Clone Name	rbaal1m16
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY103710.1| Zea mays PCO123562 mRNA sequence	236	5e-59
2	gb|BT016569.1| Zea mays clone Contig402 mRNA sequence	220	3e-54
3	ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predic...	170	2e-39
4	dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clon...	170	2e-39
5	ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predic...	167	4e-38
6	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	167	4e-38
7	gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str...	167	4e-38
8	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	167	4e-38
9	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	167	4e-38
10	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	167	4e-38
11	dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D...	167	4e-38
12	dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clon...	167	4e-38
13	gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome...	167	4e-38
14	ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predic...	161	2e-36
15	gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome...	161	2e-36
16	gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome...	161	2e-36
17	dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clon...	161	2e-36
18	dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clon...	161	2e-36
19	gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence	157	4e-35
20	dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, co...	157	4e-35
21	dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, co...	157	4e-35
22	dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, co...	157	4e-35
23	emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)	145	1e-31
24	gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complet...	145	1e-31
25	gb|BT016301.1| Zea mays clone Contig134 mRNA sequence	125	1e-25
26	gb|AY103585.1| Zea mays PCO123564 mRNA sequence	123	5e-25
27	gb|AY104486.1| Zea mays PCO109435 mRNA sequence	119	8e-24
28	gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence	115	1e-22
29	gb|AY109370.1| Zea mays CL2029_4 mRNA sequence	107	3e-20
30	gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds	107	3e-20
31	gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence	100	7e-18
32	emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA	94	5e-16
33	gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependen...	94	5e-16
34	dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D...	94	5e-16
35	dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clon...	94	5e-16
36	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	92	2e-15
37	emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4,...	92	2e-15
38	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	90	7e-15
39	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	90	7e-15
40	emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa...	90	7e-15
41	emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa...	90	7e-15
42	gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence	86	1e-13
43	ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA	82	2e-12
44	gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds	74	4e-10
45	emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA	74	4e-10
46	gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and ...	74	4e-10
47	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	74	4e-10
48	dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic D...	74	4e-10
49	dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic D...	74	4e-10
50	dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clon...	74	4e-10
51	dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clon...	74	4e-10
52	ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA	72	2e-09
53	dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clon...	72	2e-09
54	ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA	70	7e-09
55	gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (...	70	7e-09
56	gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosom...	70	7e-09
57	ref|NM_010436.2| Mus musculus H2A histone family, member X (H2af...	70	7e-09
58	emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X	70	7e-09
59	emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X	70	7e-09
60	gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (...	70	7e-09
61	dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells ...	70	7e-09
62	dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RI...	70	7e-09
63	dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	7e-09
64	dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	7e-09
65	dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	7e-09
66	emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112...	70	7e-09
67	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	68	3e-08
68	dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic D...	68	3e-08
69	gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome...	66	1e-07
70	gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome...	66	1e-07
71	gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic seque...	66	1e-07
72	ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA	66	1e-07
73	gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co...	66	1e-07
74	ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo...	66	1e-07
75	ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
76	ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
77	ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
78	ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
79	ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
80	ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
81	ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
82	ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
83	ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
84	ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
85	ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
86	ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone ...	66	1e-07
87	ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
88	ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
89	ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, ...	66	1e-07
90	ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, ...	66	1e-07
91	ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone ...	66	1e-07
92	gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with appar...	66	1e-07
93	emb|X94693.1|TAH2A254 T.aestivum histone H2A gene	66	1e-07
94	emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143	66	1e-07
95	emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones	66	1e-07
96	emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones	66	1e-07
97	emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)	66	1e-07
98	emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)	66	1e-07
99	gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MG...	66	1e-07
100	emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr...	66	1e-07
101	ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA	66	1e-07
102	emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr...	66	1e-07
103	emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom...	66	1e-07
104	emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr...	66	1e-07
105	emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr...	66	1e-07
106	gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MG...	66	1e-07
107	gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MG...	66	1e-07
108	dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKE...	66	1e-07
109	dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	66	1e-07
110	dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu...	66	1e-07
111	ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA	66	1e-07
112	gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, comple...	66	1e-07
113	gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365,...	66	1e-07
114	gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, ...	66	1e-07
115	gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016	66	1e-07
116	gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108	66	1e-07
117	ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA	66	1e-07
118	ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA	66	1e-07
119	ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA	66	1e-07
120	gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone...	66	1e-07
121	dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	66	1e-07
122	dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-l...	66	1e-07
123	ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (H...	66	1e-07
124	ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA	66	1e-07
125	ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA	66	1e-07
126	gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, comp...	66	1e-07
127	gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, comp...	66	1e-07
128	gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp...	66	1e-07
129	gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, comp...	66	1e-07
130	gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, comp...	66	1e-07
131	gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, comp...	66	1e-07
132	gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, comp...	66	1e-07
133	gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp...	66	1e-07
134	gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene...	66	1e-07
135	gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp...	66	1e-07
136	ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA	66	1e-07
137	dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, co...	66	1e-07
138	dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, co...	66	1e-07
139	gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent ...	66	1e-07
140	gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complet...	66	1e-07
141	gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds	66	1e-07
142	gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 ...	66	1e-07
143	gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:720558...	64	4e-07
144	ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	64	4e-07
145	ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A hist...	64	4e-07
146	emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	64	4e-07
147	ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone...	64	4e-07
148	gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	64	4e-07
149	gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	64	4e-07
150	ref|NM_021840.2| Rattus norvegicus histone 2a (H2a), mRNA	62	2e-06
151	gb|BC099140.1| Rattus norvegicus histone 2a, mRNA (cDNA clone MG...	62	2e-06
152	emb|BX063165.1|CNS09KWH Single read from an extremity of a full-...	62	2e-06
153	emb|BX063164.1|CNS09KWG Single read from an extremity of a full-...	62	2e-06
154	emb|BX040864.1|CNS093P0 Single read from an extremity of a full-...	62	2e-06
155	emb|BX019683.1|CNS08NCN Single read from an extremity of a full-...	62	2e-06
156	emb|BX016452.1|CNS08KUW Single read from an extremity of a full-...	62	2e-06
157	emb|BX016451.1|CNS08KUV Single read from an extremity of a full-...	62	2e-06
158	emb|BX009846.1|CNS08FRE Single read from an extremity of a full-...	62	2e-06
159	ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (p...	62	2e-06
160	ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020 ...	62	2e-06
161	ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 ...	62	2e-06
162	ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 ...	62	2e-06
163	emb|X14730.1|CMHIST2A Duck H2A histone gene	60	6e-06
164	emb|X02622.1|MMHISHSA Mouse gene fragment for histone H2a	60	6e-06
165	gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, comp...	60	6e-06
166	ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA	60	6e-06
167	gb|U95112.1|MCU95112 Mus caroli histone H2a pseudogene, complete...	60	6e-06
168	ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA	58	3e-05
169	ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, ...	58	3e-05
170	ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, ...	58	3e-05
171	ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, ...	58	3e-05
172	ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, ...	58	3e-05
173	ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ...	58	3e-05
174	ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro...	58	3e-05
175	ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi...	58	3e-05
176	gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC...	58	3e-05
177	gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMA...	58	3e-05
178	emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-...	58	3e-05
179	emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4...	58	3e-05
180	emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking r...	58	3e-05
181	ref|XM_694570.1| PREDICTED: Danio rerio similar to histone H2A (...	58	3e-05
182	dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKE...	58	3e-05
183	dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA...	58	3e-05
184	dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	58	3e-05
185	dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-...	58	3e-05
186	dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN ...	58	3e-05
187	dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE...	58	3e-05
188	ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA	58	3e-05
189	gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, compl...	58	3e-05
190	gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp...	58	3e-05
191	dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, comple...	58	3e-05
192	gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, ...	58	3e-05
193	gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, c...	58	3e-05
194	gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, co...	58	3e-05
195	emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr...	58	3e-05
196	gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, com...	58	3e-05
197	gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, comp...	58	3e-05
198	gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks	58	3e-05
199	gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 ...	56	1e-04
200	gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 ...	56	1e-04
201	ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	56	1e-04
202	ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone ...	56	1e-04
203	ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone ...	56	1e-04
204	ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone ...	56	1e-04
205	ref|XM_692742.1| PREDICTED: Danio rerio similar to H2A histone f...	56	1e-04
206	emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4	56	1e-04
207	gb|AY104828.1| Zea mays PCO072413 mRNA sequence	56	1e-04
208	gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	56	1e-04
209	gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone...	54	4e-04
210	emb|BX008487.1|CNS08EPN Single read from an extremity of a full-...	54	4e-04
211	ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone...	54	4e-04
212	gb|AY104826.1| Zea mays PCO099353 mRNA sequence	54	4e-04
213	gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	52	0.002
214	gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG...	52	0.002
215	ref|NM_001030332.2| Xenopus tropicalis hypothetical protein LOC5...	52	0.002
216	ref|NM_001030325.2| Xenopus tropicalis hypothetical protein LOC5...	52	0.002
217	ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA	52	0.002
218	gb|BC074601.1| Xenopus tropicalis MGC69325 protein, mRNA (cDNA c...	52	0.002
219	gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds	52	0.002
220	emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes	52	0.002
221	emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr...	52	0.002
222	ref|NM_001004821.1| Xenopus tropicalis MGC69325 protein (MGC6932...	52	0.002
223	gb|AY158921.1| Mus musculus histone protein Hist1h2aa gene, comp...	52	0.002
224	emb|CR762147.2| Xenopus tropicalis finished cDNA, clone TGas072e19	52	0.002
225	emb|CR761789.2| Xenopus tropicalis finished cDNA, clone TGas125k04	52	0.002
226	ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H...	50	0.006
227	gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	50	0.006
228	gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC...	50	0.006
229	ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, ...	50	0.006
230	ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA	50	0.006
231	ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone ...	50	0.006
232	emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr...	50	0.006
233	ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA	50	0.006
234	ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (R...	50	0.006
235	ref|XM_683938.1| PREDICTED: Danio rerio similar to histone H2A (...	50	0.006
236	ref|XM_694138.1| PREDICTED: Danio rerio similar to histone H2A (...	50	0.006
237	ref|XM_688696.1| PREDICTED: Danio rerio similar to histone H2A (...	50	0.006
238	gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple...	50	0.006
239	gb|BC092032.1| Xenopus laevis hypothetical protein MGC83508, mRN...	50	0.006
240	gb|BC093343.1| Danio rerio MID1 interacting protein 1, mRNA (cDN...	50	0.006
241	dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, comple...	50	0.006
242	gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, co...	50	0.006
243	emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ...	50	0.006
244	gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complet...	50	0.006
245	gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complet...	50	0.006
246	ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H...	48	0.025
247	ref|XM_527249.1| PREDICTED: Pan troglodytes similar to H2A histo...	48	0.025
248	ref|NM_006632.1| Homo sapiens solute carrier family 17 (sodium p...	48	0.025
249	ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA	48	0.025
250	gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339	48	0.025
251	ref|XM_870470.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	48	0.025
252	gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (...	48	0.025
253	gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone I...	48	0.025
254	ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	48	0.025
