ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal1m20
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 315 5e-83
2emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 307 1e-80
3emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 305 5e-80
4emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 299 3e-78
5gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 299 3e-78
6gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 250 3e-63
7emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 222 6e-55
8emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 214 1e-52
9emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 206 3e-50
10emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 206 3e-50
11gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid... 202 5e-49
12gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi... 202 5e-49
13gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi... 202 5e-49
14gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m... 143 4e-31
15gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 143 4e-31
16gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 143 4e-31
17gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid... 135 1e-28
18gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome... 119 6e-24
19dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 119 6e-24
20dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 6e-24
21dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 6e-24
22gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 119 6e-24
23dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 115 1e-22
24emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 115 1e-22
25dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
26gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 115 1e-22
27emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 115 1e-22
28gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) m... 111 2e-21
29gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 111 2e-21
30emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 111 2e-21
31gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran... 107 2e-20
32emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein 107 2e-20
33dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 2e-20
34dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 2e-20
35emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa... 107 2e-20
36gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m... 107 2e-20
37gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I... 100 6e-18
38gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT I... 100 6e-18
39emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA 96 9e-17
40emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 96 9e-17
41gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran... 88 2e-14
42emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 88 2e-14
43emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp... 88 2e-14
44emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA 88 2e-14
45emb|X71667.1|SVLTP1 S.vulgare ltp1 gene 88 2e-14
46emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 88 2e-14
47dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 2e-14
48dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 2e-14
49gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I... 88 2e-14
50gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4)... 86 9e-14
51emb|X71668.1|SVLTP2 S.vulgare ltp2 gene 84 3e-13
52dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
53dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 84 3e-13
54gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,... 80 5e-12
55gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA... 80 5e-12
56gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf... 80 5e-12
57gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe... 80 5e-12
58gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf... 80 5e-12
59gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi... 80 5e-12
60gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip... 80 5e-12
61gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf... 80 5e-12
62gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe... 80 5e-12
63gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf... 80 5e-12
64gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe... 80 5e-12
65gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe... 80 5e-12
66gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe... 80 5e-12
67gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf... 80 5e-12
68gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf... 80 5e-12
69gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe... 80 5e-12
70gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf... 80 5e-12
71gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf... 80 5e-12
72gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi... 80 5e-12
73gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi... 80 5e-12
74gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi... 80 5e-12
75gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol... 80 5e-12
76gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi... 80 5e-12
77gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip... 80 5e-12
78gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip... 80 5e-12
79gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi... 80 5e-12
80gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi... 80 5e-12
81gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip... 80 5e-12
82gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip... 80 5e-12
83gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip... 80 5e-12
84dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 2e-11
85dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 8e-11
86dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 8e-11
87dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 8e-11
88dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 8e-11
89gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence 72 1e-09
90emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 72 1e-09
91gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs... 72 1e-09
92gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe... 72 1e-09
93gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi... 72 1e-09
94gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi... 72 1e-09
95gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi... 72 1e-09
96gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol... 72 1e-09
97gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip... 72 1e-09
98gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip... 72 1e-09
99gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip... 72 1e-09
100gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip... 72 1e-09
101gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip... 72 1e-09
102gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol... 72 1e-09
103gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip... 72 1e-09
104gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3... 72 1e-09
105gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co... 72 1e-09
106gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA,... 68 2e-08
107gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip... 64 3e-07
108gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholip... 64 3e-07
109dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfe... 62 1e-06
110gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid... 58 2e-05
111gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein... 46 0.075
112gb|AC161418.4| Mus musculus BAC clone RP23-325K2 from chromosome... 42 1.2
113dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
114dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
115dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
116dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.2
117dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.2
118dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.2
119dbj|AK100917.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.2
120gb|AC132475.4| Mus musculus BAC clone RP23-114P16 from 3, comple... 42 1.2
121gb|AC005222.1| Homo sapiens chromosome 16, cosmid clone RT163 (L... 40 4.6
122emb|AL121777.39|HSJ1057D4 Human DNA sequence from clone RP5-1057... 40 4.6
123gb|AC012676.5| Homo sapiens chromosome 16 clone RP11-295D4, comp... 40 4.6
124gb|AE004829.1| Pseudomonas aeruginosa PAO1, section 390 of 529 o... 40 4.6
125dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.6
126dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.6
127dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.6
128dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.6
129dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.6
130dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.6
131gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein... 40 4.6 
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  315 bits (159), Expect = 5e-83
 Identities = 172/177 (97%)
 Strand = Plus / Minus

