| || |||| || | |||||||||| ||| ||| Sbjct: 657 cttcttgttggtgaagagcttccttcctctctcggtgtttacgatgtagtgcgagttcgg 598 Query: 438 caggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtactggttcttgg 493 ||||| ||||||||||| || |||||||| || || || ||||||| |||||||| Sbjct: 597 aaggtgagacaggtcggccagggtgaactcatcaccagccaggtactcgttcttgg 542
>gb|AY111697.1| Zea mays CL1117_-1 mRNA sequence Length = 977 Score = 56.0 bits (28), Expect = 2e-04 Identities = 94/116 (81%) Strand = Plus / Minus Query: 378 cttcttggaggtgaagagcttcctgcccctctgggagccggcgatgtagtgggaggccgg 437 ||||||| ||||||||||||||| || |||| || | |||||||||| ||| ||| Sbjct: 657 cttcttgttggtgaagagcttccttcctctctcggtgtttacgatgtagtgcgagttcgg 598 Query: 438 caggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtactggttcttgg 493 ||||| ||||||||||| || |||||||| || || || ||||||| |||||||| Sbjct: 597 aaggtgagacaggtcggccagggtgaactcatcaccagccaggtactcgttcttgg 542
>emb|AL732484.13| Mouse DNA sequence from clone RP23-37B7 on chromosome 2, complete sequence Length = 201265 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgctg 238 |||||||||||||||||||||||||| Sbjct: 168004 attcatgcatgcatgcatgcatgctg 168029 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 168026 catgcatgcatgcatgcatg 168007 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 168000 attcattcatgcatgcatgcatgc 168023
>gb|AC158236.2| Mus musculus BAC clone RP23-132B15 from chromosome 8, complete sequence Length = 209957 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgct 237 ||||||||||||||||||||||||| Sbjct: 78696 attcatgcatgcatgcatgcatgct 78720 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 78718 catgcatgcatgcatgcatg 78699 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 78692 attcattcatgcatgcatgcatgc 78715
>dbj|AK089473.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F730037C07 product:lipoprotein lipase, full insert sequence Length = 2424 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgct 237 ||||||||||||||||||||||||| Sbjct: 713 attcatgcatgcatgcatgcatgct 737 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 735 catgcatgcatgcatgcatg 716 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 709 attcattcatgcatgcatgcatgc 732
>gb|DQ323045.1| Phaseolus vulgaris clone BAC-71F18, complete sequence Length = 157468 Score = 50.1 bits (25), Expect = 0.010 Identities = 25/25 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgctgcc 240 ||||||||||||||||||||||||| Sbjct: 88346 catgcatgcatgcatgcatgctgcc 88322 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 220 catgcatgcatgcatgctgcc 240 ||||||||||||||||||||| Sbjct: 97711 catgcatgcatgcatgctgcc 97691 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 220 catgcatgcatgcatgctgcc 240 ||||||||||||||||||||| Sbjct: 91739 catgcatgcatgcatgctgcc 91719 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 88327 catgcatgcatgcatgcatg 88346
>gb|AC166108.4| Mus musculus BAC clone RP23-192E10 from chromosome 1, complete sequence Length = 188836 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 3227 attcatgcatgcatgcatgcatgc 3250 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 3252 atgcatgcatgcatgcatgc 3233 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 3249 catgcatgcatgcatgcatg 3230
>ref|XM_470192.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 531 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 312 ctgcatcttgaccacctgcttcca 335 |||||||||||||||||||||||| Sbjct: 504 ctgcatcttgaccacctgcttcca 481
>gb|AC112962.15| Mus musculus chromosome 19, clone RP24-74N6, complete sequence Length = 182999 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 51484 attcatgcatgcatgcatgcatgc 51461 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 51458 catgcatgcatgcatgcatgc 51478 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 51477 catgcatgcatgcatgcatgc 51457 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 51488 attcattcatgcatgcatgcatgc 51465 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 51462 catgcatgcatgcatgcatg 51481
>gb|AC117682.11| Mus musculus chromosome 1, clone RP23-436K7, complete sequence Length = 212395 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 211 agattcatgcatgcatgcatgcat 234 |||||||||||||||||||||||| Sbjct: 89797 agattcatgcatgcatgcatgcat 89774 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 agattcatgcatgcatgcat 230 |||||||||||||||||||| Sbjct: 192788 agattcatgcatgcatgcat 192769
>gb|AC154527.2| Mus musculus BAC clone RP23-221K13 from chromosome 14, complete sequence Length = 215802 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 120444 attcatgcatgcatgcatgcatgc 120467 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 120451 catgcatgcatgcatgcatgc 120471 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 120470 catgcatgcatgcatgcatgc 120450 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 120473 atgcatgcatgcatgcatgc 120454 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 120466 catgcatgcatgcatgcatg 120447
>gb|AC097832.7| Rattus norvegicus 11 BAC CH230-68C19 (Children's Hospital Oakland Research Institute) complete sequence Length = 262323 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 245990 attcatgcatgcatgcatgcatgc 246013 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 246015 atgcatgcatgcatgcatgc 245996 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 246012 catgcatgcatgcatgcatg 245993 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 245986 attcattcatgcatgcatgcatgc 246009
>gb|AF130357.2| Mus musculus chromosome X clone CT7-148C10, complete sequence Length = 106724 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 23305 attcatgcatgcatgcatgcatgc 23328 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 23312 catgcatgcatgcatgcatgc 23332 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 23331 catgcatgcatgcatgcatgc 23311 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 23327 catgcatgcatgcatgcatg 23308
>gb|AC130828.4| Mus musculus BAC clone RP23-406H14 from chromosome 6, complete sequence Length = 182673 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 56693 attcatgcatgcatgcatgcatgc 56670 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 56667 catgcatgcatgcatgcatgc 56687 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 56686 catgcatgcatgcatgcatgc 56666 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 56671 catgcatgcatgcatgcatg 56690 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 56664 atgcatgcatgcatgcatgc 56683
>ref|XM_956634.1| Neurospora crassa OR74A hypothetical protein (NCU05270.1) partial mRNA Length = 3309 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 519 catctgctgcagcttcctctcgtt 542 |||||||||||||||||||||||| Sbjct: 933 catctgctgcagcttcctctcgtt 910
>ref|XM_324626.1| Neurospora crassa OR74A hypothetical protein (NCU05270.1) partial mRNA Length = 3309 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 519 catctgctgcagcttcctctcgtt 542 |||||||||||||||||||||||| Sbjct: 933 catctgctgcagcttcctctcgtt 910
>gb|AC124211.2| Mus musculus chromosome X clone CT7-497M13 map qA7.1, complete sequence Length = 114873 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 70805 attcatgcatgcatgcatgcatgc 70828 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 70812 catgcatgcatgcatgcatgc 70832 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 70831 catgcatgcatgcatgcatgc 70811 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 70827 catgcatgcatgcatgcatg 70808
>gb|AC124717.3| Mus musculus BAC clone RP24-147K15 from chromosome 18, complete sequence Length = 204165 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 18206 attcatgcatgcatgcatgcatgc 18183 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 18180 catgcatgcatgcatgcatgc 18200 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 18199 catgcatgcatgcatgcatgc 18179 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 18210 attcattcatgcatgcatgcatgc 18187 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 18184 catgcatgcatgcatgcatg 18203 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 18177 atgcatgcatgcatgcatgc 18196
>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence Length = 234127 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 56908 attcatgcatgcatgcatgcatgc 56885 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 56912 attcattcatgcatgcatgcatgc 56889 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 56886 catgcatgcatgcatgcatg 56905 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 56883 atgcatgcatgcatgcatgc 56902
>gb|AC135016.3| Mus musculus BAC clone RP24-244B4 from chromosome 18, complete sequence Length = 177193 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 33322 attcatgcatgcatgcatgcatgc 33299 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 33296 catgcatgcatgcatgcatgc 33316 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 33315 catgcatgcatgcatgcatgc 33295 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 33292 catgcatgcatgcatgcatgc 33312 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 33311 catgcatgcatgcatgcatgc 33291 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 33288 catgcatgcatgcatgcatgc 33308 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 33300 catgcatgcatgcatgcatg 33319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 33307 catgcatgcatgcatgcatg 33288
>gb|AC007598.7| Homo sapiens chromosome 16 clone RP11-165M1, complete sequence Length = 186120 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 128051 attcatgcatgcatgcatgcatgc 128028 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 128055 attcattcatgcatgcatgcatgc 128032 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 128029 catgcatgcatgcatgcatg 128048 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 128026 atgcatgcatgcatgcatgc 128045
>emb|CR974462.5| Mouse DNA sequence from clone RP23-222K15 on chromosome 17, complete sequence Length = 228057 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 111465 attcatgcatgcatgcatgcatgc 111442 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 111439 catgcatgcatgcatgcatgc 111459 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 111458 catgcatgcatgcatgcatgc 111438 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 111443 catgcatgcatgcatgcatg 111462 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 111436 atgcatgcatgcatgcatgc 111455
>emb|CT025643.4| Mouse DNA sequence from clone RP24-386L23 on chromosome 13, complete sequence Length = 148821 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 76464 attcatgcatgcatgcatgcatgc 76487 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 76428 attcatgcatgcatgcatgcatgc 76451 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 76344 attcatgcatgcatgcatgcatgc 76367 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 76396 attcatgcatgcatgcatgcat 76417 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 76351 catgcatgcatgcatgcatgc 76371 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 76370 catgcatgcatgcatgcatgc 76350 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 76489 atgcatgcatgcatgcatgc 76470 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 76486 catgcatgcatgcatgcatg 76467 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 76460 attcattcatgcatgcatgcatgc 76483 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 76453 atgcatgcatgcatgcatgc 76434 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 76450 catgcatgcatgcatgcatg 76431 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 76424 attcattcatgcatgcatgcatgc 76447 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 76373 atgcatgcatgcatgcatgc 76354 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 76366 catgcatgcatgcatgcatg 76347 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 76340 attcattcatgcatgcatgcatgc 76363
