ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags32d03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK119175.1| Oryza sativa (japonica cultivar-group) cDNA clon... 549 e-153
2ref|XM_483414.1| Oryza sativa (japonica cultivar-group), mRNA 541 e-151
3emb|AJ833644.1| Oryza sativa (indica cultivar-group) mRNA for ri... 519 e-144
4dbj|AK099282.1| Oryza sativa (japonica cultivar-group) cDNA clon... 511 e-142
5dbj|AK063752.1| Oryza sativa (japonica cultivar-group) cDNA clon... 511 e-142
6dbj|AK120524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 502 e-139
7gb|AY110014.1| Zea mays CL1797_2 mRNA sequence 456 e-125
8gb|BT016923.1| Zea mays clone E04912701G06.c mRNA sequence 424 e-115
9gb|AY111440.1| Zea mays CL1797_4 mRNA sequence 385 e-103
10gb|AC099404.2| Oryza sativa (japonica cultivar-group) chromosome... 287 2e-74
11gb|AC108763.2| Oryza sativa (japonica cultivar-group) chromosome... 287 2e-74
12dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 287 2e-74
13dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 272 1e-69
14dbj|AP003888.4| Oryza sativa (japonica cultivar-group) genomic D... 272 1e-69
15gb|AF140494.1|AF140494 Oryza sativa 60S ribosomal protein mRNA, ... 256 7e-65
16gb|AY109477.1| Zea mays CL1797_1 mRNA sequence 252 1e-63
17gb|DQ222508.1| Solanum tuberosum clone 115D08 ly200-like protein... 137 5e-29
18gb|DQ191670.1| Solanum tuberosum ly200-like protein mRNA, comple... 137 5e-29
19ref|NM_180811.1| Arabidopsis thaliana structural constituent of ... 131 3e-27
20ref|NM_124013.2| Arabidopsis thaliana structural constituent of ... 131 3e-27
21gb|AF446871.1|AF446871 Arabidopsis thaliana AT5g46430/K11I1_2 mR... 131 3e-27
22gb|AY052193.1| Arabidopsis thaliana AT5g46430/K11I1_2 mRNA, comp... 131 3e-27
23gb|AY042872.1| Arabidopsis thaliana ribosomal protein L32 (K11I1... 131 3e-27
24gb|BT002551.1| Arabidopsis thaliana ribosomal protein L32 (At5g4... 131 3e-27
25gb|AY488030.1| Capsicum annuum ly200 protein mRNA, complete cds 129 1e-26
26gb|DQ122831.1| Medicago sativa clone C3 ribosomal protein L32 mR... 127 4e-26
27ref|NM_117920.2| Arabidopsis thaliana structural constituent of ... 125 2e-25
28gb|BT000235.1| Arabidopsis thaliana ribosomal protein L32 -like ... 125 2e-25
29gb|AY072399.1| Arabidopsis thaliana ribosomal protein L32 -like ... 125 2e-25
30gb|AY057566.1| Arabidopsis thaliana AT4g18100/F15J5_70 mRNA, com... 125 2e-25
31dbj|AP006687.1| Lotus japonicus genomic DNA, chromosome 6, clone... 125 2e-25
32emb|AL161548.2|ATCHRIV48 Arabidopsis thaliana DNA chromosome 4, ... 121 3e-24
33emb|AL161547.2|ATCHRIV47 Arabidopsis thaliana DNA chromosome 4, ... 121 3e-24
34emb|AL110123.1|ATF15J5 Arabidopsis thaliana DNA chromosome 4, BA... 121 3e-24
35emb|BX828680.1|CNS0A3L6 Arabidopsis thaliana Full-length cDNA Co... 117 4e-23
36gb|AY086736.1| Arabidopsis thaliana clone 271605 mRNA, complete ... 117 4e-23
37emb|BX830633.1|CNS0A1Y2 Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
38gb|AY310755.1| Nicotiana benthamiana clone 2-236 unknown mRNA 113 7e-22
39gb|AC148239.7| Medicago truncatula clone mth2-5d7, complete sequ... 101 3e-18
40gb|AC150706.4| Medicago truncatula clone mth2-132l18, complete s... 101 3e-18
41dbj|AB019223.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 100 1e-17
42emb|X75646.1|ZML32 Zea mays mRNA for ribosomal protein L32 100 1e-17
43gb|AY310795.1| Nicotiana benthamiana clone 10-360 unknown mRNA 94 6e-16
44dbj|AB180441.1| Plutella xylostella mRNA for Ribosomal protein L... 70 9e-09
45gb|AF358665.1|AF358665 Mercurialis annua ribosomal protein L32 m... 68 4e-08
46gb|AY335237.1| Drosophila saltans clone D.sal12 ribosomal protei... 64 6e-07
47ref|NM_001034783.1| Bos taurus similar to 60S ribosomal protein ... 60 9e-06
48emb|BX028659.1|CNS08U9Z Single read from an extremity of a full-... 60 9e-06
49gb|BC102748.1| Bos taurus similar to 60S ribosomal protein L32, ... 60 9e-06
50gb|AF190579.1|AF190579 Ovis aries ribosomal protein L32 mRNA, pa... 60 9e-06
51dbj|D10964.2|RICAD4L32 Oryza sativa mRNA for ribosomal protein L32 58 3e-05
52gb|AY769302.1| Bombyx mori ribosomal protein L32 (RpL32) mRNA, c... 56 1e-04
53gb|AY231887.1| Drosophila yakuba clone yak-em_RpL32 mRNA sequence 56 1e-04
54dbj|AB048205.1| Bombyx mori rp49 mRNA for ribosomal protein 49, ... 56 1e-04
55gb|AY335236.1| Drosophila sucinea clone D.suc12 ribosomal protei... 54 5e-04
56gb|AY335235.1| Drosophila capricorni clone D.cap12 ribosomal pro... 54 5e-04
57emb|BX072406.1|CNS09S16 Single read from an extremity of a full-... 52 0.002
58emb|BX072405.1|CNS09S15 Single read from an extremity of a full-... 52 0.002
59emb|BX072363.1|CNS09RZZ Single read from an extremity of a full-... 52 0.002
60emb|BX072362.1|CNS09RZY Single read from an extremity of a full-... 52 0.002
61emb|BX072246.1|CNS09RWQ Single read from an extremity of a full-... 52 0.002
62emb|BX069104.1|CNS09PHG Single read from an extremity of a full-... 52 0.002
63emb|BX060492.1|CNS09IU8 Single read from an extremity of a full-... 52 0.002
64emb|BX055443.1|CNS09EXZ Single read from an extremity of a full-... 52 0.002
65emb|BX054318.1|CNS09E2Q Single read from an extremity of a full-... 52 0.002
66emb|BX053725.1|CNS09DM9 Single read from an extremity of a full-... 52 0.002
67emb|BX042256.1|CNS094RO Single read from an extremity of a full-... 52 0.002
68emb|BX038957.1|CNS09281 Single read from an extremity of a full-... 52 0.002
69emb|BX038614.1|CNS091YI Single read from an extremity of a full-... 52 0.002
70emb|BX038239.1|CNS091O3 Single read from an extremity of a full-... 52 0.002
71emb|BX038238.1|CNS091O2 Single read from an extremity of a full-... 52 0.002
72emb|BX038213.1|CNS091ND Single read from an extremity of a full-... 52 0.002
73emb|BX038212.1|CNS091NC Single read from an extremity of a full-... 52 0.002
74emb|BX037881.1|CNS091E5 Single read from an extremity of a full-... 52 0.002
75emb|BX037742.1|CNS091AA Single read from an extremity of a full-... 52 0.002
76emb|BX037741.1|CNS091A9 Single read from an extremity of a full-... 52 0.002
77emb|BX037616.1|CNS0916S Single read from an extremity of a full-... 52 0.002
78emb|BX035455.1|CNS08ZIR Single read from an extremity of a full-... 52 0.002
79emb|BX035454.1|CNS08ZIQ Single read from an extremity of a full-... 52 0.002
80emb|BX035081.1|CNS08Z8D Single read from an extremity of a full-... 52 0.002
81emb|BX035080.1|CNS08Z8C Single read from an extremity of a full-... 52 0.002
82emb|BX034018.1|CNS08YEU Single read from an extremity of a full-... 52 0.002
83emb|BX031693.1|CNS08WM9 Single read from an extremity of a full-... 52 0.002
84emb|BX031670.1|CNS08WLM Single read from an extremity of a full-... 52 0.002
85emb|BX031402.1|CNS08WE6 Single read from an extremity of a full-... 52 0.002
86emb|BX031230.1|CNS08W9E Single read from an extremity of a full-... 52 0.002
87emb|BX031229.1|CNS08W9D Single read from an extremity of a full-... 52 0.002
88emb|BX030137.1|CNS08VF1 Single read from an extremity of a full-... 52 0.002
89emb|BX028334.1|CNS08U0Y Single read from an extremity of a full-... 52 0.002
90emb|BX025196.1|CNS08RLS Single read from an extremity of a full-... 52 0.002
91emb|BX024698.1|CNS08R7Y Single read from an extremity of a full-... 52 0.002
92emb|BX024689.1|CNS08R7P Single read from an extremity of a full-... 52 0.002
93emb|BX023560.1|CNS08QCC Single read from an extremity of a full-... 52 0.002
94emb|BX022073.1|CNS08P71 Single read from an extremity of a full-... 52 0.002
95emb|BX022072.1|CNS08P70 Single read from an extremity of a full-... 52 0.002
96emb|BX021654.1|CNS08OVE Single read from an extremity of a full-... 52 0.002
97emb|BX017413.1|CNS08LLL Single read from an extremity of a full-... 52 0.002
98emb|BX016591.1|CNS08KYR Single read from an extremity of a full-... 52 0.002
99emb|BX016586.1|CNS08KYM Single read from an extremity of a full-... 52 0.002
100emb|BX015405.1|CNS08K1T Single read from an extremity of a full-... 52 0.002
101emb|BX012521.1|CNS08HTP Single read from an extremity of a full-... 52 0.002
102emb|BX012079.1|CNS08HHF Single read from an extremity of a full-... 52 0.002
103emb|BX008500.1|CNS08EQ0 Single read from an extremity of a full-... 52 0.002
104emb|BX007798.1|CNS08E6I Single read from an extremity of a full-... 52 0.002
105gb|AF400195.1| Spodoptera frugiperda ribosomal protein L32 mRNA,... 52 0.002
106ref|XM_320915.2| Anopheles gambiae str. PEST ENSANGP00000017702 ... 52 0.002
107gb|DQ296005.1| Antheraea pernyi ribosomal protein 49 (RP49) mRNA... 52 0.002
108ref|XM_414453.1| PREDICTED: Gallus gallus similar to 60S ribosom... 50 0.008
109gb|AY550039.1| Sus scrofa 60S ribosomal protein L32 mRNA, comple... 50 0.008
110emb|BX932322.2| Gallus gallus finished cDNA, clone ChEST352p19 50 0.008
111emb|BX931502.2| Gallus gallus finished cDNA, clone ChEST398a16 50 0.008
112gb|AF370438.1|AF370438 Mercurialis annua type monoecious ribosom... 50 0.008
113gb|AF370437.1|AF370437 Mercurialis annua type androdioecious rib... 50 0.008
114emb|BX931261.1| Gallus gallus finished cDNA, clone ChEST263h18 50 0.008
115emb|BX933805.1| Gallus gallus finished cDNA, clone ChEST1010a20 50 0.008
116emb|BX930684.1| Gallus gallus finished cDNA, clone ChEST376p22 50 0.008
117emb|BX929563.1| Gallus gallus finished cDNA, clone ChEST753b6 50 0.008
118ref|NM_001001636.1| Sus scrofa 60S ribosomal protein L32 (RPL32)... 50 0.008
119gb|AY610304.1| Sus scrofa clone rcut06_l18.y1.abd, mRNA sequence 50 0.008
120emb|BX028660.1|CNS08UA0 Single read from an extremity of a full-... 48 0.033
121emb|Y09706.1|DBIRP49 D.bifasciate rp49 gene exons 1 & 2 48 0.033
122gb|AF401587.1| Ictalurus punctatus ribosomal protein L32 mRNA, c... 48 0.033
123gb|AY335233.1| Drosophila willistoni clone Dwill0811.4 ribosomal... 48 0.033
124ref|XM_964471.1| PREDICTED: Tribolium castaneum similar to CG793... 46 0.13
125emb|BX014653.1|CNS08JGX Single read from an extremity of a full-... 46 0.13
126emb|BX007253.1|CNS08DRD Single read from an extremity of a full-... 46 0.13
127dbj|AB118976.1| Lucilia sericata rp49 mRNA for ribosomal protein... 46 0.13
128gb|AY335238.1| Drosophila sturtevanti clone D.stur12 ribosomal p... 46 0.13
129emb|BX036679.1|CNS090GR Single read from an extremity of a full-... 44 0.52
130emb|BX024690.1|CNS08R7Q Single read from an extremity of a full-... 44 0.52
131emb|BX012522.1|CNS08HTQ Single read from an extremity of a full-... 44 0.52
132emb|Y09705.1|DAZRP49 D.azteca rp49 gene exons 1 & 2 44 0.52
133emb|Y09704.1|DAFRP49 D.affinis rp49 gene exons 1 & 2 44 0.52
134gb|AY754570.1| Drosophila affinis ribosomal protein L32 (RpL32) ... 44 0.52
135emb|BX047905.1|CNS0994L Single read from an extremity of a full-... 42 2.0
136ref|NM_001030357.1| Gallus gallus proprotein convertase subtilis... 42 2.0
137emb|AJ720169.1| Gallus gallus mRNA for hypothetical protein, clo... 42 2.0
138gb|AF450502.1|AF450502 Epinephelus coioides ribosomal protein L3... 42 2.0
139gb|AC171015.5| Gallus gallus BAC clone CH261-18L11 from chromoso... 42 2.0
140gb|AC009884.8| Homo sapiens chromosome 8, clone RP11-420B22, com... 42 2.0
141ref|XM_322549.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.1
142ref|XM_951690.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.1
143gb|AC144625.3| Mus musculus BAC clone RP24-196P19 from chromosom... 40 8.1
144ref|XM_535916.2| PREDICTED: Canis familiaris similar to 60S ribo... 40 8.1
145ref|XM_533736.2| PREDICTED: Canis familiaris similar to 60S ribo... 40 8.1
146gb|BT011442.1| Drosophila melanogaster RE59709 full insert cDNA 40 8.1
147ref|XM_854019.1| PREDICTED: Canis familiaris similar to 60S ribo... 40 8.1
148ref|XM_844472.1| PREDICTED: Canis familiaris similar to 60S ribo... 40 8.1
149gb|AC125543.3| Mus musculus BAC clone RP23-360H5 from chromosome... 40 8.1
150ref|XM_763444.1| Giardia lamblia ATCC 50803 hypothetical protein... 40 8.1
151ref|XM_848585.1| PREDICTED: Canis familiaris similar to 60S ribo... 40 8.1
152ref|XM_536234.2| PREDICTED: Canis familiaris similar to 60S ribo... 40 8.1
153ref|XM_535299.2| PREDICTED: Canis familiaris similar to 60S ribo... 40 8.1
154ref|XM_853337.1| PREDICTED: Canis familiaris similar to 60S ribo... 40 8.1
155ref|XM_853297.1| PREDICTED: Canis familiaris similar to 60S ribo... 40 8.1
156ref|XM_535164.2| PREDICTED: Canis familiaris similar to 60S ribo... 40 8.1
157gb|AC165350.3| Mus musculus BAC clone RP23-249A17 from chromosom... 40 8.1
158emb|AL109760.3|HSJ513G18 Human DNA sequence from clone RP3-513G1... 40 8.1
159emb|BX060493.1|CNS09IU9 Single read from an extremity of a full-... 40 8.1
160emb|BX052957.1|CNS09D0X Single read from an extremity of a full-... 40 8.1
161emb|BX052956.1|CNS09D0W Single read from an extremity of a full-... 40 8.1
162emb|BX053726.1|CNS09DMA Single read from an extremity of a full-... 40 8.1
163emb|BX041388.1|CNS0943K Single read from an extremity of a full-... 40 8.1
164emb|BX041387.1|CNS0943J Single read from an extremity of a full-... 40 8.1
165emb|BX030138.1|CNS08VF2 Single read from an extremity of a full-... 40 8.1
166emb|BX017414.1|CNS08LLM Single read from an extremity of a full-... 40 8.1
167emb|BX007799.1|CNS08E6J Single read from an extremity of a full-... 40 8.1
168emb|Y13939.1|DMRP4912 Drosophila melanogaster rp49 gene 40 8.1
169emb|X80095.1|DSJ9OST D.subobscura (J9.Ost) gene for ribosomal pr... 40 8.1
170emb|X80094.1|DSJ8OST D.subobscura (J8.Ost) gene for ribosomal pr... 40 8.1
171emb|X80093.1|DSJ70ST D.subobscura (J7.Ost) gene for ribosomal pr... 40 8.1
172emb|X80092.1|DSJ6OST D.subobscura (J6.Ost) gene for ribosomal pr... 40 8.1
173emb|X80091.1|DSJ5OST D.subobscura (J5.Ost) gene for ribosomal pr... 40 8.1
174emb|X80090.1|DSJ4OST D.subobscura (J4.Ost) gene for ribosomal pr... 40 8.1
175emb|X80079.1|DSJ3OST D.subobscura (J3.Ost) gene for ribosomal pr... 40 8.1
176emb|Y09709.1|DMIRP49 D.miranda rp49 gene exons 1 & 2 40 8.1
177emb|Y09708.1|DMARP49 D.madeirensis rp49 gene exons 1 & 2 40 8.1
178emb|Y09707.1|DGURP49 D.guanche rp49 gene exons 1 & 2 40 8.1
179emb|X80081.1|DSJ16RP49 D.subobscura (J16.O3+4) gene for ribosoma... 40 8.1
180emb|X80077.1|DSJ2OST49 D.subobscura (J2.Ost) gene for ribosomal ... 40 8.1
181emb|X80076.1|DSJ10ST49 D.subobscura (J1.Ost) gene for ribosomal ... 40 8.1
182emb|X80109.1|DSJ33OST D.subobscura (J33.Ost) gene for ribosomal ... 40 8.1
183emb|X80108.1|DSJ32034 D.subobscura (J32.O3+4) gene for ribosomal... 40 8.1
184emb|X80107.1|DSJ34OST D.subobscura (J34.Ost) gene for ribosomal ... 40 8.1
185emb|X80106.1|DSJ30034 D.subobscura (J30.O3+4) gene for ribosomal... 40 8.1
186emb|X80105.1|DSJ26034 D.subobscura (J26.O3+4) gene for ribosomal... 40 8.1
187emb|X80104.1|DSJ25034 D.subobscura (J25.O3+4) gene for ribosomal... 40 8.1
188emb|X80103.1|DSJ22034 D.subobscura (J22.O3+4) gene for ribosomal... 40 8.1
189emb|X80102.1|DSJ21034 D.subobscura (J21.O3+4) gene for ribosomal... 40 8.1
190emb|X80101.1|DSJ20034 D.subobscura (J20.O3+4) gene for ribosomal... 40 8.1
191emb|X80100.1|DSJ18034 D.subobscura (J18.O3+4) gene for ribosomal... 40 8.1
192emb|X80099.1|DSJ14OST D.subobscura (J14.Ost) gene for ribosomal ... 40 8.1
193emb|X80098.1|DSJ15034 D.subobscura (J15.O3+4) gene for ribosomal... 40 8.1
194emb|X80097.1|DSJ12OST D.subobscura (J12.Ost) gene for ribosomal ... 40 8.1
195emb|X80096.1|DSJ11OST D.subobscura (J11.Ost) gene for ribosomal ... 40 8.1
196emb|X80089.1|DSJ31034 D.subobscura (J31.O3+4) gene for ribosomal... 40 8.1
197emb|X80088.1|DSJ28034 D.subobscura (J28.O3+4) gene for ribosomal... 40 8.1
198emb|X80087.1|DSJ29034 D.subobscura (J29.O3+4) gene for ribosomal... 40 8.1
199emb|X80086.1|DSJ27034 D.subobscura (J27.O3+4) gene for ribosomal... 40 8.1
200emb|X80085.1|DSJ24034 D.subobscura (J24.O3+4) gene for ribosomal... 40 8.1
201emb|X80084.1|DSJ23034 D.subobscura (J23.O3+4) gene for ribosomal... 40 8.1
202emb|X80083.1|DSJ19034 D.subobscura (J19.O3+4) gene for ribosomal... 40 8.1
203emb|X80082.1|DSJ17034 D.subobscura (J17.O3+4) gene for ribosomal... 40 8.1
204emb|X80080.1|DSJ13OST D.subobscura (J13.Ost) gene for ribosomal ... 40 8.1
205emb|X80078.1|DSJ10OST D.subobscura (J10.Ost) gene for ribosomal ... 40 8.1
206emb|X72654.1|DSRP49J D.subobscura (B9) gene for ribosomal protei... 40 8.1
207emb|X72653.1|DSRP49H D.subobscura (T7) gene for ribosomal protei... 40 8.1
208emb|X72652.1|DSRP49G D.subobscura (B8) gene for ribosomal protei... 40 8.1
209emb|X72651.1|DSRP49F D.subobscura (B6) gene for ribosomal protei... 40 8.1
210emb|X72650.1|DSRP49E D.subobscura (B5) gene for ribosomal protei... 40 8.1
211emb|X72649.1|DSRP49D D.subobscura (B4) gene for ribosomal protei... 40 8.1
212emb|X72648.1|DSRP49C D.subobscura (B2) gene for ribosomal protei... 40 8.1
213emb|X72647.1|DSRP49B D.subobscura (B3) gene for ribosomal protei... 40 8.1
214emb|X72646.1|DSRP49A D.subobscura (B1) gene for ribosomal protei... 40 8.1
215gb|BC098631.1| Rattus norvegicus cAMP responsive element binding... 40 8.1
216emb|BX883044.1| Rattus norvegicus chromosome 20, major histocomp... 40 8.1
217ref|NM_001002809.1| Rattus norvegicus cAMP responsive element bi... 40 8.1
218gb|AC129099.6| Canis familiaris clone rp81-289m11, complete sequ... 40 8.1
219ref|NM_170461.1| Drosophila melanogaster Ribosomal protein L32 C... 40 8.1
220ref|NM_170460.1| Drosophila melanogaster Ribosomal protein L32 C... 40 8.1
221ref|NM_079843.2| Drosophila melanogaster Ribosomal protein L32 C... 40 8.1
222gb|AC069356.6| Homo sapiens chromosome 18, clone RP11-575O17, co... 40 8.1
223gb|AY070656.1| Drosophila melanogaster RH03940 full length cDNA 40 8.1
224gb|AC161372.2| Mus musculus BAC clone RP23-326G14 from chromosom... 40 8.1
225gb|AC013751.6|AC013751 Homo sapiens chromosome , clone RP11-298P... 40 8.1
226gb|AF370436.1|AF370436 Mercurialis annua type dioecious ribosoma... 40 8.1
227gb|AC007886.7|AC007886 Drosophila melanogaster, chromosome 3R, r... 40 8.1
228gb|AC124861.3| Homo sapiens BAC clone RP11-622A18 from 2, comple... 40 8.1
229gb|AC157533.2| Pan troglodytes BAC clone CH251-276N1 from chromo... 40 8.1
230gb|AY168763.1| Branchiostoma belcheri tsingtaunese ribosomal pro... 40 8.1
231gb|AY971345.1| Danaus plexippus ribosomal protein 49 mRNA, parti... 40 8.1
232gb|AY754569.1| Drosophila miranda strain MSH22 ribosomal protein... 40 8.1
233gb|AE003772.2| Drosophila melanogaster chromosome 3R, section 11... 40 8.1
234emb|AL049831.2|CNS00008 Human chromosome 14 DNA sequence BAC R-3... 40 8.1
235gb|AC134462.5| Mus musculus BAC clone RP23-391L12 from chromosom... 40 8.1
236gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome 40 8.1
237gb|AC130824.4| Mus musculus BAC clone RP23-349B5 from 12, comple... 40 8.1
238emb|Z68883.1|HSL118GB Human DNA sequence from clone LA04NC01-118... 40 8.1
239gb|U92431.1|DMU92431 Drosophila melanogaster ribosomal protein 4... 40 8.1
240emb|AJ309046.1|DSI309046 Drosophila simulans RpL32 gene for ribo... 40 8.1
241emb|AJ309045.1|DSI309045 Drosophila simulans RpL32 gene for ribo... 40 8.1
242emb|AJ309044.1|DSI309044 Drosophila simulans RpL32 gene for ribo... 40 8.1
243emb|AJ309043.1|DSI309043 Drosophila simulans RpL32 gene for ribo... 40 8.1
244emb|AJ309042.1|DSI309042 Drosophila simulans RpL32 gene for ribo... 40 8.1
245emb|AJ309041.1|DSI309041 Drosophila simulans RpL32 gene for ribo... 40 8.1
246emb|AJ309040.1|DSI309040 Drosophila simulans RpL32 gene for ribo... 40 8.1
247emb|AJ309039.1|DSI309039 Drosophila simulans RpL32 gene for ribo... 40 8.1
248emb|AJ309038.1|DSI309038 Drosophila simulans RpL32 gene for ribo... 40 8.1
249emb|AJ309037.1|DSI309037 Drosophila simulans RpL32 gene for ribo... 40 8.1
250emb|AJ309036.1|DSI309036 Drosophila simulans RpL32 gene for ribo... 40 8.1
251emb|AJ309035.1|DSI309035 Drosophila simulans RpL32 gene for ribo... 40 8.1
252emb|AJ309034.1|DSI309034 Drosophila simulans RpL32 gene for ribo... 40 8.1
253emb|AJ309033.1|DSI309033 Drosophila simulans RpL32 gene for ribo... 40 8.1
254emb|AJ309032.1|DSI309032 Drosophila simulans RpL32 gene for ribo... 40 8.1
255emb|AJ309031.1|DSI309031 Drosophila simulans RpL32 gene for ribo... 40 8.1
256emb|AJ309030.1|DSI309030 Drosophila simulans RpL32 gene for ribo... 40 8.1
257emb|AJ309029.1|DSI309029 Drosophila simulans RpL32 gene for ribo... 40 8.1
258emb|AJ309028.1|DSI309028 Drosophila simulans RpL32 gene for ribo... 40 8.1
259emb|AJ309027.1|DSI309027 Drosophila simulans RpL32 gene for ribo... 40 8.1
260emb|AJ309026.1|DSI309026 Drosophila simulans RpL32 gene for ribo... 40 8.1
261emb|AJ309025.1|DSI309025 Drosophila simulans RpL32 gene for ribo... 40 8.1
262emb|AJ309024.1|DSI309024 Drosophila simulans RpL32 gene for ribo... 40 8.1
263emb|AJ309023.1|DSI309023 Drosophila simulans RpL32 gene for ribo... 40 8.1
264emb|AJ310284.1|DSU310284 Drosophila subobscura RpL32 gene for ri... 40 8.1
265emb|AJ310283.1|DSU310283 Drosophila subobscura RpL32 gene for ri... 40 8.1
266emb|AJ310282.1|DSU310282 Drosophila subobscura RpL32 gene for ri... 40 8.1
267emb|AJ310281.1|DSU310281 Drosophila subobscura RpL32 gene for ri... 40 8.1
268emb|AJ310280.1|DSU310280 Drosophila subobscura RpL32 gene for ri... 40 8.1
269emb|AJ310279.1|DSU310279 Drosophila subobscura RpL32 gene for ri... 40 8.1
270emb|AJ310278.1|DSU310278 Drosophila subobscura RpL32 gene for ri... 40 8.1
271emb|AJ310277.1|DSU310277 Drosophila subobscura RpL32 gene for ri... 40 8.1
272emb|AJ310276.1|DSU310276 Drosophila subobscura RpL32 gene for ri... 40 8.1
273emb|AJ310275.1|DSU310275 Drosophila subobscura RpL32 gene for ri... 40 8.1
274emb|AJ310274.1|DSU310274 Drosophila subobscura RpL32 gene for ri... 40 8.1
275emb|AJ310273.1|DSU310273 Drosophila subobscura RpL32 gene for ri... 40 8.1
276emb|AJ310272.1|DSU310272 Drosophila subobscura RpL32 gene for ri... 40 8.1
277emb|AJ310271.1|DSU310271 Drosophila subobscura RpL32 gene for ri... 40 8.1
278emb|AJ310270.1|DSU310270 Drosophila subobscura RpL32 gene for ri... 40 8.1
279emb|AJ310269.1|DSU310269 Drosophila subobscura RpL32 gene for ri... 40 8.1
280emb|AJ228899.1|DSU228899 Drosophila subobscura rp49 gene (strain... 40 8.1
281emb|AJ228898.1|DSU228898 Drosophila subobscura rp49 gene (strain... 40 8.1
282emb|AJ228897.1|DSU228897 Drosophila subobscura rp49 gene (strain... 40 8.1
283emb|AJ228896.1|DSU228896 Drosophila subobscura rp49 gene (strain... 40 8.1
284emb|AJ228895.1|DSU228895 Drosophila subobscura rp49 gene (strain... 40 8.1
285emb|AJ228894.1|DSU228894 Drosophila subobscura rp49 gene (strain... 40 8.1
286emb|AJ228893.1|DSU228893 Drosophila subobscura rp49 gene (strain... 40 8.1
287emb|AJ228892.1|DSU228892 Drosophila subobscura rp49 gene (strain... 40 8.1
288emb|AJ228891.1|DSU228891 Drosophila subobscura rp49 gene (strain... 40 8.1
289emb|AJ228890.1|DSU228890 Drosophila subobscura rp49 gene (strain... 40 8.1
290emb|AJ228889.1|DSU228889 Drosophila subobscura rp49 gene (strain... 40 8.1
291emb|AJ228888.1|DSU228888 Drosophila subobscura rp49 gene (strain... 40 8.1
292emb|AJ228887.1|DSU228887 Drosophila subobscura rp49 gene (strain... 40 8.1
293emb|AJ228886.1|DSU228886 Drosophila subobscura rp49 gene (strain... 40 8.1
294emb|AJ228921.1|DSU228921 Drosophila subobscura rp49 gene (strain... 40 8.1
295emb|AJ228920.1|DSU228920 Drosophila subobscura rp49 gene (strain... 40 8.1
296emb|AJ228919.1|DSU228919 Drosophila subobscura rp49 gene (strain... 40 8.1
297emb|AJ228918.1|DSU228918 Drosophila subobscura rp49 gene (strain... 40 8.1
298emb|AJ228917.1|DSU228917 Drosophila subobscura rp49 gene (strain... 40 8.1
299emb|AJ228916.1|DSU228916 Drosophila subobscura rp49 gene (strain... 40 8.1
300emb|AJ228915.1|DSU228915 Drosophila subobscura rp49 gene (strain... 40 8.1
301emb|AJ228914.1|DSU228914 Drosophila subobscura rp49 gene (strain... 40 8.1
302emb|AJ228913.1|DSU228913 Drosophila subobscura rp49 gene (strain... 40 8.1
303emb|AJ228912.1|DSU228912 Drosophila subobscura rp49 gene (strain... 40 8.1
304emb|AJ228911.1|DSU228911 Drosophila subobscura rp49 gene (strain... 40 8.1
305emb|AJ228910.1|DSU228910 Drosophila subobscura rp49 gene (strain... 40 8.1
306emb|AJ228909.1|DSU228909 Drosophila subobscura rp49 gene (strain... 40 8.1
307emb|AJ228908.1|DSU228908 Drosophila subobscura rp49 gene (strain... 40 8.1
308emb|AJ228907.1|DSU228907 Drosophila subobscura rp49 gene (strain... 40 8.1
309emb|AJ228906.1|DSU228906 Drosophila subobscura rp49 gene (strain... 40 8.1
310emb|AJ228905.1|DSU228905 Drosophila subobscura rp49 gene (strain... 40 8.1
311emb|AJ228904.1|DSU228904 Drosophila subobscura rp49 gene (strain... 40 8.1
312emb|AJ228903.1|DSU228903 Drosophila subobscura rp49 gene (strain... 40 8.1
313emb|AJ228902.1|DSU228902 Drosophila subobscura rp49 gene (strain... 40 8.1
314emb|AJ228901.1|DSU228901 Drosophila subobscura rp49 gene (strain... 40 8.1
315emb|AJ228900.1|DSU228900 Drosophila subobscura rp49 gene (strain... 40 8.1
316emb|AJ228885.1|DSU228885 Drosophila subobscura rp49 gene (strain... 40 8.1
317emb|AJ228884.1|DSU228884 Drosophila subobscura rp49 gene (strain... 40 8.1
318emb|AJ228883.1|DSU228883 Drosophila subobscura rp49 gene (strain... 40 8.1
319emb|AJ228882.1|DSU228882 Drosophila subobscura rp49 gene (strain... 40 8.1
320emb|AJ228881.1|DSU228881 Drosophila subobscura rp49 gene (strain... 40 8.1
321emb|AJ310306.1|DMA310306 Drosophila madeirensis RpL32 gene for r... 40 8.1
322emb|AJ310305.1|DMA310305 Drosophila madeirensis RpL32 gene for r... 40 8.1
323emb|AJ310304.1|DMA310304 Drosophila madeirensis RpL32 gene for r... 40 8.1
324emb|AJ310303.1|DMA310303 Drosophila madeirensis RpL32 gene for r... 40 8.1
325emb|AJ310302.1|DMA310302 Drosophila madeirensis RpL32 gene for r... 40 8.1
326emb|AJ310301.1|DMA310301 Drosophila madeirensis RpL32 gene for r... 40 8.1
327emb|AJ310300.1|DMA310300 Drosophila madeirensis RpL32 gene for r... 40 8.1
328emb|AJ310299.1|DMA310299 Drosophila madeirensis RpL32 gene for r... 40 8.1
329emb|AJ310298.1|DMA310298 Drosophila madeirensis RpL32 gene for r... 40 8.1
330emb|AJ310297.1|DMA310297 Drosophila madeirensis RpL32 gene for r... 40 8.1
331emb|AJ310296.1|DMA310296 Drosophila madeirensis RpL32 gene for r... 40 8.1
332emb|AJ310295.1|DMA310295 Drosophila madeirensis RpL32 gene for r... 40 8.1
333emb|AJ310294.1|DMA310294 Drosophila madeirensis RpL32 gene for r... 40 8.1
334emb|AJ310293.1|DMA310293 Drosophila madeirensis RpL32 gene for r... 40 8.1
335emb|AJ310292.1|DMA310292 Drosophila madeirensis RpL32 gene for r... 40 8.1
336emb|AJ310291.1|DMA310291 Drosophila madeirensis RpL32 gene for r... 40 8.1
337emb|AJ310290.1|DMA310290 Drosophila madeirensis RpL32 gene for r... 40 8.1
338emb|AJ310289.1|DMA310289 Drosophila madeirensis RpL32 gene for r... 40 8.1
339emb|AJ310288.1|DMA310288 Drosophila madeirensis RpL32 gene for r... 40 8.1
340emb|AJ310287.1|DMA310287 Drosophila madeirensis RpL32 gene for r... 40 8.1
341emb|AJ310286.1|DMA310286 Drosophila madeirensis RpL32 gene for r... 40 8.1
342emb|AJ310285.1|DMA310285 Drosophila madeirensis RpL32 gene for r... 40 8.1
343gb|M21333.1|DRORIB D.subobscura ribosomal protein (rp49) gene, c... 40 8.1
344dbj|AB035089.1| Homo sapiens SCCA2 gene for squamous cell carcin... 40 8.1