                                                                       
Query: 172 agtggttgatcagnnaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 231
           |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 357

                                                                       
Query: 232 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 291
           |||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 356 gacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgct 297

                                                                    
Query: 292 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccag 348
           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 296 cttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccag 240
to top
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score =  307 bits (155), Expect = 1e-80
 Identities = 171/177 (96%)
 Strand = Plus / Minus

                                                                        
Query: 172  agtggttgatcagnnaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 231
            |||||| ||||||  |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1386 agtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 1327

                                                                        
Query: 232  gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 291
            ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 1326 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 1267

                                                                     
Query: 292  cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccag 348
            ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1266 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 1210
to top
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score =  305 bits (154), Expect = 5e-80
 Identities = 170/176 (96%)
 Strand = Plus / Minus

                                                                       
Query: 172 agtggttgatcagnnaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 231
           |||||| ||||||  |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 371 agtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 312

                                                                       
Query: 232 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 291
           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 311 gacgccgcacatggaggggatgccggcggccttgccagcgtttagcccacccgcagcgct 252

                                                                   
Query: 292 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggcca 347
           |||||||||||||||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 251 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccggcca 196
to top
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score =  299 bits (151), Expect = 3e-78
 Identities = 170/177 (96%)
 Strand = Plus / Minus

                                                                        
Query: 172  agtggttgatcagnnaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 231
            |||||||||||||  ||||||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 1021 agtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgct 962

                                                                        
Query: 232  gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 291
            ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 961  gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 902

                                                                     
Query: 292  cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccag 348
            ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 901  cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 845
to top
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score =  299 bits (151), Expect = 3e-78
 Identities = 170/177 (96%)
 Strand = Plus / Minus

                                                                        
Query: 172  agtggttgatcagnnaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 231
            |||||||||||||  ||||||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 2417 agtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgct 2358

                                                                        
Query: 232  gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 291
            ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 2357 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 2298

                                                                     
Query: 292  cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccag 348
            ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 2297 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 2241
to top
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score =  250 bits (126), Expect = 3e-63
 Identities = 163/176 (92%)
 Strand = Plus / Minus

                                                                       
Query: 172 agtggttgatcagnnaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 231
           |||||| ||||||  ||||||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 442 agtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgct 383

                                                                       
Query: 232 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 291
           |||||||||| ||||||||||||||||||||||||||||||| | |||| | ||||||||
Sbjct: 382 gacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgct 323

                                                                   
Query: 292 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggcca 347
           |||||||||||||||| ||||||||||||||||||||||||| || ||||||||||
Sbjct: 322 cttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggcca 267
to top
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score =  222 bits (112), Expect = 6e-55
 Identities = 146/158 (92%)
 Strand = Plus / Minus

                                                                        
Query: 179  gatcagnnaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 238
            ||||||  |||||||||||||||||| |||| ||||||||||||||||||||| ||||||
Sbjct: 1619 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccg 1560

                                                                        
Query: 239  cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 298
            ||| | | ||||||||||||||||||||||||||| |||||| | |||||||||||||||
Sbjct: 1559 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgatg 1500

                                                  
Query: 299  cacttgcacgccgcttgcttgtcagcggtgctctgggc 336
            ||||||||||||||||||||||||||||||||| ||||
Sbjct: 1499 cacttgcacgccgcttgcttgtcagcggtgctccgggc 1462
to top
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score =  214 bits (108), Expect = 1e-52
 Identities = 145/158 (91%)
 Strand = Plus / Minus

                                                                       
Query: 179 gatcagnnaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 238
           ||||||  |||||||||||||||||| |||| |||||||||||| |||||||| ||||||
Sbjct: 315 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaagggacgctaacgccg 256

                                                                       
Query: 239 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 298
           ||| | | ||||||||||||||||||||||||||| |||||| | |||||||||||||||
Sbjct: 255 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgatg 196

                                                 
Query: 299 cacttgcacgccgcttgcttgtcagcggtgctctgggc 336
           ||||||||||||||||||||||||||||||||| ||||
Sbjct: 195 cacttgcacgccgcttgcttgtcagcggtgctccgggc 158
to top
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score =  206 bits (104), Expect = 3e-50
 Identities = 144/158 (91%)
 Strand = Plus / Minus