255	ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g ...	48	0.025
256	ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone ...	48	0.025
257	ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone ...	48	0.025
258	ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone ...	48	0.025
259	ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h...	48	0.025
260	gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds	48	0.025
261	emb|CT025304.2| Xenopus tropicalis finished cDNA, clone TNeu074k04	48	0.025
262	ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone ...	48	0.025
263	ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone ...	48	0.025
264	ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone ...	48	0.025
265	ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AF...	48	0.025
266	emb|AL138726.12| Human DNA sequence from clone RP1-139G21 on chr...	48	0.025
267	emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A ...	48	0.025
268	emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a...	48	0.025
269	emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes	48	0.025
270	emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X	48	0.025
271	emb|CR457079.1| Homo sapiens full open reading frame cDNA clone ...	48	0.025
272	gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (...	48	0.025
273	emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblas...	48	0.025
274	gb|AF098457.1|AF098457 Homo sapiens H2A/t pseudogene, complete s...	48	0.025
275	gb|U90545.1|HSU90545 Human sodium phosphate transporter (NPT4) m...	48	0.025
276	ref|XM_693555.1| PREDICTED: Danio rerio similar to histone H2A (...	48	0.025
277	ref|XM_693436.1| PREDICTED: Danio rerio similar to histone H2A (...	48	0.025
278	dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-...	48	0.025
279	dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-...	48	0.025
280	dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-...	48	0.025
281	dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-...	48	0.025
282	gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ...	48	0.025
283	dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full...	48	0.025
284	ref|NG_002685.1| Homo sapiens histone 1, H2a, pseudogene 2 (HIST...	48	0.025
285	gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX)...	48	0.025
286	ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA	48	0.025
287	ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (p...	48	0.025
288	ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2...	48	0.025
289	ref|XM_574997.1| PREDICTED: Rattus norvegicus similar to histone...	48	0.025
290	gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, comp...	48	0.025
291	gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, com...	48	0.025
292	gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, com...	48	0.025
293	gb|BC062255.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M...	48	0.025
294	gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (...	48	0.025
295	gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp...	48	0.025
296	gb|AY108339.1| Zea mays PCO070432 mRNA sequence	48	0.025
297	dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:C...	48	0.025
298	gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome...	48	0.025
299	gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple...	48	0.025
300	gb|BC053966.1| Mus musculus histone 2, H2aa2, mRNA (cDNA clone I...	48	0.025
301	ref|XM_667061.1| Plasmodium berghei strain ANKA histone h2a (PB3...	48	0.025
302	gb|BC089519.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M...	48	0.025
303	gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),...	48	0.025
304	gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I...	48	0.025
305	gb|J00950.1|NVIHIS2A Newt histone H2a gene, partial	48	0.025
306	gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c...	48	0.025
307	gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome...	48	0.025
308	ref|XM_520760.1| PREDICTED: Pan troglodytes similar to H2A histo...	46	0.097
309	ref|XM_474362.1| Oryza sativa (japonica cultivar-group), predic...	46	0.097
310	gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds	46	0.097
311	gb|BC003602.1| Homo sapiens H2A histone family, member J, transc...	46	0.097
312	ref|XM_870822.1| PREDICTED: Bos taurus similar to H2A histone fa...	46	0.097
313	ref|NM_177688.2| Mus musculus H2A histone family, member J (H2af...	46	0.097
314	ref|XM_652790.1| Aspergillus nidulans FGSC A4 hypothetical prote...	46	0.097
315	ref|NM_177925.1| Homo sapiens H2A histone family, member J (H2AF...	46	0.097
316	ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone ...	46	0.097
317	ref|XR_003029.1| PREDICTED: Mus musculus similar to H2A histone ...	46	0.097
318	ref|XR_001920.1| PREDICTED: Mus musculus similar to H2A histone ...	46	0.097
319	gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple...	46	0.097
320	gb|AC123686.11| Mus musculus chromosome 5, clone RP23-301L9, com...	46	0.097
321	emb|AL606456.2|OSJN00017 Oryza sativa genomic DNA, chromosome 4,...	46	0.097
322	gb|BC103043.1| Bos taurus cDNA clone MGC:128401 IMAGE:7983967, c...	46	0.097
323	emb|CR625218.1| full-length cDNA clone CS0DI023YM11 of Placenta ...	46	0.097
324	gb|AC010168.6| Homo sapiens 12p12-31.7-32.2 BAC RP11-174G6 (Rose...	46	0.097
325	ref|XM_687955.1| PREDICTED: Danio rerio similar to histone H2A (...	46	0.097
326	ref|XM_686987.1| PREDICTED: Danio rerio similar to replication-d...	46	0.097
327	dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	46	0.097
328	ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone...	46	0.097
329	emb|AL732353.1| Oryza sativa genomic DNA, chromosome 4, BAC clon...	46	0.097
330	gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (...	46	0.097
331	gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (...	46	0.097
332	emb|AL133626.1|HSM801493 Homo sapiens mRNA; cDNA DKFZp434K0522 (...	46	0.097
333	ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone p...	44	0.38
334	ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H...	44	0.38
335	ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA	44	0.38
336	ref|NM_001040642.1| Gallus gallus similar to Histone H1.2 (H1d) ...	44	0.38
337	ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 ...	44	0.38
338	ref|XM_871147.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	44	0.38
339	gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC...	44	0.38
340	ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	44	0.38
341	ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 ...	44	0.38
342	ref|NG_001335.1| Homo sapiens genomic large histone family clust...	44	0.38
343	ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA	44	0.38
344	ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA	44	0.38
345	ref|NM_021065.2| Homo sapiens histone 1, H2ad (HIST1H2AD), mRNA	44	0.38
346	ref|NM_021052.2| Homo sapiens histone 1, H2ae (HIST1H2AE), mRNA	44	0.38
347	gb|AY812081.1| Schistosoma japonicum SJCHGC05779 protein mRNA, p...	44	0.38
348	gb|AY223124.1| Schistosoma japonicum clone ZZD1425 mRNA sequence	44	0.38
349	ref|XM_856111.1| PREDICTED: Canis familiaris similar to Core his...	44	0.38
350	ref|XM_856079.1| PREDICTED: Canis familiaris similar to Core his...	44	0.38
351	ref|XM_845205.1| PREDICTED: Canis familiaris similar to Core his...	44	0.38
352	ref|XM_856021.1| PREDICTED: Canis familiaris similar to Core his...	44	0.38
353	ref|XM_546142.2| PREDICTED: Canis familiaris similar to Core his...	44	0.38
354	ref|XM_855966.1| PREDICTED: Canis familiaris similar to Core his...	44	0.38
355	gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, comp...	44	0.38
356	emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o...	44	0.38
357	emb|Z80776.1|HSH2AG H.sapiens H2A/g gene	44	0.38
358	emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23	44	0.38
359	emb|X16495.1|MMHIST2A Murine H2A gene for histone H2A	44	0.38
360	emb|X01752.1|GGHISH1 Chicken histone H1 gene	44	0.38
361	emb|AJ494852.1|ODI494852 Oikopleura dioica partial H2A.4 gene fo...	44	0.38
362	gb|BC093807.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG...	44	0.38
363	emb|CR541999.1| Homo sapiens full open reading frame cDNA clone ...	44	0.38
364	emb|CR541970.1| Homo sapiens full open reading frame cDNA clone ...	44	0.38
365	dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-1409...	44	0.38
366	gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2...	44	0.38
367	gb|BC093862.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG...	44	0.38
368	gb|BC093809.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG...	44	0.38
369	gb|BC093836.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG...	44	0.38
370	dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...	44	0.38
371	gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, comp...	44	0.38
372	gb|M60752.1|HUMHISAG Human histone H2A.1 (H2A) gene, complete cds	44	0.38
373	gb|AY131986.1| Homo sapiens histone H2A (HIST1H2AE) gene, comple...	44	0.38
374	gb|AY131985.1| Homo sapiens histone H2A (HIST1H2AD) gene, comple...	44	0.38
375	ref|XM_482082.1| Oryza sativa (japonica cultivar-group), mRNA	42	1.5
376	gb|BT016168.1| Zea mays clone Contig1 mRNA sequence	42	1.5
377	ref|XM_603142.2| PREDICTED: Bos taurus similar to histone 1, H2a...	42	1.5
378	ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX ...	42	1.5
379	ref|NM_018267.2| Homo sapiens H2A histone family, member J (H2AF...	42	1.5
380	gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl...	42	1.5
381	gb|AF517874.1| Griffithsia japonica isolate Gj10 histone protein...	42	1.5
382	ref|XM_792460.1| PREDICTED: Strongylocentrotus purpuratus simila...	42	1.5
383	ref|XM_781115.1| PREDICTED: Strongylocentrotus purpuratus simila...	42	1.5
384	emb|AJ245999.1|BNA245999 Brassica napus H2A gene for Histone H2A	42	1.5
385	gb|DQ397869.1| Cenarchaeum symbiosum clone C04C05, complete sequ...	42	1.5
386	dbj|AK001765.1| Homo sapiens cDNA FLJ10903 fis, clone OVARC10000...	42	1.5
387	ref|XM_684593.1| PREDICTED: Danio rerio similar to histone H2A (...	42	1.5
388	ref|XM_683706.1| PREDICTED: Danio rerio similar to histone H2A (...	42	1.5
389	ref|XM_683060.1| PREDICTED: Danio rerio similar to replication-d...	42	1.5
390	ref|XM_694133.1| PREDICTED: Danio rerio similar to replication-d...	42	1.5
391	ref|XM_688274.1| PREDICTED: Danio rerio similar to histone H2A (...	42	1.5
392	gb|AF315728.1|AF315728 Carassius auratus gibelio histone H2A mRN...	42	1.5
393	gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family me...	42	1.5
394	ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (p...	42	1.5
395	dbj|AP004397.3| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
396	dbj|AP003962.3| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
397	ref|XM_318365.1| Anopheles gambiae str. PEST ENSANGP00000015967 ...	42	1.5
398	ref|XM_307083.1| Anopheles gambiae str. PEST ENSANGP00000012043 ...	42	1.5
399	dbj|AK072348.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.5
400	gb|AY105006.1| Zea mays PCO108932 mRNA sequence	42	1.5
401	ref|XM_511661.1| PREDICTED: Pan troglodytes similar to Galectin-...	40	6.0
402	ref|XM_527281.1| PREDICTED: Pan troglodytes similar to H2A histo...	40	6.0
403	ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H...	40	6.0
404	ref|NM_196515.1| Oryza sativa (japonica cultivar-group) putative...	40	6.0
405	gb|AY730593.1| Salmonella enterica subsp. enterica serovar Urban...	40	6.0
406	gb|BT023909.1| Drosophila melanogaster GH04784 full insert cDNA	40	6.0
407	gb|AY389715.1| Hyacinthus orientalis histone H2A-like protein mR...	40	6.0
408	gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462	40	6.0
409	ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@...	40	6.0
410	ref|NM_021066.2| Homo sapiens histone 1, H2aj (HIST1H2AJ), mRNA	40	6.0
411	ref|NM_003509.2| Homo sapiens histone 1, H2ai (HIST1H2AI), mRNA	40	6.0
412	gb|BC066234.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	6.0
413	gb|BC066232.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	6.0
414	gb|BC066233.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	6.0
415	gb|BC066237.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	6.0
416	gb|BC066236.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	6.0
417	gb|BC066235.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM...	40	6.0
418	gb|AY232048.1| Drosophila yakuba clone yak-ad_RpS6 mRNA sequence	40	6.0
419	gb|AY231781.1| Drosophila yakuba clone yak-em_RpS6 mRNA sequence	40	6.0
420	emb|CR709561.2|CNS0GAG5 Tetraodon nigroviridis full-length cDNA	40	6.0
421	ref|NM_001024396.1| Danio rerio zgc:110434 (zgc:110434), mRNA	40	6.0
422	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	40	6.0
423	emb|AL050344.31|HSJ799D16 Human DNA sequence from clone RP4-799D...	40	6.0
424	emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A...	40	6.0
425	emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o...	40	6.0
426	gb|AC137931.3| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
427	ref|XM_967564.1| PREDICTED: Tribolium castaneum similar to CG435...	40	6.0
428	ref|XM_962318.1| PREDICTED: Tribolium castaneum similar to H2A h...	40	6.0
429	emb|Z83742.1|HSZ83742 H.sapiens hH2A/c gene	40	6.0
430	emb|Z83736.1|HSZ83736 H.sapiens hH2A/e gene	40	6.0
431	gb|AE008793.1| Salmonella typhimurium LT2, section 97 of 220 of ...	40	6.0
432	emb|BX572603.1| Rhodopseudomonas palustris CGA009 complete genom...	40	6.0
433	emb|AL627273.1| Salmonella enterica serovar Typhi (Salmonella ty...	40	6.0
434	gb|AC118670.2| Genomic sequence for Oryza sativa, Nipponbare sta...	40	6.0
435	gb|AC103809.2| Homo sapiens chromosome 17, clone RP11-647F2, com...	40	6.0
436	ref|NM_167136.1| Drosophila melanogaster Ribosomal protein S6 CG...	40	6.0
437	ref|NM_167135.2| Drosophila melanogaster Ribosomal protein S6 CG...	40	6.0
438	gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica culti...	40	6.0
439	ref|NM_078518.2| Drosophila melanogaster Ribosomal protein S6 CG...	40	6.0
440	gb|AC109643.1| Caenorhabditis briggsae cosmid CB033F17, complete...	40	6.0
441	ref|XM_940760.1| PREDICTED: Homo sapiens similar to Galectin-3 b...	40	6.0
442	ref|XM_371078.2| PREDICTED: Homo sapiens similar to Galectin-3 b...	40	6.0
443	gb|AY058620.1| Drosophila melanogaster LD31286 full length cDNA	40	6.0
444	gb|BC095260.1| Danio rerio zgc:110434, mRNA (cDNA clone MGC:1104...	40	6.0
445	gb|AE006470.1| Chlorobium tepidum TLS, complete genome	40	6.0
446	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
447	gb|AY012199.1| Salmonella enterica subsp. VI isolate M324 GDP-ma...	40	6.0
448	gb|AY012198.1| Salmonella enterica subsp. I isolate M286 GDP-man...	40	6.0
449	gb|AY012195.1| Salmonella enterica subsp. VI isolate M326 GDP-ma...	40	6.0
450	gb|AY012192.1| Salmonella enterica subsp. I isolate M258 GDP-man...	40	6.0
451	gb|AY012187.1| Salmonella enterica subsp. I isolate M273 GDP-man...	40	6.0
452	gb|AY012186.1| Salmonella enterica subsp. I isolate M264 GDP-man...	40	6.0
453	gb|AY012185.1| Salmonella enterica subsp. IV isolate M1654 phosp...	40	6.0
454	gb|AY012184.1| Salmonella enterica subsp. IIIa isolate M1651 pho...	40	6.0
455	gb|AY012182.1| Salmonella enterica subsp. IIIb isolate M1653 pho...	40	6.0
456	gb|AY012181.1| Salmonella enterica subsp. I isolate M1646 phosph...	40	6.0
457	gb|AY012180.1| Salmonella enterica subsp. VI isolate M324 GDP-ma...	40	6.0
458	gb|AY012177.1| Salmonella enterica subsp. I isolate M252 GDP-man...	40	6.0
459	gb|AY012176.1| Salmonella enterica subsp. I isolate M274 GDP-man...	40	6.0
460	gb|AY012175.1| Salmonella enterica subsp. I isolate M255 GDP-man...	40	6.0
461	gb|AY012174.1| Salmonella enterica subsp. I isolate M273 GDP-man...	40	6.0
462	gb|AY012173.1| Salmonella enterica subsp. I isolate M286 GDP-man...	40	6.0
463	gb|AY012172.1| Salmonella enterica subsp. I isolate M264 GDP-man...	40	6.0
464	gb|AY012171.1| Salmonella enterica subsp. VI isolate M326 phosph...	40	6.0
465	gb|AY012168.1| Salmonella enterica subsp. IV isolate M1655 phosp...	40	6.0
466	gb|AY012166.1| Salmonella enterica subsp. IIIa isolate M1651 pho...	40	6.0
467	gb|AY012165.1| Salmonella enterica subsp. IIIa isolate M1784 pho...	40	6.0
468	gb|AY012164.1| Salmonella enterica subsp. IIIa isolate M1639 pho...	40	6.0
469	gb|AC148038.3| Ovis aries clone CH243-361I2, complete sequence	40	6.0
470	dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.0
471	gb|AY131990.1| Homo sapiens histone H2A (HIST1H2AJ) gene, comple...	40	6.0
472	gb|AY131989.1| Homo sapiens histone H2A (HIST1H2AI) gene, comple...	40	6.0
473	gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb00...	40	6.0
474	gb|AC055863.16| Homo sapiens chromosome 17, clone RP11-478P5, co...	40	6.0
475	gb|AC104512.11| Drosophila melanogaster BAC RP98-39C15 (Roswell...	40	6.0
476	gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat...	40	6.0
477	dbj|AK121515.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
478	emb|X59886.1|STCPSBG S.enterica cpsB and cpsG genes for mannose-...	40	6.0
479	ref|XM_318363.2| Anopheles gambiae str. PEST ENSANGP00000015971 ...	40	6.0
480	dbj|AK107121.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.0
481	gb|BC112256.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	40	6.0
482	gb|BC112254.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG...	40	6.0
483	emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple...	40	6.0
484	gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi...	40	6.0
485	gb|L02074.1|DRORBS6 Drosophila melanogaster ribosomal protein S6...	40	6.0
486	gb|AE003442.3| Drosophila melanogaster chromosome X, section 26 ...	40	6.0
487	gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole...	40	6.0
488	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
489	gb|L01658.1|DRORPS6X Drosophila melanogaster ribosomal protein S...	40	6.0
490	gb|M84642.1|SERFBC1 Salmonella enterica group C1 rfb gene cluster	40	6.0
491	gb|L02075.1|DRORBSCS6 Drosophila melanogaster ribosomal protein ...	40	6.0
492	gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2...	40	6.0
493	gb|M11084.1|SUPHIS2A1 Sea urchin (P.miliaris) late histone H2A-1...	40	6.0
494	gb|M14140.1|SUPH2B2 P.miliaris histone H2A-2.1 gene, complete cds	40	6.0
495	gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds	40	6.0
496	gb|L07881.1|DRORPS67BC Drosophila melanogaster ribosomal protein...	40	6.0
497	dbj|AB065914.1| Homo sapiens gene for seven transmembrane helix ...	40	6.0