>gb|AC124170.3| Mus musculus BAC clone RP23-155H5 from 8, complete sequence Length = 235023 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 110948 attcatgcatgcatgcatgcatgc 110971 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 110973 atgcatgcatgcatgcatgc 110954 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 110970 catgcatgcatgcatgcatg 110951 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 110944 attcattcatgcatgcatgcatgc 110967
>gb|AC108812.9| Mus musculus chromosome 18, clone RP23-417M2, complete sequence Length = 202340 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 125508 attcatgcatgcatgcatgcatgc 125485 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 125482 catgcatgcatgcatgcatgc 125502 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 125501 catgcatgcatgcatgcatgc 125481 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 125478 catgcatgcatgcatgcatgc 125498 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 125497 catgcatgcatgcatgcatgc 125477 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 125474 catgcatgcatgcatgcatgc 125494 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 125486 catgcatgcatgcatgcatg 125505 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 125493 catgcatgcatgcatgcatg 125474
>gb|AC101813.5| Mus musculus chromosome 1, clone RP24-315D8, complete sequence Length = 159286 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 11944 attcatgcatgcatgcatgcatgc 11967 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 11969 atgcatgcatgcatgcatgc 11950 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 11966 catgcatgcatgcatgcatg 11947
>emb|AL035459.6|HS81G23 Human DNA sequence from clone RP1-81G23 on chromosome 20q12 Contains part of the PTPRT gene for protein tyrosine phosphatase receptor type T, ESTs, STS and GSSs, complete sequence Length = 50348 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 48444 attcatgcatgcatgcatgcatgc 48467 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 48469 atgcatgcatgcatgcatgc 48450 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 48466 catgcatgcatgcatgcatg 48447
>gb|BT009259.1| Triticum aestivum clone wlk4.pk0015.a10:fis, full insert mRNA sequence Length = 788 Score = 48.1 bits (24), Expect = 0.040 Identities = 36/40 (90%) Strand = Plus / Minus Query: 450 gtcggcgagcgtgaactcgtcgccggcgaggtactggttc 489 ||||||||||||||| |||||||||| ||||||| |||| Sbjct: 548 gtcggcgagcgtgaaggcgtcgccggccaggtacttgttc 509
>emb|AL662855.19| Mouse DNA sequence from clone RP23-388J21 on chromosome 11, complete sequence Length = 157088 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 134948 attcatgcatgcatgcatgcatgc 134925 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 134926 catgcatgcatgcatgcatg 134945 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 134923 atgcatgcatgcatgcatgc 134942
>gb|AC093004.2| Homo sapiens 3 BAC RP11-129J11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 159134 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 26456 attcatgcatgcatgcatgcatgc 26479 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 26481 atgcatgcatgcatgcatgc 26462 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 26478 catgcatgcatgcatgcatg 26459
>dbj|AK140551.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:B930026D16 product:unclassifiable, full insert sequence Length = 1136 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 300 attcatgcatgcatgcatgcatgc 277 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 269 tcatgcatgcatgcatgcatgc 290 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 274 catgcatgcatgcatgcatgc 294 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 293 catgcatgcatgcatgcatgc 273 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 304 attcattcatgcatgcatgcatgc 281 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 278 catgcatgcatgcatgcatg 297 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 289 catgcatgcatgcatgcatg 270
>gb|AC160561.2| Mus musculus BAC clone RP23-102D22 from chromosome 12, complete sequence Length = 204231 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 53744 attcatgcatgcatgcatgcatgc 53721 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 53718 catgcatgcatgcatgcatgc 53738 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 53737 catgcatgcatgcatgcatgc 53717 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 53722 catgcatgcatgcatgcatg 53741 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 53715 atgcatgcatgcatgcatgc 53734
>gb|AC157916.2| Mus musculus chromosome 19, clone RP24-330P23, complete sequence Length = 190666 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 41516 attcatgcatgcatgcatgcatgc 41539 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 41523 catgcatgcatgcatgcatgc 41543 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 41542 catgcatgcatgcatgcatgc 41522 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 41538 catgcatgcatgcatgcatg 41519 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 41512 attcattcatgcatgcatgcatgc 41535
>dbj|AK078684.1| Mus musculus adult male eyeball cDNA, RIKEN full-length enriched library, clone:7530406I19 product:unclassifiable, full insert sequence Length = 3453 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 1878 attcatgcatgcatgcatgcatgc 1855 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1852 catgcatgcatgcatgcatgc 1872 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1871 catgcatgcatgcatgcatgc 1851 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1848 catgcatgcatgcatgcatgc 1868 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1867 catgcatgcatgcatgcatgc 1847 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 1844 catgcatgcatgcatgcatgc 1864 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 1856 catgcatgcatgcatgcatg 1875 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 1863 catgcatgcatgcatgcatg 1844
>gb|AC154470.2| Mus musculus BAC clone RP23-193P13 from chromosome 13, complete sequence Length = 216294 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 13572 attcatgcatgcatgcatgcatgc 13595 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 13536 attcatgcatgcatgcatgcatgc 13559 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 13452 attcatgcatgcatgcatgcatgc 13475 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 13504 attcatgcatgcatgcatgcat 13525 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 13459 catgcatgcatgcatgcatgc 13479 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 13478 catgcatgcatgcatgcatgc 13458 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 13597 atgcatgcatgcatgcatgc 13578 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 13594 catgcatgcatgcatgcatg 13575 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 13568 attcattcatgcatgcatgcatgc 13591 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 13561 atgcatgcatgcatgcatgc 13542 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 13558 catgcatgcatgcatgcatg 13539 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 13532 attcattcatgcatgcatgcatgc 13555 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 13481 atgcatgcatgcatgcatgc 13462 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 13474 catgcatgcatgcatgcatg 13455 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 13448 attcattcatgcatgcatgcatgc 13471
>gb|AC154183.2| Mus musculus BAC clone RP23-474E16 from chromosome 17, complete sequence Length = 181773 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 11004 attcatgcatgcatgcatgcatgc 10981 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 10973 tcatgcatgcatgcatgcatgc 10994 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 10978 catgcatgcatgcatgcatgc 10998 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 10997 catgcatgcatgcatgcatgc 10977 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 11008 attcattcatgcatgcatgcatgc 10985 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 10982 catgcatgcatgcatgcatg 11001 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 10993 catgcatgcatgcatgcatg 10974
>gb|AC148019.5| Mus musculus BAC clone RP23-12B6 from chromosome 18, complete sequence Length = 211149 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 61284 attcatgcatgcatgcatgcatgc 61307 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 61291 catgcatgcatgcatgcatgc 61311 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 61310 catgcatgcatgcatgcatgc 61290 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 61313 atgcatgcatgcatgcatgc 61294 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 61306 catgcatgcatgcatgcatg 61287 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 61280 attcattcatgcatgcatgcatgc 61303
>gb|AF090447.2| Zea mays 22 kDa alpha zein gene cluster, complete sequence Length = 346296 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgctgc 239 |||||||||||||||||||||||| Sbjct: 32509 catgcatgcatgcatgcatgctgc 32486 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 32490 catgcatgcatgcatgcatg 32509
>dbj|AK059226.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D08, full insert sequence Length = 631 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 312 ctgcatcttgaccacctgcttcca 335 |||||||||||||||||||||||| Sbjct: 363 ctgcatcttgaccacctgcttcca 340
>dbj|AP001922.4| Homo sapiens genomic DNA, chromosome 11q, clone:CTD-2530H12, complete sequence Length = 219366 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 135549 attcatgcatgcatgcatgcatgc 135572 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 135574 atgcatgcatgcatgcatgc 135555 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 135571 catgcatgcatgcatgcatg 135552
>gb|AF100956.1|AF100956 Mus musculus major histocompatibility locus class II region; Fas-binding protein Daxx (DAXX) gene, partial cds; Bing1 (BING1), tapasin (tapasin), RalGDS-like factor (RLF), KE2 (KE2), BING4 (BING4), beta1, 3-galactosyl transferase (beta1,3-galactosyl transferase), ribosomal protein subunit S18 (RPS18), Sacm21 (Sacm21), H2K1(b) (H2-K1(b)), RING1 (RING1), KE6a (KE6a), KE4 (KE4), RXRbeta (RXRbeta), collagen alpha-2 (XI) (COLA11A2), H2-O alpha (H2-Oalpha), RING3 (RING3), H2-M alpha (H2-M alpha), H2-M beta 2 (H2-M beta2), and H2-M beta1 (H2-M beta1) genes, complete cds; and LMP 2 gene, partial cds Length = 273800 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 104946 attcatgcatgcatgcatgcatgc 104923 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 104920 catgcatgcatgcatgcatgc 104940 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 104939 catgcatgcatgcatgcatgc 104919 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 104924 catgcatgcatgcatgcatg 104943 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 104917 atgcatgcatgcatgcatgc 104936
>emb|AL591542.20| Mouse DNA sequence from clone RP23-321M14 on chromosome 2, complete sequence Length = 197190 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 115939 attcatgcatgcatgcatgcatgc 115962 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 115946 catgcatgcatgcatgcatgc 115966 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 115965 catgcatgcatgcatgcatgc 115945 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 115961 catgcatgcatgcatgcatg 115942