                                                                       
Query: 179 gatcagnnaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 238
           ||||||  |||||||||||||||||| |||| ||||||||||||||||| ||| ||||||
Sbjct: 416 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggatgctaacgccg 357

                                                                       
Query: 239 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 298
           ||| | | ||||||||||||||||||||||||||| |||||| | |||||||||||||| 
Sbjct: 356 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgata 297

                                                 
Query: 299 cacttgcacgccgcttgcttgtcagcggtgctctgggc 336
           ||||||||||||||||||||||||||||||||| ||||
Sbjct: 296 cacttgcacgccgcttgcttgtcagcggtgctccgggc 259
to top
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score =  206 bits (104), Expect = 3e-50
 Identities = 144/158 (91%)
 Strand = Plus / Minus

                                                                        
Query: 179  gatcagnnaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 238
            ||||||  |||||||||||||||||| |||| ||||||||||||||||||||| ||||||
Sbjct: 1607 gatcagtgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccg 1548

                                                                        
Query: 239  cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 298
            ||| | | |||||||||||||||||||||||| || |||||| | |||||||||||||||
Sbjct: 1547 cactttgtggggatgccggcggccttgccagcattgagcccagcagcagcgctcttgatg 1488

                                                  
Query: 299  cacttgcacgccgcttgcttgtcagcggtgctctgggc 336
            ||||||||| ||||||||||||||||||||||| ||||
Sbjct: 1487 cacttgcacaccgcttgcttgtcagcggtgctccgggc 1450
to top
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  202 bits (102), Expect = 5e-49
 Identities = 138/150 (92%)
 Strand = Plus / Minus

                                                                       
Query: 187 aatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatgga 246
           |||||||||||||||||| |||| ||||||||||||||||||||| ||||||||| | | 
Sbjct: 342 aatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgcactttgt 283

                                                                       
Query: 247 ggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgca 306
           ||||||||| ||||||||||||||||| |||||| | |||||||||||||| ||||||||
Sbjct: 282 ggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgatacacttgca 223

                                         
Query: 307 cgccgcttgcttgtcagcggtgctctgggc 336
           ||||||||||||||||||||||||| ||||
Sbjct: 222 cgccgcttgcttgtcagcggtgctccgggc 193
to top
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  202 bits (102), Expect = 5e-49
 Identities = 138/150 (92%)
 Strand = Plus / Minus

                                                                       
Query: 187 aatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatgga 246
           |||||||||||||||||| |||| ||||||||||||||||||||| ||||||||| | | 
Sbjct: 342 aatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgcactttgt 283

                                                                       
Query: 247 ggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgca 306
           ||||||||| ||||||||||||||||| |||||| | |||||||||||||| ||||||||
Sbjct: 282 ggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgatacacttgca 223

                                         
Query: 307 cgccgcttgcttgtcagcggtgctctgggc 336
           ||||||||||||||||||||||||| ||||
Sbjct: 222 cgccgcttgcttgtcagcggtgctccgggc 193
to top
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  202 bits (102), Expect = 5e-49
 Identities = 147/162 (90%)
 Strand = Plus / Minus

                                                                       
Query: 187 aatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatgga 246
           ||||||||||||||| ||||| | ||| ||||||||||||| ||||||||||||| ||||
Sbjct: 342 aatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgcacttgga 283

                                                                       
Query: 247 ggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgca 306
           ||||||||| |||||||| |||||||| |||||||| ||||| ||||| |||||||||||
Sbjct: 282 ggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgcacttgca 223

                                                     
Query: 307 cgccgcttgcttgtcagcggtgctctgggcagcgccggccag 348
           ||||||||||||||||||||||||| | || |||||||||||
Sbjct: 222 cgccgcttgcttgtcagcggtgctccgcgctgcgccggccag 181
to top
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score =  143 bits (72), Expect = 4e-31
 Identities = 126/144 (87%)
 Strand = Plus / Minus

                                                                       
Query: 188 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 247
           |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 248 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 307
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                   
Query: 308 gccgcttgcttgtcagcggtgctc 331
           |||||||||||||| |||||||||
Sbjct: 221 gccgcttgcttgtcggcggtgctc 198
to top
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  143 bits (72), Expect = 4e-31
 Identities = 126/144 (87%)
 Strand = Plus / Minus