---

>gb|AY103710.1| Zea mays PCO123562 mRNA sequence
          Length = 770

 Score =  236 bits (119), Expect = 5e-59
 Identities = 223/257 (86%), Gaps = 3/257 (1%)
 Strand = Plus / Minus

                                                                       
Query: 191 gccttcttgggggacttggcggccttcttgggcgacttgccctccttgggctcc---ttc 247
           ||||||||||||||||||||||||||||||||||||||| ||||||||| | ||   |||
Sbjct: 560 gccttcttgggggacttggcggccttcttgggcgacttggcctccttggccgccgccttc 501

                                                                       
Query: 248 tccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcg 307
           ||||||||| ||||||| || |||||||||||||||||||| || ||||||||||| |||
Sbjct: 500 tccgcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcg 441

                                                                       
Query: 308 atggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcagg 367
           ||||||||||||| ||||||| | |||||||||| |||||| |  | ||| ||||||| |
Sbjct: 440 atggtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacg 381

                                                                       
Query: 368 tgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccaga 427
           || |  || | |||||||| |||||||||||||||||| ||||| ||||| |||||||| 
Sbjct: 380 tggcgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagc 321

                            
Query: 428 agctccgcggccaggta 444
           | ||| |||||||||||
Sbjct: 320 acctcggcggccaggta 304

---

>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence
          Length = 719

 Score =  220 bits (111), Expect = 3e-54
 Identities = 221/257 (85%), Gaps = 3/257 (1%)
 Strand = Plus / Minus

                                                                       
Query: 191 gccttcttgggggacttggcggccttcttgggcgacttgccctccttgggctcc---ttc 247
           ||||||||||||||||||| || ||||||||| |||||| ||||||||||| ||   |||
Sbjct: 560 gccttcttgggggacttggggggcttcttgggggacttggcctccttgggcgccgccttc 501

                                                                       
Query: 248 tccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcg 307
           ||||||||| ||||||| || |||||||||||||||||||| || ||||||||||| |||
Sbjct: 500 tccgcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcg 441

                                                                       
Query: 308 atggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcagg 367
           ||||||||||||| ||||||| | |||||||||| |||||| |  | ||| ||||||| |
Sbjct: 440 atggtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacg 381

                                                                       
Query: 368 tgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccaga 427
           || |  || | |||||||| |||||||||||||||||| ||||| ||||| |||||||| 
Sbjct: 380 tggcgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagc 321

                            
Query: 428 agctccgcggccaggta 444
           | ||| |||||||||||
Sbjct: 320 acctcggcggccaggta 304

---

>ref|NM_193707.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 480

 Score =  170 bits (86), Expect = 2e-39
 Identities = 173/202 (85%)
 Strand = Plus / Minus

                                                                       
Query: 243 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
           |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 412 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 353

                                                                       
Query: 303 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
           |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 352 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 293

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 292 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 233

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||| | ||| ||||| |||||
Sbjct: 232 ccagcacctcggcggcgaggta 211



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/52 (90%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                               
Query: 190 ggccttcttgggggacttggcggcc---ttcttgggcgacttgccctccttg 238
           ||||||||||||||||||| |||||   ||||||||||||||| ||||||||
Sbjct: 477 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttg 426

---

>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full
           insert sequence
          Length = 797

 Score =  170 bits (86), Expect = 2e-39
 Identities = 173/202 (85%)
 Strand = Plus / Minus

                                                                       
Query: 243 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
           |||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 480 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 421

                                                                       
Query: 303 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
           ||||||||||||| ||||| |||||| |||||||||||| |||||| |  |  || || |
Sbjct: 420 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 361

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||| |||||| || | ||| |||  |||||||||||||   || ||||||||||||||||
Sbjct: 360 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 301

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||| | ||| ||||| |||||
Sbjct: 300 ccagcacctctgcggcgaggta 279

---

>ref|XM_475081.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 522

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Minus

                                                                       
Query: 243 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
           |||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 454 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 395

                                                                       
Query: 303 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
           ||||||||||||| ||||| |||||| |||||||||||| |||||| |  |  || || |
Sbjct: 394 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 335

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||| |||||| || | ||| |||  |||||||||||||   || ||||||||||||||||
Sbjct: 334 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 275

               
Query: 423 ccag 426
           ||||
Sbjct: 274 ccag 271

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Plus

                                                                           
Query: 243     ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
               |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 9471210 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 9471269

                                                                           
Query: 303     gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
               |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 9471270 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 9471329

                                                                           
Query: 363     gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
               ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 9471330 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 9471389

                   
Query: 423     ccag 426
               ||||
Sbjct: 9471390 ccag 9471393



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                                   
Query: 190     ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 238
               ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 9471145 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 9471196



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 135/169 (79%)
 Strand = Plus / Minus

                                                                            
Query: 258      tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
                ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 28998341 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 28998282

                                                                            
Query: 318      cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
                 | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 28998281 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 28998222

                                                                 
Query: 378      cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
                |||| | |  ||||||||||||| | || ||||||||||| ||||||||
Sbjct: 28998221 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctccag 28998173



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 205      cttggcggccttcttgggcgacttgccctcct 236
                ||||||| ||||||||||||||| || |||||
Sbjct: 10411003 cttggcgcccttcttgggcgactcgctctcct 10410972

---

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Plus

                                                                          
Query: 243    ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
              |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 168610 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 168669

                                                                          
Query: 303    gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
              |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 168670 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 168729

                                                                          
Query: 363    gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
              ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 168730 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 168789

                  
Query: 423    ccag 426
              ||||
Sbjct: 168790 ccag 168793



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                                  
Query: 190    ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 238
              ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 168545 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 168596

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5,
              complete sequence
          Length = 29737217

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Minus

                                                                          
Query: 243    ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
              |||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 707417 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 707358

                                                                          
Query: 303    gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
              ||||||||||||| ||||| |||||| |||||||||||| |||||| |  |  || || |
Sbjct: 707357 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 707298

                                                                          
Query: 363    gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
              ||| |||||| || | ||| |||  |||||||||||||   || ||||||||||||||||
Sbjct: 707297 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 707238

                  
Query: 423    ccag 426
              ||||
Sbjct: 707237 ccag 707234



 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Plus

                                                                            
Query: 252      cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
                ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 22512323 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 22512382

                                                     
Query: 312      tgacgccggccagcagcctcccgagctcctggtcgtt 348
                ||||||||||||||||| |||||||||||| ||||||
Sbjct: 22512383 tgacgccggccagcagcttcccgagctcctcgtcgtt 22512419

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Plus

                                                                           
Query: 243     ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
               |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 9469331 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 9469390

                                                                           
Query: 303     gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
               |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 9469391 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 9469450

                                                                           
Query: 363     gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
               ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 9469451 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 9469510

                   
Query: 423     ccag 426
               ||||
Sbjct: 9469511 ccag 9469514



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                                   
Query: 190     ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 238
               ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 9469266 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 9469317



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 135/169 (79%)
 Strand = Plus / Minus

                                                                            
Query: 258      tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
                ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 29089763 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 29089704

                                                                            
Query: 318      cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
                 | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 29089703 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 29089644

                                                                 
Query: 378      cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
                |||| | |  ||||||||||||| | || ||||||||||| ||||||||
Sbjct: 29089643 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctccag 29089595



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 205      cttggcggccttcttgggcgacttgccctcct 236
                ||||||| ||||||||||||||| || |||||
Sbjct: 10409104 cttggcgcccttcttgggcgactcgctctcct 10409073

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Minus

                                                                            
Query: 243      ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
                |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 17417162 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 17417103

                                                                            
Query: 303      gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
                |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 17417102 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 17417043

                                                                            
Query: 363      gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
                ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 17417042 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 17416983

                    
Query: 423      ccag 426
                ||||
Sbjct: 17416982 ccag 17416979



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                            
Query: 214      cttcttgggcgacttgccctccttgggctccttctccgcggtcctcttggggagcagcac 273
                |||||| ||||||||| ||||||||    |||||||||||| |||||| ||||| |||||
Sbjct: 43063433 cttctttggcgacttggcctccttgttggccttctccgcggccctctttgggaggagcac 43063374

                                                       
Query: 274      cgggttgatgttgggcagcacgccgccgtgcgcgatggt 312
                | ||||||||||||||||||| ||||| || ||||||||
Sbjct: 43063373 caggttgatgttgggcagcactccgccatgggcgatggt 43063335



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/52 (90%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                                    
Query: 190      ggccttcttgggggacttggcggcc---ttcttgggcgacttgccctccttg 238
                ||||||||||||||||||| |||||   ||||||||||||||| ||||||||
Sbjct: 17417227 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttg 17417176



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 189      cggccttcttgggggacttggcgg 212
                ||||||||||||||||||||||||
Sbjct: 43063467 cggccttcttgggggacttggcgg 43063444

---

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Minus

                                                                         
Query: 243   ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
             |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 70554 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 70495

                                                                         
Query: 303   gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
             |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 70494 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 70435

                                                                         
Query: 363   gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
             ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 70434 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 70375

                 
Query: 423   ccag 426
             ||||
Sbjct: 70374 ccag 70371



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/52 (90%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                                 
Query: 190   ggccttcttgggggacttggcggcc---ttcttgggcgacttgccctccttg 238
             ||||||||||||||||||| |||||   ||||||||||||||| ||||||||
Sbjct: 70619 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttg 70568

---

>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full
           insert sequence
          Length = 754

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Minus

                                                                       
Query: 243 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
           |||||||||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 502 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 443

                                                                       
Query: 303 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
           |||||||||| ||||||||||||||| | |||||||||| ||||||||| |  || || |
Sbjct: 442 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 383

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||| ||| |  || | ||| | |  ||||||||||||| |||| ||||||||||||||||
Sbjct: 382 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 323

               
Query: 423 ccag 426
           ||||
Sbjct: 322 ccag 319



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 48/52 (92%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                               
Query: 190 ggccttcttgggggactt---ggcggccttcttgggcgacttgccctccttg 238
           ||||||||||||||||||   |||||||||||||||||||||| ||||||||
Sbjct: 567 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttg 516

---

>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0041A22, complete sequence
          Length = 117919

 Score =  167 bits (84), Expect = 4e-38
 Identities = 159/184 (86%)
 Strand = Plus / Minus

                                                                         
Query: 243   ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
             |||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 52616 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 52557

                                                                         
Query: 303   gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
             ||||||||||||| ||||| |||||| |||||||||||| |||||| |  |  || || |
Sbjct: 52556 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 52497

                                                                         
Query: 363   gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
             ||| |||||| || | ||| |||  |||||||||||||   || ||||||||||||||||
Sbjct: 52496 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 52437

                 
Query: 423   ccag 426
             ||||
Sbjct: 52436 ccag 52433

---

>ref|XM_475374.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 492

 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 397 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 338

                                                
Query: 312 tgacgccggccagcagcctcccgagctcctggtcgtt 348
           ||||||||||||||||| |||||||||||| ||||||
Sbjct: 337 tgacgccggccagcagcttcccgagctcctcgtcgtt 301

---

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
            complete sequence
          Length = 93826

 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Plus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 7373 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 7432

                                                 
Query: 312  tgacgccggccagcagcctcccgagctcctggtcgtt 348
            ||||||||||||||||| |||||||||||| ||||||
Sbjct: 7433 tgacgccggccagcagcttcccgagctcctcgtcgtt 7469

---

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
              complete sequence
          Length = 163130

 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Plus

                                                                          
Query: 252    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
              ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 101730 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 101789

                                                   
Query: 312    tgacgccggccagcagcctcccgagctcctggtcgtt 348
              ||||||||||||||||| |||||||||||| ||||||
Sbjct: 101790 tgacgccggccagcagcttcccgagctcctcgtcgtt 101826

---

>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full
           insert sequence
          Length = 912

 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 467 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 408

                                                
Query: 312 tgacgccggccagcagcctcccgagctcctggtcgtt 348
           ||||||||||||||||| |||||||||||| ||||||
Sbjct: 407 tgacgccggccagcagcttcccgagctcctcgtcgtt 371

---

>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full
           insert sequence
          Length = 1097

 Score =  161 bits (81), Expect = 2e-36
 Identities = 93/97 (95%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 468 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 409

                                                
Query: 312 tgacgccggccagcagcctcccgagctcctggtcgtt 348
           ||||||||||||||||| |||||||||||| ||||||
Sbjct: 408 tgacgccggccagcagcttcccgagctcctcgtcgtt 372

---

>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence
          Length = 674

 Score =  157 bits (79), Expect = 4e-35
 Identities = 173/203 (85%), Gaps = 1/203 (0%)
 Strand = Plus / Minus

                                                                       
Query: 243 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
           |||||||||| ||| ||||||| ||||| ||||||||||||||||||| |||||||||||
Sbjct: 463 ccttctccgccgtcttcttgggcagcaggaccgggttgatgttgggcaacacgccgccgt 404

                                                                       
Query: 303 gcgcgatggtgacgccggccagcagcc-tcccgagctcctggtcgttcctcacggcgagg 361
           | |||||||| ||||||| |||||||| |||||||||||| |||||| |  |  || || 
Sbjct: 403 gggcgatggtcacgccggtcagcagccttcccgagctcctcgtcgttgcggatcgccagc 344

                                                                       
Query: 362 agcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagc 421
           |||| ||| |  || |||||||| | |||||||||||||||||| ||||| |||||||||
Sbjct: 343 agcacgtggcgcgggacgatgcgcgtcttcttgttgtccttggcagcgttgccggcgagc 284

                                  
Query: 422 tccagaagctccgcggccaggta 444
           ||||| | ||| ||||| |||||
Sbjct: 283 tccaggacctcagcggcgaggta 261



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 47/48 (97%)
 Strand = Plus / Minus

                                                           
Query: 191 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 238
           ||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 527 gccttcttgggggacttggcggccttcttgggcgacttggcctccttg 480

---

>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9
          Length = 704

 Score =  157 bits (79), Expect = 4e-35
 Identities = 160/187 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           |||||||||||||||| | |||||||||||| | |||||| ||||| |||||||||||||
Sbjct: 411 tcttggggagcagcacggagttgatgttggggatcacgccaccgtgggcgatggtgacgc 352