>emb|AL671335.12| Mouse DNA sequence from clone RP23-130J1 on chromosome X, complete sequence Length = 175336 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 121635 attcatgcatgcatgcatgcatgc 121658 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 121642 catgcatgcatgcatgcatgct 121663 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 121661 catgcatgcatgcatgcatgc 121641 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 121657 catgcatgcatgcatgcatg 121638 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 121631 attcattcatgcatgcatgcatgc 121654
>emb|AL807394.9| Mouse DNA sequence from clone RP23-304N5 on chromosome X, complete sequence Length = 161674 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 84770 attcatgcatgcatgcatgcatgc 84793 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 84777 catgcatgcatgcatgcatgc 84797 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 84796 catgcatgcatgcatgcatgc 84776 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 84792 catgcatgcatgcatgcatg 84773
>emb|AL627323.6| Mouse DNA sequence from clone RP23-477G24 on chromosome 11, complete sequence Length = 64341 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||||| Sbjct: 44093 attcatgcatgcatgcatgcatgc 44116 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 44118 atgcatgcatgcatgcatgc 44099 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 44115 catgcatgcatgcatgcatg 44096 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 44089 attcattcatgcatgcatgcatgc 44112
>gb|AC162902.4| Mus musculus BAC clone RP23-448D23 from chromosome 12, complete sequence Length = 190357 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 214 ttcatgcatgcatgcatgcatgc 236 ||||||||||||||||||||||| Sbjct: 105976 ttcatgcatgcatgcatgcatgc 105998 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 105982 catgcatgcatgcatgcatgc 106002 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 106001 catgcatgcatgcatgcatgc 105981 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 105997 catgcatgcatgcatgcatg 105978
>gb|AC164641.5| Mus musculus BAC clone RP23-393F10 from chromosome 12, complete sequence Length = 198725 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 214 ttcatgcatgcatgcatgcatgc 236 ||||||||||||||||||||||| Sbjct: 175110 ttcatgcatgcatgcatgcatgc 175088 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 175085 catgcatgcatgcatgcatgc 175105 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 175104 catgcatgcatgcatgcatgc 175084 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 175089 catgcatgcatgcatgcatg 175108
>gb|AC093366.9| Mus musculus chromosome 8, clone RP23-60P23, complete sequence Length = 230236 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgctgc 239 ||||||||||||||||||||||| Sbjct: 55336 atgcatgcatgcatgcatgctgc 55314
>gb|AC123053.4| Mus musculus BAC clone RP24-374O20 from chromosome 7, complete sequence Length = 184618 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 214 ttcatgcatgcatgcatgcatgc 236 ||||||||||||||||||||||| Sbjct: 176520 ttcatgcatgcatgcatgcatgc 176542 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 176544 atgcatgcatgcatgcatgc 176525 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 176541 catgcatgcatgcatgcatg 176522
>gb|AC146569.5| Medicago truncatula clone mth2-102a8, complete sequence Length = 127803 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgct 237 ||||||||||||||||||||||| Sbjct: 117823 tcatgcatgcatgcatgcatgct 117801 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 117803 catgcatgcatgcatgcatg 117822
>gb|BT009210.1| Triticum aestivum clone wle1n.pk0047.h6:fis, full insert mRNA sequence Length = 966 Score = 46.1 bits (23), Expect = 0.16 Identities = 29/31 (93%) Strand = Plus / Minus Query: 448 aggtcggcgagcgtgaactcgtcgccggcga 478 |||||||| || ||||||||||||||||||| Sbjct: 614 aggtcggcaagggtgaactcgtcgccggcga 584
>ref|XM_965640.1| PREDICTED: Tribolium castaneum similar to CG7368-PA (LOC659323), mRNA Length = 1282 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 429 ggaggccggcaggtgggacaggt 451 ||||||||||||||||||||||| Sbjct: 607 ggaggccggcaggtgggacaggt 585
>gb|AC155312.2| Mus musculus BAC clone RP23-411F11 from chromosome 12, complete sequence Length = 197795 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 214 ttcatgcatgcatgcatgcatgc 236 ||||||||||||||||||||||| Sbjct: 193541 ttcatgcatgcatgcatgcatgc 193563 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 193547 catgcatgcatgcatgcatgc 193567 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 193566 catgcatgcatgcatgcatgc 193546 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 193562 catgcatgcatgcatgcatg 193543
>emb|BX571770.5| Zebrafish DNA sequence from clone DKEY-276I5 in linkage group 24, complete sequence Length = 210504 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatg 235 ||||||||||||||||||||||| Sbjct: 202874 attcatgcatgcatgcatgcatg 202896 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 202896 catgcatgcatgcatgcatg 202877
>gb|AC159811.2| Mus musculus BAC clone RP24-127J13 from chromosome 9, complete sequence Length = 134895 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 214 ttcatgcatgcatgcatgcatgc 236 ||||||||||||||||||||||| Sbjct: 32193 ttcatgcatgcatgcatgcatgc 32171 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 32172 catgcatgcatgcatgcatg 32191 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 32169 atgcatgcatgcatgcatgc 32188
>gb|AC026440.4|AC026440 Homo sapiens chromosome 5 clone CTD-2269F5, complete sequence Length = 103115 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 214 ttcatgcatgcatgcatgcatgc 236 ||||||||||||||||||||||| Sbjct: 21215 ttcatgcatgcatgcatgcatgc 21193 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 21194 catgcatgcatgcatgcatg 21213 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 21191 atgcatgcatgcatgcatgc 21210
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Plus Query: 209 gaagattcatgcatgcatgcatgcatg 235 |||||| |||||||||||||||||||| Sbjct: 33527585 gaagatgcatgcatgcatgcatgcatg 33527611 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 33527612 tcatgcatgcatgcatgcatgc 33527591 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 22806396 tcatgcatgcatgcatgcatgc 22806417 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatg 235 ||||||||||||||||||||| Sbjct: 24837011 tcatgcatgcatgcatgcatg 24837031 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgct 237 ||||||||||||||||||||| Sbjct: 16570659 atgcatgcatgcatgcatgct 16570639 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 214 ttcatgcatgcatgcatgcat 234 ||||||||||||||||||||| Sbjct: 4056783 ttcatgcatgcatgcatgcat 4056803 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgct 237 ||||||||||||||||||||| Sbjct: 5015 atgcatgcatgcatgcatgct 4995 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 33527589 atgcatgcatgcatgcatgc 33527608 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 28680428 atgcatgcatgcatgcatgc 28680447 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 24837031 catgcatgcatgcatgcatg 24837012 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 22806419 atgcatgcatgcatgcatgc 22806400 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 22806416 catgcatgcatgcatgcatg 22806397 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 10124106 catgcatgcatgcatgcatg 10124125 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 10124125 catgcatgcatgcatgcatg 10124106
>gb|AC157998.2| Mus musculus BAC clone RP23-27L18 from chromosome 9, complete sequence Length = 253762 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 214 ttcatgcatgcatgcatgcatgc 236 ||||||||||||||||||||||| Sbjct: 14750 ttcatgcatgcatgcatgcatgc 14772 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 14774 atgcatgcatgcatgcatgc 14755 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 14771 catgcatgcatgcatgcatg 14752
>gb|AC107815.11| Mus musculus chromosome 7, clone RP23-114A6, complete sequence Length = 228068 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgctg 238 ||||||||||||||||||||||| Sbjct: 125312 catgcatgcatgcatgcatgctg 125290 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 125293 catgcatgcatgcatgcatgc 125313
>dbj|AP005535.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0054K20 Length = 153584 Score = 46.1 bits (23), Expect = 0.16 Identities = 26/27 (96%) Strand = Plus / Plus Query: 209 gaagattcatgcatgcatgcatgcatg 235 |||||| |||||||||||||||||||| Sbjct: 102460 gaagatgcatgcatgcatgcatgcatg 102486 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 102487 tcatgcatgcatgcatgcatgc 102466 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 102464 atgcatgcatgcatgcatgc 102483
>gb|AC154489.2| Mus musculus BAC clone RP23-205G15 from chromosome 14, complete sequence Length = 210483 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgct 237 ||||||||||||||||||||||| Sbjct: 77945 tcatgcatgcatgcatgcatgct 77923 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 77925 catgcatgcatgcatgcatg 77944
>gb|AC149062.3| Mus musculus BAC clone RP23-183E20 from 7, complete sequence Length = 229956 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 214 ttcatgcatgcatgcatgcatgc 236 ||||||||||||||||||||||| Sbjct: 90408 ttcatgcatgcatgcatgcatgc 90430 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 90432 atgcatgcatgcatgcatgc 90413 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 90429 catgcatgcatgcatgcatg 90410
>emb|AL670231.7| Mouse DNA sequence from clone RP23-329G7 on chromosome 4, complete sequence Length = 229957 Score = 46.1 bits (23), Expect = 0.16 Identities = 23/23 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatg 235 ||||||||||||||||||||||| Sbjct: 110419 attcatgcatgcatgcatgcatg 110441 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 110441 catgcatgcatgcatgcatg 110422
>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence Length = 186903 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 26835 catgcatgcatgcatgcatgct 26856 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 26854 catgcatgcatgcatgcatgc 26834 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 26831 catgcatgcatgcatgcatgc 26851 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 26850 catgcatgcatgcatgcatgc 26830 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 26827 catgcatgcatgcatgcatgc 26847 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 26846 catgcatgcatgcatgcatgc 26826 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 26823 catgcatgcatgcatgcatgc 26843 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 26842 catgcatgcatgcatgcatgc 26822 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 26820 atgcatgcatgcatgcatgc 26839 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 26575 catgcatgcatgcatgcatg 26594 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 26594 catgcatgcatgcatgcatg 26575
>gb|AC153581.18| Mus musculus 6 BAC RP23-111F17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 208262 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 82306 attcatgcatgcatgcatgcat 82327
>gb|AC151761.1| Ornithorhynchus anatinus chromosome UNK clone OABb-434P24, complete sequence Length = 134595 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 116298 attcatgcatgcatgcatgcat 116277
>gb|AC154555.3| Mus musculus BAC clone RP23-418L12 from chromosome 16, complete sequence Length = 192614 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 74973 catgcatgcatgcatgcatgct 74952 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 74954 catgcatgcatgcatgcatg 74973