                                                                        
Query: 188  atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 247
            |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 3197 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 3138

                                                                        
Query: 248  gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 307
            ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 3137 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 3078

                                    
Query: 308  gccgcttgcttgtcagcggtgctc 331
            |||||||||||||| |||||||||
Sbjct: 3077 gccgcttgcttgtcggcggtgctc 3054



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 80   ctcacatggagatcagatcagagcgtttattcatatatat 119
            ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 3341 ctcacatggagatcatatcagagcatttattcatgtatat 3302
to top
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  143 bits (72), Expect = 4e-31
 Identities = 126/144 (87%)
 Strand = Plus / Minus

                                                                       
Query: 188 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 247
           |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 401 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 342

                                                                       
Query: 248 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 307
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 341 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 282

                                   
Query: 308 gccgcttgcttgtcagcggtgctc 331
           |||||||||||||| |||||||||
Sbjct: 281 gccgcttgcttgtcggcggtgctc 258



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 80  ctcacatggagatcagatcagagcgtttattcatatatat 119
           ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 545 ctcacatggagatcatatcagagcatttattcatgtatat 506
to top
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  135 bits (68), Expect = 1e-28
 Identities = 125/144 (86%)
 Strand = Plus / Minus

                                                                       
Query: 188 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 247
           ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 248 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 307
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                   
Query: 308 gccgcttgcttgtcagcggtgctc 331
           |||||||||||||| |||||||||
Sbjct: 221 gccgcttgcttgtcggcggtgctc 198
to top
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score =  119 bits (60), Expect = 6e-24
 Identities = 81/88 (92%)
 Strand = Plus / Plus

                                                                         
Query: 192   tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 251
             |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080

                                         
Query: 252   tgccggcggccttgccagcgttaagccc 279
             ||| |||||| ||||| ||||| |||||
Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  119 bits (60), Expect = 6e-24
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                            
Query: 192      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 251
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000

                                            
Query: 252      tgccggcggccttgccagcgttaagccc 279
                ||| |||||| ||||| ||||| |||||
Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972



 Score =  107 bits (54), Expect = 2e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 254    ccggcggccttgccagcgttaagccc 279
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 254    ccggcggccttgccagcgtt 273
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 254    ccggcg 259
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 226    gacgctgacgccgcacatggaggggatgccggcggc 261
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810
to top
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score =  119 bits (60), Expect = 6e-24
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                       
Query: 192 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 251
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400

                                       
Query: 252 tgccggcggccttgccagcgttaagccc 279
           ||| |||||| ||||| ||||| |||||
Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372
to top
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score =  119 bits (60), Expect = 6e-24
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                       
Query: 192 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 251
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399

                                       
Query: 252 tgccggcggccttgccagcgttaagccc 279
           ||| |||||| ||||| ||||| |||||
Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  119 bits (60), Expect = 6e-24
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                            
Query: 192      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 251
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179

                                            
Query: 252      tgccggcggccttgccagcgttaagccc 279
                ||| |||||| ||||| ||||| |||||
Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151



 Score =  107 bits (54), Expect = 2e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 254    ccggcggccttgccagcgttaagccc 279
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 254    ccggcggccttgccagcgtt 273
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 254    ccggcg 259
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 226    gacgctgacgccgcacatggaggggatgccggcggc 261
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score =  115 bits (58), Expect = 1e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 254    ccggcggccttgccagcgttaagccc 279
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 254    ccggcggccttgccagcgtt 273
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 254    ccggcg 259
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 226    gacgctgacgccgcacatggaggggatgccggcggc 261
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520
to top
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score =  115 bits (58), Expect = 1e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354

                                     
Query: 254 ccggcggccttgccagcgttaagccc 279
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
to top
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score =  115 bits (58), Expect = 1e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611

                                     
Query: 254 ccggcggccttgccagcgttaagccc 279
           | |||||| ||||| ||||| |||||
Sbjct: 610 ctggcggcgttgccggcgttgagccc 585
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  115 bits (58), Expect = 1e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 254    ccggcggccttgccagcgttaagccc 279
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 254    ccggcggccttgccagcgtt 273
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 194    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 254    ccggcg 259
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 226    gacgctgacgccgcacatggaggggatgccggcggc 261
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520
to top
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score =  115 bits (58), Expect = 1e-22
 Identities = 79/86 (91%)
 Strand = Plus / Plus