                                                                       
Query: 318 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
           | || |||||||| ||||||||||||||||| |  || ||||| |||||||| |  || |
Sbjct: 351 cagcgagcagcctgccgagctcctggtcgttgcggacagcgagcagcaggtggcgcggga 292

                                                                       
Query: 378 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctccgcgg 437
            |||||||| |||||||||||||||||| ||||| ||||| |||||||| | ||| ||||
Sbjct: 291 tgatgcgggtcttcttgttgtccttggccgcgttgccggcaagctccagcacctcggcgg 232

                  
Query: 438 ccaggta 444
           | |||||
Sbjct: 231 cgaggta 225



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 214 cttcttgggcgacttgccctcctt 237
           |||||||||||||||| |||||||
Sbjct: 455 cttcttgggcgacttggcctcctt 432

---

>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3
          Length = 1153

 Score =  157 bits (79), Expect = 4e-35
 Identities = 160/187 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           |||||||||||||||| | |||||||||||| |  ||||||||||| |||||||||||||
Sbjct: 432 tcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatggtgacgc 373

                                                                       
Query: 318 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
           |||| |||||||| || |||||||||||||| |  ||||| || |||||||| |  || |
Sbjct: 372 cggcgagcagcctgcccagctcctggtcgttgcggacggccagcagcaggtggcgcggga 313

                                                                       
Query: 378 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctccgcgg 437
            |||||| | |||||||||||||||||| ||||| |||||||||||||| | ||| ||||
Sbjct: 312 tgatgcgcgtcttcttgttgtccttggccgcgttgccggcgagctccaggacctcggcgg 253

                  
Query: 438 ccaggta 444
           | |||||
Sbjct: 252 cgaggta 246

---

>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2
          Length = 717

 Score =  157 bits (79), Expect = 4e-35
 Identities = 160/187 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           |||||||||||||||| | |||||||||||| |  ||||||||||| |||||||||||||
Sbjct: 434 tcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatggtgacgc 375

                                                                       
Query: 318 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
           |||| |||||||| ||||||||||||||||| |  ||||| || |||||||| |  || |
Sbjct: 374 cggcgagcagcctgccgagctcctggtcgttgcggacggccagcagcaggtggcgcggga 315

                                                                       
Query: 378 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctccgcgg 437
            |||||| | |||||||||||||||||| ||||| ||||| |||||||| | ||| ||||
Sbjct: 314 tgatgcgcgtcttcttgttgtccttggccgcgttgccggcaagctccaggacctcggcgg 255

                  
Query: 438 ccaggta 444
           | |||||
Sbjct: 254 cgaggta 248



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 193 cttcttgggggacttggcggc 213
           |||||||||||||||||||||
Sbjct: 499 cttcttgggggacttggcggc 479

---

>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)
          Length = 2546

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                        
Query: 258  tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
            ||||||| |||||||| | ||||||  |||| |  ||||||||||| |||||||||||||
Sbjct: 2233 tcttgggcagcagcacggagttgattgtggggatgacgccgccgtgggcgatggtgacgc 2174

                                                                        
Query: 318  cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
            |||| |||||||| ||||||||||||||||| |  |||||||| |||||||| |  || |
Sbjct: 2173 cggcaagcagcctgccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 2114

                                                             
Query: 378  cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
             |||||||| |||||||||||||||||| ||||| ||||| ||||||||
Sbjct: 2113 tgatgcgggtcttcttgttgtccttggctgcgttgccggcaagctccag 2065



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 214  cttcttgggcgacttgccctcctt 237
            |||||||||||||||| |||||||
Sbjct: 2277 cttcttgggcgacttggcctcctt 2254

---

>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds
          Length = 2546

 Score =  145 bits (73), Expect = 1e-31
 Identities = 145/169 (85%)
 Strand = Plus / Minus

                                                                        
Query: 258  tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
            ||||||| |||||||| | ||||||  |||| |  ||||||||||| |||||||||||||
Sbjct: 2233 tcttgggcagcagcacggagttgattgtggggatgacgccgccgtgggcgatggtgacgc 2174

                                                                        
Query: 318  cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
            |||| |||||||| ||||||||||||||||| |  |||||||| |||||||| |  || |
Sbjct: 2173 cggcaagcagcctgccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 2114

                                                             
Query: 378  cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
             |||||||| |||||||||||||||||| ||||| ||||| ||||||||
Sbjct: 2113 tgatgcgggtcttcttgttgtccttggctgcgttgccggcaagctccag 2065



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 214  cttcttgggcgacttgccctcctt 237
            |||||||||||||||| |||||||
Sbjct: 2277 cttcttgggcgacttggcctcctt 2254

---

>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence
          Length = 846

 Score =  125 bits (63), Expect = 1e-25
 Identities = 84/91 (92%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           |||||||||||||||| ||||||||||||||||| || |||||||| |||||||||||||
Sbjct: 395 tcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacgc 336

                                          
Query: 318 cggccagcagcctcccgagctcctggtcgtt 348
           ||||||| ||| |||||||||||| ||||||
Sbjct: 335 cggccagtagcttcccgagctcctcgtcgtt 305

---

>gb|AY103585.1| Zea mays PCO123564 mRNA sequence
          Length = 1953

 Score =  123 bits (62), Expect = 5e-25
 Identities = 167/202 (82%)
 Strand = Plus / Minus

                                                                       
Query: 243 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
           |||||||||| | | ||||||| || ||||| | || ||||||||| || ||||||||||
Sbjct: 623 ccttctccgccgccttcttgggcaggagcacggagtggatgttggggaggacgccgccgt 564

                                                                       
Query: 303 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
           |||||||||||||||||||||||||| |||||||||||| |||||| |  |  || ||||
Sbjct: 563 gcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgttgcggatcgccagga 504

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||| ||| |  || | |||||| | |||||||||||| || || |||||||| || | ||
Sbjct: 503 gcacgtggcgcgggatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaact 444

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||||| ||| ||||| |||||
Sbjct: 443 ccagaacctcggcggcgaggta 422



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 191 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 238
           ||||||||||||||||||||| |||||||||| ||||||  |||||||
Sbjct: 687 gccttcttgggggacttggcgcccttcttgggggacttgggctccttg 640

---

>gb|AY104486.1| Zea mays PCO109435 mRNA sequence
          Length = 992

 Score =  119 bits (60), Expect = 8e-24
 Identities = 78/84 (92%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           |||||||||||||||| ||||||||||||||||| || |||||||| |||||||||||||
Sbjct: 466 tcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacgc 407

                                   
Query: 318 cggccagcagcctcccgagctcct 341
           ||||||| ||| ||||||||||||
Sbjct: 406 cggccagtagcttcccgagctcct 383

---

>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence
          Length = 699

 Score =  115 bits (58), Expect = 1e-22
 Identities = 166/202 (82%)
 Strand = Plus / Minus

                                                                       
Query: 243 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
           |||||||||| | | ||||||| || ||||| | || ||||||||| || ||||| ||||
Sbjct: 474 ccttctccgccgccttcttgggcaggagcacggagtggatgttggggaggacgccaccgt 415

                                                                       
Query: 303 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
           |||||||||||||||||||||||||| |||||||||||| |||||| |  |  || ||||
Sbjct: 414 gcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgttgcggatcgccagga 355

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||| ||| |  || | |||||| | |||||||||||| || || |||||||| || | ||
Sbjct: 354 gcacgtggcgcgggatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaact 295

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||||| ||| ||||| |||||
Sbjct: 294 ccagaacctcggcggcgaggta 273



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 191 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 238
           ||||||||||||||||||||| |||||||||| ||||||  |||||||
Sbjct: 538 gccttcttgggggacttggcgcccttcttgggggacttgggctccttg 491

---

>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence
          Length = 1051

 Score =  107 bits (54), Expect = 3e-20
 Identities = 165/202 (81%)
 Strand = Plus / Minus

                                                                       
Query: 243 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
           |||||||||| ||| ||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 499 ccttctccgccgtcttcttgggcagcagaacagggttgatattggggagcacaccgccgt 440

                                                                       
Query: 303 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
           | |||||||| |||||| |||||||| |||| ||||||| ||||||||  |  || || |
Sbjct: 439 gagcgatggtcacgccgcccagcagcttcccaagctcctcgtcgttccggatcgccagaa 380

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||| ||| |  || |  ||||| | ||||||||||||| |||| || || || |||||||
Sbjct: 379 gcacgtggcgcggaataatgcgagtcttcttgttgtccctggcagcattaccagcgagct 320

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||||| ||| ||||| |||||
Sbjct: 319 ccagaacctcagcggcgaggta 298



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 204 acttggcggccttcttgggcgacttgccctccttg 238
           |||||||||||||||||||||||||  ||||||||
Sbjct: 550 acttggcggccttcttgggcgactttgcctccttg 516

---

>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds
          Length = 714

 Score =  107 bits (54), Expect = 3e-20
 Identities = 165/202 (81%)
 Strand = Plus / Minus

                                                                       
Query: 243 ccttctccgcggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgt 302
           |||||||||| ||| ||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 480 ccttctccgccgtcttcttgggcagcagaacagggttgatattggggagcacaccgccgt 421

                                                                       
Query: 303 gcgcgatggtgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgagga 362
           | |||||||| |||||| ||| |||| |||| ||||||| ||||||||  |  || || |
Sbjct: 420 gagcgatggtcacgccgcccaacagcttcccaagctcctcgtcgttccggatcgccagaa 361

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||| ||| |  || |  ||||| | ||||||||||||| |||| || || ||||||||||
Sbjct: 360 gcacgtggcgcggaataatgcgagtcttcttgttgtccctggcagcattaccggcgagct 301

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||||| ||| ||||| |||||
Sbjct: 300 ccagaacctcagcggcgaggta 279



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 191 gccttcttgggggacttggcggccttcttgggcgacttgccctccttg 238
           |||||||| |||||||||||||||||||||||||||||  ||||||||
Sbjct: 544 gccttcttaggggacttggcggccttcttgggcgactttgcctccttg 497

---

>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence
          Length = 772

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 119/142 (83%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           |||||||||| || || ||||| |||||||||||||| |||||||||||||||||||| |
Sbjct: 447 tcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcgatggtgaccc 388

                                                                       
Query: 318 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
           |  |||||||| | |||||||||| |||||| |  | ||||||||| ||||| |  || |
Sbjct: 387 cacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggtggcgcggga 328

                                 
Query: 378 cgatgcgggacttcttgttgtc 399
            ||||||||  |||||||||||
Sbjct: 327 tgatgcgggttttcttgttgtc 306



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 189 cggccttcttgggggacttgg 209
           |||||||||||||||||||||
Sbjct: 507 cggccttcttgggggacttgg 487

---

>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA
          Length = 547

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 152/187 (81%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| ||||||||||  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 387 tcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgggcgatggtcactc 328

                                                                       
Query: 318 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
           || |||||||| |    ||||||| |||||| | |||||| ||  |||||||||  || |
Sbjct: 327 cgcccagcagcttgttcagctcctcgtcgttgcgcacggccagctgcaggtgccgcggga 268

                                                                       
Query: 378 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctccgcgg 437
            ||| | || ||||||||||||   ||||||||||||||| |||||||| | ||| ||||
Sbjct: 267 tgatcctggtcttcttgttgtcgcgggcggcgttcccggccagctccaggatctcagcgg 208

                  
Query: 438 ccaggta 444
            ||||||
Sbjct: 207 tcaggta 201

---

>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete
            cds
          Length = 2120

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 143/175 (81%)
 Strand = Plus / Minus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | |||||||||||| ||||| || || |||||||
Sbjct: 1169 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatgg 1110

                                                                        
Query: 312  tgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcc 371
            |||||||| |||||||| |   |||||||| |||||| | |||||| ||  ||||||| |
Sbjct: 1109 tgacgccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgac 1050

                                                                   
Query: 372  tgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
             ||| | |||||||| ||||||||||||   |||||| || ||||| ||||||||
Sbjct: 1049 gggggatgatgcgggtcttcttgttgtcgcgggcggcattgccggccagctccag 995

---

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0459B04
          Length = 142475

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                         
Query: 214   cttcttgggcgacttgccctccttgggctccttctccgcggtcctcttggggagcagcac 273
             |||||| ||||||||| ||||||||    |||||||||||| |||||| ||||| |||||
Sbjct: 60462 cttctttggcgacttggcctccttgttggccttctccgcggccctctttgggaggagcac 60403

                                                    
Query: 274   cgggttgatgttgggcagcacgccgccgtgcgcgatggt 312
             | ||||||||||||||||||| ||||| || ||||||||
Sbjct: 60402 caggttgatgttgggcagcactccgccatgggcgatggt 60364



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 189   cggccttcttgggggacttggcgg 212
             ||||||||||||||||||||||||
Sbjct: 60496 cggccttcttgggggacttggcgg 60473

---

>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full
           insert sequence
          Length = 747

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 152/187 (81%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||||||||||  | ||| ||||||||||||||||||||||   |||||||||||| 
Sbjct: 477 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 418

                                                                       
Query: 318 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
           || | |||||||| |  ||||||| |||||| | ||| || ||  | | |||||| ||||
Sbjct: 417 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 358

                                                                       
Query: 378 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctccgcgg 437
           |||| |||  ||||||||||||| | || |||||||| || |||||||| | ||| ||||
Sbjct: 357 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctccagcacctcggcgg 298

                  
Query: 438 ccaggta 444
           | |||||
Sbjct: 297 cgaggta 291

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 61/66 (92%)
 Strand = Plus / Minus

                                                                           
Query: 263     gggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgccggcc 322
               ||||||||||||||||||||||| |||||||| || || ||||||||||||||||| |||
Sbjct: 7508467 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 7508408

                     
Query: 323     agcagc 328
               ||||||
Sbjct: 7508407 agcagc 7508402



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 313      gacgccggccagcagcctcccga 335
                |||||||||||||||||||||||
Sbjct: 34705649 gacgccggccagcagcctcccga 34705627



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 407     gcgttcccggcgagctccag 426
               ||||||||||||||||||||
Sbjct: 7508324 gcgttcccggcgagctccag 7508305

---

>emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0021F22,
             complete sequence
          Length = 181498

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 61/66 (92%)
 Strand = Plus / Minus

                                                                         
Query: 263   gggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgccggcc 322
             ||||||||||||||||||||||| |||||||| || || ||||||||||||||||| |||
Sbjct: 30940 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 30881

                   
Query: 323   agcagc 328
             ||||||
Sbjct: 30880 agcagc 30875



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 407   gcgttcccggcgagctccag 426
             ||||||||||||||||||||
Sbjct: 30797 gcgttcccggcgagctccag 30778