>dbj|AK119175.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-F05, full
           insert sequence
          Length = 967

 Score =  549 bits (277), Expect = e-153
 Identities = 373/405 (92%)
 Strand = Plus / Minus

                                                                       
Query: 140 tactcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgt 199
           ||||| ||||| ||||| |||||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 807 tactcgtcctcctggctacggagccttgcaagcttgttggtgaccacgatgtcgagctgc 748

                                                                       
Query: 200 gcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgca 259
           || |||||||||||||| |||||||||||||| || ||||||||||| |||||||| |||
Sbjct: 747 gcagcacgctcaacgatctccttgcgcttcttcgtagagacgttgtgggcaatctcggca 688

                                                                       
Query: 260 cagtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaac 319
           ||||||||||||||||||||||| |||| ||||||||||||||||||||| || ||||||
Sbjct: 687 cagtaggtcctgttgtgcatcatgagcaactccagctcagagacattgtgcaccacaaac 628

                                                                       
Query: 320 ttcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttg 379
           ||||||||||||||||| ||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 627 ttcttgaacttgttggggaggtagtgcctggtcttcttgtctgagccgtaaccaatgttg 568

                                                                       
Query: 380 ggcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctg 439
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 567 ggcatcaaggtgcatcccttgaactttctcctgacacgggagtcaatacccttgggcctg 508

                                                                       
Query: 440 cgccagctttgcttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgacc 499
           ||||||||| |||||||||  | ||||||||| ||||||| ||||||||| |||||||||
Sbjct: 507 cgccagcttggcttgaggcataggtagcggtcactatggggcctcttgaactgcttgacc 448

                                                        
Query: 500 ctcttcttcacgatcttcttcgtcagaatcggcaccgccatctct 544
           |||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 447 ctcttcttcacgatcttcttcgtcagcagcggcaccgccatctct 403



to top

>ref|XM_483414.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 402

 Score =  541 bits (273), Expect = e-151
 Identities = 369/401 (92%)
 Strand = Plus / Minus

                                                                       
Query: 140 tactcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgt 199
           ||||| ||||| ||||| |||||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 401 tactcgtcctcctggctacggagccttgcaagcttgttggtgaccacgatgtcgagctgc 342

                                                                       
Query: 200 gcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgca 259
           || |||||||||||||| |||||||||||||| || ||||||||||| |||||||| |||
Sbjct: 341 gcagcacgctcaacgatctccttgcgcttcttcgtagagacgttgtgggcaatctcggca 282

                                                                       
Query: 260 cagtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaac 319
           ||||||||||||||||||||||| |||| ||||||||||||||||||||| || ||||||
Sbjct: 281 cagtaggtcctgttgtgcatcatgagcaactccagctcagagacattgtgcaccacaaac 222

                                                                       
Query: 320 ttcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttg 379
           ||||||||||||||||| ||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 221 ttcttgaacttgttggggaggtagtgcctggtcttcttgtctgagccgtaaccaatgttg 162

                                                                       
Query: 380 ggcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctg 439
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 161 ggcatcaaggtgcatcccttgaactttctcctgacacgggagtcaatacccttgggcctg 102

                                                                       
Query: 440 cgccagctttgcttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgacc 499
           ||||||||| |||||||||  | ||||||||| ||||||| ||||||||| |||||||||
Sbjct: 101 cgccagcttggcttgaggcataggtagcggtcactatggggcctcttgaactgcttgacc 42

                                                    
Query: 500 ctcttcttcacgatcttcttcgtcagaatcggcaccgccat 540
           |||||||||||||||||||||||||| | ||||||||||||
Sbjct: 41  ctcttcttcacgatcttcttcgtcagcagcggcaccgccat 1



to top

>emb|AJ833644.1| Oryza sativa (indica cultivar-group) mRNA for ribosomal L32 protein
           (rpl32 gene)
          Length = 713

 Score =  519 bits (262), Expect = e-144
 Identities = 367/402 (91%)
 Strand = Plus / Minus

                                                                       
Query: 141 actcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtg 200
           |||| ||||| ||||||||||||||||||||||||||||| ||||||||||| ||||| |
Sbjct: 554 actcgtcctcctggctgcggagcctggcaagcttgttggtgaccacgatgtccagctgcg 495

                                                                       
Query: 201 cggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcac 260
           | || ||||| ||||| |||||||||||   ||||||||||||||| |||||||| || |
Sbjct: 494 cagcgcgctcgacgatctccttgcgcttgcgggtggagacgttgtgagcaatctcagcgc 435

                                                                       
Query: 261 agtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaact 320
           |||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 434 agtatgtcctgttgtgcatcataagcagctccagctcagagacattgtgcaccacaaact 375

                                                                       
Query: 321 tcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgg 380
           |||||||||||||||||||||| ||||| ||||||||||||||||| || ||||||||||
Sbjct: 374 tcttgaacttgttgggaaggtagtgccttgtcttcttgtcagaaccatatccaatgttgg 315

                                                                       
Query: 381 gcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgc 440
           |||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||
Sbjct: 314 gcatcaaggtgcatcctttgaactttctcctgacacgagagtcaataccctttggcctgc 255

                                                                       
Query: 441 gccagctttgcttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccc 500
           ||||||||  |||||||||||||||||||||||| || | ||||||||| ||||| ||||
Sbjct: 254 gccagcttgtcttgaggccaatgtagcggtcgctgtgcggcctcttgaactgcttcaccc 195

                                                     
Query: 501 tcttcttcacgatcttcttcgtcagaatcggcaccgccatct 542
            |||||||||||||||||||||||| | ||||||||||||||
Sbjct: 194 gcttcttcacgatcttcttcgtcagcaacggcaccgccatct 153



to top

>dbj|AK099282.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023130H04, full
           insert sequence
          Length = 745

 Score =  511 bits (258), Expect = e-142
 Identities = 366/402 (91%)
 Strand = Plus / Minus