                                                                         
Query: 194   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
             |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450

                                       
Query: 254   ccggcggccttgccagcgttaagccc 279
             | |||||| ||||| ||||| |||||
Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                         
Query: 194   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577

                                 
Query: 254   ccggcggccttgccagcgtt 273
             | |||||| ||||| |||||
Sbjct: 46578 ctggcggcattgccggcgtt 46597



 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 194   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
             |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466

                   
Query: 254   ccggcg 259
             ||||||
Sbjct: 56467 ccggcg 56472



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 226   gacgctgacgccgcacatggaggggatgccggcggc 261
             |||| ||||||||||| ||  |||||||||||||||
Sbjct: 33579 gacgttgacgccgcacttgccggggatgccggcggc 33614
to top
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds
          Length = 348

 Score =  111 bits (56), Expect = 2e-21
 Identities = 122/144 (84%)
 Strand = Plus / Minus

                                                                       
Query: 188 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 247
           |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282

                                                                       
Query: 248 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 307
           || ||||| |||||||||   | ||| ||||| || ||| | ||||||| |||| |||| 
Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222

                                   
Query: 308 gccgcttgcttgtcagcggtgctc 331
           |  ||||||||||| |||||||||
Sbjct: 221 gtagcttgcttgtcggcggtgctc 198
to top
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  111 bits (56), Expect = 2e-21
 Identities = 122/144 (84%)
 Strand = Plus / Minus

                                                                       
Query: 188 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 247
           |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| |||||
Sbjct: 420 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 361

                                                                       
Query: 248 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 307
           || ||||| |||||||||   | ||| ||||| || ||| | ||||||| |||| |||| 
Sbjct: 360 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 301

                                   
Query: 308 gccgcttgcttgtcagcggtgctc 331
           |  ||||||||||| |||||||||
Sbjct: 300 gtagcttgcttgtcggcggtgctc 277



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 80  ctcacatggagatcagatcagagcgtttattcatatatat 119
           ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 550 ctcacatggagatcatatcagagcatttattcatgtatat 511
to top
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score =  111 bits (56), Expect = 2e-21
 Identities = 122/144 (84%)
 Strand = Plus / Minus

                                                                       
Query: 188 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 247
           |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| |||||
Sbjct: 361 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 302

                                                                       
Query: 248 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 307
           || ||||| |||||||||   | ||| ||||| || ||| | ||||||| |||| |||| 
Sbjct: 301 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 242

                                   
Query: 308 gccgcttgcttgtcagcggtgctc 331
           |  ||||||||||| |||||||||
Sbjct: 241 gtagcttgcttgtcggcggtgctc 218



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 80  ctcacatggagatcagatcagagcgtttattcatatatat 119
           ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 491 ctcacatggagatcatatcagagcatttattcatgtatat 452
to top
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score =  107 bits (54), Expect = 2e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367

                                     
Query: 254 ccggcggccttgccagcgttaagccc 279
           | |||||| ||||| ||||| |||||
Sbjct: 366 ctggcggcgttgccggcgttgagccc 341
to top
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score =  107 bits (54), Expect = 2e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 254 ccggcggccttgccagcgttaagccc 279
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
to top
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score =  107 bits (54), Expect = 2e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                        
Query: 194  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
            |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386

                                      
Query: 254  ccggcggccttgccagcgttaagccc 279
            | |||||| ||||| ||||| |||||
Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360
to top
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score =  107 bits (54), Expect = 2e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263

                                     
Query: 254 ccggcggccttgccagcgttaagccc 279
           | |||||| ||||| ||||| |||||
Sbjct: 262 ctggcggcgttgccggcgttgagccc 237
to top
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score =  107 bits (54), Expect = 2e-20
 Identities = 78/86 (90%)
 Strand = Plus / Plus

                                                                         
Query: 194   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
             |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590

                                       
Query: 254   ccggcggccttgccagcgttaagccc 279
             | |||||| ||||| ||||| |||||
Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                         
Query: 194   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267

                                 
Query: 254   ccggcggccttgccagcgtt 273
             | |||||| ||||| |||||
Sbjct: 50268 ctggcggcattgccggcgtt 50287



 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 194   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
             |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562