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 138/169 (81%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
                ||||||||||||||  | ||| ||||||||||||||||||||||   |||||||||||| 
Sbjct: 20924435 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 20924494

                                                                            
Query: 318      cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
                || | |||||||| |  ||||||| |||||| | ||| || ||  | | |||||| ||||
Sbjct: 20924495 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 20924554

                                                                 
Query: 378      cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
                |||| |||  ||||||||||||| | || |||||||| || ||||||||
Sbjct: 20924555 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctccag 20924603



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 119/147 (80%)
 Strand = Plus / Plus

                                                                            
Query: 280      gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 339
                |||||||||||  |||||||||   ||||||||| ||||| | |||||| |   ||||||
Sbjct: 14468549 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14468608

                                                                            
Query: 340      ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 399
                || |||||| | ||| |||||  | | ||| |  ||||| ||||||| ||||||||||||
Sbjct: 14468609 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14468668

                                           
Query: 400      cttggcggcgttcccggcgagctccag 426
                | | || ||||||||||||||||||||
Sbjct: 14468669 cctcgccgcgttcccggcgagctccag 14468695

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 138/169 (81%)
 Strand = Plus / Plus

                                                                            
Query: 258      tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
                ||||||||||||||  | ||| ||||||||||||||||||||||   |||||||||||| 
Sbjct: 20850649 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 20850708

                                                                            
Query: 318      cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
                || | |||||||| |  ||||||| |||||| | ||| || ||  | | |||||| ||||
Sbjct: 20850709 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 20850768

                                                                 
Query: 378      cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
                |||| |||  ||||||||||||| | || |||||||| || ||||||||
Sbjct: 20850769 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctccag 20850817



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 119/147 (80%)
 Strand = Plus / Plus

                                                                            
Query: 280      gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 339
                |||||||||||  |||||||||   ||||||||| ||||| | |||||| |   ||||||
Sbjct: 14422833 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14422892

                                                                            
Query: 340      ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 399
                || |||||| | ||| |||||  | | ||| |  ||||| ||||||| ||||||||||||
Sbjct: 14422893 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14422952

                                           
Query: 400      cttggcggcgttcccggcgagctccag 426
                | | || ||||||||||||||||||||
Sbjct: 14422953 cctcgccgcgttcccggcgagctccag 14422979

---

>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 182172

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 138/169 (81%)
 Strand = Plus / Plus

                                                                         
Query: 258   tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
             ||||||||||||||  | ||| ||||||||||||||||||||||   |||||||||||| 
Sbjct: 9925  tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 9984

                                                                         
Query: 318   cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
             || | |||||||| |  ||||||| |||||| | ||| || ||  | | |||||| ||||
Sbjct: 9985  cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 10044

                                                              
Query: 378   cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
             |||| |||  ||||||||||||| | || |||||||| || ||||||||
Sbjct: 10045 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctccag 10093

---

>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 107819

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 138/169 (81%)
 Strand = Plus / Minus

                                                                         
Query: 258   tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
             ||||||||||||||  | ||| ||||||||||||||||||||||   |||||||||||| 
Sbjct: 34560 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 34501

                                                                         
Query: 318   cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
             || | |||||||| |  ||||||| |||||| | ||| || ||  | | |||||| ||||
Sbjct: 34500 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 34441

                                                              
Query: 378   cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
             |||| |||  ||||||||||||| | || |||||||| || ||||||||
Sbjct: 34440 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctccag 34392

---

>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence
          Length = 538

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           |||||||||||||||| | |||||||||||| | ||| |||||||| |||||||||||||
Sbjct: 266 tcttggggagcagcacggagttgatgttggggatcacaccgccgtgggcgatggtgacgc 325

                      
Query: 318 cggccagcagc 328
           |||| ||||||
Sbjct: 326 cggcgagcagc 336



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 44/51 (86%), Gaps = 6/51 (11%)
 Strand = Plus / Plus

                                                              
Query: 193 cttcttgggggacttggcggc------cttcttgggcgacttgccctcctt 237
           |||||||||||||||||||||      |||||||||||||||| |||||||
Sbjct: 195 cttcttgggggacttggcggccgtcttcttcttgggcgacttggcctcctt 245

---

>ref|XM_482492.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 405

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 134/165 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 339
           |||||||||||  ||||||||||  |||||||||||| || | ||||| | |   |||||
Sbjct: 339 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 280

                                                                       
Query: 340 ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 399
           || |||||| | |||||||||  | | |||||| |||||||| || | ||||||||||||
Sbjct: 279 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 220

                                                        
Query: 400 cttggcggcgttcccggcgagctccagaagctccgcggccaggta 444
           |   || ||||||||||||||||| |||| ||| ||||| |||||
Sbjct: 219 ccgcgccgcgttcccggcgagctcaagaacctcggcggcgaggta 175

---

>gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds
          Length = 763

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 136/169 (80%)
 Strand = Plus / Plus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           |||||||||||||||| |  | |||||||||||| || ||||| || ||||||||||| |
Sbjct: 291 tcttggggagcagcacagactggatgttgggcagaaccccgccctgggcgatggtgaccc 350

                                                                       
Query: 318 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
           |  | |||||  |   |||||||| |||||| | |||||||||  ||||||||||||| |
Sbjct: 351 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggga 410

                                                            
Query: 378 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
            |||||| | ||||||||| |||  ||| ||||| ||||| | ||||||
Sbjct: 411 tgatgcgagtcttcttgttatcccgggcagcgttgccggccaactccag 459

---

>emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA
          Length = 775

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 155/193 (80%), Gaps = 1/193 (0%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| ||||||||||  | ||||||||||||||||||||| || |||||||
Sbjct: 402 cggtcttcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgagcgatgg 343

                                                                       
Query: 312 tgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcc 371
           | || ||  |||||||| |   |||||||| |||||| | ||| || ||  ||||||| |
Sbjct: 342 tcactcctcccagcagcttgttgagctcctcgtcgttgcgcaccgccagctgcaggtggc 283

                                                                       
Query: 372 tgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagct 431
            ||| | ||||||||  |||||||||||   ||| ||||| ||||| |||||||| | ||
Sbjct: 282 gggggatgatgcggg-tttcttgttgtcgcgggcagcgttgccggccagctccaggatct 224

                        
Query: 432 ccgcggccaggta 444
           | |||| ||||||
Sbjct: 223 cggcggtcaggta 211

---

>gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and histone H2A variant (H2AInr)
            genes, complete cds
          Length = 2396

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 141/175 (80%), Gaps = 3/175 (1%)
 Strand = Plus / Minus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| || |||||||
Sbjct: 1588 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgggcgatgg 1529

                                                                        
Query: 312  tgacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcc 371
            |||| ||| |||||||| |   |||||||| |||||| | |||||| ||  ||||||| |
Sbjct: 1528 tgactccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgac 1469

                                                                   
Query: 372  tgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
             ||| | ||||||||   ||||||||||   |||||| || ||||| ||||||||
Sbjct: 1468 gggggatgatgcggg---tcttgttgtcgcgggcggcattgccggccagctccag 1417

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                            
Query: 280      gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 339
                |||||||||||  ||||||||||  |||||||||||| || | ||||| | |   |||||
Sbjct: 20566495 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 20566436

                                                                            
Query: 340      ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 399
                || |||||| | |||||||||  | | |||||| |||||||| || | ||||||||||||
Sbjct: 20566435 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 20566376

                                             
Query: 400      cttggcggcgttcccggcgagctccagaa 428
                |   || ||||||||||||||||| ||||
Sbjct: 20566375 ccgcgccgcgttcccggcgagctcaagaa 20566347



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 406      ggcgttcccggcgagctccag 426
                |||||||||||||||||||||
Sbjct: 17645345 ggcgttcccggcgagctccag 17645365

---

>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0032E15
          Length = 120419

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                         
Query: 280   gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 339
             |||||||||||  ||||||||||  |||||||||||| || | ||||| | |   |||||
Sbjct: 70456 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 70397

                                                                         
Query: 340   ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 399
             || |||||| | |||||||||  | | |||||| |||||||| || | ||||||||||||
Sbjct: 70396 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 70337

                                          
Query: 400   cttggcggcgttcccggcgagctccagaa 428
             |   || ||||||||||||||||| ||||
Sbjct: 70336 ccgcgccgcgttcccggcgagctcaagaa 70308

---

>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1663_D06
          Length = 139103

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                         
Query: 280   gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 339
             |||||||||||  ||||||||||  |||||||||||| || | ||||| | |   |||||
Sbjct: 40867 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 40808

                                                                         
Query: 340   ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 399
             || |||||| | |||||||||  | | |||||| |||||||| || | ||||||||||||
Sbjct: 40807 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 40748

                                          
Query: 400   cttggcggcgttcccggcgagctccagaa 428
             |   || ||||||||||||||||| ||||
Sbjct: 40747 ccgcgccgcgttcccggcgagctcaagaa 40719

---

>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full
           insert sequence
          Length = 824

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 133/165 (80%)
 Strand = Plus / Minus

                                                                       
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 339
           |||||||||||  |||||||||   ||||||||| ||||| | |||||| |   ||||||
Sbjct: 454 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 395

                                                                       
Query: 340 ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 399
           || |||||| | ||| |||||  | | ||| |  ||||| ||||||| ||||||||||||
Sbjct: 394 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 335

                                                        
Query: 400 cttggcggcgttcccggcgagctccagaagctccgcggccaggta 444
           | | || |||||||||||||||||||| | ||| ||||| |||||
Sbjct: 334 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggta 290

---

>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full
           insert sequence
          Length = 733

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 133/165 (80%)
 Strand = Plus / Minus

                                                                       
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 339
           |||||||||||  |||||||||   ||||||||| ||||| | |||||| |   ||||||
Sbjct: 453 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 394

                                                                       
Query: 340 ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 399
           || |||||| | ||| |||||  | | ||| |  ||||| ||||||| ||||||||||||
Sbjct: 393 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 334

                                                        
Query: 400 cttggcggcgttcccggcgagctccagaagctccgcggccaggta 444
           | | || |||||||||||||||||||| | ||| ||||| |||||
Sbjct: 333 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggta 289

---

>ref|XM_478633.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 830

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                       
Query: 373 gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctc 432
           |||||| ||||||| ||||||||||||| | || ||||||||||||||||| |||| |||
Sbjct: 401 gggcactatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctcaagaacctc 342

                       
Query: 433 cgcggccaggta 444
            ||||| |||||
Sbjct: 341 agcggcgaggta 330

---

>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full
           insert sequence
          Length = 830

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                       
Query: 373 gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctc 432
           |||||| ||||||| ||||||||||||| | || ||||||||||||||||| |||| |||
Sbjct: 401 gggcactatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctcaagaacctc 342

                       
Query: 433 cgcggccaggta 444
            ||||| |||||
Sbjct: 341 agcggcgaggta 330

---

>ref|XM_478632.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 823

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 374 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctcc 433
           ||||||||||||| ||||||||||||| | || ||||||||||||||||| || | ||| 
Sbjct: 394 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctcgagcacctca 335

                      
Query: 434 gcggccaggta 444
           ||||| |||||
Sbjct: 334 gcggcgaggta 324

---

>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:11561 IMAGE:3156946), complete cds
          Length = 1414

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 405 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 346

                      
Query: 318 cggccagcagc 328
           || ||||||||
Sbjct: 345 cgcccagcagc 335

---

>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence
          Length = 185902

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                          
Query: 258    tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
              ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 149656 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 149715

                         
Query: 318    cggccagcagc 328
              || ||||||||
Sbjct: 149716 cgcccagcagc 149726

---

>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA
          Length = 1414

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 405 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 346

                      
Query: 318 cggccagcagc 328
           || ||||||||
Sbjct: 345 cgcccagcagc 335

---

>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X
          Length = 2166

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 984 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 925

                      
Query: 318 cggccagcagc 328
           || ||||||||
Sbjct: 924 cgcccagcagc 914

---

>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X
          Length = 1359

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 409 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 350

                      
Query: 318 cggccagcagc 328
           || ||||||||
Sbjct: 349 cgcccagcagc 339

---

>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:6616 IMAGE:3490058), complete cds
          Length = 1367

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 399 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 340

                      
Query: 318 cggccagcagc 328
           || ||||||||
Sbjct: 339 cgcccagcagc 329

---

>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430002L09
           product:H2A histone family, member X, full insert
           sequence
          Length = 1379

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 428 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 369

                      
Query: 318 cggccagcagc 328
           || ||||||||
Sbjct: 368 cgcccagcagc 358

---

>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010005I09 product:H2A histone
           family, member X, full insert sequence
          Length = 564

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 425 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 366

                      
Query: 318 cggccagcagc 328
           || ||||||||
Sbjct: 365 cgcccagcagc 355

---

>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full
           insert sequence
          Length = 823

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 374 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctcc 433
           ||||||||||||| ||||||||||||| | || ||||||||||||||||| || | ||| 
Sbjct: 394 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctcgagcacctca 335

                      
Query: 434 gcggccaggta 444
           ||||| |||||
Sbjct: 334 gcggcgaggta 324

---

>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full
           insert sequence
          Length = 724

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 149/187 (79%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 474 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 415

                                                                       
Query: 318 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
            | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 414 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 355

                                                                       
Query: 378 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctccgcgg 437
           |||| | |  ||||||||||||| | || ||||||||||| |||||||| | ||| ||||
Sbjct: 354 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctccagcacctcggcgg 295

                  
Query: 438 ccaggta 444
           | |||||
Sbjct: 294 cgaggta 288

---

>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full
           insert sequence
          Length = 1718

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 374 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctcc 433
           ||||||||||||| ||||||||||||| | || ||||||||||||||||| || | ||| 
Sbjct: 395 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctcgagcacctca 336

                      
Query: 434 gcggccaggta 444
           ||||| |||||
Sbjct: 335 gcggcgaggta 325

---

>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118101

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 119/147 (80%)
 Strand = Plus / Minus

                                                                         
Query: 280   gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagcctcccgagctc 339
             |||||||||||  |||||||||   ||||||||| ||||| | |||||| |   ||||||
Sbjct: 48743 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 48684

                                                                         
Query: 340   ctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttcttgttgtc 399
             || |||||| | ||| |||||  | | ||| |  ||||| ||||||| ||||||||||||
Sbjct: 48683 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 48624

                                        
Query: 400   cttggcggcgttcccggcgagctccag 426
             | | || ||||||||||||||||||||
Sbjct: 48623 cctcgccgcgttcccggcgagctccag 48597