                                                                       
Query: 141 actcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtg 200
           |||| ||||| ||||||||||||||||||||||||||||| ||||||||||| ||||| |
Sbjct: 456 actcgtcctcctggctgcggagcctggcaagcttgttggtgaccacgatgtccagctgcg 397

                                                                       
Query: 201 cggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcac 260
           | || ||||| ||||| |||||||||||   ||||||||||||||| |||||||| || |
Sbjct: 396 cagcgcgctcgacgatctccttgcgcttgcgggtggagacgttgtgagcaatctcagcgc 337

                                                                       
Query: 261 agtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaact 320
           |||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 336 agtatgtcctgttgtgcatcataagcagctccagctcagagacattgtgcaccacaaact 277

                                                                       
Query: 321 tcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgg 380
           |||||||||||||||||||||| ||||| ||||||||||||||||| || ||||||||||
Sbjct: 276 tcttgaacttgttgggaaggtagtgccttgtcttcttgtcagaaccatatccaatgttgg 217

                                                                       
Query: 381 gcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgc 440
           |||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||
Sbjct: 216 gcatcaaggtgcatcctttgaactttctcctgacacgagagtcaataccctttggcctgc 157

                                                                       
Query: 441 gccagctttgcttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccc 500
           ||||||||  |||||||||||||||||||||||| || | ||||||||| ||||| ||||
Sbjct: 156 gccagcttgtcttgaggccaatgtagcggtcgctgtgcggcctcttgaactgcttcaccc 97

                                                     
Query: 501 tcttcttcacgatcttcttcgtcagaatcggcaccgccatct 542
            |||||||||||||||||||||||| | ||||||| ||||||
Sbjct: 96  gcttcttcacgatcttcttcgtcagcaacggcaccaccatct 55



to top

>dbj|AK063752.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-121-A02, full
           insert sequence
          Length = 750

 Score =  511 bits (258), Expect = e-142
 Identities = 366/402 (91%)
 Strand = Plus / Minus

                                                                       
Query: 141 actcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtg 200
           |||| ||||| ||||||||||||||||||||||||||||| ||||||||||| ||||| |
Sbjct: 455 actcgtcctcctggctgcggagcctggcaagcttgttggtgaccacgatgtccagctgcg 396

                                                                       
Query: 201 cggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcac 260
           | || ||||| ||||| |||||||||||   ||||||||||||||| |||||||| || |
Sbjct: 395 cagcgcgctcgacgatctccttgcgcttgcgggtggagacgttgtgagcaatctcagcgc 336

                                                                       
Query: 261 agtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaact 320
           |||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 335 agtatgtcctgttgtgcatcataagcagctccagctcagagacattgtgcaccacaaact 276

                                                                       
Query: 321 tcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgg 380
           |||||||||||||||||||||| ||||| ||||||||||||||||| || ||||||||||
Sbjct: 275 tcttgaacttgttgggaaggtagtgccttgtcttcttgtcagaaccatatccaatgttgg 216

                                                                       
Query: 381 gcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgc 440
           |||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||
Sbjct: 215 gcatcaaggtgcatcctttgaactttctcctgacacgagagtcaataccctttggcctgc 156

                                                                       
Query: 441 gccagctttgcttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccc 500
           ||||||||  |||||||||||||||||||||||| || | ||||||||| ||||| ||||
Sbjct: 155 gccagcttgtcttgaggccaatgtagcggtcgctgtgcggcctcttgaactgcttcaccc 96

                                                     
Query: 501 tcttcttcacgatcttcttcgtcagaatcggcaccgccatct 542
            |||||||||||||||||||||||| | ||||||| ||||||
Sbjct: 95  gcttcttcacgatcttcttcgtcagcaacggcaccaccatct 54



to top

>dbj|AK120524.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013126M04, full
           insert sequence
          Length = 657

 Score =  502 bits (253), Expect = e-139
 Identities = 367/405 (90%)
 Strand = Plus / Minus

                                                                       
Query: 138 tttactcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagct 197
           ||||||| ||||| |||||||| |||||||||||||||||||| |||||||| || ||||
Sbjct: 427 tttactcgtcctcctggctgcgaagcctggcaagcttgttggtgaccacgatatcaagct 368

                                                                       
Query: 198 gtgcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccg 257
           |||| |||||||| ||||| |||||||||||||| || ||||| ||||| || ||||| |
Sbjct: 367 gtgcagcacgctccacgatctccttgcgcttcttcgttgagacattgtgagcgatctcag 308

                                                                       
Query: 258 cacagtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaa 317
           ||||||| |||||||||||||||||||| | |||||||||||||||||||||||| ||||
Sbjct: 307 cacagtatgtcctgttgtgcatcataagtaactccagctcagagacattgtggacgacaa 248

                                                                       
Query: 318 acttcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgt 377
           |||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||| |
Sbjct: 247 acttcttgaatttgttgggaaggtaatgcctcgtcttcttgtcagaaccatagccaatat 188

                                                                       
Query: 378 tgggcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcc 437
           | |||||||| |||||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 187 taggcatcaaagtgcatcccttgaactttctcctgacacgggagtcgataccctttggcc 128

                                                                       
Query: 438 tgcgccagctttgcttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttga 497
           |||||||||||  ||||||||| |||||||||||||| || | ||||||||| ||||| |
Sbjct: 127 tgcgccagcttgtcttgaggccgatgtagcggtcgctgtgcggcctcttgaactgcttca 68

                                                        
Query: 498 ccctcttcttcacgatcttcttcgtcagaatcggcaccgccatct 542
           ||| |||||||||||||||||||||||| | ||||||||||||||
Sbjct: 67  cccgcttcttcacgatcttcttcgtcagcaacggcaccgccatct 23



to top

>gb|AY110014.1| Zea mays CL1797_2 mRNA sequence
          Length = 1374

 Score =  456 bits (230), Expect = e-125
 Identities = 359/402 (89%)
 Strand = Plus / Minus

                                                                        
Query: 141  actcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtg 200
            |||| ||||||||||||||||||||||||||||||||||| ||||||||||| || || |
Sbjct: 1133 actcgtcctcttggctgcggagcctggcaagcttgttggtgaccacgatgtccagttgcg 1074

                                                                        
Query: 201  cggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcac 260
            | |||||||| || || |||||||||||   |||||| |||||||| |||||||| || |
Sbjct: 1073 cagcacgctcgacaatctccttgcgcttgcgggtggacacgttgtgggcaatctcagcgc 1014

                                                                        
Query: 261  agtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaact 320
            |||| ||||||||||||||||  |||||||||||||| ||||||||||| ||||||||||
Sbjct: 1013 agtaagtcctgttgtgcatcaacagcagctccagctcggagacattgtgaacaacaaact 954

                                                                        
Query: 321  tcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgg 380
            |||||||||||||||||||||| ||||||||||||||||| || ||||| ||||||||||
Sbjct: 953  tcttgaacttgttgggaaggtagtgcctggtcttcttgtcggagccgtatccaatgttgg 894

                                                                        
Query: 381  gcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgc 440
            ||||||||||||||||||||||||| | |||||| ||||| || |||||||| |||||||
Sbjct: 893  gcatcaaggtgcatcccttgaacttacgcctgacgcgggagtcgatacccttgggcctgc 834

                                                                        
Query: 441  gccagctttgcttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccc 500
            |||||||| |||| ||||   |||||||||||  ||||| ||||||||| ||||||||||
Sbjct: 833  gccagcttggcttaaggcacttgtagcggtcgagatggggcctcttgaactgcttgaccc 774

                                                      
Query: 501  tcttcttcacgatcttcttcgtcagaatcggcaccgccatct 542
            |||||||||||||||||| |||||| | ||||||||||||||
Sbjct: 773  tcttcttcacgatcttctgcgtcagcagcggcaccgccatct 732



to top

>gb|BT016923.1| Zea mays clone E04912701G06.c mRNA sequence
          Length = 723

 Score =  424 bits (214), Expect = e-115
 Identities = 355/402 (88%)
 Strand = Plus / Plus

                                                                       
Query: 141 actcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtg 200
           |||| ||||| |||||||| |||||||||||||||||||| ||||||||||| || || |
Sbjct: 242 actcgtcctcctggctgcgaagcctggcaagcttgttggtgaccacgatgtccagttgcg 301

                                                                       
Query: 201 cggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcac 260
           | ||||| || ||||| ||||||||||||  |||||| |||||||| |||||||| ||||
Sbjct: 302 cagcacgttcgacgatctccttgcgcttccgggtggacacgttgtgggcaatctcggcac 361

                                                                       
Query: 261 agtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaact 320
           |||| ||||||||||||||||  |||||||||||||||||||| ||||| || |||||||
Sbjct: 362 agtatgtcctgttgtgcatcaacagcagctccagctcagagacgttgtgaacgacaaact 421

                                                                       
Query: 321 tcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgg 380
           |||||||||||||||||||||| ||||| |||||||||||||| ||||| ||||||||||
Sbjct: 422 tcttgaacttgttgggaaggtagtgcctcgtcttcttgtcagagccgtatccaatgttgg 481

                                                                       
Query: 381 gcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgc 440
           ||||||||||||||||||||||||| | |||||||||||| || |||||||| ||||| |
Sbjct: 482 gcatcaaggtgcatcccttgaacttccgcctgacacgggagtcgatacccttgggcctac 541

                                                                       
Query: 441 gccagctttgcttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccc 500
           |||||||| |||||||||   |||||||||||   || | ||||||||| ||||||||||
Sbjct: 542 gccagcttggcttgaggcacttgtagcggtcgaggtgtggcctcttgaactgcttgaccc 601

                                                     
Query: 501 tcttcttcacgatcttcttcgtcagaatcggcaccgccatct 542
            ||||||||||||||||| |||||| | |||||| |||||||
Sbjct: 602 gcttcttcacgatcttctgcgtcagcagcggcactgccatct 643



to top

>gb|AY111440.1| Zea mays CL1797_4 mRNA sequence
          Length = 634

 Score =  385 bits (194), Expect = e-103
 Identities = 324/368 (88%)
 Strand = Plus / Minus

                                                                       
Query: 140 tactcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgt 199
           ||||||||||| ||||||||||||||||| ||||||||||| ||||| ||||||||||| 
Sbjct: 393 tactcatcctcctggctgcggagcctggcgagcttgttggtgaccacaatgtcgagctgc 334

                                                                       
Query: 200 gcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgca 259
           ||||| || ||||| || ||||||||||||||||| || |||||||| || ||||| |||
Sbjct: 333 gcggcgcgttcaacaatctccttgcgcttcttggttgaaacgttgtgggcgatctcggca 274

                                                                       
Query: 260 cagtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaac 319
           |||||||| |||||||||||||| |||| ||||||||||||||||||||| || ||||||
Sbjct: 273 cagtaggttctgttgtgcatcatgagcaactccagctcagagacattgtgcaccacaaac 214

                                                                       
Query: 320 ttcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttg 379
           ||||||||||||||||| ||||| ||||||||    |||||||| ||||| |||||||||
Sbjct: 213 ttcttgaacttgttggggaggtagtgcctggttgatttgtcagagccgtaaccaatgttg 154

                                                                       
Query: 380 ggcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctg 439
           |||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||
Sbjct: 153 ggcatcaaggtgcatcccttgaacttcctcctgacacgggagtcaatcccctttggcctg 94

                                                                       
Query: 440 cgccagctttgcttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgacc 499
           ||||||||| |||| ||||   | |||||| |   ||||| ||| ||||| |||||||||
Sbjct: 93  cgccagcttggcttaaggcacttatagcggncaagatggggcctnttgaactgcttgacc 34

                   
Query: 500 ctcttctt 507
           | ||||||
Sbjct: 33  cgcttctt 26



to top

>gb|AC099404.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone
              OSJNBa0019D02, complete sequence
          Length = 154692

 Score =  287 bits (145), Expect = 2e-74
 Identities = 172/181 (95%)
 Strand = Plus / Minus

                                                                          
Query: 268    cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
              |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 154244 cctgttgtgcatcataagcagctccagctcagagacattgtgcaccacaaacttcttgaa 154185

                                                                          
Query: 328    cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
              ||||||||||||||| ||||| ||||||||||||||||| || |||||||||||||||||
Sbjct: 154184 cttgttgggaaggtagtgccttgtcttcttgtcagaaccatatccaatgttgggcatcaa 154125

                                                                          
Query: 388    ggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagct 447
              ||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 154124 ggtgcatcctttgaactttctcctgacacgagagtcaataccctttggcctgcgccagct 154065

               
Query: 448    t 448
              |
Sbjct: 154064 t 154064



 Score =  111 bits (56), Expect = 3e-21
 Identities = 83/92 (90%)
 Strand = Plus / Minus

                                                                          
Query: 451    cttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccctcttcttcac 510
              |||||||||||||||||||||||| || | ||||||||| ||||| |||| |||||||||
Sbjct: 153148 cttgaggccaatgtagcggtcgctgtgcggcctcttgaactgcttcacccgcttcttcac 153089

                                              
Query: 511    gatcttcttcgtcagaatcggcaccgccatct 542
              ||||||||||||||| | ||||||| ||||||
Sbjct: 153088 gatcttcttcgtcagcaacggcaccaccatct 153057



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                          
Query: 169    aagcttgttggtaaccacgatgtcgagctgtgcggcacgctcaacgatgtccttgcgctt 228
              |||||||||||| ||||||||||| ||||| || || ||||| ||||| |||||||||||
Sbjct: 154692 aagcttgttggtgaccacgatgtccagctgcgcagcgcgctcgacgatctccttgcgctt 154633

                                                           
Query: 229    cttggtggagacgttgtgcgcaatctccgcacagtaggtcctgtt 273
                 ||||||||||||||| |||||||| || ||||| ||||||||
Sbjct: 154632 gcgggtggagacgttgtgagcaatctcagcgcagtatgtcctgtt 154588



to top

>gb|AC108763.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone
             OSJNBb0004A05, complete sequence
          Length = 157913

 Score =  287 bits (145), Expect = 2e-74
 Identities = 172/181 (95%)
 Strand = Plus / Minus

                                                                         
Query: 268   cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
             |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 38918 cctgttgtgcatcataagcagctccagctcagagacattgtgcaccacaaacttcttgaa 38859

                                                                         
Query: 328   cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
             ||||||||||||||| ||||| ||||||||||||||||| || |||||||||||||||||
Sbjct: 38858 cttgttgggaaggtagtgccttgtcttcttgtcagaaccatatccaatgttgggcatcaa 38799

                                                                         
Query: 388   ggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagct 447
             ||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 38798 ggtgcatcctttgaactttctcctgacacgagagtcaataccctttggcctgcgccagct 38739

              
Query: 448   t 448
             |
Sbjct: 38738 t 38738



 Score =  272 bits (137), Expect = 1e-69
 Identities = 170/181 (93%)
 Strand = Plus / Plus

                                                                         
Query: 268   cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
             |||||||||||||||||| | |||||||||||||||||||||||| ||||||||||||||
Sbjct: 58121 cctgttgtgcatcataagtaactccagctcagagacattgtggacgacaaacttcttgaa 58180

                                                                         
Query: 328   cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
              |||||||||||||||||||| ||||||||||||||||| |||||||| || ||||||||
Sbjct: 58181 tttgttgggaaggtaatgcctcgtcttcttgtcagaaccatagccaatattaggcatcaa 58240

                                                                         
Query: 388   ggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagct 447
              |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 58241 agtgcatcccttgaactttctcctgacacgggagtcgataccctttggcctgcgccagct 58300

              
Query: 448   t 448
             |
Sbjct: 58301 t 58301



 Score =  248 bits (125), Expect = 2e-62
 Identities = 167/181 (92%)
 Strand = Plus / Plus

                                                                         
Query: 268   cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
             |||||||||||||||||||||||||||||| ||||| ||||| || ||||||||||||||
Sbjct: 52323 cctgttgtgcatcataagcagctccagctctgagacgttgtgcaccacaaacttcttgaa 52382

                                                                         
Query: 328   cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
             ||||||||| ||||||||||||||||||||||| ||||| || ||||| |||||||||||
Sbjct: 52383 cttgttgggcaggtaatgcctggtcttcttgtccgaaccatatccaatattgggcatcaa 52442

                                                                         
Query: 388   ggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagct 447
              ||||||||||||||||| ||||||||||| || |||||||||||||| |||||||||||
Sbjct: 52443 tgtgcatcccttgaacttcctcctgacacgtgagtcaataccctttggtctgcgccagct 52502

              
Query: 448   t 448
             |
Sbjct: 52503 t 52503



 Score =  143 bits (72), Expect = 8e-31
 Identities = 120/136 (88%)
 Strand = Plus / Plus

                                                                         
Query: 138   tttactcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagct 197
             ||||||| ||||| |||||||| |||||||||||||||||||| |||||||| || ||||
Sbjct: 57852 tttactcgtcctcctggctgcgaagcctggcaagcttgttggtgaccacgatatcaagct 57911

                                                                         
Query: 198   gtgcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccg 257
             |||| |||||||| ||||| |||||||||||||| || ||||| ||||| || ||||| |
Sbjct: 57912 gtgcagcacgctccacgatctccttgcgcttcttcgttgagacattgtgagcgatctcag 57971

                             
Query: 258   cacagtaggtcctgtt 273
             ||||||| ||||||||
Sbjct: 57972 cacagtatgtcctgtt 57987



 Score =  137 bits (69), Expect = 5e-29
 Identities = 117/133 (87%)
 Strand = Plus / Minus

                                                                         
Query: 141   actcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtg 200
             |||| ||||| ||||||||||||||||||||||||||||| ||||||||||| ||||| |
Sbjct: 39394 actcgtcctcctggctgcggagcctggcaagcttgttggtgaccacgatgtccagctgcg 39335

                                                                         
Query: 201   cggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcac 260
             | || ||||| ||||| |||||||||||   ||||||||||||||| |||||||| || |
Sbjct: 39334 cagcgcgctcgacgatctccttgcgcttgcgggtggagacgttgtgagcaatctcagcgc 39275

                          
Query: 261   agtaggtcctgtt 273
             |||| ||||||||
Sbjct: 39274 agtatgtcctgtt 39262



 Score =  111 bits (56), Expect = 3e-21
 Identities = 83/92 (90%)
 Strand = Plus / Plus

                                                                         
Query: 451   cttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccctcttcttcac 510
             ||||||||| |||||||||||||| || | ||||||||| ||||| |||| |||||||||
Sbjct: 59513 cttgaggccgatgtagcggtcgctgtgcggcctcttgaactgcttcacccgcttcttcac 59572

                                             
Query: 511   gatcttcttcgtcagaatcggcaccgccatct 542
             ||||||||||||||| | ||||||||||||||
Sbjct: 59573 gatcttcttcgtcagcaacggcaccgccatct 59604



 Score =  111 bits (56), Expect = 3e-21
 Identities = 83/92 (90%)
 Strand = Plus / Minus

                                                                         
Query: 451   cttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccctcttcttcac 510
             |||||||||||||||||||||||| || | ||||||||| ||||| |||| |||||||||
Sbjct: 37822 cttgaggccaatgtagcggtcgctgtgcggcctcttgaactgcttcacccgcttcttcac 37763

                                             
Query: 511   gatcttcttcgtcagaatcggcaccgccatct 542
             ||||||||||||||| | ||||||| ||||||
Sbjct: 37762 gatcttcttcgtcagcaacggcaccaccatct 37731



 Score =  103 bits (52), Expect = 6e-19
 Identities = 82/92 (89%)
 Strand = Plus / Plus

                                                                         
Query: 451   cttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccctcttcttcac 510
             |||||||||||||||||||||||| || | ||||||||| ||||| |||| |||||||||
Sbjct: 53166 cttgaggccaatgtagcggtcgctgtgcggcctcttgaactgcttcacccgcttcttcac 53225

                                             
Query: 511   gatcttcttcgtcagaatcggcaccgccatct 542
             ||||||||||||||| |  || ||||||||||
Sbjct: 53226 gatcttcttcgtcagcaatggaaccgccatct 53257



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 112/134 (83%)
 Strand = Plus / Plus

                                                                         
Query: 140   tactcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgt 199
             ||||||||||| |||||||| |||||||||||||||||||| || || ||||| ||||| 
Sbjct: 52069 tactcatcctcctggctgcgtagcctggcaagcttgttggtgacgacaatgtcaagctga 52128

                                                                         
Query: 200   gcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgca 259
             || || ||||| || || |||||||| ||||| ||||| || || || ||||| || |||
Sbjct: 52129 gcagcgcgctccactatctccttgcgtttcttcgtggacacattatgagcaatttcagca 52188

                           
Query: 260   cagtaggtcctgtt 273
             |||||  |||||||
Sbjct: 52189 cagtacatcctgtt 52202