                   
Query: 254   ccggcg 259
             ||||||
Sbjct: 63563 ccggcg 63568



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 226   gacgctgacgccgcacatggaggggatgccggcggc 261
             |||| ||||||||||| ||  |||||||||||||||
Sbjct: 28127 gacgttgacgccgcacttgccggggatgccggcggc 28162
to top
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score =  107 bits (54), Expect = 2e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 254 ccggcggccttgccagcgttaagccc 279
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
to top
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           ||||||| || |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314

                                     
Query: 254 ccggcggccttgccagcgttaagccc 279
           | |||||| ||||| ||||| |||||
Sbjct: 313 ctggcggcgttgccggcgttgagccc 288
to top
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds
          Length = 805

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 78/86 (90%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| |||||||||||||| |||||| ||||||||||||||| |||||||||||
Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354

                                     
Query: 254 ccggcggccttgccagcgttaagccc 279
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
to top
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA
          Length = 660

 Score = 95.6 bits (48), Expect = 9e-17
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 289 gctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccag 348
           |||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226
to top
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score = 95.6 bits (48), Expect = 9e-17
 Identities = 121/144 (84%), Gaps = 1/144 (0%)
 Strand = Plus / Minus

                                                                       
Query: 188 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 247
           |||||||||||||||||    |||||||| | |||||||||||||||||||||| |||||
Sbjct: 411 atcttagagcagtcgacactggcgctgatcgtgtaggggacgctgacgccgcacctggag 352

                                                                       
Query: 248 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 307
           |||||||| |||||| |||| |||||   | | || ||| | ||||||| |||| |||||
Sbjct: 351 gggatgcctgcggccctgccggcgttgtacgcgccggca-cactcttgaggcacctgcac 293

                                   
Query: 308 gccgcttgcttgtcagcggtgctc 331
           |  ||||||||||| |||||||||
Sbjct: 292 gtagcttgcttgtcggcggtgctc 269
to top
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 409 ctggcggcattgccggcgtt 390
to top
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 188 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 247
           ||||| |||||||||||    |||||||| | |||||||||||||||||||||| |||||
Sbjct: 343 atcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgccgcacctggag 284

                                                                       
Query: 248 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 307
           |||||||| |||||| |||| |||||   | | || ||  | ||||||| |||| |||||
Sbjct: 283 gggatgcctgcggccctgccggcgttgtacgcgccggcgacactcttgaggcacctgcac 224

                                   
Query: 308 gccgcttgcttgtcagcggtgctc 331
           |  ||||||||||| |||||||||
Sbjct: 223 gtagcttgcttgtcggcggtgctc 200
to top
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 641 ctggcggcattgccggcgtt 622
to top
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 234 ctggcggcgttgccggcgtt 215
to top
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 937 ctggcggcgttgccggcgtt 918
to top
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 271 ctggcggcattgccggcgtt 252
to top
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 594 ctggcggcattgccggcgtt 575
to top
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 377 ctggcggcattgccggcgtt 358
to top
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 359 ctggcggcattgccggcgtt 340
to top
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete
           cds
          Length = 345

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 220 gtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagcgttaagccc 279
           ||||||||||||||||| |||| ||||||||||  | |||||| ||||  | || | |||
Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250

                                                          
Query: 280 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcgg 326
           ||| ||||| ||||||||||||  ||||||||||| |||||||||||
Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcgg 203
to top
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906

                         
Query: 254 ccggcggccttgcc 267
           | ||||||||||||
Sbjct: 905 ctggcggccttgcc 892
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                            
Query: 194      gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
                |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||||
Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005

                      
Query: 254      ccggcg 259
                ||||||
Sbjct: 14437004 ccggcg 14436999



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 81       tcacatggagatcagatcaga 101
                |||||||||||||||||||||
Sbjct: 22847882 tcacatggagatcagatcaga 22847902
to top
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                         
Query: 194   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
             |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||||
Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503

                   
Query: 254   ccggcg 259
             ||||||
Sbjct: 45502 ccggcg 45497
to top
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 206 gaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttg 265
           |||| |||||||| |||||||| ||||||||||||| |||||||||||| |||||| |||
Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266

                   
Query: 266 ccagcgtt 273
           || |||||
Sbjct: 265 ccggcgtt 258
to top
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 363 ctggcggcgttgccggcgtt 344
to top
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 273 ctggcggcgttgccggcgtt 254
to top
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246
to top
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246
to top
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 374 ctggcggcgttgccggcgtt 355
to top
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 391 ctggcggcgttgccggcgtt 372
to top
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcgttgccggcgtt 335
to top
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Plus