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                  
Query: 374      ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctc 423
                ||||||||||||| ||||||||||||| | || |||||||||||||||||
Sbjct: 21536909 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctc 21536860



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                        
Query: 373      gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaa 428
                |||||| ||||||| ||||||||||||| | || ||||||||||||||||| ||||
Sbjct: 21539549 gggcactatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctcaagaa 21539494

---

>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1582_D10
          Length = 103475

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                               
Query: 374   ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctc 423
             ||||||||||||| ||||||||||||| | || |||||||||||||||||
Sbjct: 74693 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctc 74644



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 373   gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaa 428
             |||||| ||||||| ||||||||||||| | || ||||||||||||||||| ||||
Sbjct: 77333 gggcactatgcgggtcttcttgttgtccctcgccgcgttcccggcgagctcaagaa 77278

---

>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone
             OSJNBa0031O09, complete sequence
          Length = 161339

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 135/169 (79%)
 Strand = Plus / Minus

                                                                         
Query: 258   tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
             ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 38482 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 38423

                                                                         
Query: 318   cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
              | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 38422 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 38363

                                                              
Query: 378   cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
             |||| | |  ||||||||||||| | || ||||||||||| ||||||||
Sbjct: 38362 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctccag 38314

---

>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map
              near C10769, complete sequence
          Length = 194856

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 135/169 (79%)
 Strand = Plus / Plus

                                                                          
Query: 258    tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
              ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 140950 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 141009

                                                                          
Query: 318    cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
               | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 141010 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 141069

                                                               
Query: 378    cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
              |||| | |  ||||||||||||| | || ||||||||||| ||||||||
Sbjct: 141070 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctccag 141118

---

>gb|AC147426.2| Oryza sativa chromosome 3  B1377B10 genomic sequence, complete sequence
          Length = 184366

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 135/169 (79%)
 Strand = Plus / Minus

                                                                          
Query: 258    tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
              ||||||| ||||| ||| | | ||||||||||||||||||||||   ||||| |||||| 
Sbjct: 181636 tcttgggaagcaggacctgctggatgttgggcagcacgccgccggcggcgatcgtgacgg 181577

                                                                          
Query: 318    cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
               | |||||||||| |  ||||||| |||||| | ||| || ||  | | |||||  ||||
Sbjct: 181576 tgcccagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgccgcggca 181517

                                                               
Query: 378    cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
              |||| | |  ||||||||||||| | || ||||||||||| ||||||||
Sbjct: 181516 cgatcctgttcttcttgttgtccctcgccgcgttcccggccagctccag 181468

---

>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                         
Query: 252   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 64633 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 64574

                              
Query: 312   tgacgccggccagcagc 328
             | |||| | ||||||||
Sbjct: 64573 tcacgcggcccagcagc 64557



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 252   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 60544 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 60603

                              
Query: 312   tgacgccggccagcagc 328
             | |||| | ||||||||
Sbjct: 60604 tcacgcggcccagcagc 60620



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                          
Query: 252    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 101104 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 101163

                    
Query: 312    tgacgc 317
              | ||||
Sbjct: 101164 tcacgc 101169

---

>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome
           13
          Length = 1357

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 846 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 787

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 786 tcacgcggcccagcagc 770

---

>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488308), mRNA
          Length = 456

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 427 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 368

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 367 tcacgcggcccagcagc 351

---

>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC611496), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488291), mRNA
          Length = 387

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289),
           mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488278), mRNA
          Length = 576

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488272), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132),
           mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488270), mRNA
          Length = 462

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 433 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 374

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 373 tcacgcggcccagcagc 357

---

>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488262), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082),
           mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488254), mRNA
          Length = 417

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 388 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 329

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 328 tcacgcggcccagcagc 312

---

>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251),
           mRNA
          Length = 396

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 2 (LOC488268), mRNA
          Length = 402

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 1 (LOC488268), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2
           (LOC665433), mRNA
          Length = 465

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 396 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 337

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 336 tcacgcggcccagcagc 320

---

>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1
           (LOC665433), mRNA
          Length = 467

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 398 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 339

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 338 tcacgcggcccagcagc 322

---

>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203),
           mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained
           intron
          Length = 497

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 395 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 336

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 335 tcacgcggcccagcagc 319

---

>emb|X94693.1|TAH2A254 T.aestivum histone H2A gene
          Length = 2241

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 374  ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
            |||||||| |||| ||||||||||||| |||||||||| ||||| ||||||||
Sbjct: 1613 ggcacgatacgggtcttcttgttgtccctggcggcgtttccggccagctccag 1561

---

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1937 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1878

                             
Query: 312  tgacgccggccagcagc 328
            | |||| | ||||||||
Sbjct: 1877 tcacgcggcccagcagc 1861

---

>emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones
          Length = 1653

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1500 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1441

                             
Query: 312  tgacgccggccagcagc 328
            | |||| | ||||||||
Sbjct: 1440 tcacgcggcccagcagc 1424

---

>emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones
          Length = 1635

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1246 cggtcttcttgggcagcagcacagcctggatgttgggcagaacgccgccctgcgcgatgg 1187

                             
Query: 312  tgacgccggccagcagc 328
            | |||| | ||||||||
Sbjct: 1186 tcacgcggcccagcagc 1170

---

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1312 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1253

                             
Query: 312  tgacgccggccagcagc 328
            | |||| | ||||||||
Sbjct: 1252 tcacgcggcccagcagc 1236

---

>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)
          Length = 1797

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1313 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1254

                             
Query: 312  tgacgccggccagcagc 328
            | |||| | ||||||||
Sbjct: 1253 tcacgcggcccagcagc 1237

---

>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571
           IMAGE:30789778), complete cds
          Length = 1075

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 374 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 315

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 314 tcacgcggcccagcagc 298

---

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
              novel gene, the genes for three H1, four H2a, five H2b,
              four H3 and four H4 histone family members, the 3' end of a
              variant of the Hfe gene for hemochromatosis protein (Mr2)
              and ten CpG islands, complete sequence
          Length = 184730

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                          
Query: 252    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 163969 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 164028

                               
Query: 312    tgacgccggccagcagc 328
              | |||| | ||||||||
Sbjct: 164029 tcacgcggcccagcagc 164045



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                         
Query: 252   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 55440 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 55381

                              
Query: 312   tgacgccggccagcagc 328
             | |||| | ||||||||
Sbjct: 55380 tcacgcggcccagcagc 55364



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 252   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 51351 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 51410

                              
Query: 312   tgacgccggccagcagc 328
             | |||| | ||||||||
Sbjct: 51411 tcacgcggcccagcagc 51427



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 252   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 14876 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 14817

                   
Query: 312   tgacgc 317
             | ||||
Sbjct: 14816 tcacgc 14811

---

>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA
          Length = 2493

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 408 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 349

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 348 tcacgcggcccagcagc 332

---

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 252   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 33279 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 33338

                              
Query: 312   tgacgccggccagcagc 328
             | |||| | ||||||||
Sbjct: 33339 tcacgcggcccagcagc 33355



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                         
Query: 252   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 10997 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 10938

                              
Query: 312   tgacgccggccagcagc 328
             | |||| | ||||||||
Sbjct: 10937 tcacgcggcccagcagc 10921

---

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 252   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 59920 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 59979

                              
Query: 312   tgacgccggccagcagc 328
             | |||| | ||||||||
Sbjct: 59980 tcacgcggcccagcagc 59996



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                         
Query: 252   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
             ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 52545 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 52604

                              
Query: 312   tgacgccggccagcagc 328
             | |||| | ||||||||
Sbjct: 52605 tcacgcggcccagcagc 52621

---

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                          
Query: 252    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 174454 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 174513

                               
Query: 312    tgacgccggccagcagc 328
              | |||| | ||||||||
Sbjct: 174514 tcacgcggcccagcagc 174530



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                          
Query: 252    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 142446 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 142505

                               
Query: 312    tgacgccggccagcagc 328
              | |||| | ||||||||
Sbjct: 142506 tcacgcggcccagcagc 142522



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                          
Query: 252    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 137775 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 137716

                               
Query: 312    tgacgccggccagcagc 328
              | |||| | ||||||||
Sbjct: 137715 tcacgcggcccagcagc 137699



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                               
Query: 280    gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
              |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 207873 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 207921

---

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                          
Query: 252    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 142184 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 142125

                               
Query: 312    tgacgccggccagcagc 328
              | |||| | ||||||||
Sbjct: 142124 tcacgcggcccagcagc 142108



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                          
Query: 252    cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
              ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 136882 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 136941

                               
Query: 312    tgacgccggccagcagc 328
              | |||| | ||||||||
Sbjct: 136942 tcacgcggcccagcagc 136958

---

>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771
           IMAGE:1263745), complete cds
          Length = 527

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 386 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 327

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 326 tcacgcggcccagcagc 310

---

>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847
           IMAGE:5713252), complete cds
          Length = 492

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 394 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 335

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 334 tcacgcggcccagcagc 318

---

>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:I0C0045N09 product:histone 1,
           H2ad, full insert sequence
          Length = 446

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 397 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 338

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 337 tcacgcggcccagcagc 321

---

>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730004H15 product:histone 1, H2ai, full insert
           sequence
          Length = 1396

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 67/77 (87%), Gaps = 1/77 (1%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 375 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 316

                            
Query: 312 tgacgccggccagcagc 328
           | ||| |||||||||||
Sbjct: 315 tcacg-cggccagcagc 300

---

>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920064A15 product:histone 1, H2ad, full
           insert sequence
          Length = 445

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 395 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 336

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 335 tcacgcggcccagcagc 319

---

>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA
          Length = 506

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 409 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 350

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 349 tcacgcggcccagcagc 333

---

>gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, complete cds
          Length = 2241

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 374  ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
            |||||||| |||| ||||||||||||| |||||||||| ||||| ||||||||
Sbjct: 1613 ggcacgatacgggtcttcttgttgtccctggcggcgtttccggccagctccag 1561

---

>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds
          Length = 447

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 376 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 317

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 316 tcacgcggcccagcagc 300

---

>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds
          Length = 444

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 376 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 317

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 316 tcacgcggcccagcagc 300

---

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 634 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 575

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 574 tcacgcggcccagcagc 558

---

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 632 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 573

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 572 tcacgcggcccagcagc 556

---

>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA
          Length = 527

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 386 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 327

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 326 tcacgcggcccagcagc 310

---

>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA
          Length = 705

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 477 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 418

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 417 tcacgcggcccagcagc 401

---

>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone
            H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 1465 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1524

                             
Query: 312  tgacgccggccagcagc 328
            | |||| | ||||||||
Sbjct: 1525 tcacgcggcccagcagc 1541

---

>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1190022L06 product:HISTONE H2A
           homolog [Homo sapiens], full insert sequence
          Length = 705

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 477 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 418

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 417 tcacgcggcccagcagc 401

---

>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
           library, clone:9030420B16 product:histone 1, H2ac, full
           insert sequence
          Length = 2493

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 408 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 349

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 348 tcacgcggcccagcagc 332

---

>ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (Hist1h2aa), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA
          Length = 393

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds
          Length = 1390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 804 tcacgcggcccagcagc 788

---

>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds
          Length = 1390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 804 tcacgcggcccagcagc 788

---

>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds
          Length = 1390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 804 tcacgcggcccagcagc 788

---

>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds
          Length = 1390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 804 tcacgcggcccagcagc 788

---

>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds
          Length = 1392

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 863 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 804

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 803 tcacgcggcccagcagc 787

---

>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds
          Length = 1381

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 861 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 802

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 801 tcacgcggcccagcagc 785

---

>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds
          Length = 1390

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 804 tcacgcggcccagcagc 788

---

>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds
          Length = 1201

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 898 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 839

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 838 tcacgcggcccagcagc 822

---

>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence
          Length = 1357

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 846 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 787

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 786 tcacgcggcccagcagc 770

---

>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds
          Length = 1387

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 861 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 802

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 801 tcacgcggcccagcagc 785

---

>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA
          Length = 387

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 304 tcacgcggcccagcagc 288

---

>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone
           wcH2A-10
          Length = 691

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 374 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctcc 433
           ||||||||||||| ||||||||||||| | || ||||||||||| | |||||||| ||| 
Sbjct: 329 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggccaactccagaacctca 270

                
Query: 434 gcggc 438
           |||||
Sbjct: 269 gcggc 265

---

>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4
          Length = 725

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 374 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctcc 433
           ||||||||||||| ||||||||||||| | || ||||||||||| | |||||||| ||| 
Sbjct: 327 ggcacgatgcgggtcttcttgttgtccctcgccgcgttcccggccaactccagaacctca 268

                
Query: 434 gcggc 438
           |||||
Sbjct: 267 gcggc 263

---

>gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent histone H2A mRNA,
           complete cds
          Length = 466

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 135/169 (79%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | |||||||||||| || || || || ||||||||||| |
Sbjct: 379 tcttgggcagcagcacggcctggatgttgggcaggacccccccctgggcgatggtgactc 320

                                                                       
Query: 318 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
           || |||||||| |   |||||||| |||||| | |||||| ||  ||||||| | ||| |
Sbjct: 319 cgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacggggga 260

                                                            
Query: 378 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
            |||||| | ||||||||||||   |||||| || ||||| ||||||||
Sbjct: 259 tgatgcgagtcttcttgttgtcgcgggcggcattgccggccagctccag 211

---

>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence
          Length = 567

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 427 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 368

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 367 tcacgcggcccagcagc 351

---

>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds
          Length = 929

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 527 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 468

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 467 tcacgcggcccagcagc 451

---

>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene
          Length = 668

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 487 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 428

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 427 tcacgcggcccagcagc 411

---

>gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:7205580, complete cds
          Length = 799

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 128/160 (80%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           |||||||||||||||| |  | |||||||||||| || ||||| || ||||||||||| |
Sbjct: 370 tcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgaccc 311

                                                                       
Query: 318 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
           |  | |||||  |   |||||||| |||||| | |||||||||  ||||||||||||| |
Sbjct: 310 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggga 251

                                                   
Query: 378 cgatgcgggacttcttgttgtccttggcggcgttcccggc 417
            ||| || | ||||||||| |||  ||| ||||| |||||
Sbjct: 250 tgatccgagtcttcttgttatcccgggcagcgttgccggc 211

---

>ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616611), mRNA
          Length = 393

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| ||||||||||  | |||||||||||| |||||||| || |||||||
Sbjct: 364 cggtcttcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgagcgatgg 305