>gb|AY024015.1| Oryza sativa microsatellite MRG6340 containing (CATG)X8, closest to marker L131, genomic sequence Length = 232 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 100 tcatgcatgcatgcatgcatgc 121 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 132 catgcatgcatgcatgcatgc 112 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 109 catgcatgcatgcatgcatgc 129 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 128 catgcatgcatgcatgcatgc 108 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 105 catgcatgcatgcatgcatgc 125 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 124 catgcatgcatgcatgcatgc 104 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 113 catgcatgcatgcatgcatg 132 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 120 catgcatgcatgcatgcatg 101
>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome Length = 943016 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 513 gccgagcatctgctgcagcttc 534 |||||||||||||||||||||| Sbjct: 204230 gccgagcatctgctgcagcttc 204209
>gb|AC005737.1| Homo sapiens chromosome 16, BAC clone 97H22 (LANL), complete sequence Length = 174098 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 63676 tcatgcatgcatgcatgcatgc 63697 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 63696 catgcatgcatgcatgcatg 63677
>gb|AC146440.5| Pan troglodytes BAC clone RP43-11P11 from 7, complete sequence Length = 181369 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 334 caggaggggcggctggagatgg 355 |||||||||||||||||||||| Sbjct: 174146 caggaggggcggctggagatgg 174125
>gb|AC141565.3| Mus musculus BAC clone RP23-160M21 from chromosome 14, complete sequence Length = 210128 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 214 ttcatgcatgcatgcatgcatg 235 |||||||||||||||||||||| Sbjct: 136153 ttcatgcatgcatgcatgcatg 136174 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 64912 catgcatgcatgcatgcatgct 64891 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 64901 catgcatgcatgcatgcatgc 64921 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 64920 catgcatgcatgcatgcatgc 64900 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 64897 catgcatgcatgcatgcatgc 64917 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 64916 catgcatgcatgcatgcatgc 64896 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 64893 catgcatgcatgcatgcatgc 64913 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 136174 catgcatgcatgcatgcatg 136155 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 64923 atgcatgcatgcatgcatgc 64904 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 ||||| |||||||||||||||||| Sbjct: 64886 attcaagcatgcatgcatgcatgc 64909
>gb|AY661659.1| Sorghum bicolor clone BAC 75D9, complete sequence Length = 204120 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 218 tgcatgcatgcatgcatgctgc 239 |||||||||||||||||||||| Sbjct: 196251 tgcatgcatgcatgcatgctgc 196230
>gb|AC161197.9| Mus musculus chromosome 7, clone RP23-179K11, complete sequence Length = 240657 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 190627 attcatgcatgcatgcatgcat 190606
>gb|AC135809.4| Mus musculus BAC clone RP23-353F16 from chromosome 7, complete sequence Length = 195041 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 152878 catgcatgcatgcatgcatgct 152899 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 152897 catgcatgcatgcatgcatg 152878
>gb|AC134546.4| Mus musculus BAC clone RP24-471H17 from chromosome 18, complete sequence Length = 208921 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 91643 attcatgcatgcatgcatgcat 91622
>gb|AC120418.10| Mus musculus chromosome 6, clone RP24-474I24, complete sequence Length = 177307 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 123119 attcatgcatgcatgcatgcat 123098
>gb|AC166827.2| Mus musculus BAC clone RP23-359M9 from chromosome 12, complete sequence Length = 219729 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 89577 attcatgcatgcatgcatgcat 89556
>gb|AC104868.8| Mus musculus chromosome 1, clone RP24-532K6, complete sequence Length = 182376 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 211 agattcatgcatgcatgcatgcatgc 236 |||| ||||||||||||||||||||| Sbjct: 174177 agatacatgcatgcatgcatgcatgc 174202 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 174204 atgcatgcatgcatgcatgc 174185 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 174201 catgcatgcatgcatgcatg 174182
>gb|AC161442.5| Mus musculus chromosome 5, clone RP23-384P12, complete sequence Length = 174557 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 55629 attcatgcatgcatgcatgcat 55608
>gb|AC155823.8| Mus musculus BAC clone RP23-348C5 from chromosome 8, complete sequence Length = 219597 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 173995 catgcatgcatgcatgcatgct 173974 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 173976 catgcatgcatgcatgcatgc 173996
>gb|AC158612.7| Mus musculus 10 BAC RP23-39I3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 206234 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 91453 catgcatgcatgcatgcatgct 91474 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 91472 catgcatgcatgcatgcatgc 91452 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 91450 atgcatgcatgcatgcatgc 91469
>gb|AC099704.7| Mus musculus chromosome 15, clone RP23-256A2, complete sequence Length = 204704 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 211 agattcatgcatgcatgcatgcatgc 236 |||| ||||||||||||||||||||| Sbjct: 126224 agatgcatgcatgcatgcatgcatgc 126199 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 126200 catgcatgcatgcatgcatgc 126220 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 126197 atgcatgcatgcatgcatgc 126216 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 126141 atgcatgcatgcatgcatgc 126122 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 211 agattcatgcatgcatgcatgcat 234 |||| ||||||||||||||||||| Sbjct: 126143 agatgcatgcatgcatgcatgcat 126120 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 126120 atgcatgcatgcatgcatgc 126139
>gb|AY525126.1| Homo sapiens signal transducer and activator of transcription 2, 113kDa (STAT2) gene, complete cds Length = 22461 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgctg 238 |||||||||||||||||||||| Sbjct: 9468 atgcatgcatgcatgcatgctg 9447
>gb|AC139939.6| Mus musculus chromosome 1, clone RP23-458O23, complete sequence Length = 175033 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 101164 attcatgcatgcatgcatgcat 101185
>gb|AC133950.4| Mus musculus BAC clone RP24-243C16 from chromosome 7, complete sequence Length = 176244 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 143440 catgcatgcatgcatgcatgct 143461 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 143459 catgcatgcatgcatgcatgc 143439 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 143436 catgcatgcatgcatgcatgc 143456 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 143455 catgcatgcatgcatgcatgc 143435 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 143432 catgcatgcatgcatgcatgc 143452 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 143451 catgcatgcatgcatgcatgc 143431 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 143428 catgcatgcatgcatgcatgc 143448 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 143447 catgcatgcatgcatgcatgc 143427 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 143425 atgcatgcatgcatgcatgc 143444 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 143184 catgcatgcatgcatgcatg 143203 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 143203 catgcatgcatgcatgcatg 143184
>emb|AJ438040.1|TCH438040 Tetraselmis chui DNA containing repeats, strain CCAP 8/6 Length = 903 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 302 tcatgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 326 catgcatgcatgcatgcatgc 306 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 307 catgcatgcatgcatgcatg 326 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 322 catgcatgcatgcatgcatg 303
>ref|XM_726387.1| Aspergillus fumigatus Af293 glutathione transferase (Afu6g00760) partial mRNA Length = 585 Score = 44.1 bits (22), Expect = 0.62 Identities = 43/50 (86%) Strand = Plus / Minus Query: 435 cggcaggtgggacaggtcggcgagcgtgaactcgtcgccggcgaggtact 484 |||||| || ||||| || |||| ||||| |||||||||||| ||||||| Sbjct: 504 cggcagatgcgacagatccgcgaacgtgacctcgtcgccggcaaggtact 455
>gb|AC102819.5| Mus musculus chromosome 8, clone RP23-117H21, complete sequence Length = 191116 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 59205 attcatgcatgcatgcatgcat 59184
>gb|AC124683.3| Mus musculus BAC clone RP24-349E11 from chromosome 6, complete sequence Length = 168179 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 211 agattcatgcatgcatgcatgcatgc 236 |||| ||||||||||||||||||||| Sbjct: 84603 agatgcatgcatgcatgcatgcatgc 84628 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 84627 catgcatgcatgcatgcatgc 84607 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 84630 atgcatgcatgcatgcatgc 84611
>gb|AC131773.3| Mus musculus BAC clone RP24-308A19 from chromosome 15, complete sequence Length = 168423 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 211 agattcatgcatgcatgcatgcatgc 236 |||| ||||||||||||||||||||| Sbjct: 13158 agatgcatgcatgcatgcatgcatgc 13183 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 13182 catgcatgcatgcatgcatgc 13162 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 13262 atgcatgcatgcatgcatgc 13243 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 13241 atgcatgcatgcatgcatgc 13260 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 211 agattcatgcatgcatgcatgcat 234 |||| ||||||||||||||||||| Sbjct: 13239 agatgcatgcatgcatgcatgcat 13262 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 13185 atgcatgcatgcatgcatgc 13166
>gb|AC124187.3| Mus musculus BAC clone RP23-237I24 from 18, complete sequence Length = 172828 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 219 gcatgcatgcatgcatgctgcc 240 |||||||||||||||||||||| Sbjct: 131436 gcatgcatgcatgcatgctgcc 131457
>gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genomic sequence, complete sequence Length = 164705 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Plus Query: 210 aagattcatgcatgcatgcatgcatg 235 ||||| |||||||||||||||||||| Sbjct: 153643 aagatgcatgcatgcatgcatgcatg 153668 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 153668 catgcatgcatgcatgcatgc 153648 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 153646 atgcatgcatgcatgcatgc 153665
>gb|AC117596.6| Mus musculus chromosome 6, clone RP23-392K24, complete sequence Length = 233811 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 223385 catgcatgcatgcatgcatgct 223406 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 223404 catgcatgcatgcatgcatgc 223384 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 223381 catgcatgcatgcatgcatgc 223401 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 223400 catgcatgcatgcatgcatgc 223380 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 223377 catgcatgcatgcatgcatgc 223397 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 223396 catgcatgcatgcatgcatg 223377
>gb|AC108423.10| Mus musculus chromosome 16, clone RP23-443N12, complete sequence Length = 192819 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 184884 tcatgcatgcatgcatgcatgc 184863 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 184860 catgcatgcatgcatgcatgc 184880 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 184879 catgcatgcatgcatgcatgc 184859 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 184864 catgcatgcatgcatgcatg 184883
>gb|AC164425.3| Mus musculus BAC clone RP24-497H13 from chromosome 16, complete sequence Length = 162603 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 18743 catgcatgcatgcatgcatgct 18764 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 18762 catgcatgcatgcatgcatg 18743
>gb|AC108436.5| Mus musculus chromosome 8, clone RP23-230G11, complete sequence Length = 185534 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 177823 attcatgcatgcatgcatgcat 177802 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 177827 attcattcatgcatgcatgcatgc 177804