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  287 bits (145), Expect = 2e-74
 Identities = 172/181 (95%)
 Strand = Plus / Minus

                                                                            
Query: 268      cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
                |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 19108959 cctgttgtgcatcataagcagctccagctcagagacattgtgcaccacaaacttcttgaa 19108900

                                                                            
Query: 328      cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
                ||||||||||||||| ||||| ||||||||||||||||| || |||||||||||||||||
Sbjct: 19108899 cttgttgggaaggtagtgccttgtcttcttgtcagaaccatatccaatgttgggcatcaa 19108840

                                                                            
Query: 388      ggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagct 447
                ||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 19108839 ggtgcatcctttgaactttctcctgacacgagagtcaataccctttggcctgcgccagct 19108780

                 
Query: 448      t 448
                |
Sbjct: 19108779 t 19108779



 Score =  272 bits (137), Expect = 1e-69
 Identities = 170/181 (93%)
 Strand = Plus / Plus

                                                                            
Query: 268      cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
                |||||||||||||||||| | |||||||||||||||||||||||| ||||||||||||||
Sbjct: 19127101 cctgttgtgcatcataagtaactccagctcagagacattgtggacgacaaacttcttgaa 19127160

                                                                            
Query: 328      cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
                 |||||||||||||||||||| ||||||||||||||||| |||||||| || ||||||||
Sbjct: 19127161 tttgttgggaaggtaatgcctcgtcttcttgtcagaaccatagccaatattaggcatcaa 19127220

                                                                            
Query: 388      ggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagct 447
                 |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 19127221 agtgcatcccttgaactttctcctgacacgggagtcgataccctttggcctgcgccagct 19127280

                 
Query: 448      t 448
                |
Sbjct: 19127281 t 19127281



 Score =  248 bits (125), Expect = 2e-62
 Identities = 167/181 (92%)
 Strand = Plus / Plus

                                                                            
Query: 268      cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
                |||||||||||||||||||||||||||||| ||||| ||||| || ||||||||||||||
Sbjct: 19121909 cctgttgtgcatcataagcagctccagctctgagacgttgtgcaccacaaacttcttgaa 19121968

                                                                            
Query: 328      cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
                ||||||||| ||||||||||||||||||||||| ||||| || ||||| |||||||||||
Sbjct: 19121969 cttgttgggcaggtaatgcctggtcttcttgtccgaaccatatccaatattgggcatcaa 19122028

                                                                            
Query: 388      ggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagct 447
                 ||||||||||||||||| ||||||||||| || |||||||||||||| |||||||||||
Sbjct: 19122029 tgtgcatcccttgaacttcctcctgacacgtgagtcaataccctttggtctgcgccagct 19122088

                 
Query: 448      t 448
                |
Sbjct: 19122089 t 19122089



 Score =  143 bits (72), Expect = 8e-31
 Identities = 120/136 (88%)
 Strand = Plus / Plus

                                                                            
Query: 138      tttactcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagct 197
                ||||||| ||||| |||||||| |||||||||||||||||||| |||||||| || ||||
Sbjct: 19126832 tttactcgtcctcctggctgcgaagcctggcaagcttgttggtgaccacgatatcaagct 19126891

                                                                            
Query: 198      gtgcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccg 257
                |||| |||||||| ||||| |||||||||||||| || ||||| ||||| || ||||| |
Sbjct: 19126892 gtgcagcacgctccacgatctccttgcgcttcttcgttgagacattgtgagcgatctcag 19126951

                                
Query: 258      cacagtaggtcctgtt 273
                ||||||| ||||||||
Sbjct: 19126952 cacagtatgtcctgtt 19126967



 Score =  111 bits (56), Expect = 3e-21
 Identities = 83/92 (90%)
 Strand = Plus / Plus

                                                                            
Query: 451      cttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccctcttcttcac 510
                ||||||||| |||||||||||||| || | ||||||||| ||||| |||| |||||||||
Sbjct: 19128493 cttgaggccgatgtagcggtcgctgtgcggcctcttgaactgcttcacccgcttcttcac 19128552

                                                
Query: 511      gatcttcttcgtcagaatcggcaccgccatct 542
                ||||||||||||||| | ||||||||||||||
Sbjct: 19128553 gatcttcttcgtcagcaacggcaccgccatct 19128584



 Score =  111 bits (56), Expect = 3e-21
 Identities = 83/92 (90%)
 Strand = Plus / Minus

                                                                            
Query: 451      cttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccctcttcttcac 510
                |||||||||||||||||||||||| || | ||||||||| ||||| |||| |||||||||
Sbjct: 19107864 cttgaggccaatgtagcggtcgctgtgcggcctcttgaactgcttcacccgcttcttcac 19107805

                                                
Query: 511      gatcttcttcgtcagaatcggcaccgccatct 542
                ||||||||||||||| | ||||||| ||||||
Sbjct: 19107804 gatcttcttcgtcagcaacggcaccaccatct 19107773



 Score =  103 bits (52), Expect = 6e-19
 Identities = 82/92 (89%)
 Strand = Plus / Plus

                                                                            
Query: 451      cttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccctcttcttcac 510
                |||||||||||||||||||||||| || | ||||||||| ||||| |||| |||||||||
Sbjct: 19122752 cttgaggccaatgtagcggtcgctgtgcggcctcttgaactgcttcacccgcttcttcac 19122811

                                                
Query: 511      gatcttcttcgtcagaatcggcaccgccatct 542
                ||||||||||||||| |  || ||||||||||
Sbjct: 19122812 gatcttcttcgtcagcaatggaaccgccatct 19122843



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 112/134 (83%)
 Strand = Plus / Plus

                                                                            
Query: 140      tactcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgt 199
                ||||||||||| |||||||| |||||||||||||||||||| || || ||||| ||||| 
Sbjct: 19121655 tactcatcctcctggctgcgtagcctggcaagcttgttggtgacgacaatgtcaagctga 19121714

                                                                            
Query: 200      gcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgca 259
                || || ||||| || || |||||||| ||||| ||||| || || || ||||| || |||
Sbjct: 19121715 gcagcgcgctccactatctccttgcgtttcttcgtggacacattatgagcaatttcagca 19121774

                              
Query: 260      cagtaggtcctgtt 273
                |||||  |||||||
Sbjct: 19121775 cagtacatcctgtt 19121788



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  272 bits (137), Expect = 1e-69
 Identities = 170/181 (93%)
 Strand = Plus / Minus

                                                                            
Query: 268      cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
                ||||||||||||||| |||| ||||||||||||||||||||| || ||||||||||||||
Sbjct: 26085193 cctgttgtgcatcatgagcaactccagctcagagacattgtgcaccacaaacttcttgaa 26085134

                                                                            
Query: 328      cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
                ||||||||| ||||| ||||||||||||||||| || ||||| |||||||||||||||||
Sbjct: 26085133 cttgttggggaggtagtgcctggtcttcttgtctgagccgtaaccaatgttgggcatcaa 26085074

                                                                            
Query: 388      ggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagct 447
                ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 26085073 ggtgcatcccttgaactttctcctgacacgggagtcaatacccttgggcctgcgccagct 26085014

                 
Query: 448      t 448
                |
Sbjct: 26085013 t 26085013



 Score =  170 bits (86), Expect = 3e-39
 Identities = 122/134 (91%)
 Strand = Plus / Minus

                                                                            
Query: 140      tactcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgt 199
                ||||| ||||| ||||| |||||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 26085443 tactcgtcctcctggctacggagccttgcaagcttgttggtgaccacgatgtcgagctgc 26085384

                                                                            
Query: 200      gcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgca 259
                || |||||||||||||| |||||||||||||| || ||||||||||| |||||||| |||
Sbjct: 26085383 gcagcacgctcaacgatctccttgcgcttcttcgtagagacgttgtgggcaatctcggca 26085324

                              
Query: 260      cagtaggtcctgtt 273
                ||||||||||||||
Sbjct: 26085323 cagtaggtcctgtt 26085310



 Score =  125 bits (63), Expect = 2e-25
 Identities = 78/83 (93%)
 Strand = Plus / Minus

                                                                            
Query: 463      gtagcggtcgctatgggccctcttgaagtgcttgaccctcttcttcacgatcttcttcgt 522
                ||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 26083933 gtagcggtcactatggggcctcttgaactgcttgaccctcttcttcacgatcttcttcgt 26083874

                                       
Query: 523      cagaatcggcaccgccatctctg 545
                ||| | |||||||||||||||||
Sbjct: 26083873 cagcagcggcaccgccatctctg 26083851



to top

>dbj|AP003888.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1191_A10
          Length = 140643

 Score =  272 bits (137), Expect = 1e-69
 Identities = 170/181 (93%)
 Strand = Plus / Minus

                                                                         
Query: 268   cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
             ||||||||||||||| |||| ||||||||||||||||||||| || ||||||||||||||
Sbjct: 29124 cctgttgtgcatcatgagcaactccagctcagagacattgtgcaccacaaacttcttgaa 29065

                                                                         
Query: 328   cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
             ||||||||| ||||| ||||||||||||||||| || ||||| |||||||||||||||||
Sbjct: 29064 cttgttggggaggtagtgcctggtcttcttgtctgagccgtaaccaatgttgggcatcaa 29005

                                                                         
Query: 388   ggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagct 447
             ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 29004 ggtgcatcccttgaactttctcctgacacgggagtcaatacccttgggcctgcgccagct 28945

              
Query: 448   t 448
             |
Sbjct: 28944 t 28944



 Score =  170 bits (86), Expect = 3e-39
 Identities = 122/134 (91%)
 Strand = Plus / Minus

                                                                         
Query: 140   tactcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgt 199
             ||||| ||||| ||||| |||||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 29374 tactcgtcctcctggctacggagccttgcaagcttgttggtgaccacgatgtcgagctgc 29315

                                                                         
Query: 200   gcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgca 259
             || |||||||||||||| |||||||||||||| || ||||||||||| |||||||| |||
Sbjct: 29314 gcagcacgctcaacgatctccttgcgcttcttcgtagagacgttgtgggcaatctcggca 29255

                           
Query: 260   cagtaggtcctgtt 273
             ||||||||||||||
Sbjct: 29254 cagtaggtcctgtt 29241



 Score =  125 bits (63), Expect = 2e-25
 Identities = 78/83 (93%)
 Strand = Plus / Minus

                                                                         
Query: 463   gtagcggtcgctatgggccctcttgaagtgcttgaccctcttcttcacgatcttcttcgt 522
             ||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 27864 gtagcggtcactatggggcctcttgaactgcttgaccctcttcttcacgatcttcttcgt 27805

                                    
Query: 523   cagaatcggcaccgccatctctg 545
             ||| | |||||||||||||||||
Sbjct: 27804 cagcagcggcaccgccatctctg 27782



to top

>gb|AF140494.1|AF140494 Oryza sativa 60S ribosomal protein mRNA, partial cds
          Length = 342

 Score =  256 bits (129), Expect = 7e-65
 Identities = 202/225 (89%), Gaps = 1/225 (0%)
 Strand = Plus / Minus

                                                                       
Query: 319 cttcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatg-t 377
           |||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||  |
Sbjct: 254 cttcttgaacttgttgggcaggtaatgcctggtcttcttgtccgaaccatatccaataat 195

                                                                       
Query: 378 tgggcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcc 437
           |||||||||| ||||||||||||||||| ||||||||||| || |||||||||||||| |
Sbjct: 194 tgggcatcaatgtgcatcccttgaacttcctcctgacacgtgagtcaataccctttggtc 135

                                                                       
Query: 438 tgcgccagctttgcttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttga 497
           |||||||||||  |||||||||||||||||||||||| || | ||||||||| ||||| |
Sbjct: 134 tgcgccagcttgtcttgaggccaatgtagcggtcgctgtgcggcctcttgaactgcttca 75

                                                        
Query: 498 ccctcttcttcacgatcttcttcgtcagaatcggcaccgccatct 542
           ||| |||||||||||||||||||||||| |  || ||||||||||
Sbjct: 74  cccgcttcttcacgatcttcttcgtcagcaatggaaccgccatct 30



 Score =  143 bits (72), Expect = 8e-31
 Identities = 87/92 (94%)
 Strand = Plus / Minus

                                                                       
Query: 267 tcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttga 326
           ||||||||||||||||||||||||||||||| ||||| ||||| || |||||||||||||
Sbjct: 339 tcctgttgtgcatcataagcagctccagctctgagacgttgtgcaccacaaacttcttga 280

                                           
Query: 327 acttgttgggaaggtaatgcctggtcttcttg 358
           |||||||||| |||||||||||||||||||||
Sbjct: 279 acttgttgggcaggtaatgcctggtcttcttg 248



to top

>gb|AY109477.1| Zea mays CL1797_1 mRNA sequence
          Length = 828

 Score =  252 bits (127), Expect = 1e-63
 Identities = 202/227 (88%)
 Strand = Plus / Minus

                                                                       
Query: 140 tactcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgt 199
           ||||| ||||| |||||||||||||| ||||||||||| || ||||| ||||||||||| 
Sbjct: 490 tactcgtcctcctggctgcggagcctagcaagcttgttcgtgaccacaatgtcgagctgc 431

                                                                       
Query: 200 gcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgca 259
           || |||||||| ||||| |||||||||||||| ||||| |||||||| ||||| || || 
Sbjct: 430 gcagcacgctccacgatctccttgcgcttcttagtggacacgttgtgagcaatttcagcg 371

                                                                       
Query: 260 cagtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaac 319
           ||||||||||||||||||||||| |||| |||||||||||| || |||||||| ||||||
Sbjct: 370 cagtaggtcctgttgtgcatcatgagcaactccagctcagaaacgttgtggaccacaaac 311

                                                          
Query: 320 ttcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaacc 366
           ||||||||||||||||| ||||| |||||||||  ||||||||||||
Sbjct: 310 ttcttgaacttgttggggaggtagtgcctggtcgacttgtcagaacc 264



 Score =  184 bits (93), Expect = 2e-43
 Identities = 138/153 (90%)
 Strand = Plus / Minus

                                                                       
Query: 392 catcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagctttgc 451
           |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||
Sbjct: 238 catcccttgaacttcctcctgacacgggagtcaataccctttggcctgcgccagcttggc 179

                                                                       
Query: 452 ttgaggccaatgtagcggtcgctatgggccctcttgaagtgcttgaccctcttcttcacg 511
           || ||||   |||||||||||   |||| ||||||||| |||||||||| ||||||||||
Sbjct: 178 ttaaggcacttgtagcggtcgaggtggggcctcttgaactgcttgacccgcttcttcacg 119

                                            
Query: 512 atcttcttcgtcagaatcggcaccgccatctct 544
           |||||||||||||| | ||||||||||||||||
Sbjct: 118 atcttcttcgtcagcagcggcaccgccatctct 86



to top

>gb|DQ222508.1| Solanum tuberosum clone 115D08 ly200-like protein mRNA, complete
           cds
          Length = 580

 Score =  137 bits (69), Expect = 5e-29
 Identities = 252/313 (80%)
 Strand = Plus / Minus

                                                                       
Query: 143 tcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcg 202
           |||||||| |||||| | | ||| ||||||||||| || |  || | ||| |||||||| 
Sbjct: 411 tcatcctcctggctgtgcaacctagcaagcttgtttgttatgacaacgtcaagctgtgca 352

                                                                       
Query: 203 gcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacag 262
           || ||||| ||||| || || | |||| ||||||| || || || ||||| || ||||||
Sbjct: 351 gctcgctcgacgatctctttcctcttcctggtggaaacattatgtgcaatttctgcacag 292

                                                                       
Query: 263 taggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttc 322
           || || |||||||||||||| || | ||| ||||||    |||| || ||||||||||||
Sbjct: 291 taagttctgttgtgcatcattaggatctcaagctcactagcattatgcacaacaaacttc 232

                                                                       
Query: 323 ttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggc 382
           |||||    |||||||| || || |  ||||||||||| || ||||| ||||| ||||||
Sbjct: 231 ttgaagccattgggaagatagtggcgagtcttcttgtctgacccgtaaccaatattgggc 172

                                                                       
Query: 383 atcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgc 442
           ||||||   |||||||||||||||||||| || |  |||||||||||||| || ||||||
Sbjct: 171 atcaagacacatcccttgaactttctcctcactctagaatcaatacccttgggtctgcgc 112

                        
Query: 443 cagctttgcttga 455
           ||||||| |||||
Sbjct: 111 cagctttccttga 99



to top

>gb|DQ191670.1| Solanum tuberosum ly200-like protein mRNA, complete cds
          Length = 565

 Score =  137 bits (69), Expect = 5e-29
 Identities = 252/313 (80%)
 Strand = Plus / Minus

                                                                       
Query: 143 tcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcg 202
           |||||||| |||||| | | ||| ||||||||||| || |  || | ||| |||||||| 
Sbjct: 440 tcatcctcctggctgtgcaacctagcaagcttgtttgttatgacaacgtcaagctgtgca 381

                                                                       
Query: 203 gcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacag 262
           || ||||| ||||| || || | |||| ||||||| || || || ||||| || ||||||
Sbjct: 380 gctcgctcgacgatctctttcctcttcctggtggaaacattatgtgcaatttctgcacag 321

                                                                       
Query: 263 taggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttc 322
           || || |||||||||||||| || | ||| ||||||    |||| || ||||||||||||
Sbjct: 320 taagttctgttgtgcatcattaggatctcaagctcactagcattatgcacaacaaacttc 261

                                                                       
Query: 323 ttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggc 382
           |||||    |||||||| || || |  ||||||||||| || ||||| ||||| ||||||
Sbjct: 260 ttgaagccattgggaagatagtggcgagtcttcttgtctgacccgtaaccaatattgggc 201

                                                                       
Query: 383 atcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgc 442
           ||||||   |||||||||||||||||||| || |  |||||||||||||| || ||||||
Sbjct: 200 atcaagacacatcccttgaactttctcctcactctagaatcaatacccttgggtctgcgc 141

                        
Query: 443 cagctttgcttga 455
           ||||||| |||||
Sbjct: 140 cagctttccttga 128



to top

>ref|NM_180811.1| Arabidopsis thaliana structural constituent of ribosome AT5G46430
           transcript variant AT5G46430.1 mRNA, complete cds
          Length = 602

 Score =  131 bits (66), Expect = 3e-27
 Identities = 177/214 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagag 301
           ||||| |||||||| |||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 344 ttgtgagcaatctctgcacagtaagtcctgttgtgcatcatgagtagctcgagctcagag 285

                                                                       
Query: 302 acattgtggacaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtca 361
              ||||| ||||  |||||||||||    || || ||||| || | ||||||||| |||
Sbjct: 284 gtgttgtgaacaatgaacttcttgaatccatttgggaggtagtggcgggtcttcttatca 225

                                                                       
Query: 362 gaaccgtagccaatgttgggcatcaaggtgcatcccttgaactttctcctgacacgggaa 421
           || ||||| ||||  |||||||||||||||   |||||||||||||| || || ||||| 
Sbjct: 224 gatccgtaaccaacattgggcatcaaggtgacacccttgaactttcttctcacccgggag 165

                                             
Query: 422 tcaataccctttggcctgcgccagctttgcttga 455
           ||||||||||| ||||| | |||||||| |||||
Sbjct: 164 tcaatacccttaggcctcctccagctttccttga 131



to top

>ref|NM_124013.2| Arabidopsis thaliana structural constituent of ribosome AT5G46430
           transcript variant AT5G46430.2 mRNA, complete cds
          Length = 606

 Score =  131 bits (66), Expect = 3e-27
 Identities = 177/214 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagag 301
           ||||| |||||||| |||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 348 ttgtgagcaatctctgcacagtaagtcctgttgtgcatcatgagtagctcgagctcagag 289

                                                                       
Query: 302 acattgtggacaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtca 361
              ||||| ||||  |||||||||||    || || ||||| || | ||||||||| |||
Sbjct: 288 gtgttgtgaacaatgaacttcttgaatccatttgggaggtagtggcgggtcttcttatca 229

                                                                       
Query: 362 gaaccgtagccaatgttgggcatcaaggtgcatcccttgaactttctcctgacacgggaa 421
           || ||||| ||||  |||||||||||||||   |||||||||||||| || || ||||| 
Sbjct: 228 gatccgtaaccaacattgggcatcaaggtgacacccttgaactttcttctcacccgggag 169

                                             
Query: 422 tcaataccctttggcctgcgccagctttgcttga 455
           ||||||||||| ||||| | |||||||| |||||
Sbjct: 168 tcaatacccttaggcctcctccagctttccttga 135



to top

>gb|AF446871.1|AF446871 Arabidopsis thaliana AT5g46430/K11I1_2 mRNA, complete cds
          Length = 402