                                                                       
Query: 211 gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagc 270
           |||||||| |||||||| ||||||||||||| |||||||||||| |||||| ||||| ||
Sbjct: 97  gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156

              
Query: 271 gtt 273
           |||
Sbjct: 157 gtt 159
to top
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371

                 
Query: 254 ccggcg 259
           ||||||
Sbjct: 370 ccggcg 365
to top
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                        
Query: 194  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
            |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457

                  
Query: 254  ccggcg 259
            ||||||
Sbjct: 3456 ccggcg 3451
to top
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373

                 
Query: 254 ccggcg 259
           ||||||
Sbjct: 372 ccggcg 367
to top
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375

                 
Query: 254 ccggcg 259
           ||||||
Sbjct: 374 ccggcg 369
to top
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 374 ctggcggc 367
to top
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 188 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 247
           ||||| |||||||||||    |||||||| | ||||||||||||||| |||||| |||||
Sbjct: 414 atcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccccgcacctggag 355

                                                                       
Query: 248 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 307
           |||||||| |||||| | || |||||   | | || ||  | ||||||| |||| |||||
Sbjct: 354 gggatgcctgcggcccttccggcgttgtacgcgccggcgacactcttgaggcacctgcac 295

                                   
Query: 308 gccgcttgcttgtcagcggtgctc 331
           |  ||||||||||| |||||||||
Sbjct: 294 gtagcttgcttgtcggcggtgctc 271
to top
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||| ||| | |||||||| ||||||||   ||||||||||| |||||||||||
Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcattgccggcgtt 335
to top
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| ||||||| |||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 356 ctggcggc 349
to top
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 281 ctggcggc 274
to top
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 380 ctggcggc 373
to top
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 393 ctggcggc 386
to top
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 395 ctggcggc 388
to top
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 393 ctggcggc 386
to top
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 254 ccggcggccttgccagcgtt 273
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 204 ctggcggc 197
to top
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 391 ctggcggc 384
to top
>gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 766

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||||| |||||| |||||||||| | |||| |||||| |||||||||||
Sbjct: 384 gagcagtcggtggaagggctgatagcgtaggggatgttgaccccgcacttggaggggatg 325

                 
Query: 254 ccggcg 259
           ||||||
Sbjct: 324 ccggcg 319
to top
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | ||||||||  ||||||| ||||||||||||| |||||||||||
Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 259 ctggcggc 252
to top
>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 686

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||| | |||||||| |||||||| ||||||||| ||| |||||||||||
Sbjct: 320 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccacacttggaggggatg 261

                   
Query: 254 ccggcggc 261
           | ||||||
Sbjct: 260 ctggcggc 253
to top
>dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfer protein
          Length = 372

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 194 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 253
           |||||||||  ||||| ||||||| ||||||||| | ||||| ||||| |||||||||||
Sbjct: 141 gagcagtcggtggaagggctgatgccgtaggggatgttgacgtcgcacttggaggggatg 82

              
Query: 254 ccg 256
           |||
Sbjct: 81  ccg 79
to top
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 211  gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 259
            ||||||||||||||||| | ||||||||||| ||  |||||||||||||
Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722
to top
>gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein (BG14) mRNA,
           complete cds
          Length = 841

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 213 tgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 259
           |||||||||||||||   ||||||||||| ||  |||||||||||||
Sbjct: 401 tgatggcgtaggggatattgacgccgcacttgctggggatgccggcg 355
to top
>gb|AC161418.4| Mus musculus BAC clone RP23-325K2 from chromosome 3, complete sequence
          Length = 202765

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 7     aaagtaaaaaacaaccatagt 27
             |||||||||||||||||||||
Sbjct: 67013 aaagtaaaaaacaaccatagt 67033
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 317      ttgtcagcggtgctctgggca 337
                |||||||||||||||||||||
Sbjct: 11569463 ttgtcagcggtgctctgggca 11569483
to top
>dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1034_C08
          Length = 154441

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 317    ttgtcagcggtgctctgggca 337
              |||||||||||||||||||||
Sbjct: 123597 ttgtcagcggtgctctgggca 123617
to top
>dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0467G09
          Length = 158204