>emb|AL589745.8| Human DNA sequence from clone RP11-478K15 on chromosome 13 Contains parts of four novel genes, the 5' end of a novel gene and a CpG island, complete sequence Length = 170765 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 130577 attcatgcatgcatgcatgcat 130556 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 212 gattcatgcatgcatgcatgcatgc 236 ||||||| ||||||||||||||||| Sbjct: 130582 gattcattcatgcatgcatgcatgc 130558
>emb|AL356858.19| Human DNA sequence from clone RP11-357K9 on chromosome Xp11.4-21.2 Contains the PRRG1 gene for proline-rich Gla (G-carboxyglutamic acid) polypetide 1, a ferritin heavy polypeptide-like 17 (FTHL17) pseudogene and a CpG island, complete sequence Length = 128968 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 100235 attcatgcatgcatgcatgcat 100256 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 100231 attcattcatgcatgcatgcatgc 100254
>gb|AC026231.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-114F4, complete sequence Length = 208199 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 135066 tcatgcatgcatgcatgcatgc 135045 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 135046 catgcatgcatgcatgcatg 135065
>emb|AL162379.14| Human DNA sequence from clone RP11-426K7 on chromosome 13 Contains part of a novel gene, complete sequence Length = 109757 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 39263 attcatgcatgcatgcatgcat 39242 Score = 42.1 bits (21), Expect = 2.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 212 gattcatgcatgcatgcatgcatgc 236 ||||||| ||||||||||||||||| Sbjct: 39268 gattcattcatgcatgcatgcatgc 39244
>gb|AC108850.3| Mus musculus chromosome 1, clone RP24-85N11, complete sequence Length = 194889 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 36283 attcatgcatgcatgcatgcat 36304
>gb|AC120241.5| Rattus norvegicus X BAC CH230-390I1 (Children's Hospital Oakland Research Institute) complete sequence Length = 174991 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 2298 tcatgcatgcatgcatgcatgc 2277 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 2278 catgcatgcatgcatgcatg 2297
>emb|AL008715.1|HS1216H12 Human DNA sequence from clone CTC-1216H12 on chromosome 22, complete sequence Length = 101817 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 88897 attcatgcatgcatgcatgcat 88918 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 88893 attcattcatgcatgcatgcatgc 88916
>emb|CR354557.9| Zebrafish DNA sequence from clone DKEY-34I7 in linkage group 23, complete sequence Length = 127420 Score = 44.1 bits (22), Expect = 0.62 Identities = 25/26 (96%) Strand = Plus / Minus Query: 211 agattcatgcatgcatgcatgcatgc 236 |||| ||||||||||||||||||||| Sbjct: 86137 agatgcatgcatgcatgcatgcatgc 86112 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 86113 catgcatgcatgcatgcatgc 86133 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 86109 catgcatgcatgcatgcatgc 86129 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 86128 catgcatgcatgcatgcatgc 86108 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 86106 atgcatgcatgcatgcatgc 86125
>gb|AC154601.3| Mus musculus BAC clone RP23-342J18 from chromosome 16, complete sequence Length = 189457 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 4910 tcatgcatgcatgcatgcatgc 4889 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 4886 catgcatgcatgcatgcatgc 4906 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 4905 catgcatgcatgcatgcatgc 4885 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 4890 catgcatgcatgcatgcatg 4909
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 169479 attcatgcatgcatgcatgcat 169458
>emb|AJ318464.1|MMU318464 Mus musculus Rpgr gene for retinitis pigmentosa GTPase regulator, exons 1-19 Length = 109632 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 88687 attcatgcatgcatgcatgcat 88708
>emb|CR407555.9| Zebrafish DNA sequence from clone DKEY-260H8 in linkage group 5, complete sequence Length = 156095 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 4181 attcatgcatgcatgcatgcat 4202 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 4177 attcattcatgcatgcatgcatgc 4200
>emb|BX571792.9| Zebrafish DNA sequence from clone CH211-177D9 in linkage group 12, complete sequence Length = 141671 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 42230 catgcatgcatgcatgcatgct 42251 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 42249 catgcatgcatgcatgcatgc 42229 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 42227 atgcatgcatgcatgcatgc 42246
>gb|AC109445.3| Homo sapiens chromosome 5 clone CTD-2351A8, complete sequence Length = 135875 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 94282 catgcatgcatgcatgcatgct 94303 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 94301 catgcatgcatgcatgcatgc 94281
>gb|AC097537.2| Homo sapiens BAC clone RP11-806K15 from 4, complete sequence Length = 138574 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 39706 attcatgcatgcatgcatgcat 39685
>gb|AC137589.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0072L08, complete sequence Length = 152272 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 110785 tcatgcatgcatgcatgcatgc 110764 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 110765 catgcatgcatgcatgcatg 110784
>gb|AC144558.1| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0072L08, sequencing in progress, complete sequence Length = 152272 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 110785 tcatgcatgcatgcatgcatgc 110764 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 110765 catgcatgcatgcatgcatg 110784
>gb|AC116574.6| Mus musculus BAC clone RP23-234F20 from chromosome 12, complete sequence Length = 191808 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 17017 attcatgcatgcatgcatgcat 16996
>emb|AL935185.11| Zebrafish DNA sequence from clone CH211-250A16 in linkage group 21, complete sequence Length = 191281 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 2136 attcatgcatgcatgcatgcat 2115
>gb|AC125310.5| Mus musculus BAC clone RP24-548E5 from chromosome 1, complete sequence Length = 223534 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 99443 attcatgcatgcatgcatgcat 99422
>gb|AC153820.4| Mus musculus 6 BAC RP23-459L15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 180996 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 17930 catgcatgcatgcatgcatgct 17951 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 17949 catgcatgcatgcatgcatgc 17929 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 17926 catgcatgcatgcatgcatgc 17946 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 17945 catgcatgcatgcatgcatgc 17925 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 17922 catgcatgcatgcatgcatgc 17942 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 17941 catgcatgcatgcatgcatgc 17921 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 17918 catgcatgcatgcatgcatgc 17938 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 17937 catgcatgcatgcatgcatgc 17917
>emb|BX005236.16| Mouse DNA sequence from clone RP23-254A23 on chromosome X, complete sequence Length = 122633 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 119386 attcatgcatgcatgcatgcat 119365
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 24133175 attcatgcatgcatgcatgcat 24133154 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 21501439 catgcatgcatgcatgcatgct 21501460 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 21501458 catgcatgcatgcatgcatgc 21501438 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 218 tgcatgcatgcatgcatgctg 238 ||||||||||||||||||||| Sbjct: 17640165 tgcatgcatgcatgcatgctg 17640185 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatg 235 ||||||||||||||||||||| Sbjct: 1149021 tcatgcatgcatgcatgcatg 1149001 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatg 235 ||||||||||||||||||||| Sbjct: 1149000 tcatgcatgcatgcatgcatg 1149020 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 catgcatgcatgcatgctgc 239 |||||||||||||||||||| Sbjct: 23594672 catgcatgcatgcatgctgc 23594653 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgc 232 |||||||||||||||||||| Sbjct: 21858112 attcatgcatgcatgcatgc 21858131 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 20033314 atgcatgcatgcatgcatgc 20033295 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 20033293 atgcatgcatgcatgcatgc 20033312 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcat 234 |||||||||||||||||||| Sbjct: 16581435 tcatgcatgcatgcatgcat 16581416
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 21108470 tcatgcatgcatgcatgcatgc 21108449 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 26702626 catgcatgcatgcatgcatgc 26702606 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 26702603 catgcatgcatgcatgcatgc 26702623 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 26702607 catgcatgcatgcatgcatg 26702626 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 26702622 catgcatgcatgcatgcatg 26702603 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgc 232 |||||||||||||||||||| Sbjct: 25088432 attcatgcatgcatgcatgc 25088413 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 22733973 atgcatgcatgcatgcatgc 22733954 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 21108450 catgcatgcatgcatgcatg 21108469 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 15917284 atgcatgcatgcatgcatgc 15917303 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 14496812 atgcatgcatgcatgcatgc 14496793 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 14496791 atgcatgcatgcatgcatgc 14496810 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 6481793 atgcatgcatgcatgcatgc 6481812
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 16066357 tcatgcatgcatgcatgcatgc 16066378 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 2564518 catgcatgcatgcatgcatgc 2564498 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 2564495 catgcatgcatgcatgcatgc 2564515 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 2564514 catgcatgcatgcatgcatgc 2564494 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 2564491 catgcatgcatgcatgcatgc 2564511 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 16066377 catgcatgcatgcatgcatg 16066358 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 2564499 catgcatgcatgcatgcatg 2564518 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 2564510 catgcatgcatgcatgcatg 2564491
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 211 agattcatgcatgcatgcatgc 232 |||||||||||||||||||||| Sbjct: 916044 agattcatgcatgcatgcatgc 916023 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 210 aagattcatgcatgcatgcatgca 233 ||||||| |||||||||||||||| Sbjct: 10853478 aagattcgtgcatgcatgcatgca 10853501 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcat 234 |||||||||||||||||||| Sbjct: 3135562 tcatgcatgcatgcatgcat 3135543 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcat 234 |||||||||||||||||||| Sbjct: 3090728 tcatgcatgcatgcatgcat 3090709 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcat 234 |||||||||||||||||||| Sbjct: 3045484 tcatgcatgcatgcatgcat 3045465