 Score =  131 bits (66), Expect = 3e-27
 Identities = 177/214 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagag 301
           ||||| |||||||| |||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 299 ttgtgagcaatctctgcacagtaagtcctgttgtgcatcatgagtagctcgagctcagag 240

                                                                       
Query: 302 acattgtggacaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtca 361
              ||||| ||||  |||||||||||    || || ||||| || | ||||||||| |||
Sbjct: 239 gtgttgtgaacaatgaacttcttgaatccatttgggaggtagtggcgggtcttcttatca 180

                                                                       
Query: 362 gaaccgtagccaatgttgggcatcaaggtgcatcccttgaactttctcctgacacgggaa 421
           || ||||| ||||  |||||||||||||||   |||||||||||||| || || ||||| 
Sbjct: 179 gatccgtaaccaacattgggcatcaaggtgacacccttgaactttcttctcacccgggag 120

                                             
Query: 422 tcaataccctttggcctgcgccagctttgcttga 455
           ||||||||||| ||||| | |||||||| |||||
Sbjct: 119 tcaatacccttaggcctcctccagctttccttga 86



to top

>gb|AY052193.1| Arabidopsis thaliana AT5g46430/K11I1_2 mRNA, complete cds
          Length = 609

 Score =  131 bits (66), Expect = 3e-27
 Identities = 177/214 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagag 301
           ||||| |||||||| |||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 348 ttgtgagcaatctctgcacagtaagtcctgttgtgcatcatgagtagctcgagctcagag 289

                                                                       
Query: 302 acattgtggacaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtca 361
              ||||| ||||  |||||||||||    || || ||||| || | ||||||||| |||
Sbjct: 288 gtgttgtgaacaatgaacttcttgaatccatttgggaggtagtggcgggtcttcttatca 229

                                                                       
Query: 362 gaaccgtagccaatgttgggcatcaaggtgcatcccttgaactttctcctgacacgggaa 421
           || ||||| ||||  |||||||||||||||   |||||||||||||| || || ||||| 
Sbjct: 228 gatccgtaaccaacattgggcatcaaggtgacacccttgaactttcttctcacccgggag 169

                                             
Query: 422 tcaataccctttggcctgcgccagctttgcttga 455
           ||||||||||| ||||| | |||||||| |||||
Sbjct: 168 tcaatacccttaggcctcctccagctttccttga 135



to top

>gb|AY042872.1| Arabidopsis thaliana ribosomal protein L32 (K11I1.2) mRNA, complete
           cds
          Length = 602

 Score =  131 bits (66), Expect = 3e-27
 Identities = 177/214 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagag 301
           ||||| |||||||| |||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 344 ttgtgagcaatctctgcacagtaagtcctgttgtgcatcatgagtagctcgagctcagag 285

                                                                       
Query: 302 acattgtggacaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtca 361
              ||||| ||||  |||||||||||    || || ||||| || | ||||||||| |||
Sbjct: 284 gtgttgtgaacaatgaacttcttgaatccatttgggaggtagtggcgggtcttcttatca 225

                                                                       
Query: 362 gaaccgtagccaatgttgggcatcaaggtgcatcccttgaactttctcctgacacgggaa 421
           || ||||| ||||  |||||||||||||||   |||||||||||||| || || ||||| 
Sbjct: 224 gatccgtaaccaacattgggcatcaaggtgacacccttgaactttcttctcacccgggag 165

                                             
Query: 422 tcaataccctttggcctgcgccagctttgcttga 455
           ||||||||||| ||||| | |||||||| |||||
Sbjct: 164 tcaatacccttaggcctcctccagctttccttga 131



to top

>gb|BT002551.1| Arabidopsis thaliana ribosomal protein L32 (At5g46430) mRNA,
           complete cds
          Length = 506

 Score =  131 bits (66), Expect = 3e-27
 Identities = 177/214 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagag 301
           ||||| |||||||| |||||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 299 ttgtgagcaatctctgcacagtaagtcctgttgtgcatcatgagtagctcgagctcagag 240

                                                                       
Query: 302 acattgtggacaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtca 361
              ||||| ||||  |||||||||||    || || ||||| || | ||||||||| |||
Sbjct: 239 gtgttgtgaacaatgaacttcttgaatccatttgggaggtagtggcgggtcttcttatca 180

                                                                       
Query: 362 gaaccgtagccaatgttgggcatcaaggtgcatcccttgaactttctcctgacacgggaa 421
           || ||||| ||||  |||||||||||||||   |||||||||||||| || || ||||| 
Sbjct: 179 gatccgtaaccaacattgggcatcaaggtgacacccttgaactttcttctcacccgggag 120

                                             
Query: 422 tcaataccctttggcctgcgccagctttgcttga 455
           ||||||||||| ||||| | |||||||| |||||
Sbjct: 119 tcaatacccttaggcctcctccagctttccttga 86



to top

>gb|AY488030.1| Capsicum annuum ly200 protein mRNA, complete cds
          Length = 634

 Score =  129 bits (65), Expect = 1e-26
 Identities = 251/313 (80%)
 Strand = Plus / Minus

                                                                       
Query: 143 tcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcg 202
           |||||||| |||||||| | ||| ||||||||||| || || || | ||| || || || 
Sbjct: 457 tcatcctcctggctgcgcaacctagcaagcttgtttgttacgacaacgtcaagttgggca 398

                                                                       
Query: 203 gcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacag 262
           || ||||| ||||| ||||| | |||| | |||||||| ||||| ||||| || ||||||
Sbjct: 397 gctcgctcgacgatctccttcctcttcctagtggagacattgtgtgcaatttctgcacag 338

                                                                       
Query: 263 taggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttc 322
           || || |||||||||||||| |  | ||| ||||||    |||| || ||||||||||||
Sbjct: 337 taagttctgttgtgcatcatcaagacctcaagctcacttgcattatgcacaacaaacttc 278

                                                                       
Query: 323 ttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggc 382
           |||||   ||||||||| || || |  ||||||||||| || || || ||||| ||||||
Sbjct: 277 ttgaagccgttgggaagatagtggcgagtcttcttgtctgacccatatccaatattgggc 218

                                                                       
Query: 383 atcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgc 442
           ||||||   |||||||||||||||||||| || |  ||||| ||||| || || ||||||
Sbjct: 217 atcaagacacatcccttgaactttctcctcactctagaatcgatacctttgggtctgcgc 158

                        
Query: 443 cagctttgcttga 455
           ||||||| |||||
Sbjct: 157 cagctttccttga 145



to top

>gb|DQ122831.1| Medicago sativa clone C3 ribosomal protein L32 mRNA, complete cds
          Length = 558

 Score =  127 bits (64), Expect = 4e-26
 Identities = 175/212 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagag 301
           ||||| |||||||| |||||||| ||||||||||||||||| |  |||||||| ||   |
Sbjct: 359 ttgtgtgcaatctcagcacagtatgtcctgttgtgcatcatcaaaagctccaggtcctgg 300

                                                                       
Query: 302 acattgtggacaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtca 361
           |||||||| || || |||||||||||    || || |  || || | |||||||||||| 
Sbjct: 299 acattgtgcacgacgaacttcttgaatccattaggcaaatagtggcgggtcttcttgtct 240

                                                                       
Query: 362 gaaccgtagccaatgttgggcatcaaggtgcatcccttgaactttctcctgacacgggaa 421
           || ||||| |||||||| |||||||| ||   ||| ||||| |||||||| || || |||
Sbjct: 239 gagccgtatccaatgttaggcatcaaagtaactcctttgaattttctcctaactcgtgaa 180

                                           
Query: 422 tcaataccctttggcctgcgccagctttgctt 453
           ||||||||||||||||||||||||||||||||
Sbjct: 179 tcaataccctttggcctgcgccagctttgctt 148



to top

>ref|NM_117920.2| Arabidopsis thaliana structural constituent of ribosome AT4G18100
           mRNA, complete cds
          Length = 697

 Score =  125 bits (63), Expect = 2e-25
 Identities = 246/307 (80%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcggcacgc 208
           |||||||| |||||||| |||||| |||||||||| || | ||| ||||| |  || | |
Sbjct: 457 tcttggctacggagcctagcaagcctgttggtaacaacaacgtctagctgagaagctctc 398

                                                                       
Query: 209 tcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagtaggtc 268
           ||||| ||  |||| | |||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 397 tcaacaattgcctttctcttcttagtggagacgttgtgagcaatctcagcacagtaagtc 338

                                                                       
Query: 269 ctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaac 328
           |||||||||||||| | || ||| ||||||      ||||| ||||| || |||||||| 
Sbjct: 337 ctgttgtgcatcatcaacaactcgagctcacttgtgttgtgaacaacgaatttcttgaat 278

                                                                       
Query: 329 ttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
              |||||||| || || |  |||||||||||||| ||||| ||||  ||||||||||| 
Sbjct: 277 ccattgggaagatagtgacgagtcttcttgtcagatccgtaaccaacattgggcatcaaa 218

                                                                       
Query: 389 gtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagctt 448
           ||    || ||||||||||| || || |  |||||||||||||||||||| | |||||||
Sbjct: 217 gtcacacctttgaactttcttctcacccttgaatcaataccctttggcctcctccagctt 158

                  
Query: 449 tgcttga 455
           | |||||
Sbjct: 157 tccttga 151



to top

>gb|BT000235.1| Arabidopsis thaliana ribosomal protein L32 -like protein
           (At4g18100) mRNA, complete cds
          Length = 458

 Score =  125 bits (63), Expect = 2e-25
 Identities = 246/307 (80%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcggcacgc 208
           |||||||| |||||||| |||||| |||||||||| || | ||| ||||| |  || | |
Sbjct: 392 tcttggctacggagcctagcaagcctgttggtaacaacaacgtctagctgagaagctctc 333

                                                                       
Query: 209 tcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagtaggtc 268
           ||||| ||  |||| | |||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 332 tcaacaattgcctttctcttcttagtggagacgttgtgagcaatctcagcacagtaagtc 273

                                                                       
Query: 269 ctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaac 328
           |||||||||||||| | || ||| ||||||      ||||| ||||| || |||||||| 
Sbjct: 272 ctgttgtgcatcatcaacaactcgagctcacttgtgttgtgaacaacgaatttcttgaat 213

                                                                       
Query: 329 ttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
              |||||||| || || |  |||||||||||||| ||||| ||||  ||||||||||| 
Sbjct: 212 ccattgggaagatagtgacgagtcttcttgtcagatccgtaaccaacattgggcatcaaa 153

                                                                       
Query: 389 gtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagctt 448
           ||    || ||||||||||| || || |  |||||||||||||||||||| | |||||||
Sbjct: 152 gtcacacctttgaactttcttctcacccttgaatcaataccctttggcctcctccagctt 93

                  
Query: 449 tgcttga 455
           | |||||
Sbjct: 92  tccttga 86



to top

>gb|AY072399.1| Arabidopsis thaliana ribosomal protein L32 -like protein
           (At4g18100) mRNA, complete cds
          Length = 592

 Score =  125 bits (63), Expect = 2e-25
 Identities = 246/307 (80%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcggcacgc 208
           |||||||| |||||||| |||||| |||||||||| || | ||| ||||| |  || | |
Sbjct: 434 tcttggctacggagcctagcaagcctgttggtaacaacaacgtctagctgagaagctctc 375

                                                                       
Query: 209 tcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagtaggtc 268
           ||||| ||  |||| | |||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 374 tcaacaattgcctttctcttcttagtggagacgttgtgagcaatctcagcacagtaagtc 315

                                                                       
Query: 269 ctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaac 328
           |||||||||||||| | || ||| ||||||      ||||| ||||| || |||||||| 
Sbjct: 314 ctgttgtgcatcatcaacaactcgagctcacttgtgttgtgaacaacgaatttcttgaat 255

                                                                       
Query: 329 ttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
              |||||||| || || |  |||||||||||||| ||||| ||||  ||||||||||| 
Sbjct: 254 ccattgggaagatagtgacgagtcttcttgtcagatccgtaaccaacattgggcatcaaa 195

                                                                       
Query: 389 gtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagctt 448
           ||    || ||||||||||| || || |  |||||||||||||||||||| | |||||||
Sbjct: 194 gtcacacctttgaactttcttctcacccttgaatcaataccctttggcctcctccagctt 135

                  
Query: 449 tgcttga 455
           | |||||
Sbjct: 134 tccttga 128



to top

>gb|AY057566.1| Arabidopsis thaliana AT4g18100/F15J5_70 mRNA, complete cds
          Length = 648

 Score =  125 bits (63), Expect = 2e-25
 Identities = 246/307 (80%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcggcacgc 208
           |||||||| |||||||| |||||| |||||||||| || | ||| ||||| |  || | |
Sbjct: 434 tcttggctacggagcctagcaagcctgttggtaacaacaacgtctagctgagaagctctc 375

                                                                       
Query: 209 tcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagtaggtc 268
           ||||| ||  |||| | |||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 374 tcaacaattgcctttctcttcttagtggagacgttgtgagcaatctcagcacagtaagtc 315

                                                                       
Query: 269 ctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaac 328
           |||||||||||||| | || ||| ||||||      ||||| ||||| || |||||||| 
Sbjct: 314 ctgttgtgcatcatcaacaactcgagctcacttgtgttgtgaacaacgaatttcttgaat 255

                                                                       
Query: 329 ttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
              |||||||| || || |  |||||||||||||| ||||| ||||  ||||||||||| 
Sbjct: 254 ccattgggaagatagtgacgagtcttcttgtcagatccgtaaccaacattgggcatcaaa 195

                                                                       
Query: 389 gtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagctt 448
           ||    || ||||||||||| || || |  |||||||||||||||||||| | |||||||
Sbjct: 194 gtcacacctttgaactttcttctcacccttgaatcaataccctttggcctcctccagctt 135

                  
Query: 449 tgcttga 455
           | |||||
Sbjct: 134 tccttga 128



to top

>dbj|AP006687.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT41F23, TM0382,
             complete sequence
          Length = 99748

 Score =  125 bits (63), Expect = 2e-25
 Identities = 129/151 (85%)
 Strand = Plus / Plus

                                                                         
Query: 302   acattgtggacaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtca 361
             |||||||| |||||||| ||||||||    ||||| || ||||| | |||||||||||| 
Sbjct: 73223 acattgtgcacaacaaatttcttgaaaccattgggcagataatggcgggtcttcttgtct 73282

                                                                         
Query: 362   gaaccgtagccaatgttgggcatcaaggtgcatcccttgaactttctcctgacacgggaa 421
             || || || ||||||||||||||||| |||   |||||||||||||||||||| || || 
Sbjct: 73283 gagccataaccaatgttgggcatcaaagtgacacccttgaactttctcctgacccgagag 73342

                                            
Query: 422   tcaataccctttggcctgcgccagctttgct 452
             ||||||||||| |||||||||||||||||||
Sbjct: 73343 tcaatacccttgggcctgcgccagctttgct 73373



to top

>emb|AL161548.2|ATCHRIV48 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 48
          Length = 194143

 Score =  121 bits (61), Expect = 3e-24
 Identities = 241/301 (80%)
 Strand = Plus / Plus

                                                                        
Query: 149  tcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcggcacgc 208
            |||||||| |||||||| |||||| |||||||||| || | ||| ||||| |  || | |
Sbjct: 3007 tcttggctacggagcctagcaagcctgttggtaacaacaacgtctagctgagaagctctc 3066

                                                                        
Query: 209  tcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagtaggtc 268
            ||||| ||  |||| | |||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 3067 tcaacaattgcctttctcttcttagtggagacgttgtgagcaatctcagcacagtaagtc 3126

                                                                        
Query: 269  ctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaac 328
            |||||||||||||| | || ||| ||||||      ||||| ||||| || |||||||| 
Sbjct: 3127 ctgttgtgcatcatcaacaactcgagctcacttgtgttgtgaacaacgaatttcttgaat 3186

                                                                        
Query: 329  ttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
               |||||||| || || |  |||||||||||||| ||||| ||||  ||||||||||| 
Sbjct: 3187 ccattgggaagatagtgacgagtcttcttgtcagatccgtaaccaacattgggcatcaaa 3246

                                                                        
Query: 389  gtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagctt 448
            ||    || ||||||||||| || || |  |||||||||||||||||||| | |||||||
Sbjct: 3247 gtcacacctttgaactttcttctcacccttgaatcaataccctttggcctcctccagctt 3306

             
Query: 449  t 449
            |
Sbjct: 3307 t 3307



to top

>emb|AL161547.2|ATCHRIV47 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 47
          Length = 198067

 Score =  121 bits (61), Expect = 3e-24
 Identities = 241/301 (80%)
 Strand = Plus / Plus

                                                                          
Query: 149    tcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcggcacgc 208
              |||||||| |||||||| |||||| |||||||||| || | ||| ||||| |  || | |
Sbjct: 196074 tcttggctacggagcctagcaagcctgttggtaacaacaacgtctagctgagaagctctc 196133

                                                                          
Query: 209    tcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagtaggtc 268
              ||||| ||  |||| | |||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 196134 tcaacaattgcctttctcttcttagtggagacgttgtgagcaatctcagcacagtaagtc 196193

                                                                          
Query: 269    ctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaac 328
              |||||||||||||| | || ||| ||||||      ||||| ||||| || |||||||| 
Sbjct: 196194 ctgttgtgcatcatcaacaactcgagctcacttgtgttgtgaacaacgaatttcttgaat 196253

                                                                          
Query: 329    ttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
                 |||||||| || || |  |||||||||||||| ||||| ||||  ||||||||||| 
Sbjct: 196254 ccattgggaagatagtgacgagtcttcttgtcagatccgtaaccaacattgggcatcaaa 196313

                                                                          
Query: 389    gtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagctt 448
              ||    || ||||||||||| || || |  |||||||||||||||||||| | |||||||
Sbjct: 196314 gtcacacctttgaactttcttctcacccttgaatcaataccctttggcctcctccagctt 196373

               
Query: 449    t 449
              |
Sbjct: 196374 t 196374



to top

>emb|AL110123.1|ATF15J5 Arabidopsis thaliana DNA chromosome 4, BAC clone F15J5 (ESSA project)
          Length = 58427

 Score =  121 bits (61), Expect = 3e-24
 Identities = 241/301 (80%)
 Strand = Plus / Plus

                                                                         
Query: 149   tcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcggcacgc 208
             |||||||| |||||||| |||||| |||||||||| || | ||| ||||| |  || | |
Sbjct: 22598 tcttggctacggagcctagcaagcctgttggtaacaacaacgtctagctgagaagctctc 22657

                                                                         
Query: 209   tcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagtaggtc 268
             ||||| ||  |||| | |||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 22658 tcaacaattgcctttctcttcttagtggagacgttgtgagcaatctcagcacagtaagtc 22717

                                                                         
Query: 269   ctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaac 328
             |||||||||||||| | || ||| ||||||      ||||| ||||| || |||||||| 
Sbjct: 22718 ctgttgtgcatcatcaacaactcgagctcacttgtgttgtgaacaacgaatttcttgaat 22777

                                                                         
Query: 329   ttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
                |||||||| || || |  |||||||||||||| ||||| ||||  ||||||||||| 
Sbjct: 22778 ccattgggaagatagtgacgagtcttcttgtcagatccgtaaccaacattgggcatcaaa 22837

                                                                         
Query: 389   gtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagctt 448
             ||    || ||||||||||| || || |  |||||||||||||||||||| | |||||||
Sbjct: 22838 gtcacacctttgaactttcttctcacccttgaatcaataccctttggcctcctccagctt 22897

              
Query: 449   t 449
             |
Sbjct: 22898 t 22898



to top

>emb|BX828680.1|CNS0A3L6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL29ZE01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 528

 Score =  117 bits (59), Expect = 4e-23
 Identities = 245/307 (79%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcggcacgc 208
           |||||||| |||||||| |||||| |||||||||| || | ||| ||||| |  |  | |
Sbjct: 411 tcttggctacggagcctagcaagcctgttggtaacaacaacgtctagctgagaagttctc 352

                                                                       
Query: 209 tcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagtaggtc 268
           ||||| ||  |||| | |||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 351 tcaacaattgcctttctcttcttagtggagacgttgtgagcaatctcagcacagtaagtc 292

                                                                       
Query: 269 ctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaac 328
           |||||||||||||| | || ||| ||||||      ||||| ||||| || |||||||| 
Sbjct: 291 ctgttgtgcatcatcaacaactcgagctcacttgtgttgtgaacaacgaatttcttgaat 232

                                                                       
Query: 329 ttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
              |||||||| || || |  |||||||||||||| ||||| ||||  ||||||||||| 
Sbjct: 231 ccattgggaagatagtgacgagtcttcttgtcagatccgtaaccaacattgggcatcaaa 172