               
Query: 312 tgac 315
           ||||
Sbjct: 304 tgac 301

---

>ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A histone family, member J
           isoform 2 (LOC486669), mRNA
          Length = 598

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 442 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 383

               
Query: 312 tgac 315
           ||||
Sbjct: 382 tgac 379

---

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 128/160 (80%)
 Strand = Plus / Minus

                                                                        
Query: 258  tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
            |||||||||||||||| |  | |||||||||||| || ||||| || ||||||||||| |
Sbjct: 4729 tcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgaccc 4670

                                                                        
Query: 318  cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
            |  | |||||  |   |||||||| |||||| | |||||||||  ||||||||||||| |
Sbjct: 4669 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggga 4610

                                                    
Query: 378  cgatgcgggacttcttgttgtccttggcggcgttcccggc 417
             ||| || | ||||||||| |||  ||| ||||| |||||
Sbjct: 4609 tgatccgagtcttcttgttatcccgggcagcgttgccggc 4570

---

>ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone H2A.x (H2a/x)
           (LOC500987), mRNA
          Length = 1569

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 253 ggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 312
           |||| ||||||| |||||||| |  | |||||||||||| |||||||| |||||||| ||
Sbjct: 642 ggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatagt 583

                           
Query: 313 gacgccggccagcagc 328
            |||||| ||||||||
Sbjct: 582 cacgccgcccagcagc 567

---

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 152/192 (79%)
 Strand = Plus / Minus

                                                                        
Query: 253  ggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 312
            |||| ||||||| |||||||||| || ||||||||||||||| |||||    || |||||
Sbjct: 4163 ggtcttcttgggcagcagcaccgcgtggatgttgggcagcacaccgcccgaagcaatggt 4104

                                                                        
Query: 313  gacgccggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcct 372
             ||  || |||||||| | || ||||||| |||||| |  | ||| ||  | | ||| | 
Sbjct: 4103 cacctcgcccagcagcttgcccagctcctcgtcgttgcggatggccagctggatgtggcg 4044

                                                                        
Query: 373  gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctc 432
            |||||||||||||  ||||||||||||   ||||||||| ||||| |||||||| | |||
Sbjct: 4043 gggcacgatgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctc 3984

                        
Query: 433  cgcggccaggta 444
             |||| ||||||
Sbjct: 3983 agcggtcaggta 3972

---

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 128/160 (80%)
 Strand = Plus / Minus

                                                                        
Query: 258  tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
            |||||||||||||||| |  | |||||||||||| || ||||| || ||||||||||| |
Sbjct: 4746 tcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgaccc 4687

                                                                        
Query: 318  cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
            |  | |||||  |   |||||||| |||||| | |||||||||  ||||||||||||| |
Sbjct: 4686 ctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggga 4627

                                                    
Query: 378  cgatgcgggacttcttgttgtccttggcggcgttcccggc 417
             ||| || | ||||||||| |||  ||| ||||| |||||
Sbjct: 4626 tgatccgagtcttcttgttatcccgggcagcgttgccggc 4587

---

>ref|NM_021840.2| Rattus norvegicus histone 2a (H2a), mRNA
          Length = 1579

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||| |||||  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 363 tcttgggcagcaacaccgcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 304

                      
Query: 318 cggccagcagc 328
            | ||||||||
Sbjct: 303 ggcccagcagc 293

---

>gb|BC099140.1| Rattus norvegicus histone 2a, mRNA (cDNA clone MGC:116285
           IMAGE:7457173), complete cds
          Length = 1579

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||| |||||  | |||||||||||| |||||||| ||||||||||| ||||
Sbjct: 363 tcttgggcagcaacaccgcctggatgttgggcaggacgccgccctgcgcgatggtcacgc 304

                      
Query: 318 cggccagcagc 328
            | ||||||||
Sbjct: 303 ggcccagcagc 293

---

>emb|BX063165.1|CNS09KWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 526 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 585

                      
Query: 318 cggccagcagc 328
           ||| |||||||
Sbjct: 586 cggacagcagc 596

---

>emb|BX063164.1|CNS09KWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 475 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 416

                      
Query: 318 cggccagcagc 328
           ||| |||||||
Sbjct: 415 cggacagcagc 405

---

>emb|BX040864.1|CNS093P0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 468 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 409

                      
Query: 318 cggccagcagc 328
           ||| |||||||
Sbjct: 408 cggacagcagc 398

---

>emb|BX019683.1|CNS08NCN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 479 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 420

                      
Query: 318 cggccagcagc 328
           ||| |||||||
Sbjct: 419 cggacagcagc 409

---

>emb|BX016452.1|CNS08KUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 76  tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 135

                      
Query: 318 cggccagcagc 328
           ||| |||||||
Sbjct: 136 cggacagcagc 146

---

>emb|BX016451.1|CNS08KUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 402 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 343

                      
Query: 318 cggccagcagc 328
           ||| |||||||
Sbjct: 342 cggacagcagc 332

---

>emb|BX009846.1|CNS08FRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 357

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 119 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 178

                      
Query: 318 cggccagcagc 328
           ||| |||||||
Sbjct: 179 cggacagcagc 189

---

>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted)
           (Hist1h2an_predicted), mRNA
          Length = 546

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| ||||||||||  | |||||||||||| |||||||| || |||||||| ||||
Sbjct: 358 tcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgtgcgatggtcacgc 299

                      
Query: 318 cggccagcagc 328
            | ||||||||
Sbjct: 298 ggcccagcagc 288

---

>ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020
           (ENSANGG00000023190), partial mRNA
          Length = 297

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 277 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 218

                      
Query: 318 cggccagcagc 328
           ||| |||||||
Sbjct: 217 cggacagcagc 207

---

>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040
           (ENSANGG00000013551), partial mRNA
          Length = 375

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 355 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 296

                      
Query: 318 cggccagcagc 328
           ||| |||||||
Sbjct: 295 cggacagcagc 285

---

>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004
           (ENSANGG00000000004), mRNA
          Length = 630

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||| || |
Sbjct: 469 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 410

                      
Query: 318 cggccagcagc 328
           ||| |||||||
Sbjct: 409 cggacagcagc 399

---

>emb|X14730.1|CMHIST2A Duck H2A histone gene
          Length = 845

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgac 315
           ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||||||
Sbjct: 508 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtgac 451

---

>emb|X02622.1|MMHISHSA Mouse gene fragment for histone H2a
          Length = 204

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 85  cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 26

                 
Query: 312 tgacgc 317
           | ||||
Sbjct: 25  tcacgc 20

---

>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds
          Length = 1390

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 888 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 829

                 
Query: 312 tgacgc 317
           | ||||
Sbjct: 828 tcacgc 823

---

>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA
          Length = 393

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305

                 
Query: 312 tgacgc 317
           | ||||
Sbjct: 304 tcacgc 299

---

>gb|U95112.1|MCU95112 Mus caroli histone H2a pseudogene, complete sequence
          Length = 468

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||||
Sbjct: 330 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 271

                 
Query: 312 tgacgc 317
           | ||||
Sbjct: 270 tcacgc 265

---

>ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA
          Length = 1991

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895),
           mRNA
          Length = 390

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 305

            
Query: 312 t 312
           |
Sbjct: 304 t 304

---

>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891),
           mRNA
          Length = 390

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 305

            
Query: 312 t 312
           |
Sbjct: 304 t 304

---

>ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427885),
           mRNA
          Length = 918

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 305

            
Query: 312 t 312
           |
Sbjct: 304 t 304

---

>ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427881),
           mRNA
          Length = 534

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 508 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 449

            
Query: 312 t 312
           |
Sbjct: 448 t 448

---

>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA
          Length = 1220

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 1194 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 1135

             
Query: 312  t 312
            |
Sbjct: 1134 t 1134

---

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 1167 cggtcttcttgggcagcagcacagcctggatgttgggcagcaccccgccctgcgcgatgg 1226

             
Query: 312  t 312
            |
Sbjct: 1227 t 1227

---

>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC417952), mRNA
          Length = 1374

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 726 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 785

            
Query: 312 t 312
           |
Sbjct: 786 t 786

---

>gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC:70265
           IMAGE:6493838), complete cds
          Length = 1607

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 356 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 308

---

>gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMAGE:6819179), with
           apparent retained intron
          Length = 1490

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 362 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 314

---

>emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           ||||||||||||||||||||| || |||||||| || |||| |||||||
Sbjct: 141 gatgttgggcagcacgccgccctgggcgatggtcaccccggacagcagc 93

---

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 5295 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 5236

             
Query: 312  t 312
            |
Sbjct: 5235 t 5235



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 252  cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
            ||||| ||||||| |||||||| |  | ||||||||||||||| || || ||||||||||
Sbjct: 2149 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccaccctgcgcgatgg 2208

             
Query: 312  t 312
            |
Sbjct: 2209 t 2209

---

>emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking regions
          Length = 843

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 697 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 638

            
Query: 312 t 312
           |
Sbjct: 637 t 637

---

>ref|XM_694570.1| PREDICTED: Danio rerio similar to histone H2A (LOC571016), partial
           mRNA
          Length = 374

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||||||||| || |||||||
Sbjct: 354 cggtcttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgagcgatgg 295

            
Query: 312 t 312
           |
Sbjct: 294 t 294

---

>dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730450G06 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens], full insert
           sequence
          Length = 924

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
           enriched library, clone:D130049H21 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens], full insert
           sequence
          Length = 1991

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130315C04 product:H2A HISTONE FAMILY,
           MEMBER L homolog [Homo sapiens], full insert sequence
          Length = 1500

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 391 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 343

---

>dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930534G10 product:unclassifiable, full
           insert sequence
          Length = 767

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 217 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 265

---

>dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length
           enriched library, clone:C630019H19 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens]; RING finger
           protein TERF, full insert sequence
          Length = 3665

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 390 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 342

---

>dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230003M12 product:H2A HISTONE
           FAMILY, MEMBER L homolog [Homo sapiens], full insert
           sequence
          Length = 2150

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 393 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 345

---

>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA
          Length = 393

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 288

---

>gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, complete cds
          Length = 1201

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 870 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 822

---

>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds
          Length = 1390

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 788

---

>dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, complete cds
          Length = 1028

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 695 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 636

            
Query: 312 t 312
           |
Sbjct: 635 t 635

---

>gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, complete cds
          Length = 740

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 542 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 483

            
Query: 312 t 312
           |
Sbjct: 482 t 482

---

>gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, complete cds
          Length = 827

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 525 cggtcttcttgggcagcagcacagcctggatgttgggcagcaccccgccctgcgcgatgg 466

            
Query: 312 t 312
           |
Sbjct: 465 t 465

---

>gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, complete cds
          Length = 743

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 387 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 328

            
Query: 312 t 312
           |
Sbjct: 327 t 327

---

>emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chromosome 11, complete
             sequence
          Length = 103129

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 280   gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
             |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 39545 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 39497

---

>gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, complete sequence
          Length = 571

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 403 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 355

---

>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence
          Length = 531

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||  |||||||| ||||||||||
Sbjct: 391 cggtcttcttgggcagcagcacggcctggatgttgggcacgacgccgccctgcgcgatgg 332

                            
Query: 312 tgacgccggccagcagc 328
           | |||| | ||||||||
Sbjct: 331 tcacgcggcccagcagc 315

---

>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks
          Length = 1564

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| ||||||||||
Sbjct: 282 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 341

            
Query: 312 t 312
           |
Sbjct: 342 t 342

---

>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 309
           ||||||| |||||||| |  | ||||||||||||||||||||| ||||||||
Sbjct: 441 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgat 390

---

>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 309
           ||||||| |||||||| |  | ||||||||||||||||||||| ||||||||
Sbjct: 441 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgat 390

---

>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA
          Length = 393

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| |||| ||||||||||| |  | |||||||||||| |||||||| || |||||||
Sbjct: 364 cggtcttcttagggagcagcacggcctggatgttgggcaggacgccgccctgagcgatgg 305

               
Query: 312 tgac 315
           ||||
Sbjct: 304 tgac 301

---

>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299),
           mRNA
          Length = 387

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||  |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatgg 305

               
Query: 312 tgac 315
           ||||
Sbjct: 304 tgac 301

---

>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297),
           mRNA
          Length = 393

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||  |||||||| ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatgg 305

               
Query: 312 tgac 315
           ||||
Sbjct: 304 tgac 301

---

>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x)
           (LOC489372), mRNA
          Length = 841

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 253 ggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 312
           |||| ||||||| |||||||| |  | |||||||||||| ||||| || |||||||| ||
Sbjct: 660 ggtcttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgcgcgatcgt 601

                           
Query: 313 gacgccggccagcagc 328
            |||||| ||||||||
Sbjct: 600 cacgccgcccagcagc 585

---

>ref|XM_692742.1| PREDICTED: Danio rerio similar to H2A histone family, member X
           (LOC569361), partial mRNA
          Length = 462

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| ||||||||||  | ||||||||||||||| || || || |||||||
Sbjct: 394 cggtcttcttgggcagcagcaccgcctggatgttgggcagcacacctccctgagcgatgg 335

                           
Query: 312 tgacgccggccagcag 327
           | || ||| |||||||
Sbjct: 334 tcactccgcccagcag 319

---

>emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4
          Length = 895

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 281 atgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           ||||||||||| || ||||| |||||||||||||| ||| ||||||||
Sbjct: 60  atgttgggcagtaccccgccctgcgcgatggtgacaccgcccagcagc 107

---

>gb|AY104828.1| Zea mays PCO072413 mRNA sequence
          Length = 741

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 374 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggc 417
           ||||| ||||||| ||||||||||||| | ||||||||||||||
Sbjct: 302 ggcacaatgcgggtcttcttgttgtccctcgcggcgttcccggc 259

---

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                        
Query: 373  gggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctc 432
            |||||||||||||  ||||||||||||   ||||||||| ||||| |||||||| | |||
Sbjct: 3462 gggcacgatgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctc 3403

                        
Query: 433  cgcggccaggta 444
             |||| ||||||
Sbjct: 3402 agcggtcaggta 3391

---

>gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone MGC:82198
           IMAGE:3402168), complete cds
          Length = 1591

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 334 gagctcctggtcgttcctcacggcgaggagcaggtgcctgggcacgatgcgggacttctt 393
           ||||||||  ||||| | ||| |||||  ||||||||||||| | |||||||| ||||||
Sbjct: 290 gagctcctcatcgttgcgcacagcgagctgcaggtgcctggggatgatgcgggtcttctt 231