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 22326323 tcatgcatgcatgcatgcatgc 22326344 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 211 agattcatgcatgcatgcatg 231 ||||||||||||||||||||| Sbjct: 26243299 agattcatgcatgcatgcatg 26243279 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 22326355 catgcatgcatgcatgcatgc 22326335 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 22326332 catgcatgcatgcatgcatgc 22326352 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 22326351 catgcatgcatgcatgcatgc 22326331 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 22326328 catgcatgcatgcatgcatgc 22326348 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 22326347 catgcatgcatgcatgcatgc 22326327 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatg 235 ||||||||||||||||||||| Sbjct: 21034523 tcatgcatgcatgcatgcatg 21034503 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatg 235 ||||||||||||||||||||| Sbjct: 21034502 tcatgcatgcatgcatgcatg 21034522 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 4285518 catgcatgcatgcatgcatgc 4285498 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgc 232 |||||||||||||||||||| Sbjct: 27804335 attcatgcatgcatgcatgc 27804354 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 22326336 catgcatgcatgcatgcatg 22326355 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 22326343 catgcatgcatgcatgcatg 22326324 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 218 tgcatgcatgcatgcatgct 237 |||||||||||||||||||| Sbjct: 7774287 tgcatgcatgcatgcatgct 7774306 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 4285499 catgcatgcatgcatgcatg 4285518
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 3374656 tcatgcatgcatgcatgcatgc 3374677 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 40749592 catgcatgcatgcatgcatgc 40749612 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 40749611 catgcatgcatgcatgcatgc 40749591 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 33279917 catgcatgcatgcatgcatgc 33279937 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 33279936 catgcatgcatgcatgcatgc 33279916 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgca 233 ||||||||||||||||||||| Sbjct: 4001195 attcatgcatgcatgcatgca 4001215 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 40749589 atgcatgcatgcatgcatgc 40749608 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 33830442 atgcatgcatgcatgcatgc 33830461 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcat 234 |||||||||||||||||||| Sbjct: 28180589 tcatgcatgcatgcatgcat 28180570 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 25999374 atgcatgcatgcatgcatgc 25999355 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 218 tgcatgcatgcatgcatgct 237 |||||||||||||||||||| Sbjct: 16359502 tgcatgcatgcatgcatgct 16359521 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 ||||||||||| |||||||||||| Sbjct: 7705303 attcatgcatgtatgcatgcatgc 7705326 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 4001191 attcattcatgcatgcatgcatgc 4001214 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 3374676 catgcatgcatgcatgcatg 3374657 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 3171389 catgcatgcatgcatgcatg 3171370 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 3171370 catgcatgcatgcatgcatg 3171389 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 3155558 catgcatgcatgcatgcatg 3155577 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 3155577 catgcatgcatgcatgcatg 3155558
>gb|AC007433.16|AC007433 Mus musculus chromosome 10, clone RP21-340M5, complete sequence Length = 125105 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 111825 catgcatgcatgcatgcatgct 111804 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 111806 catgcatgcatgcatgcatgc 111826 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 111828 atgcatgcatgcatgcatgc 111809
>gb|AC087799.43| Mus musculus strain C57BL/6J chromosome 16 clone rp23-198m10, complete sequence Length = 208011 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 154075 catgcatgcatgcatgcatgct 154096 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 154094 catgcatgcatgcatgcatg 154075
>gb|AC010432.6|AC010432 Homo sapiens chromosome 5 clone CTD-2202A17, complete sequence Length = 148697 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 120138 catgcatgcatgcatgcatgct 120117 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 120119 catgcatgcatgcatgcatgc 120139
>gb|AC025574.19| Homo sapiens 12 BAC RP11-348M3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 60153 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgctg 238 |||||||||||||||||||||| Sbjct: 39323 atgcatgcatgcatgcatgctg 39302
>gb|AC111186.11| Homo sapiens chromosome 17, clone RP11-1112G13, complete sequence Length = 145601 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 141683 attcatgcatgcatgcatgcat 141662 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 141687 attcattcatgcatgcatgcatgc 141664
>gb|AC087651.19| Homo sapiens chromosome 17, clone RP11-309N17, complete sequence Length = 197148 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 121358 attcatgcatgcatgcatgcat 121379 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 121354 attcattcatgcatgcatgcatgc 121377
>gb|AC007546.6| Homo sapiens 12 BAC RP11-946P6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 168396 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 113453 attcatgcatgcatgcatgcat 113432 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 113457 attcattcatgcatgcatgcatgc 113434
>dbj|AP003810.6| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1119_A04 Length = 128906 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 211 agattcatgcatgcatgcatgc 232 |||||||||||||||||||||| Sbjct: 20391 agattcatgcatgcatgcatgc 20370
>dbj|AP004375.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0475C12 Length = 140863 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 138396 tcatgcatgcatgcatgcatgc 138417 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 138416 catgcatgcatgcatgcatg 138397
>emb|AL929073.19| Mouse DNA sequence from clone RP23-125D6 on chromosome 4, complete sequence Length = 129246 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 97963 attcatgcatgcatgcatgcat 97942
>dbj|AP003630.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0566A10 Length = 174367 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 104746 tcatgcatgcatgcatgcatgc 104767 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 104778 catgcatgcatgcatgcatgc 104758 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 104755 catgcatgcatgcatgcatgc 104775 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 104774 catgcatgcatgcatgcatgc 104754 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 104751 catgcatgcatgcatgcatgc 104771 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 104770 catgcatgcatgcatgcatgc 104750 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 104759 catgcatgcatgcatgcatg 104778 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 104766 catgcatgcatgcatgcatg 104747
>dbj|AP003301.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0701D05 Length = 172161 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 53026 tcatgcatgcatgcatgcatgc 53047 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 53046 catgcatgcatgcatgcatg 53027
>emb|BX000522.11| Zebrafish DNA sequence from clone CH211-146K11, complete sequence Length = 175406 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 131932 attcatgcatgcatgcatgcat 131953 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 131928 attcattcatgcatgcatgcatgc 131951
>emb|AL831780.12| Mouse DNA sequence from clone RP23-394B8 on chromosome 2, complete sequence Length = 173444 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 13165 attcatgcatgcatgcatgcat 13186
>dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0006O15 Length = 139723 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 39734 tcatgcatgcatgcatgcatgc 39755 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 39757 atgcatgcatgcatgcatgc 39738 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 39754 catgcatgcatgcatgcatg 39735
>dbj|AP005726.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0028A18 Length = 151080 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 4437 tcatgcatgcatgcatgcatgc 4458 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 4457 catgcatgcatgcatgcatg 4438
>gb|AC121513.15| Mus musculus chromosome 18, clone RP24-391B9, complete sequence Length = 160247 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 219 gcatgcatgcatgcatgctgcc 240 |||||||||||||||||||||| Sbjct: 123109 gcatgcatgcatgcatgctgcc 123088
>gb|AC147616.3| Mus musculus BAC clone RP23-433L22 from 8, complete sequence Length = 182152 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 164571 attcatgcatgcatgcatgcat 164592 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 164567 attcattcatgcatgcatgcatgc 164590
>gb|AC116817.9| Mus musculus chromosome 1, clone RP24-357I7, complete sequence Length = 186439 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 141823 tcatgcatgcatgcatgcatgc 141844 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 141846 atgcatgcatgcatgcatgc 141827 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 141843 catgcatgcatgcatgcatg 141824
>gb|AC091272.12| Mus musculus chromosome 1, clone RP23-74B7, complete sequence Length = 252476 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 168781 tcatgcatgcatgcatgcatgc 168760 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 168761 catgcatgcatgcatgcatg 168780
>gb|AC120132.11| Mus musculus chromosome 6, clone RP23-105D1, complete sequence Length = 203185 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 188189 attcatgcatgcatgcatgcat 188210
>gb|AC167016.5| Mus musculus chromosome 3, clone RP23-76C12, complete sequence Length = 225524 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 187540 attcatgcatgcatgcatgcat 187519
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 21418711 tcatgcatgcatgcatgcatgc 21418690 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 27027689 catgcatgcatgcatgcatgc 27027669 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 27027666 catgcatgcatgcatgcatgc 27027686 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 27027670 catgcatgcatgcatgcatg 27027689 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 27027685 catgcatgcatgcatgcatg 27027666 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgc 232 |||||||||||||||||||| Sbjct: 25399451 attcatgcatgcatgcatgc 25399432 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 23043884 atgcatgcatgcatgcatgc 23043865 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 21418691 catgcatgcatgcatgcatg 21418710 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 16004660 atgcatgcatgcatgcatgc 16004679 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 14578813 atgcatgcatgcatgcatgc 14578794 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 14578792 atgcatgcatgcatgcatgc 14578811 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 6548260 atgcatgcatgcatgcatgc 6548279
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 24061381 attcatgcatgcatgcatgcat 24061360 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 21429760 catgcatgcatgcatgcatgct 21429781 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 21429779 catgcatgcatgcatgcatgc 21429759 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 218 tgcatgcatgcatgcatgctg 238 ||||||||||||||||||||| Sbjct: 17594536 tgcatgcatgcatgcatgctg 17594556 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatg 235 ||||||||||||||||||||| Sbjct: 1149021 tcatgcatgcatgcatgcatg 1149001 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatg 235 ||||||||||||||||||||| Sbjct: 1149000 tcatgcatgcatgcatgcatg 1149020 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 catgcatgcatgcatgctgc 239 |||||||||||||||||||| Sbjct: 23522863 catgcatgcatgcatgctgc 23522844 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgc 232 |||||||||||||||||||| Sbjct: 21786457 attcatgcatgcatgcatgc 21786476 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 19959528 atgcatgcatgcatgcatgc 19959509 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 19959507 atgcatgcatgcatgcatgc 19959526 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcat 234 |||||||||||||||||||| Sbjct: 16534668 tcatgcatgcatgcatgcat 16534649