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 317   ttgtcagcggtgctctgggca 337
             |||||||||||||||||||||
Sbjct: 29734 ttgtcagcggtgctctgggca 29754
to top
>dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0006O15
          Length = 139723

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 81    tcacatggagatcagatcaga 101
             |||||||||||||||||||||
Sbjct: 81220 tcacatggagatcagatcaga 81240
to top
>dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-B12, full
           insert sequence
          Length = 685

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 188 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 240
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
to top
>dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-H07, full
           insert sequence
          Length = 654

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 188 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 240
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
to top
>dbj|AK100917.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133E20, full
            insert sequence
          Length = 5035

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 81   tcacatggagatcagatcaga 101
            |||||||||||||||||||||
Sbjct: 4798 tcacatggagatcagatcaga 4818
to top
>gb|AC132475.4| Mus musculus BAC clone RP23-114P16 from 3, complete sequence
          Length = 215899

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 7      aaagtaaaaaacaaccatagt 27
              |||||||||||||||||||||
Sbjct: 210967 aaagtaaaaaacaaccatagt 210987
to top
>gb|AC005222.1| Homo sapiens chromosome 16, cosmid clone RT163 (LANL), complete
             sequence
          Length = 40619

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 157   gcgcccatggtgggcagtgg 176
             ||||||||||||||||||||
Sbjct: 25417 gcgcccatggtgggcagtgg 25398
to top
>emb|AL121777.39|HSJ1057D4 Human DNA sequence from clone RP5-1057D4 on chromosome 20 Contains the
             SRMP1 gene for spermidine synthase pseudogene 1, the 5'
             end of the gene for a novel protein similar to
             glucosamine-6-sulfatases (SULF2) (sulfatase 2, H-SULF2,
             KIAA1247) and a CpG island, complete sequence
          Length = 131888

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    gactcctttctccctcacat 86
             ||||||||||||||||||||
Sbjct: 88928 gactcctttctccctcacat 88909
to top
>gb|AC012676.5| Homo sapiens chromosome 16 clone RP11-295D4, complete sequence
          Length = 172071

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 157   gcgcccatggtgggcagtgg 176
             ||||||||||||||||||||
Sbjct: 84403 gcgcccatggtgggcagtgg 84384
to top
>gb|AE004829.1| Pseudomonas aeruginosa PAO1, section 390 of 529 of the complete
            genome
          Length = 10201

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 244  ggaggggatgccggcggccttgcc 267
            |||| |||||||||||||||||||
Sbjct: 4301 ggagaggatgccggcggccttgcc 4278
to top
>dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030A16, full
           insert sequence
          Length = 760

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 226 gacgctgacgccgcacatggaggggatgccggcggc 261
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 400 gacgttgacgccgcacttgccggggatgccggcggc 365
to top
>dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023041I08, full
            insert sequence
          Length = 2914

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 226  gacgctgacgccgcacatggaggggatgccggcggc 261
            |||| ||||||||||| ||  |||||||||||||||
Sbjct: 2487 gacgttgacgccgcacttgccggggatgccggcggc 2452
to top
>dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-A02, full
           insert sequence
          Length = 646

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 226 gacgctgacgccgcacatggaggggatgccggcggc 261
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359
to top
>dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D09, full
           insert sequence
          Length = 928

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 226 gacgctgacgccgcacatggaggggatgccggcggc 261
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364
to top
>dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D08, full
           insert sequence
          Length = 853

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 226 gacgctgacgccgcacatggaggggatgccggcggc 261
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359
to top
>dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F09, full
           insert sequence
          Length = 773

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 226 gacgctgacgccgcacatggaggggatgccggcggc 261
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364
to top
>gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein precursor (LTP) mRNA,
           complete cds
          Length = 650

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 220 gtaggggacgctgacgccgcacatggaggggatgccggcg 259
           |||||||| | ||||||||||| ||  |||||||||||||
Sbjct: 349 gtaggggatgttgacgccgcacttgccggggatgccggcg 310


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,533,660
Number of Sequences: 3902068
Number of extensions: 2533660
Number of successful extensions: 55968
Number of sequences better than 10.0: 131
Number of HSP's better than 10.0 without gapping: 134
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55590
Number of HSP's gapped (non-prelim): 372
length of query: 348
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 326
effective length of database: 17,147,199,772
effective search space: 5589987125672
effective search space used: 5589987125672
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top