                                                                       
Query: 389 gtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagctt 448
           ||    || ||||||||||| || || |  |||||||||||||||||||| | |||||||
Sbjct: 171 gtcacacctttgaactttcttctcacccttgaatcaataccctttggcctcctccagctt 112

                  
Query: 449 tgcttga 455
           | |||||
Sbjct: 111 tccttga 105



to top

>gb|AY086736.1| Arabidopsis thaliana clone 271605 mRNA, complete sequence
          Length = 643

 Score =  117 bits (59), Expect = 4e-23
 Identities = 245/307 (79%)
 Strand = Plus / Minus

                                                                       
Query: 149 tcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcggcacgc 208
           |||||||| |||||||| |||||| |||||||||| || | ||| ||||| |  || | |
Sbjct: 460 tcttggctacggagcctagcaagcctgttggtaacaacaacgtctagctgagaagctctc 401

                                                                       
Query: 209 tcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagtaggtc 268
           ||||| ||  |||| | |||||| |||||||||||||| |||||||| |||||||| |||
Sbjct: 400 tcaacaattgcctttctcttcttagtggagacgttgtgagcaatctcagcacagtaagtc 341

                                                                       
Query: 269 ctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaac 328
           |||||||||||||| | || ||| ||||||      ||||| ||||| || |||||||| 
Sbjct: 340 ctgttgtgcatcatcaacaactcgagctcacttgtgttgtgaacaacgaatttcttgaat 281

                                                                       
Query: 329 ttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
              |||||||| || || |  |||||||||||||| ||||| ||||  ||||||||||| 
Sbjct: 280 ccattgggaagatagtgacgagtcttcttgtcagatccgtaaccaacattgggcatcaaa 221

                                                                       
Query: 389 gtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagctt 448
           ||    || ||||||||||| || |  |  |||||||||||||||||||| | |||||||
Sbjct: 220 gtcacacctttgaactttcttctcatccttgaatcaataccctttggcctcctccagctt 161

                  
Query: 449 tgcttga 455
           | |||||
Sbjct: 160 tccttga 154



to top

>emb|BX830633.1|CNS0A1Y2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZC06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 522

 Score =  115 bits (58), Expect = 2e-22
 Identities = 175/214 (81%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagag 301
           ||||| |||||||| |||||||| ||||||| ||||||||| || ||||| |||||||||
Sbjct: 309 ttgtgagcaatctctgcacagtaagtcctgtggtgcatcatgagtagctcgagctcagag 250

                                                                       
Query: 302 acattgtggacaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtca 361
              ||||  ||||  |||||||||||    || || ||||| || | ||||||||| |||
Sbjct: 249 gtgttgtaaacaatgaacttcttgaatccatttgggaggtagtggcgggtcttcttatca 190

                                                                       
Query: 362 gaaccgtagccaatgttgggcatcaaggtgcatcccttgaactttctcctgacacgggaa 421
           || ||||| ||||  |||||||||||||||   |||||||||||||| || || ||||| 
Sbjct: 189 gatccgtaaccaacattgggcatcaaggtgacacccttgaactttcttctcacccgggag 130

                                             
Query: 422 tcaataccctttggcctgcgccagctttgcttga 455
           ||||||||||| ||||| | |||||||| |||||
Sbjct: 129 tcaatacccttaggcctcctccagctttccttga 96



to top

>gb|AY310755.1| Nicotiana benthamiana clone 2-236 unknown mRNA
          Length = 507

 Score =  113 bits (57), Expect = 7e-22
 Identities = 249/313 (79%)
 Strand = Plus / Minus

                                                                       
Query: 143 tcatcctcttggctgcggagcctggcaagcttgttggtaaccacgatgtcgagctgtgcg 202
           |||||||| |||||||| | ||| ||||||||||| || |  || | ||| ||||| || 
Sbjct: 388 tcatcctcctggctgcgcaacctagcaagcttgtttgttatgacaacgtcaagctgggca 329

                                                                       
Query: 203 gcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacag 262
           || |||||||| || || || | |||| | ||||| || ||||| |||||||| ||||||
Sbjct: 328 gctcgctcaacaatctctttcctcttccttgtggaaacattgtgtgcaatctcagcacag 269

                                                                       
Query: 263 taggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttc 322
           || || ||||| |||||||| |  | ||| ||||||    |||| || |||||||| |||
Sbjct: 268 taagttctgttatgcatcattaagacctcaagctcacttgcattatgcacaacaaatttc 209

                                                                       
Query: 323 ttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggc 382
           |||||   ||||||||| || || | ||||||||||||||| ||||| || || ||||||
Sbjct: 208 ttgaaaccgttgggaagatagtgacgggtcttcttgtcagacccgtacccgatattgggc 149

                                                                       
Query: 383 atcaaggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgc 442
           ||||||   |||||||||||||||||||  || |  ||||| ||||| || || ||||||
Sbjct: 148 atcaagacacatcccttgaactttctccccactctagaatcgatacctttgggtctgcgc 89

                        
Query: 443 cagctttgcttga 455
           ||||||| |||||
Sbjct: 88  cagctttccttga 76



to top

>gb|AC148239.7| Medicago truncatula clone mth2-5d7, complete sequence
          Length = 103609

 Score =  101 bits (51), Expect = 3e-18
 Identities = 204/255 (80%)
 Strand = Plus / Plus

                                                                         
Query: 191   tcgagctgtgcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgca 250
             ||||| ||||| || | |||||| |||||||| | |||  | ||||| || ||||| |||
Sbjct: 92876 tcgagttgtgctgctctctcaactatgtcctttctcttactagtggatacattgtgtgca 92935

                                                                         
Query: 251   atctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagagacattgtgg 310
             ||||| ||||| || ||||| ||||||||||| |  |||||||  |||   ||||||   
Sbjct: 92936 atctcagcacaataagtcctattgtgcatcattaaaagctccaaatcattaacattgcaa 92995

                                                                         
Query: 311   acaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtag 370
             |||||||| ||||| ||    || || || |||||||| |||||||| || || || || 
Sbjct: 92996 acaacaaatttcttaaaaccatttggtagataatgcctagtcttcttatctgatccatac 93055

                                                                         
Query: 371   ccaatgttgggcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccc 430
             ||||| || |||||||| || |||||||| ||||||||||| ||||| ||||||||||||
Sbjct: 93056 ccaatatttggcatcaaagtacatcccttaaactttctcctcacacgtgaatcaataccc 93115

                            
Query: 431   tttggcctgcgccag 445
             ||||| |||||||||
Sbjct: 93116 tttggtctgcgccag 93130



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                        
Query: 482   ctcttgaagtgcttgaccctcttcttcacgatcttcttcgtcagaatcggcaccgccat 540
             |||||||| || |||||||||||||||||||||||||| || ||||  ||||| |||||
Sbjct: 94014 ctcttgaaatgtttgaccctcttcttcacgatcttcttggttagaagaggcacagccat 94072



to top

>gb|AC150706.4| Medicago truncatula clone mth2-132l18, complete sequence
          Length = 105472

 Score =  101 bits (51), Expect = 3e-18
 Identities = 204/255 (80%)
 Strand = Plus / Minus

                                                                          
Query: 191    tcgagctgtgcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgca 250
              ||||| ||||| || | |||||| |||||||| | |||  | ||||| || ||||| |||
Sbjct: 102759 tcgagttgtgctgctctctcaactatgtcctttctcttactagtggatacattgtgtgca 102700

                                                                          
Query: 251    atctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagagacattgtgg 310
              ||||| ||||| || ||||| ||||||||||| |  |||||||  |||   ||||||   
Sbjct: 102699 atctcagcacaataagtcctattgtgcatcattaaaagctccaaatcattaacattgcaa 102640

                                                                          
Query: 311    acaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccgtag 370
              |||||||| ||||| ||    || || || |||||||| |||||||| || || || || 
Sbjct: 102639 acaacaaatttcttaaaaccatttggtagataatgcctagtcttcttatctgatccatac 102580

                                                                          
Query: 371    ccaatgttgggcatcaaggtgcatcccttgaactttctcctgacacgggaatcaataccc 430
              ||||| || |||||||| || |||||||| ||||||||||| ||||| ||||||||||||
Sbjct: 102579 ccaatatttggcatcaaagtacatcccttaaactttctcctcacacgtgaatcaataccc 102520

                             
Query: 431    tttggcctgcgccag 445
              ||||| |||||||||
Sbjct: 102519 tttggtctgcgccag 102505



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                         
Query: 482    ctcttgaagtgcttgaccctcttcttcacgatcttcttcgtcagaatcggcaccgccat 540
              |||||||| || |||||||||||||||||||||||||| || ||||  ||||| |||||
Sbjct: 101621 ctcttgaaatgtttgaccctcttcttcacgatcttcttggttagaagaggcacagccat 101563



to top

>dbj|AB019223.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K11I1
          Length = 51529

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 149/182 (81%)
 Strand = Plus / Minus

                                                                        
Query: 268  cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
            ||||||||||||||| || ||||| |||||||||   ||||| ||||  |||||||||||
Sbjct: 5775 cctgttgtgcatcatgagtagctcgagctcagaggtgttgtgaacaatgaacttcttgaa 5716

                                                                        
Query: 328  cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
                || || ||||| || | ||||||||| ||||| ||||| ||||  |||||||||||
Sbjct: 5715 tccatttgggaggtagtggcgggtcttcttatcagatccgtaaccaacattgggcatcaa 5656

                                                                        
Query: 388  ggtgcatcccttgaactttctcctgacacgggaatcaataccctttggcctgcgccagct 447
            ||||   |||||||||||||| || || ||||| ||||||||||| ||||| | ||||||
Sbjct: 5655 ggtgacacccttgaactttcttctcacccgggagtcaatacccttaggcctcctccagct 5596

              
Query: 448  tt 449
            ||
Sbjct: 5595 tt 5594



to top

>emb|X75646.1|ZML32 Zea mays mRNA for ribosomal protein L32
          Length = 410

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 182 accacgatgtcgagctgtgcggcacgctcaacgatgtccttgcgcttcttggtggagacg 241
           ||||| |||||||||||||| |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 86  accacaatgtcgagctgtgcagcacgctccacgatctccttgcgcttcttggtggacacg 27

                                     
Query: 242 ttgtgcgcaatctccgcacagtaggt 267
           ||||| ||||| || || ||||||||
Sbjct: 26  ttgtgagcaatttcagcgcagtaggt 1



to top

>gb|AY310795.1| Nicotiana benthamiana clone 10-360 unknown mRNA
          Length = 408

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 178/223 (79%)
 Strand = Plus / Minus

                                                                       
Query: 233 gtggagacgttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctcc 292
           ||||| || ||||| |||||||| |||||||| || ||||| |||||||| |  | ||| 
Sbjct: 279 gtggaaacattgtgtgcaatctctgcacagtaagttctgttatgcatcattaagacctca 220

                                                                       
Query: 293 agctcagagacattgtggacaacaaacttcttgaacttgttgggaaggtaatgcctggtc 352
           ||||||    |||| || |||||||||||||| ||    |||||||| || || | ||| 
Sbjct: 219 agctcacttgcattatgcacaacaaacttcttnaaaccattgggaagatagtggcgggtt 160

                                                                       
Query: 353 ttcttgtcagaaccgtagccaatgttgggcatcaaggtgcatcccttgaactttctcctg 412
           ||||||||||| || || ||| ||||||||||||||   |||||||||||||||||||| 
Sbjct: 159 ttcttgtcagacccatacccantgttgggcatcaagacacatcccttgaactttctcctc 100

                                                      
Query: 413 acacgggaatcaataccctttggcctgcgccagctttgcttga 455
           || |  ||||| ||||| || ||  |||||||||||| |||||
Sbjct: 99  actctagaatcnatacctttgggtntgcgccagctttccttga 57



to top

>dbj|AB180441.1| Plutella xylostella mRNA for Ribosomal protein L32, complete cds
          Length = 522

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 206 cgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagtag 265
           ||||| |||||| ||||||||||||||| ||||||   |||||| ||||| || ||||| 
Sbjct: 418 cgctcgacgatggccttgcgcttcttggaggagactccgtgcgcgatctctgcgcagtac 359

                                                          
Query: 266 gtcctgttgtgcatcataagcagctccagctcagagacattgtggac 312
            ||||||| |||||||| || | |||||||||   ||||||||||||
Sbjct: 358 ttcctgttctgcatcatgaggatctccagctccttgacattgtggac 312



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 349 ggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
           |||||||||| | |||||||| ||||||||||||||||||
Sbjct: 275 ggtcttcttggctgaaccgtaaccaatgttgggcatcaag 236



to top

>gb|AF358665.1|AF358665 Mercurialis annua ribosomal protein L32 mRNA, complete cds
          Length = 657

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 150/186 (80%), Gaps = 2/186 (1%)
 Strand = Plus / Minus

                                                                       
Query: 248 gcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagagacattg 307
           |||||||| ||||| || ||||||||||||||||| |  ||||| |||||    ||||||
Sbjct: 347 gcaatctcagcacaataagtcctgttgtgcatcatcaaaagctcaagctcctgcacattg 288

                                                                       
Query: 308 tggacaacaaacttcttgaacttgttgggaaggtaatgcctggtcttcttgtcagaaccg 367
           || |||||||||||||| ||    |||||||| || || |  || |||||||| || || 
Sbjct: 287 tgcacaacaaacttcttaaatccattgggaagatagtggcgagttttcttgtctgatcca 228

                                                                       
Query: 368 tagccaatgttgggcatca-aggtgcatcccttgaactttctcctgacacgggaatcaat 426
           || |||||||||||||||| || | || || ||||| ||||||||||| |  ||||||||
Sbjct: 227 taaccaatgttgggcatcagagttaca-cctttgaattttctcctgacccttgaatcaat 169

                 
Query: 427 accctt 432
           ||||||
Sbjct: 168 accctt 163



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 481 cctcttgaagtgcttgaccctcttcttcacgatcttcttcgtcag 525
           ||||||||| | ||| || ||||||||||| |||||||| |||||
Sbjct: 114 cctcttgaatttcttcactctcttcttcacaatcttctttgtcag 70



to top

>gb|AY335237.1| Drosophila saltans clone D.sal12 ribosomal protein L32 (RpL32)
           gene, partial cds
          Length = 405

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                   
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacg 241
           ||||||||||||||| |||||||||||||||| |||||||
Sbjct: 379 ggcacgctcaacgatttccttgcgcttcttggaggagacg 340



to top

>ref|NM_001034783.1| Bos taurus similar to 60S ribosomal protein L32 (MGC127804), mRNA
          Length = 589

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 ccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagta 264
           ||||||| ||||||| |||||||||||| |||||||| ||||||||
Sbjct: 378 ccttgcggttcttggaggagacgttgtgagcaatctcagcacagta 333



to top

>emb|BX028659.1|CNS08U9Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 102/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||| |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 405 ggcacgctcgacgatggccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 346

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 345 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 286

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 285 cttgaa 280



to top

>gb|BC102748.1| Bos taurus similar to 60S ribosomal protein L32, mRNA (cDNA clone
           MGC:127804 IMAGE:7963527), complete cds
          Length = 589

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 ccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagta 264
           ||||||| ||||||| |||||||||||| |||||||| ||||||||
Sbjct: 378 ccttgcggttcttggaggagacgttgtgagcaatctcagcacagta 333



to top

>gb|AF190579.1|AF190579 Ovis aries ribosomal protein L32 mRNA, partial cds
          Length = 354

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 219 ccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagta 264
           ||||||| ||||||| |||||||||||| |||||||| ||||||||
Sbjct: 316 ccttgcggttcttggaggagacgttgtgagcaatctcagcacagta 271



to top

>dbj|D10964.2|RICAD4L32 Oryza sativa mRNA for ribosomal protein L32
          Length = 432

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 140 tactcatcctcttggctgcggagcctggcaagcttgttggt 180
           ||||||||||| |||||||| ||| ||||||||||||||||
Sbjct: 251 tactcatcctcctggctgcgtagcttggcaagcttgttggt 211



to top

>gb|AY769302.1| Bombyx mori ribosomal protein L32 (RpL32) mRNA, complete cds
          Length = 525

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 349 ggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
           |||||||||||  |||||||| ||||||||||||||||||
Sbjct: 267 ggtcttcttgttggaaccgtaaccaatgttgggcatcaag 228



to top

>gb|AY231887.1| Drosophila yakuba clone yak-em_RpL32 mRNA sequence
          Length = 402

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 206 cgctcaacgatgtccttgcgcttcttggtggagacg 241
           ||||||||||| |||||||||||||||| |||||||
Sbjct: 338 cgctcaacgatctccttgcgcttcttggaggagacg 303



to top

>dbj|AB048205.1| Bombyx mori rp49 mRNA for ribosomal protein 49, partial cds
          Length = 220

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 349 ggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
           |||||||||||  |||||||| ||||||||||||||||||
Sbjct: 136 ggtcttcttgttggaaccgtaaccaatgttgggcatcaag 97



to top

>gb|AY335236.1| Drosophila sucinea clone D.suc12 ribosomal protein L32 (RpL32)
           gene, partial cds
          Length = 420

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 206 cgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagta 264
           |||||||| || |||||||||||||||| ||||||   ||||||||| || ||||||||
Sbjct: 376 cgctcaacaatctccttgcgcttcttggaggagacaccgtgcgcaatttcggcacagta 318



to top

>gb|AY335235.1| Drosophila capricorni clone D.cap12 ribosomal protein L32 (RpL32)
           gene, partial cds
          Length = 394

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 206 cgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagta 264
           |||||||| || |||||||||||||||| ||||||   ||||||||| || ||||||||
Sbjct: 376 cgctcaacaatctccttgcgcttcttggaggagacaccgtgcgcaatttcggcacagta 318



to top

>emb|BX072406.1|CNS09S16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 613

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 315 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 374

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 375 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 434

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 435 cttgaa 440



to top

>emb|BX072405.1|CNS09S15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 426 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 367

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 366 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 307

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 306 cttgaa 301



to top

>emb|BX072363.1|CNS09RZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 712

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 303 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 362

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 363 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 422

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 423 cttgaa 428



to top

>emb|BX072362.1|CNS09RZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 673

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 423 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 364

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 363 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 304

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 303 cttgaa 298



to top

>emb|BX072246.1|CNS09RWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 716

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 404 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 345

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 344 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 285

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 284 cttgaa 279



to top

>emb|BX069104.1|CNS09PHG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 490

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 404 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 345

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 344 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 285

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 284 cttgaa 279



to top

>emb|BX060492.1|CNS09IU8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 631 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 572

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 571 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 512

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 511 cttgaa 506



to top

>emb|BX055443.1|CNS09EXZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 267 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 326

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 327 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 386

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 387 cttgaa 392



to top

>emb|BX054318.1|CNS09E2Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 738

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 418 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 359

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 358 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 299

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 298 cttgaa 293



to top

>emb|BX053725.1|CNS09DM9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 506

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 425 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 366

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 365 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 306

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 305 cttgaa 300



to top

>emb|BX042256.1|CNS094RO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 725

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 397 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 338

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 337 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 278

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 277 cttgaa 272



to top

>emb|BX038957.1|CNS09281 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 644

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 423 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 364

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 363 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 304

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 303 cttgaa 298



to top

>emb|BX038614.1|CNS091YI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 710

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 300 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 359

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 360 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 419

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 420 cttgaa 425



to top

>emb|BX038239.1|CNS091O3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 633

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 304 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 363

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 364 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 423

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 424 cttgaa 429



to top

>emb|BX038238.1|CNS091O2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 650

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 426 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 367

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 366 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 307

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 306 cttgaa 301



to top

>emb|BX038213.1|CNS091ND Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 620

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 313 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 372

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 373 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 432

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 433 cttgaa 438



to top

>emb|BX038212.1|CNS091NC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 423 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 364

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 363 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 304

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 303 cttgaa 298



to top

>emb|BX037881.1|CNS091E5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 424 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 365

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 364 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 305

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 304 cttgaa 299



to top

>emb|BX037742.1|CNS091AA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 681

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 304 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 363

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 364 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 423

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 424 cttgaa 429



to top

>emb|BX037741.1|CNS091A9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 650

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 423 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 364

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 363 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 304

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 303 cttgaa 298



to top

>emb|BX037616.1|CNS0916S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 631

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 427 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 368

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 367 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 308

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 307 cttgaa 302



to top

>emb|BX035455.1|CNS08ZIR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 281 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 340

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 341 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 400

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 401 cttgaa 406



to top

>emb|BX035454.1|CNS08ZIQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 421 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 362

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 361 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 302

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 301 cttgaa 296



to top

>emb|BX035081.1|CNS08Z8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 744

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 272 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 331

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 332 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 391

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 392 cttgaa 397



to top

>emb|BX035080.1|CNS08Z8C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 734

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 406 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 347

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 346 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 287