>emb|AL772426.5|CNS08CA4 Oryza sativa chromosome 12, . BAC OJ1310_C03 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 132733 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 17866 attcatgcatgcatgcatgcat 17845
>emb|AL772319.13| Mouse DNA sequence from clone RP23-397E2 on chromosome 4, complete sequence Length = 206709 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 23001 catgcatgcatgcatgcatgct 22980 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 22982 catgcatgcatgcatgcatg 23001
>emb|AL805955.26| Mouse DNA sequence from clone RP23-192A6 on chromosome 2, complete sequence Length = 182439 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 179945 catgcatgcatgcatgcatgct 179924 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 179926 catgcatgcatgcatgcatgc 179946 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 179948 atgcatgcatgcatgcatgc 179929
>emb|AL844497.4|CNS08CAU Oryza sativa chromosome 12, . BAC OSJNBa0085B23 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 158019 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 144450 catgcatgcatgcatgcatgct 144429 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 144431 catgcatgcatgcatgcatgc 144451
>emb|AL732539.6| Mouse DNA sequence from clone RP23-255E6 on chromosome 11 Contains the 3' end of the Msi2h gene for Musashi homolog 2 (Drosophila), an eukaryotic translation elongation factor 2 (Eef2) pseudogene and a ribosomal protein L35a (Rpl35a) pseudogene, complete sequence Length = 216688 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 165298 catgcatgcatgcatgcatgct 165277 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 165283 catgcatgcatgcatgcatgc 165303 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 165302 catgcatgcatgcatgcatgc 165282 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 165279 catgcatgcatgcatgcatgc 165299
>emb|AL611983.23| Mouse DNA sequence from clone RP23-467J23 on chromosome 4, complete sequence Length = 153955 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 55212 attcatgcatgcatgcatgcat 55191
>gb|AC140327.3| Mus musculus BAC clone RP24-325P20 from 6, complete sequence Length = 154692 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 218 tgcatgcatgcatgcatgctgc 239 |||||||||||||||||||||| Sbjct: 105703 tgcatgcatgcatgcatgctgc 105724
>gb|AC122444.4| Mus musculus BAC clone RP24-232I9 from 9, complete sequence Length = 184253 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 120517 attcatgcatgcatgcatgcat 120496
>gb|AC154234.1| Mus musculus BAC clone RP24-345H5 from 16, complete sequence Length = 161505 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 214 ttcatgcatgcatgcatgcatg 235 |||||||||||||||||||||| Sbjct: 113699 ttcatgcatgcatgcatgcatg 113720 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 113720 catgcatgcatgcatgcatg 113701
>gb|AC104098.5| Mus musculus BAC clone RP24-372H3 from 5, complete sequence Length = 180886 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 89476 attcatgcatgcatgcatgcat 89497 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 89472 attcattcatgcatgcatgcatgc 89495
>gb|AC153998.2| Mus musculus 6 BAC RP24-278I6 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 166019 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 14073 attcatgcatgcatgcatgcat 14094
>gb|AC139846.4| Mus musculus BAC clone RP23-385F3 from 8, complete sequence Length = 191571 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 36341 attcatgcatgcatgcatgcat 36362 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 36337 attcattcatgcatgcatgcatgc 36360
>gb|AC140415.3| Mus musculus BAC clone RP23-127A20 from 13, complete sequence Length = 221245 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 214 ttcatgcatgcatgcatgcatg 235 |||||||||||||||||||||| Sbjct: 177863 ttcatgcatgcatgcatgcatg 177842 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 177842 catgcatgcatgcatgcatg 177861
>emb|AL954325.8| Mouse DNA sequence from clone RP23-416H10 on chromosome 2, complete sequence Length = 195457 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 66473 tcatgcatgcatgcatgcatgc 66452 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 66449 catgcatgcatgcatgcatgc 66469 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 66468 catgcatgcatgcatgcatgc 66448 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 66453 catgcatgcatgcatgcatg 66472
>emb|CR956393.14| Pig DNA sequence from clone CH242-163M14 on chromosome 17, complete sequence Length = 195684 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 95693 tcatgcatgcatgcatgcatgc 95672 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 95669 catgcatgcatgcatgcatgc 95689 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 95688 catgcatgcatgcatgcatgc 95668 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 95673 catgcatgcatgcatgcatg 95692 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 95666 atgcatgcatgcatgcatgc 95685
>gb|AC024913.33| Mus musculus BAC Clone 402k12 RPCI-23, complete sequence Length = 197831 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 124600 catgcatgcatgcatgcatgct 124579 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 124593 catgcatgcatgcatgcatgc 124613 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 124612 catgcatgcatgcatgcatgc 124592 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 124589 catgcatgcatgcatgcatgc 124609 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 124608 catgcatgcatgcatgcatgc 124588 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 124585 catgcatgcatgcatgcatgc 124605 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 124604 catgcatgcatgcatgcatgc 124584 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 124581 catgcatgcatgcatgcatgc 124601
>gb|U18671.1|HSU18671 Human Stat2 gene, complete cds Length = 18648 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgctg 238 |||||||||||||||||||||| Sbjct: 8302 atgcatgcatgcatgcatgctg 8281
>gb|AC151918.2| Phaeodactylum tricornutum clone JGIAHOK-13P10, complete sequence Length = 37061 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 16425 attcatgcatgcatgcatgcat 16446
>gb|AC132909.14| Mus musculus chromosome 1, clone RP24-298H1, complete sequence Length = 185140 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 148181 catgcatgcatgcatgcatgct 148202 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 148200 catgcatgcatgcatgcatgc 148180 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 148178 atgcatgcatgcatgcatgc 148197
>emb|AL928653.4| Mouse DNA sequence from clone RP23-410F9 on chromosome 2, complete sequence Length = 72045 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgct 237 |||||||||||||||||||||| Sbjct: 7193 catgcatgcatgcatgcatgct 7214 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 7212 catgcatgcatgcatgcatg 7193
>emb|AL627184.18| Mouse DNA sequence from clone RP23-125F21 on chromosome 4, complete sequence Length = 152069 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 tcatgcatgcatgcatgcatgc 236 |||||||||||||||||||||| Sbjct: 43489 tcatgcatgcatgcatgcatgc 43510 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 43512 atgcatgcatgcatgcatgc 43493 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 43509 catgcatgcatgcatgcatg 43490
>emb|AL807755.7| Mouse DNA sequence from clone RP23-394N20 on chromosome X, complete sequence Length = 203068 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Minus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 74753 attcatgcatgcatgcatgcat 74732
>emb|AL691419.10| Mouse DNA sequence from clone RP23-95I4 on chromosome 3, complete sequence Length = 249405 Score = 44.1 bits (22), Expect = 0.62 Identities = 22/22 (100%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcat 234 |||||||||||||||||||||| Sbjct: 158182 attcatgcatgcatgcatgcat 158203 Score = 40.1 bits (20), Expect = 9.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 213 attcatgcatgcatgcatgcatgc 236 |||||| ||||||||||||||||| Sbjct: 158178 attcattcatgcatgcatgcatgc 158201
>gb|BC039085.1| Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 11, mRNA (cDNA clone IMAGE:3850196), complete cds Length = 4106 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 214 ttcatgcatgcatgcatgcat 234 ||||||||||||||||||||| Sbjct: 4085 ttcatgcatgcatgcatgcat 4065
>gb|AC153802.1| Mus musculus 6 NOVECTOR RP24-79H20 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 189471 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 99675 catgcatgcatgcatgcatgc 99695 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 99694 catgcatgcatgcatgcatgc 99674
>gb|AC164069.9| Mus musculus chromosome 15, clone RP23-422H17, complete sequence Length = 216364 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 59400 catgcatgcatgcatgcatgc 59420 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 59419 catgcatgcatgcatgcatgc 59399 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 59396 catgcatgcatgcatgcatgc 59416 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 59415 catgcatgcatgcatgcatgc 59395 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 59392 catgcatgcatgcatgcatgc 59412 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 59422 atgcatgcatgcatgcatgc 59403 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 59411 catgcatgcatgcatgcatg 59392
>gb|AY779455.1| Eimeria maxima clone USDA-EM-6-8 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 324 catgcatgcatgcatgcatgc 344 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 343 catgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319
>gb|AY779452.1| Eimeria maxima clone USDA-EM-6-47 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 324 catgcatgcatgcatgcatgc 344 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 343 catgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319
>gb|AY779451.1| Eimeria maxima clone USDA-EM-6-40 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779450.1| Eimeria maxima clone USDA-EM-6-39 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779448.1| Eimeria maxima clone USDA-EM-6-36 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779447.1| Eimeria maxima clone USDA-EM-6-35 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779445.1| Eimeria maxima clone USDA-EM-6-31 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 951 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 306 catgcatgcatgcatgcatgc 326 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 325 catgcatgcatgcatgcatgc 305 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 302 catgcatgcatgcatgcatgc 322 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 321 catgcatgcatgcatgcatgc 301
>gb|AY779444.1| Eimeria maxima clone USDA-EM-6-3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 973 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 310 catgcatgcatgcatgcatgc 330 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 329 catgcatgcatgcatgcatgc 309 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 306 catgcatgcatgcatgcatgc 326 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 325 catgcatgcatgcatgcatgc 305
>gb|AY779442.1| Eimeria maxima clone USDA-EM-6-21 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 950 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779439.1| Eimeria maxima clone USDA-EM-6-18 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 324 catgcatgcatgcatgcatgc 344 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 343 catgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319