                                                              
Query: 394 gttgtccttggcggcgttcccggcgagctccagaagctccgcggccaggta 444
           ||| |||  ||| ||||| ||||| | |||||| | ||| |||| ||||||
Sbjct: 230 gttatcccgggcagcgttgccggccaactccaggatctcagcggtcaggta 180

---

>emb|BX008487.1|CNS08EPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 312
           ||||||| |||||||| |  | ||||||||||||||||||||| || ||||||||
Sbjct: 229 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggt 175

---

>ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone H2A.l (H2A/l)
           (LOC502125), mRNA
          Length = 393

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 312
           ||||||| ||||||||||  | |||||||||||| |||||||| || ||||||||
Sbjct: 358 tcttgggcagcagcaccgcttggatgttgggcagaacgccgccctgggcgatggt 304

---

>gb|AY104826.1| Zea mays PCO099353 mRNA sequence
          Length = 793

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 ggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccagaagctcc 433
           ||||||||||||| ||||||||| ||| | || |||||||| || |||||||| | ||| 
Sbjct: 344 ggcacgatgcgggtcttcttgttatccctcgctgcgttcccagcaagctccaggacctca 285

                      
Query: 434 gcggccaggta 444
           ||||| |||||
Sbjct: 284 gcggcgaggta 274

---

>gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MGC:130330
           IMAGE:40055855), complete cds
          Length = 391

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| ||||| || ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatgg 305

                 
Query: 312 tgacgc 317
           | ||||
Sbjct: 304 tcacgc 299

---

>gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MGC:130331
           IMAGE:40055860), complete cds
          Length = 391

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| ||||| || ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatgg 305

                 
Query: 312 tgacgc 317
           | ||||
Sbjct: 304 tcacgc 299

---

>ref|NM_001030332.2| Xenopus tropicalis hypothetical protein LOC594922 (LOC594922), mRNA
          Length = 519

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||||||||||||| | ||| |||| ||||||||| |||  ||| ||||||||||| | ||
Sbjct: 267 gcaggtgcctggggatgatacgggtcttcttgttatcccgggcagcgttcccggccaact 208

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||| | ||| |||| ||||||
Sbjct: 207 ccaggatctcagcggtcaggta 186

---

>ref|NM_001030325.2| Xenopus tropicalis hypothetical protein LOC594911 (LOC594911), mRNA
          Length = 787

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||||||||||||| | ||| |||| ||||||||| |||  ||| ||||||||||| | ||
Sbjct: 258 gcaggtgcctggggatgatacgggtcttcttgttatcccgggcagcgttcccggccaact 199

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||| | ||| |||| ||||||
Sbjct: 198 ccaggatctcagcggtcaggta 177

---

>ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA
          Length = 390

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| ||||| || ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatgg 305

                 
Query: 312 tgacgc 317
           | ||||
Sbjct: 304 tcacgc 299

---

>gb|BC074601.1| Xenopus tropicalis MGC69325 protein, mRNA (cDNA clone MGC:69325
           IMAGE:5308897), complete cds
          Length = 1495

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||||||||||||| | ||| |||| ||||||||| |||  ||| ||||||||||| | ||
Sbjct: 269 gcaggtgcctggggatgatacgggtcttcttgttatcccgggcagcgttcccggccaact 210

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||| | ||| |||| ||||||
Sbjct: 209 ccaggatctcagcggtcaggta 188

---

>gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds
          Length = 643

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Minus

                                                                       
Query: 266 agcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagc 325
           |||| ||||||||||||||| ||||| || || ||||| ||||| |||||||| || || 
Sbjct: 404 agcaacaccgggttgatgttcggcaggactccaccgtgagcgatcgtgacgcctgcaagt 345

                                                             
Query: 326 agcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctggg 375
           ||| | || |  ||||  ||||||||||| || || |||| |||||||||
Sbjct: 344 agcttgcccaattcctcatcgttcctcactgccagcagcacgtgcctggg 295

---

>emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes
          Length = 2597

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           |||||||||||||||| |  | |||||||||||| || || || || |||||||||||||
Sbjct: 721 tcttggggagcagcactgcctggatgttgggcagaacaccaccctgagcgatggtgacgc 662

             
Query: 318 cg 319
           ||
Sbjct: 661 cg 660

---

>emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chromosome 13 Contains the
             3' end of the Slc17a1 gene for solute carrier family 17
             vesicular glutamate transporter) member 1, the gene for a
             novel solute carrier family 17 (Slc17a) member, a U1 small
             nuclear ribonucleoprotein 1C (Snrp1c) pseudogene, a H2B
             histone family (H2b) pseudogene, the gene for a novel H2A
             histone family (H2a) member, a novel gene, the gene for
             the ortholog of human secretagogin, EF-hand calcium
             binding protein SCGN and the 3' end of a novel gene,
             complete sequence
          Length = 183698

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                         
Query: 252   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
             ||||| ||||||| |||||||| |  | |||||||||||| ||||| || ||||||||||
Sbjct: 53750 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatgg 53691

                   
Query: 312   tgacgc 317
             | ||||
Sbjct: 53690 tcacgc 53685

---

>ref|NM_001004821.1| Xenopus tropicalis MGC69325 protein (MGC69325), mRNA
          Length = 1495

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||||||||||||| | ||| |||| ||||||||| |||  ||| ||||||||||| | ||
Sbjct: 269 gcaggtgcctggggatgatacgggtcttcttgttatcccgggcagcgttcccggccaact 210

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||| | ||| |||| ||||||
Sbjct: 209 ccaggatctcagcggtcaggta 188

---

>gb|AY158921.1| Mus musculus histone protein Hist1h2aa gene, complete cds
          Length = 1201

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | |||||||||||| ||||| || ||||||||||
Sbjct: 304 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccaccctgcgcgatgg 363

                 
Query: 312 tgacgc 317
           | ||||
Sbjct: 364 tcacgc 369

---

>emb|CR762147.2| Xenopus tropicalis finished cDNA, clone TGas072e19
          Length = 519

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||||||||||||| | ||| |||| ||||||||| |||  ||| ||||||||||| | ||
Sbjct: 267 gcaggtgcctggggatgatacgggtcttcttgttatcccgggcagcgttcccggccaact 208

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||| | ||| |||| ||||||
Sbjct: 207 ccaggatctcagcggtcaggta 186

---

>emb|CR761789.2| Xenopus tropicalis finished cDNA, clone TGas125k04
          Length = 787

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 363 gcaggtgcctgggcacgatgcgggacttcttgttgtccttggcggcgttcccggcgagct 422
           ||||||||||||| | ||| |||| ||||||||| |||  ||| ||||||||||| | ||
Sbjct: 258 gcaggtgcctggggatgatacgggtcttcttgttatcccgggcagcgttcccggccaact 199

                                 
Query: 423 ccagaagctccgcggccaggta 444
           |||| | ||| |||| ||||||
Sbjct: 198 ccaggatctcagcggtcaggta 177

---

>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700),
           mRNA
          Length = 393

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 336 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 288

---

>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165
           IMAGE:3355200), complete cds
          Length = 897

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 378 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 330

---

>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456
           IMAGE:6671338), complete cds
          Length = 889

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 368 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 320

---

>ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427893),
           mRNA
          Length = 390

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| || || ||||||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccaccctgcgcgatgg 305

            
Query: 312 t 312
           |
Sbjct: 304 t 304

---

>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA
          Length = 496

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 378 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 330

---

>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488304), mRNA
          Length = 588

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           ||||| |||||| |||||||| ||||||||||| |||| | ||||||||
Sbjct: 483 gatgtggggcaggacgccgccctgcgcgatggtcacgcggcccagcagc 435

---

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                               
Query: 280    gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
              |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 100883 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 100835

---

>ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA
          Length = 390

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggt 312
           ||||||||||||||| ||||| |||||||||||
Sbjct: 336 gatgttgggcagcaccccgccctgcgcgatggt 304

---

>ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (RGD1564767_predicted),
           mRNA
          Length = 393

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggt 312
           |||||||||||| |||||||| |||||||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggt 304

---

>ref|XM_683938.1| PREDICTED: Danio rerio similar to histone H2A (LOC560527), mRNA
          Length = 387

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| || |||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcacaccgccctgagcgatgg 305

            
Query: 312 t 312
           |
Sbjct: 304 t 304

---

>ref|XM_694138.1| PREDICTED: Danio rerio similar to histone H2A (LOC570634), mRNA
          Length = 387

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| || |||||||
Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcacaccgccctgagcgatgg 305

            
Query: 312 t 312
           |
Sbjct: 304 t 304

---

>ref|XM_688696.1| PREDICTED: Danio rerio similar to histone H2A (LOC565417), mRNA
          Length = 384

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggt 312
           ||||||||||||||||||||| || ||||||||
Sbjct: 336 gatgttgggcagcacgccgccctgagcgatggt 304

---

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                          
Query: 284   ttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
             ||||||||||||||||| || |||||||| || ||| ||||||||
Sbjct: 98624 ttgggcagcacgccgccctgagcgatggtcactccgcccagcagc 98580

---

>gb|BC092032.1| Xenopus laevis hypothetical protein MGC83508, mRNA (cDNA clone
           MGC:84952 IMAGE:6323734), complete cds
          Length = 1415

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 133/169 (78%)
 Strand = Plus / Minus

                                                                       
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggtgacgc 317
           |||||||||||||||| |  | |||||||||||  || || || || ||||| ||||| |
Sbjct: 414 tcttggggagcagcacggcctggatgttgggcaagactcccccttgagcgatagtgaccc 355

                                                                       
Query: 318 cggccagcagcctcccgagctcctggtcgttcctcacggcgaggagcaggtgcctgggca 377
           |  |||||||| |   |||||||| ||||||||  | ||| |   ||||||||| ||| |
Sbjct: 354 ctcccagcagcttattgagctcctcgtcgttccggatggccaattgcaggtgccggggga 295

                                                            
Query: 378 cgatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
            |||||||| |||||||||||||  ||| ||||| ||||| | ||||||
Sbjct: 294 tgatgcgggtcttcttgttgtcccgggcagcgtttccggccaactccag 246

---

>gb|BC093343.1| Danio rerio MID1 interacting protein 1, mRNA (cDNA clone MGC:112497
           IMAGE:7411962), complete cds
          Length = 1726

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| || |||||||
Sbjct: 402 cggtcttcttgggcagcagcacggcctggatgttgggcagcacaccgccctgagcgatgg 343

            
Query: 312 t 312
           |
Sbjct: 342 t 342

---

>dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, complete cds
          Length = 1495

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 252 cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
           ||||| ||||||| |||||||| |  | ||||||||||||||| || || ||||||||||
Sbjct: 717 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccaccctgcgcgatgg 658

            
Query: 312 t 312
           |
Sbjct: 657 t 657

---

>gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, complete cds
          Length = 575

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggt 312
           ||||||||||||||| ||||| |||||||||||
Sbjct: 354 gatgttgggcagcaccccgccctgcgcgatggt 322

---

>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25,
             complete sequence
          Length = 167326

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                         
Query: 252   cggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatgg 311
             ||||| ||||||| |||||||| |  | ||||||||||||||| ||||| || |||||||
Sbjct: 87534 cggtcttcttgggcagcagcacggcctggatgttgggcagcacaccgccctgagcgatgg 87593

              
Query: 312   t 312
             |
Sbjct: 87594 t 87594



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 280    gatgttgggcagcacgccgccgtgcgcgatggt 312
              ||||||||||||||| ||||| || ||||||||
Sbjct: 117585 gatgttgggcagcacaccgccctgagcgatggt 117617



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 280   gatgttgggcagcacgccgccgtgcgcgatggt 312
             ||||||||||||||| ||||| || ||||||||
Sbjct: 91998 gatgttgggcagcacaccgccctgagcgatggt 92030



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 280   gatgttgggcagcacgccgccgtgcgcgatggt 312
             ||||||||||||||| ||||| || ||||||||
Sbjct: 62065 gatgttgggcagcacaccgccctgagcgatggt 62033



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                             
Query: 379   gatgcgggacttcttgttgtccttggcggcgttcccggcgagctccag 426
             |||||||| |||||||||||||   |||||||| ||||| | ||||||
Sbjct: 92097 gatgcgggtcttcttgttgtcccgagcggcgtttccggccaactccag 92144

---

>gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complete cds
          Length = 575

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggt 312
           |||||||||||| |||||||| |||||||||||
Sbjct: 400 gatgttgggcaggacgccgccctgcgcgatggt 368

---

>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds
          Length = 1173

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 280 gatgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           |||||||||||| ||||| || ||||||||||| |||| | ||||||||
Sbjct: 728 gatgttgggcaggacgccaccctgcgcgatggtcacgcggcccagcagc 680

---

>ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H2A.x (H2a/x)
           (LOC466864), mRNA
          Length = 432

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                       
Query: 253 ggtcctcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgatggt 312
           |||| ||||||| |||||||| |  | |||||||||||| ||||| || || ||||| ||
Sbjct: 363 ggtcttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgt 304

                           
Query: 313 gacgccggccagcagc 328
            |||||| ||||||||
Sbjct: 303 cacgccgcccagcagc 288

---

>ref|XM_527249.1| PREDICTED: Pan troglodytes similar to H2A histone family, member P
           (LOC471871), mRNA
          Length = 660

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 281 atgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           ||||||||||| || ||||| ||||||||||||||  || ||||||||
Sbjct: 497 atgttgggcaggacaccgccctgcgcgatggtgacttcgcccagcagc 450

---

>ref|NM_006632.1| Homo sapiens solute carrier family 17 (sodium phosphate), member 3
           (SLC17A3), mRNA
          Length = 1795

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 281 atgttgggcagcacgccgccgtgcgcgatggtgacgccggccagcagc 328
           ||||||||||| || ||||| ||||||||||||||  || ||||||||
Sbjct: 236 atgttgggcaggacaccgccctgcgcgatggtgacttcgcccagcagc 189

---

>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA
          Length = 578

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 309
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||
Sbjct: 401 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgat 350

---

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 258 tcttggggagcagcaccgggttgatgttgggcagcacgccgccgtgcgcgat 309
           ||||||| |||||||| |  | |||||||||||| |||||||| ||||||||
Sbjct: 385 tcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgat 334


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,436,041
Number of Sequences: 3902068
Number of extensions: 3436041
Number of successful extensions: 71027
Number of sequences better than 10.0: 498
Number of HSP's better than 10.0 without gapping: 504
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 69194
Number of HSP's gapped (non-prelim): 1790
length of query: 444
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 422
effective length of database: 17,147,199,772
effective search space: 7236118303784
effective search space used: 7236118303784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---