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 286 cttgaa 281



to top

>emb|BX034018.1|CNS08YEU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 407 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 348

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 347 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 288

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 287 cttgaa 282



to top

>emb|BX031693.1|CNS08WM9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 746

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 279 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 338

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 339 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 398

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 399 cttgaa 404



to top

>emb|BX031670.1|CNS08WLM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 725

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 392 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 333

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 332 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 273

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 272 cttgaa 267



to top

>emb|BX031402.1|CNS08WE6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 404 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 345

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 344 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 285

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 284 cttgaa 279



to top

>emb|BX031230.1|CNS08W9E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 729

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 272 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 331

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 332 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 391

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 392 cttgaa 397



to top

>emb|BX031229.1|CNS08W9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 725

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 405 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 346

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 345 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 286

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 285 cttgaa 280



to top

>emb|BX030137.1|CNS08VF1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 733

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 405 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 346

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 345 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 286

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 285 cttgaa 280



to top

>emb|BX028334.1|CNS08U0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 713

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 387 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 328

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 327 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 268

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 267 cttgaa 262



to top

>emb|BX025196.1|CNS08RLS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 753

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 416 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 357

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 356 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 297

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 296 cttgaa 291



to top

>emb|BX024698.1|CNS08R7Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 451

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 399 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 340

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 339 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 280

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 279 cttgaa 274



to top

>emb|BX024689.1|CNS08R7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 443

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 362 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 303

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 302 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 243

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 242 cttgaa 237



to top

>emb|BX023560.1|CNS08QCC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 419 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 360

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 359 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 300

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 299 cttgaa 294



to top

>emb|BX022073.1|CNS08P71 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 522

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 277 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 336

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 337 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 396

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 397 cttgaa 402



to top

>emb|BX022072.1|CNS08P70 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 389 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 330

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 329 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 270

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 269 cttgaa 264



to top

>emb|BX021654.1|CNS08OVE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 654

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 337 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 278

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 277 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 218

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 217 cttgaa 212



to top

>emb|BX017413.1|CNS08LLL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 316 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 257

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 256 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 197

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 196 cttgaa 191



to top

>emb|BX016591.1|CNS08KYR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 742

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 418 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 359

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 358 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 299

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 298 cttgaa 293



to top

>emb|BX016586.1|CNS08KYM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 547

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 298 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 239

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 238 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 179

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 178 cttgaa 173



to top

>emb|BX015405.1|CNS08K1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 708

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 243 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 302

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 303 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 362

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 363 cttgaa 368



to top

>emb|BX012521.1|CNS08HTP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 724

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 396 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 337

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 336 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 277

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 276 cttgaa 271



to top

>emb|BX012079.1|CNS08HHF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 408 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 349

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 348 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 289

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 288 cttgaa 283



to top

>emb|BX008500.1|CNS08EQ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 400 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 341

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 340 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 281

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 280 cttgaa 275



to top

>emb|BX007798.1|CNS08E6I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 417 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 358

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 357 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 298

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 297 cttgaa 292



to top

>gb|AF400195.1| Spodoptera frugiperda ribosomal protein L32 mRNA, complete cds
          Length = 522

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                       
Query: 193 gagctgtgcggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaat 252
           |||||||  ||| ||||| ||||||  |||||||||||| | ||||||   ||| || ||
Sbjct: 414 gagctgttgggcgcgctctacgatggtcttgcgcttctttgaggagactccgtgggcgat 355

                                                                       
Query: 253 ctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggac 312
           ||| || |||||  ||||||| |||||||| || | ||||||||||  ||||||||| ||
Sbjct: 354 ctctgcgcagtacttcctgttctgcatcatgaggatctccagctcacggacattgtgtac 295

             
Query: 313 aa 314
           ||
Sbjct: 294 aa 293



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 349 ggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
           |||||||||||  || ||||| ||||||||||||||||||
Sbjct: 258 ggtcttcttgtttgatccgtaaccaatgttgggcatcaag 219



to top

>ref|XM_320915.2| Anopheles gambiae str. PEST ENSANGP00000017702
           (ENSANGG00000015213), partial mRNA
          Length = 603

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 101/126 (80%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 345 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 286

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 285 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 226

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 225 cttgaa 220



to top

>gb|DQ296005.1| Antheraea pernyi ribosomal protein 49 (RP49) mRNA, partial cds
          Length = 242

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 244 gtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctcagagac 303
           |||||||||||| ||||||||  ||||||| |||||||| || | |||||| |||  |||
Sbjct: 195 gtgcgcaatctctgcacagtatttcctgttctgcatcattaggatctccagttcacggac 136

                 
Query: 304 attgtg 309
           ||||||
Sbjct: 135 attgtg 130



to top

>ref|XM_414453.1| PREDICTED: Gallus gallus similar to 60S ribosomal protein L32
           (LOC416122), mRNA
          Length = 1129

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 acgttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctca 298
           |||||||| || |||||||||||||| | | |||||  |||||| |||| ||||||||| 
Sbjct: 714 acgttgtgagcgatctccgcacagtacgacttgttgctcatcatgagcacctccagctct 655

                                        
Query: 299 gagacattgtggacaacaaacttcttgaa 327
             ||| |||||||| | ||||||| ||||
Sbjct: 654 ttgacgttgtggaccagaaacttcctgaa 626



to top

>gb|AY550039.1| Sus scrofa 60S ribosomal protein L32 mRNA, complete cds
          Length = 688

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 212 acgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagta 264
           |||||| | ||||| |||||||  ||||||||||| |||||||| ||||||||
Sbjct: 361 acgatggctttgcggttcttggaagagacgttgtgagcaatctcagcacagta 309



to top

>emb|BX932322.2| Gallus gallus finished cDNA, clone ChEST352p19
          Length = 787

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 acgttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctca 298
           |||||||| || |||||||||||||| | | |||||  |||||| |||| ||||||||| 
Sbjct: 642 acgttgtgagcgatctccgcacagtacgacttgttgctcatcatgagcacctccagctct 583

                                        
Query: 299 gagacattgtggacaacaaacttcttgaa 327
             ||| |||||||| | ||||||| ||||
Sbjct: 582 ttgacgttgtggaccagaaacttcctgaa 554



to top

>emb|BX931502.2| Gallus gallus finished cDNA, clone ChEST398a16
          Length = 856

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 acgttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctca 298
           |||||||| || |||||||||||||| | | |||||  |||||| |||| ||||||||| 
Sbjct: 719 acgttgtgagcgatctccgcacagtacgacttgttgctcatcatgagcacctccagctct 660

                                        
Query: 299 gagacattgtggacaacaaacttcttgaa 327
             ||| |||||||| | ||||||| ||||
Sbjct: 659 ttgacgttgtggaccagaaacttcctgaa 631



to top

>gb|AF370438.1|AF370438 Mercurialis annua type monoecious ribosomal protein L32 (rpl32) gene,
            complete cds
          Length = 1809

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 130/165 (78%)
 Strand = Plus / Minus

                                                                        
Query: 268  cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
            ||||||||||||||| |  ||||| |||||    || ||||| |||||||||||||| ||
Sbjct: 1391 cctgttgtgcatcatcaaaagctcaagctcttgcacgttgtgcacaacaaacttcttaaa 1332

                                                                        
Query: 328  cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
                |||||||| || || |  || |||||||| || ||||| |||||||||||||||| 
Sbjct: 1331 tccattgggaagatagtggcgagttttcttgtctgatccgtaaccaatgttgggcatcag 1272

                                                         
Query: 388  ggtgcatcccttgaactttctcctgacacgggaatcaataccctt 432
             ||    || ||||| ||||||||||| |  ||||||||||||||
Sbjct: 1271 agtaacacctttgaattttctcctgacccttgaatcaataccctt 1227



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 481 cctcttgaagtgcttgaccctcttcttcacgatcttcttcgtcag 525
           ||||||||| | ||| || ||||||||||| |||||||| |||||
Sbjct: 217 cctcttgaacttcttcactctcttcttcacaatcttctttgtcag 173



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 137  gtttactcatcctcttggct 156
            ||||||||||||||||||||
Sbjct: 1619 gtttactcatcctcttggct 1600



to top

>gb|AF370437.1|AF370437 Mercurialis annua type androdioecious ribosomal protein L32 (rpl32)
            gene, complete cds
          Length = 1810

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 130/165 (78%)
 Strand = Plus / Minus

                                                                        
Query: 268  cctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
            ||||||||||||||| |  ||||| |||||    || ||||| |||||||||||||| ||
Sbjct: 1392 cctgttgtgcatcatcaaaagctcaagctcttgcacgttgtgcacaacaaacttcttaaa 1333

                                                                        
Query: 328  cttgttgggaaggtaatgcctggtcttcttgtcagaaccgtagccaatgttgggcatcaa 387
                |||||||| || || |  || |||||||| || ||||| |||||||||||||||| 
Sbjct: 1332 tccattgggaagatagtggcgagttttcttgtctgatccgtaaccaatgttgggcatcag 1273

                                                         
Query: 388  ggtgcatcccttgaactttctcctgacacgggaatcaataccctt 432
             ||    || ||||| ||||||||||| |  ||||||||||||||
Sbjct: 1272 agtaacacctttgaattttctcctgacccttgaatcaataccctt 1228



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 481 cctcttgaagtgcttgaccctcttcttcacgatcttcttcgtcag 525
           ||||||||| | ||| || ||||||||||| |||||||| |||||
Sbjct: 217 cctcttgaacttcttcactctcttcttcacaatcttctttgtcag 173



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 137  gtttactcatcctcttggct 156
            ||||||||||||||||||||
Sbjct: 1620 gtttactcatcctcttggct 1601



to top

>emb|BX931261.1| Gallus gallus finished cDNA, clone ChEST263h18
          Length = 662

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 acgttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctca 298
           |||||||| || |||||||||||||| | | |||||  |||||| |||| ||||||||| 
Sbjct: 515 acgttgtgagcgatctccgcacagtacgacttgttgctcatcatgagcacctccagctct 456

                                        
Query: 299 gagacattgtggacaacaaacttcttgaa 327
             ||| |||||||| | ||||||| ||||
Sbjct: 455 ttgacgttgtggaccagaaacttcctgaa 427



to top

>emb|BX933805.1| Gallus gallus finished cDNA, clone ChEST1010a20
          Length = 513

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 acgttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctca 298
           |||||||| || |||||||||||||| | | |||||  |||||| |||| ||||||||| 
Sbjct: 165 acgttgtgagcgatctccgcacagtacgacttgttgctcatcatgagcacctccagctct 224

                                        
Query: 299 gagacattgtggacaacaaacttcttgaa 327
             ||| |||||||| | ||||||| ||||
Sbjct: 225 ttgacgttgtggaccagaaacttcctgaa 253



to top

>emb|BX930684.1| Gallus gallus finished cDNA, clone ChEST376p22
          Length = 749

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 acgttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctca 298
           |||||||| || |||||||||||||| | | |||||  |||||| |||| ||||||||| 
Sbjct: 602 acgttgtgagcgatctccgcacagtacgacttgttgctcatcatgagcacctccagctct 543

                                        
Query: 299 gagacattgtggacaacaaacttcttgaa 327
             ||| |||||||| | ||||||| ||||
Sbjct: 542 ttgacgttgtggaccagaaacttcctgaa 514



to top

>emb|BX929563.1| Gallus gallus finished cDNA, clone ChEST753b6
          Length = 861

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 acgttgtgcgcaatctccgcacagtaggtcctgttgtgcatcataagcagctccagctca 298
           |||||||| || |||||||||||||| | | |||||  |||||| |||| ||||||||| 
Sbjct: 714 acgttgtgagcgatctccgcacagtacgacttgttgctcatcatgagcacctccagctct 655

                                        
Query: 299 gagacattgtggacaacaaacttcttgaa 327
             ||| |||||||| | ||||||| ||||
Sbjct: 654 ttgacgttgtggaccagaaacttcctgaa 626



to top

>ref|NM_001001636.1| Sus scrofa 60S ribosomal protein L32 (RPL32), mRNA
          Length = 688

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 212 acgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagta 264
           |||||| | ||||| |||||||  ||||||||||| |||||||| ||||||||
Sbjct: 361 acgatggctttgcggttcttggaagagacgttgtgagcaatctcagcacagta 309



to top

>gb|AY610304.1| Sus scrofa clone rcut06_l18.y1.abd, mRNA sequence
          Length = 593

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 212 acgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagta 264
           |||||| | ||||| |||||||  ||||||||||| |||||||| ||||||||
Sbjct: 343 acgatggctttgcggttcttggaagagacgttgtgagcaatctcagcacagta 291



to top

>emb|BX028660.1|CNS08UA0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 212

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 202 ggcacgctcaacgatgtccttgcgcttcttgg 233
           ||||||||| |||||| |||||||||||||||
Sbjct: 129 ggcacgctcgacgatggccttgcgcttcttgg 160



to top

>emb|Y09706.1|DBIRP49 D.bifasciate rp49 gene exons 1 & 2
          Length = 1532

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||||||||| |||||||||||||| | |||||||
Sbjct: 1205 cgctcaacgatttccttgcgcttctttgaggagacg 1170



to top

>gb|AF401587.1| Ictalurus punctatus ribosomal protein L32 mRNA, complete cds
          Length = 477

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 235 ggagacgttgtgcgcaatctccgcacagtaggtcctgttg 274
           |||||||||||| |||||||| ||||||||| || |||||
Sbjct: 336 ggagacgttgtgggcaatctctgcacagtagctcttgttg 297



to top

>gb|AY335233.1| Drosophila willistoni clone Dwill0811.4 ribosomal protein L32
           (RpL32) gene, partial cds
          Length = 376

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 206 cgctcaacgatgtccttgcgcttcttggtggagacg 241
           |||||||| || |||||||||||||||| |||||||
Sbjct: 337 cgctcaacaatttccttgcgcttcttggaggagacg 302



to top

>ref|XM_964471.1| PREDICTED: Tribolium castaneum similar to CG7939-PA, isoform A
           (LOC658058), mRNA
          Length = 519

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 365 ccgtagccaatgttgggcatcaa 387
           |||||||||||||||||||||||
Sbjct: 251 ccgtagccaatgttgggcatcaa 229



to top

>emb|BX014653.1|CNS08JGX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 713

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 260 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 319

              
Query: 262 gta 264
           |||
Sbjct: 320 gta 322



to top

>emb|BX007253.1|CNS08DRD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 736

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| ||||| |||||
Sbjct: 407 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgatctcggcaca 348

              
Query: 262 gta 264
           |||
Sbjct: 347 gta 345



to top

>dbj|AB118976.1| Lucilia sericata rp49 mRNA for ribosomal protein 49, partial cds
          Length = 273

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 362 gaaccgtagccaatgttgggcatcaag 388
           |||||||| ||||||||||||||||||
Sbjct: 122 gaaccgtaaccaatgttgggcatcaag 96



to top

>gb|AY335238.1| Drosophila sturtevanti clone D.stur12 ribosomal protein L32 (RpL32)
           gene, partial cds
          Length = 416

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagac 240
           |||||||||||| || || ||||||||||||| ||||||
Sbjct: 380 ggcacgctcaacaatctctttgcgcttcttggaggagac 342



to top

>emb|BX036679.1|CNS090GR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 341

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 100/126 (79%)
 Strand = Plus / Minus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || ||   |||||| ||||| |||||
Sbjct: 305 ggcacgctcgacgataaccttgcgcttcttggacgacacagcgtgcgcgatctcggcaca 246

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 245 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 186

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 185 cttgaa 180



to top

>emb|BX024690.1|CNS08R7Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 570

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 100/126 (79%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||| ||||  || |||  |||||| ||||| |||||
Sbjct: 255 ggcacgctcgacgatagccttgcgctttttggacgacacggcgtgcgcgatctcggcaca 314

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 315 gtacaaacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 374

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 375 cttgaa 380



to top

>emb|BX012522.1|CNS08HTQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 518

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 100/126 (79%)
 Strand = Plus / Plus

                                                                       
Query: 202 ggcacgctcaacgatgtccttgcgcttcttggtggagacgttgtgcgcaatctccgcaca 261
           ||||||||| |||||  |||||||||||||||  || |||  |||||| | ||| |||||
Sbjct: 264 ggcacgctcgacgatagccttgcgcttcttggacgacacggcgtgcgcgacctcggcaca 323

                                                                       
Query: 262 gtaggtcctgttgtgcatcataagcagctccagctcagagacattgtggacaacaaactt 321
           |||    | ||| |||||||| |||| |||||||||   ||| |||||||| |  |||||
Sbjct: 324 gtacacacggttctgcatcatcagcacctccagctcgcggacgttgtggaccaggaactt 383

                 
Query: 322 cttgaa 327
           ||||||
Sbjct: 384 cttgaa 389



to top

>emb|Y09705.1|DAZRP49 D.azteca rp49 gene exons 1 & 2
          Length = 1541

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 206  cgctcaacgatgtccttgcgcttctt 231
            ||||||||||| ||||||||||||||
Sbjct: 1240 cgctcaacgatttccttgcgcttctt 1215



to top

>emb|Y09704.1|DAFRP49 D.affinis rp49 gene exons 1 & 2
          Length = 1538

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 206  cgctcaacgatgtccttgcgcttctt 231
            ||||||||||| ||||||||||||||
Sbjct: 1237 cgctcaacgatttccttgcgcttctt 1212



to top

>gb|AY754570.1| Drosophila affinis ribosomal protein L32 (RpL32) gene, complete cds
          Length = 1193

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 206  cgctcaacgatgtccttgcgcttctt 231
            ||||||||||| ||||||||||||||
Sbjct: 1115 cgctcaacgatttccttgcgcttctt 1090



to top

>emb|BX047905.1|CNS0994L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 87/109 (79%)
 Strand = Plus / Minus

                                                                       
Query: 219 ccttgcgcttcttggtggagacgttgtgcgcaatctccgcacagtaggtcctgttgtgca 278
           |||||||||||||||  || |||  |||||| ||||| ||||||||    | ||| ||||
Sbjct: 383 ccttgcgcttcttggacgacacggcgtgcgcgatctcggcacagtacacacggttctgca 324

                                                            
Query: 279 tcataagcagctccagctcagagacattgtggacaacaaacttcttgaa 327
           |||| |||| |||||||||   ||| |||||||| |  |||||||||||
Sbjct: 323 tcatcagcacctccagctcgcggacgttgtggaccaggaacttcttgaa 275



to top

>ref|NM_001030357.1| Gallus gallus proprotein convertase subtilisin/kexin type 7 (PCSK7),
            mRNA
          Length = 3513

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  aagcagctccagctcagagac 303
            |||||||||||||||||||||
Sbjct: 2043 aagcagctccagctcagagac 2023



to top

>emb|AJ720169.1| Gallus gallus mRNA for hypothetical protein, clone 11o15
          Length = 3549

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  aagcagctccagctcagagac 303
            |||||||||||||||||||||
Sbjct: 2043 aagcagctccagctcagagac 2023



to top

>gb|AF450502.1|AF450502 Epinephelus coioides ribosomal protein L32 mRNA, complete cds
          Length = 520

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 227 ttcttggtggagacgttgtgcgcaatctccgcacagt 263
           ||||||| |||||||||||| || ||||| |||||||
Sbjct: 376 ttcttggaggagacgttgtgggcgatctcagcacagt 340



to top

>gb|AC171015.5| Gallus gallus BAC clone CH261-18L11 from chromosome ul, complete
             sequence
          Length = 215430

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 283   aagcagctccagctcagagac 303
             |||||||||||||||||||||
Sbjct: 90788 aagcagctccagctcagagac 90808



to top

>gb|AC009884.8| Homo sapiens chromosome 8, clone RP11-420B22, complete sequence
          Length = 161443

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 44    aggaacagcagatatccctggcaga 68
             ||||||||||||| |||||||||||
Sbjct: 66267 aggaacagcagatgtccctggcaga 66291



to top

>ref|XM_322549.1| Neurospora crassa OR74A hypothetical protein (NCU00464.1) partial
           mRNA
          Length = 396

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 236 gagacgttgtgcgcaatctccgcacagtaggtcctgttgtgcat 279
           ||||||||||| || ||||| |||  ||||||| ||||||||||
Sbjct: 305 gagacgttgtgggcgatctcagcagcgtaggtcttgttgtgcat 262



to top

>ref|XM_951690.1| Neurospora crassa OR74A hypothetical protein (NCU00464.1) partial
           mRNA
          Length = 396

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 236 gagacgttgtgcgcaatctccgcacagtaggtcctgttgtgcat 279
           ||||||||||| || ||||| |||  ||||||| ||||||||||
Sbjct: 305 gagacgttgtgggcgatctcagcagcgtaggtcttgttgtgcat 262



to top

>gb|AC144625.3| Mus musculus BAC clone RP24-196P19 from chromosome 5, complete sequence
          Length = 145348