>gb|AY779437.1| Eimeria maxima clone USDA-EM-6-16 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779436.1| Eimeria maxima clone USDA-EM-6-13 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779433.1| Eimeria maxima clone USDA-EM-5-43 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 968 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 324 catgcatgcatgcatgcatgc 344 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 343 catgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319
>gb|AY779429.1| Eimeria maxima clone USDA-EM-5-36 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779427.1| Eimeria maxima clone USDA-EM-5-10 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779425.1| Eimeria maxima clone USDA-EM-4-38 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 971 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779421.1| Eimeria maxima clone USDA-EM-4-16 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 324 catgcatgcatgcatgcatgc 344 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 343 catgcatgcatgcatgcatgc 323 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319
>gb|AY779417.1| Eimeria maxima clone USDA-EM-3-56 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779416.1| Eimeria maxima clone USDA-EM-3-55 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779415.1| Eimeria maxima clone USDA-EM-3-54 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 973 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 310 catgcatgcatgcatgcatgc 330 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 329 catgcatgcatgcatgcatgc 309 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 306 catgcatgcatgcatgcatgc 326 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 325 catgcatgcatgcatgcatgc 305
>gb|AY779413.1| Eimeria maxima clone USDA-EM-3-50 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779412.1| Eimeria maxima clone USDA-EM-3-49 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779410.1| Eimeria maxima clone USDA-EM-3-2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779408.1| Eimeria maxima clone USDA-EM-3-12 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779403.1| Eimeria maxima clone USDA-EM-2-43 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 951 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779399.1| Eimeria maxima clone USDA-EM-2-115 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 969 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 320 catgcatgcatgcatgcatgc 340 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 339 catgcatgcatgcatgcatgc 319 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779396.1| Eimeria maxima clone USDA-EM-2-1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 950 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AY779390.1| Eimeria maxima clone USDA-EM-1-3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 950 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 359 catgcatgcatgcatgcatgc 379 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 378 catgcatgcatgcatgcatgc 358 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 356 atgcatgcatgcatgcatgc 375
>gb|AC167963.5| Mus musculus chromosome 1, clone RP24-171A4, complete sequence Length = 172954 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 214 ttcatgcatgcatgcatgcat 234 ||||||||||||||||||||| Sbjct: 37006 ttcatgcatgcatgcatgcat 37026
>gb|AC130671.7| Mus musculus chromosome 15, clone RP24-90K19, complete sequence Length = 205646 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 121133 catgcatgcatgcatgcatgc 121153 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 121152 catgcatgcatgcatgcatgc 121132
>gb|AC124333.13| Mus musculus chromosome 1, clone RP24-511E9, complete sequence Length = 185857 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 76846 catgcatgcatgcatgcatgc 76866 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 76865 catgcatgcatgcatgcatgc 76845 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 76842 catgcatgcatgcatgcatgc 76862 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 76861 catgcatgcatgcatgcatg 76842
>gb|AC110512.13| Mus musculus chromosome 15, clone RP24-134E9, complete sequence Length = 163319 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 86401 catgcatgcatgcatgcatgc 86381 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 86382 catgcatgcatgcatgcatg 86401
>gb|AC163684.5| Mus musculus BAC clone RP23-8N10 from chromosome 13, complete sequence Length = 234717 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 170191 catgcatgcatgcatgcatgc 170211 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 170210 catgcatgcatgcatgcatg 170191
>gb|AC151980.3| Mus musculus BAC clone RP24-83M3 from chromosome 8, complete sequence Length = 253457 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 9196 catgcatgcatgcatgcatgc 9176 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 9173 catgcatgcatgcatgcatgc 9193 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 9192 catgcatgcatgcatgcatgc 9172 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 9177 catgcatgcatgcatgcatg 9196 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 9170 atgcatgcatgcatgcatgc 9189
>gb|AC168117.2| Mus musculus BAC clone RP23-461G13 from chromosome 17, complete sequence Length = 169205 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 218 tgcatgcatgcatgcatgctg 238 ||||||||||||||||||||| Sbjct: 89495 tgcatgcatgcatgcatgctg 89475
>gb|AC166158.3| Mus musculus BAC clone RP24-244P14 from chromosome 1, complete sequence Length = 170234 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 34631 catgcatgcatgcatgcatgc 34651 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 34650 catgcatgcatgcatgcatgc 34630 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 34653 atgcatgcatgcatgcatgc 34634
>gb|AC167971.3| Mus musculus BAC clone RP24-439I22 from chromosome 7, complete sequence Length = 198057 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 71263 catgcatgcatgcatgcatgc 71243 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 71244 catgcatgcatgcatgcatg 71263 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 71241 atgcatgcatgcatgcatgc 71260
>gb|AC110214.7| Mus musculus chromosome 8, clone RP24-485L5, complete sequence Length = 213387 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 145851 catgcatgcatgcatgcatgc 145871 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 145873 atgcatgcatgcatgcatgc 145854 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 145870 catgcatgcatgcatgcatg 145851
>gb|DP000017.1| Sus scrofa target 1 genomic scaffold Length = 1471440 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 907464 catgcatgcatgcatgcatgc 907484 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 907483 catgcatgcatgcatgcatg 907464
>gb|AC116853.12| Mus musculus chromosome 1, clone RP24-400M20, complete sequence Length = 188514 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 94247 catgcatgcatgcatgcatgc 94227 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 94228 catgcatgcatgcatgcatg 94247 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 94225 atgcatgcatgcatgcatgc 94244
>gb|AC148611.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1007D10, complete sequence Length = 153366 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 107100 catgcatgcatgcatgcatgc 107120 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 107122 atgcatgcatgcatgcatgc 107103 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 107119 catgcatgcatgcatgcatg 107100
>gb|AC104743.28| Mus musculus chromosome 6, clone RP23-27D8, complete sequence Length = 218391 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 108477 catgcatgcatgcatgcatgc 108497 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 108496 catgcatgcatgcatgcatg 108477
>gb|AF405701.1| Synthetic construct legume box RY repeat motif sequence Length = 82 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 70 catgcatgcatgcatgcatgc 50 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 47 catgcatgcatgcatgcatgc 67 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 66 catgcatgcatgcatgcatgc 46 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 43 catgcatgcatgcatgcatgc 63 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 62 catgcatgcatgcatgcatgc 42 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 39 catgcatgcatgcatgcatgc 59 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 58 catgcatgcatgcatgcatgc 38 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 35 catgcatgcatgcatgcatgc 55 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 54 catgcatgcatgcatgcatgc 34 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 31 catgcatgcatgcatgcatgc 51 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 50 catgcatgcatgcatgcatgc 30 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 51 catgcatgcatgcatgcatg 70
>gb|AY024272.1| Oryza sativa microsatellite MRG6597 containing (TGCA)X8, closest to marker RM132, genomic sequence Length = 232 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 111 catgcatgcatgcatgcatgc 131 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 130 catgcatgcatgcatgcatgc 110 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 107 catgcatgcatgcatgcatgc 127 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 126 catgcatgcatgcatgcatgc 106 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 103 catgcatgcatgcatgcatgc 123 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 122 catgcatgcatgcatgcatgc 102
>gb|AY024014.1| Oryza sativa microsatellite MRG6339 containing (CATG)X6, closest to marker Y6854L, genomic sequence Length = 224 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 124 catgcatgcatgcatgcatgc 104 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 101 catgcatgcatgcatgcatgc 121 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 105 catgcatgcatgcatgcatg 124 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 120 catgcatgcatgcatgcatg 101
>gb|AC145381.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0024K17 map near S16403, complete sequence Length = 172238 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 30967 catgcatgcatgcatgcatgc 30987 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 30986 catgcatgcatgcatgcatg 30967
>gb|AY258809.1| Xiphophorus maculatus microsatellite Msc018 sequence Length = 724 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 216 catgcatgcatgcatgcatgc 236 ||||||||||||||||||||| Sbjct: 472 catgcatgcatgcatgcatgc 492 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 atgcatgcatgcatgcatgc 236 |||||||||||||||||||| Sbjct: 494 atgcatgcatgcatgcatgc 475 Score = 40.1 bits (20), Expect = 9.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 catgcatgcatgcatgcatg 235 |||||||||||||||||||| Sbjct: 491 catgcatgcatgcatgcatg 472 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,963,607 Number of Sequences: 3902068 Number of extensions: 4963607 Number of successful extensions: 146263 Number of sequences better than 10.0: 837 Number of HSP's better than 10.0 without gapping: 878 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 129846 Number of HSP's gapped (non-prelim): 13725 length of query: 705 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 682 effective length of database: 17,143,297,704 effective search space: 11691729034128 effective search space used: 11691729034128 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)