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 315   caaacttcttgaacttgttg 334
             ||||||||||||||||||||
Sbjct: 88700 caaacttcttgaacttgttg 88719



to top

>ref|XM_535916.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L32
           (LOC478750), mRNA
          Length = 852

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 365 ccgtagccaatgttgggcatcaag 388
           ||||| ||||||||||||||||||
Sbjct: 566 ccgtaaccaatgttgggcatcaag 543



to top

>ref|XM_533736.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L32
           (LOC476530), mRNA
          Length = 541

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 365 ccgtagccaatgttgggcatcaag 388
           ||||| ||||||||||||||||||
Sbjct: 254 ccgtaaccaatgttgggcatcaag 231



to top

>gb|BT011442.1| Drosophila melanogaster RE59709 full insert cDNA
          Length = 762

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 218 tccttgcgcttcttggtggagacg 241
           |||||||||||||||| |||||||
Sbjct: 585 tccttgcgcttcttggaggagacg 562



to top

>ref|XM_854019.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L32,
           transcript variant 2 (LOC607481), mRNA
          Length = 608

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 365 ccgtagccaatgttgggcatcaag 388
           ||||| ||||||||||||||||||
Sbjct: 317 ccgtaaccaatgttgggcatcaag 294



to top

>ref|XM_844472.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L32,
           transcript variant 1 (LOC607481), mRNA
          Length = 613

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 365 ccgtagccaatgttgggcatcaag 388
           ||||| ||||||||||||||||||
Sbjct: 322 ccgtaaccaatgttgggcatcaag 299



to top

>gb|AC125543.3| Mus musculus BAC clone RP23-360H5 from chromosome 12, complete sequence
          Length = 184081

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 161   agcctggcaagcttgttggt 180
             ||||||||||||||||||||
Sbjct: 66585 agcctggcaagcttgttggt 66566



to top

>ref|XM_763444.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_510_31960_31247) partial mRNA
          Length = 714

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 436 cctgcgccagctttgcttga 455
           ||||||||||||||||||||
Sbjct: 430 cctgcgccagctttgcttga 411



to top

>ref|XM_848585.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L32
           (LOC610983), mRNA
          Length = 479

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 365 ccgtagccaatgttgggcatcaag 388
           ||||| ||||||||||||||||||
Sbjct: 200 ccgtaaccaatgttgggcatcaag 177



to top

>ref|XM_536234.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L32
           (LOC479087), mRNA
          Length = 426

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 365 ccgtagccaatgttgggcatcaag 388
           ||||| ||||||||||||||||||
Sbjct: 200 ccgtaaccaatgttgggcatcaag 177



to top

>ref|XM_535299.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L32
           (LOC478124), mRNA
          Length = 515

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 365 ccgtagccaatgttgggcatcaag 388
           ||||| ||||||||||||||||||
Sbjct: 233 ccgtaaccaatgttgggcatcaag 210



to top

>ref|XM_853337.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L32,
           transcript variant 3 (LOC477979), mRNA
          Length = 491

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 365 ccgtagccaatgttgggcatcaag 388
           ||||| ||||||||||||||||||
Sbjct: 233 ccgtaaccaatgttgggcatcaag 210



to top

>ref|XM_853297.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L32,
           transcript variant 2 (LOC477979), mRNA
          Length = 478

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 365 ccgtagccaatgttgggcatcaag 388
           ||||| ||||||||||||||||||
Sbjct: 233 ccgtaaccaatgttgggcatcaag 210



to top

>ref|XM_535164.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L32,
           transcript variant 1 (LOC477979), mRNA
          Length = 541

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 365 ccgtagccaatgttgggcatcaag 388
           ||||| ||||||||||||||||||
Sbjct: 248 ccgtaaccaatgttgggcatcaag 225



to top

>gb|AC165350.3| Mus musculus BAC clone RP23-249A17 from chromosome 12, complete sequence
          Length = 227048

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 161    agcctggcaagcttgttggt 180
              ||||||||||||||||||||
Sbjct: 185906 agcctggcaagcttgttggt 185925



to top

>emb|AL109760.3|HSJ513G18 Human DNA sequence from clone RP3-513G18 on chromosome 4, complete
             sequence
          Length = 112560

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 305   ttgtggacaacaaacttctt 324
             ||||||||||||||||||||
Sbjct: 39909 ttgtggacaacaaacttctt 39890



to top

>emb|BX060493.1|CNS09IU9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 270

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 202 ggcacgctcaacgatgtccttgcgcttcttgg 233
           ||||||||| |||||  |||||||||||||||
Sbjct: 226 ggcacgctcgacgatagccttgcgcttcttgg 257



to top

>emb|BX052957.1|CNS09D0X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 723

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 202 ggcacgctcaacgatgtccttgcgcttcttgg 233
           ||||||||| |||||  |||||||||||||||
Sbjct: 266 ggcacgctcgacgatagccttgcgcttcttgg 297



to top

>emb|BX052956.1|CNS09D0W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 202 ggcacgctcaacgatgtccttgcgcttcttgg 233
           ||||||||| |||||  |||||||||||||||
Sbjct: 674 ggcacgctcgacgatagccttgcgcttcttgg 643



to top

>emb|BX053726.1|CNS09DMA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 343

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 202 ggcacgctcaacgatgtccttgcgcttcttgg 233
           ||||||||| |||||  |||||||||||||||
Sbjct: 291 ggcacgctcgacgatagccttgcgcttcttgg 322



to top

>emb|BX041388.1|CNS0943K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 202 ggcacgctcaacgatgtccttgcgcttcttgg 233
           ||||||||| |||||  |||||||||||||||
Sbjct: 269 ggcacgctcgacgatagccttgcgcttcttgg 300



to top

>emb|BX041387.1|CNS0943J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 202 ggcacgctcaacgatgtccttgcgcttcttgg 233
           ||||||||| |||||  |||||||||||||||
Sbjct: 680 ggcacgctcgacgatagccttgcgcttcttgg 649



to top

>emb|BX030138.1|CNS08VF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA45AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 202 ggcacgctcaacgatgtccttgcgcttcttgg 233
           ||||||||| |||||  |||||||||||||||
Sbjct: 276 ggcacgctcgacgatagccttgcgcttcttgg 307



to top

>emb|BX017414.1|CNS08LLM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 458

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 202 ggcacgctcaacgatgtccttgcgcttcttgg 233
           ||||||||| |||||  |||||||||||||||
Sbjct: 245 ggcacgctcgacgatagccttgcgcttcttgg 276



to top

>emb|BX007799.1|CNS08E6J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 725

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 202 ggcacgctcaacgatgtccttgcgcttcttgg 233
           ||||||||| |||||  |||||||||||||||
Sbjct: 273 ggcacgctcgacgatagccttgcgcttcttgg 304



to top

>emb|Y13939.1|DMRP4912 Drosophila melanogaster rp49 gene
          Length = 1380

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 218 tccttgcgcttcttggtggagacg 241
           |||||||||||||||| |||||||
Sbjct: 751 tccttgcgcttcttggaggagacg 728



to top

>emb|X80095.1|DSJ9OST D.subobscura (J9.Ost) gene for ribosomal protein 49
          Length = 1519

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1242 cgctcgacgatttccttgcgcttctttgaggagacg 1207



to top

>emb|X80094.1|DSJ8OST D.subobscura (J8.Ost) gene for ribosomal protein 49
          Length = 1519

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1242 cgctcgacgatttccttgcgcttctttgaggagacg 1207



to top

>emb|X80093.1|DSJ70ST D.subobscura (J7.Ost) gene for ribosomal protein 49
          Length = 1519

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1242 cgctcgacgatttccttgcgcttctttgaggagacg 1207



to top

>emb|X80092.1|DSJ6OST D.subobscura (J6.Ost) gene for ribosomal protein 49
          Length = 1514

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1237 cgctcgacgatttccttgcgcttctttgaggagacg 1202



to top

>emb|X80091.1|DSJ5OST D.subobscura (J5.Ost) gene for ribosomal protein 49
          Length = 1514

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1237 cgctcgacgatttccttgcgcttctttgaggagacg 1202



to top

>emb|X80090.1|DSJ4OST D.subobscura (J4.Ost) gene for ribosomal protein 49
          Length = 1516

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1239 cgctcgacgatttccttgcgcttctttgaggagacg 1204



to top

>emb|X80079.1|DSJ3OST D.subobscura (J3.Ost) gene for ribosomal protein 49
          Length = 1515

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1238 cgctcgacgatttccttgcgcttctttgaggagacg 1203



to top

>emb|Y09709.1|DMIRP49 D.miranda rp49 gene exons 1 & 2
          Length = 1566

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1245 cgctcgacgatttccttgcgcttctttgaggagacg 1210



to top

>emb|Y09708.1|DMARP49 D.madeirensis rp49 gene exons 1 & 2
          Length = 1541

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1244 cgctcgacgatttccttgcgcttctttgaggagacg 1209



to top

>emb|Y09707.1|DGURP49 D.guanche rp49 gene exons 1 & 2
          Length = 1554

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1256 cgctcgacgatttccttgcgcttctttgaggagacg 1221



to top

>emb|X80081.1|DSJ16RP49 D.subobscura (J16.O3+4) gene for ribosomal protein 49
          Length = 1519

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1242 cgctcgacgatttccttgcgcttctttgaggagacg 1207



to top

>emb|X80077.1|DSJ2OST49 D.subobscura (J2.Ost) gene for ribosomal protein 49
          Length = 1511

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1234 cgctcgacgatttccttgcgcttctttgaggagacg 1199



to top

>emb|X80076.1|DSJ10ST49 D.subobscura (J1.Ost) gene for ribosomal protein 49
          Length = 1519

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1242 cgctcgacgatttccttgcgcttctttgaggagacg 1207



to top

>emb|X80109.1|DSJ33OST D.subobscura (J33.Ost) gene for ribosomal protein 49
          Length = 1518

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1241 cgctcgacgatttccttgcgcttctttgaggagacg 1206



to top

>emb|X80108.1|DSJ32034 D.subobscura (J32.O3+4) gene for ribosomal protein 49
          Length = 1513

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1236 cgctcgacgatttccttgcgcttctttgaggagacg 1201



to top

>emb|X80107.1|DSJ34OST D.subobscura (J34.Ost) gene for ribosomal protein 49
          Length = 1505

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1228 cgctcgacgatttccttgcgcttctttgaggagacg 1193



to top

>emb|X80106.1|DSJ30034 D.subobscura (J30.O3+4) gene for ribosomal protein 49
          Length = 1513

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1236 cgctcgacgatttccttgcgcttctttgaggagacg 1201



to top

>emb|X80105.1|DSJ26034 D.subobscura (J26.O3+4) gene for ribosomal protein 49
          Length = 1519

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1242 cgctcgacgatttccttgcgcttctttgaggagacg 1207



to top

>emb|X80104.1|DSJ25034 D.subobscura (J25.O3+4) gene for ribosomal protein 49
          Length = 1513

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1241 cgctcgacgatttccttgcgcttctttgaggagacg 1206



to top

>emb|X80103.1|DSJ22034 D.subobscura (J22.O3+4) gene for ribosomal protein 49
          Length = 1517

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1240 cgctcgacgatttccttgcgcttctttgaggagacg 1205



to top

>emb|X80102.1|DSJ21034 D.subobscura (J21.O3+4) gene for ribosomal protein 49
          Length = 1514

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1242 cgctcgacgatttccttgcgcttctttgaggagacg 1207



to top

>emb|X80101.1|DSJ20034 D.subobscura (J20.O3+4) gene for ribosomal protein 49
          Length = 1515

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1238 cgctcgacgatttccttgcgcttctttgaggagacg 1203



to top

>emb|X80100.1|DSJ18034 D.subobscura (J18.O3+4) gene for ribosomal protein 49
          Length = 1516

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1240 cgctcgacgatttccttgcgcttctttgaggagacg 1205



to top

>emb|X80099.1|DSJ14OST D.subobscura (J14.Ost) gene for ribosomal protein 49
          Length = 1529

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1257 cgctcgacgatttccttgcgcttctttgaggagacg 1222



to top

>emb|X80098.1|DSJ15034 D.subobscura (J15.O3+4) gene for ribosomal protein 49
          Length = 1517

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1245 cgctcgacgatttccttgcgcttctttgaggagacg 1210



to top

>emb|X80097.1|DSJ12OST D.subobscura (J12.Ost) gene for ribosomal protein 49
          Length = 1522

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1245 cgctcgacgatttccttgcgcttctttgaggagacg 1210



to top

>emb|X80096.1|DSJ11OST D.subobscura (J11.Ost) gene for ribosomal protein 49
          Length = 1518

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1241 cgctcgacgatttccttgcgcttctttgaggagacg 1206



to top

>emb|X80089.1|DSJ31034 D.subobscura (J31.O3+4) gene for ribosomal protein 49
          Length = 1517

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1240 cgctcgacgatttccttgcgcttctttgaggagacg 1205



to top

>emb|X80088.1|DSJ28034 D.subobscura (J28.O3+4) gene for ribosomal protein 49
          Length = 1519

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1242 cgctcgacgatttccttgcgcttctttgaggagacg 1207



to top

>emb|X80087.1|DSJ29034 D.subobscura (J29.O3+4) gene for ribosomal protein 49
          Length = 1519

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1242 cgctcgacgatttccttgcgcttctttgaggagacg 1207



to top

>emb|X80086.1|DSJ27034 D.subobscura (J27.O3+4) gene for ribosomal protein 49
          Length = 1522

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1245 cgctcgacgatttccttgcgcttctttgaggagacg 1210



to top

>emb|X80085.1|DSJ24034 D.subobscura (J24.O3+4) gene for ribosomal protein 49
          Length = 1518

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1241 cgctcgacgatttccttgcgcttctttgaggagacg 1206



to top

>emb|X80084.1|DSJ23034 D.subobscura (J23.O3+4) gene for ribosomal protein 49
          Length = 1519

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1242 cgctcgacgatttccttgcgcttctttgaggagacg 1207



to top

>emb|X80083.1|DSJ19034 D.subobscura (J19.O3+4) gene for ribosomal protein 49
          Length = 1519

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1242 cgctcgacgatttccttgcgcttctttgaggagacg 1207



to top

>emb|X80082.1|DSJ17034 D.subobscura (J17.O3+4) gene for ribosomal protein 49
          Length = 1518

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1241 cgctcgacgatttccttgcgcttctttgaggagacg 1206



to top

>emb|X80080.1|DSJ13OST D.subobscura (J13.Ost) gene for ribosomal protein 49
          Length = 1514

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1237 cgctcgacgatttccttgcgcttctttgaggagacg 1202



to top

>emb|X80078.1|DSJ10OST D.subobscura (J10.Ost) gene for ribosomal protein 49
          Length = 1516

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1239 cgctcgacgatttccttgcgcttctttgaggagacg 1204



to top

>emb|X72654.1|DSRP49J D.subobscura (B9) gene for ribosomal protein 49
          Length = 1471

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1194 cgctcgacgatttccttgcgcttctttgaggagacg 1159



to top

>emb|X72653.1|DSRP49H D.subobscura (T7) gene for ribosomal protein 49
          Length = 1477

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1200 cgctcgacgatttccttgcgcttctttgaggagacg 1165



to top

>emb|X72652.1|DSRP49G D.subobscura (B8) gene for ribosomal protein 49
          Length = 1470

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1193 cgctcgacgatttccttgcgcttctttgaggagacg 1158



to top

>emb|X72651.1|DSRP49F D.subobscura (B6) gene for ribosomal protein 49
          Length = 1470

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1193 cgctcgacgatttccttgcgcttctttgaggagacg 1158



to top

>emb|X72650.1|DSRP49E D.subobscura (B5) gene for ribosomal protein 49
          Length = 1476

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1199 cgctctacgatttccttgcgcttctttgaggagacg 1164



to top

>emb|X72649.1|DSRP49D D.subobscura (B4) gene for ribosomal protein 49
          Length = 1465

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1188 cgctcgacgatttccttgcgcttctttgaggagacg 1153



to top

>emb|X72648.1|DSRP49C D.subobscura (B2) gene for ribosomal protein 49
          Length = 1471

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1194 cgctcgacgatttccttgcgcttctttgaggagacg 1159



to top

>emb|X72647.1|DSRP49B D.subobscura (B3) gene for ribosomal protein 49
          Length = 1476

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1199 cgctcgacgatttccttgcgcttctttgaggagacg 1164



to top

>emb|X72646.1|DSRP49A D.subobscura (B1) gene for ribosomal protein 49
          Length = 1462

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1188 cgctcgacgatttccttgcgcttctttgaggagacg 1153



to top

>gb|BC098631.1| Rattus norvegicus cAMP responsive element binding protein-like 1,
            mRNA (cDNA clone MGC:112556 IMAGE:7103893), complete cds
          Length = 2560

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  tggctgcggagcctggcaag 171
            ||||||||||||||||||||
Sbjct: 2069 tggctgcggagcctggcaag 2050



to top

>emb|BX883044.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
              assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
              RT1n haplotype; segment 3/11
          Length = 340493

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 152    tggctgcggagcctggcaag 171
              ||||||||||||||||||||
Sbjct: 269806 tggctgcggagcctggcaag 269787



to top

>ref|NM_001002809.1| Rattus norvegicus cAMP responsive element binding protein-like 1
            (Crebl1), mRNA
          Length = 2567

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  tggctgcggagcctggcaag 171
            ||||||||||||||||||||
Sbjct: 2138 tggctgcggagcctggcaag 2119



to top

>gb|AC129099.6| Canis familiaris clone rp81-289m11, complete sequence
          Length = 193729

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 365    ccgtagccaatgttgggcatcaag 388
              ||||| ||||||||||||||||||
Sbjct: 143512 ccgtaaccaatgttgggcatcaag 143489



to top

>ref|NM_170461.1| Drosophila melanogaster Ribosomal protein L32 CG7939-RB, transcript
           variant B (RpL32), mRNA
          Length = 604

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 218 tccttgcgcttcttggtggagacg 241
           |||||||||||||||| |||||||
Sbjct: 358 tccttgcgcttcttggaggagacg 335



to top

>ref|NM_170460.1| Drosophila melanogaster Ribosomal protein L32 CG7939-RC, transcript
           variant C (RpL32), mRNA
          Length = 830

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 218 tccttgcgcttcttggtggagacg 241
           |||||||||||||||| |||||||
Sbjct: 584 tccttgcgcttcttggaggagacg 561



to top

>ref|NM_079843.2| Drosophila melanogaster Ribosomal protein L32 CG7939-RA, transcript
           variant A (RpL32), mRNA
          Length = 590

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 218 tccttgcgcttcttggtggagacg 241
           |||||||||||||||| |||||||
Sbjct: 344 tccttgcgcttcttggaggagacg 321



to top

>gb|AC069356.6| Homo sapiens chromosome 18, clone RP11-575O17, complete sequence
          Length = 161480

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 285    gcagctccagctcagagaca 304
              ||||||||||||||||||||
Sbjct: 132721 gcagctccagctcagagaca 132702



to top

>gb|AY070656.1| Drosophila melanogaster RH03940 full length cDNA
          Length = 506

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 218 tccttgcgcttcttggtggagacg 241
           |||||||||||||||| |||||||
Sbjct: 361 tccttgcgcttcttggaggagacg 338



to top

>gb|AC161372.2| Mus musculus BAC clone RP23-326G14 from chromosome 16, complete
             sequence
          Length = 208994

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 341   taatgcctggtcttcttgtc 360
             ||||||||||||||||||||
Sbjct: 91982 taatgcctggtcttcttgtc 91963



to top

>gb|AC013751.6|AC013751 Homo sapiens chromosome , clone RP11-298P6, complete sequence
          Length = 205816

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 495    tgaccctcttcttcacgatc 514
              ||||||||||||||||||||
Sbjct: 142399 tgaccctcttcttcacgatc 142380



to top

>gb|AF370436.1|AF370436 Mercurialis annua type dioecious ribosomal protein L32 (rpl32) gene,
            complete cds
          Length = 2112

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 137  gtttactcatcctcttggct 156
            ||||||||||||||||||||
Sbjct: 1924 gtttactcatcctcttggct 1905



to top

>gb|AC007886.7|AC007886 Drosophila melanogaster, chromosome 3R, region 99D-99D, BAC clone
              BACR07A18, complete sequence
          Length = 168469

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 218    tccttgcgcttcttggtggagacg 241
              |||||||||||||||| |||||||
Sbjct: 155420 tccttgcgcttcttggaggagacg 155443



to top

>gb|AC124861.3| Homo sapiens BAC clone RP11-622A18 from 2, complete sequence
          Length = 153731

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   agcagctccagctcagagac 303
             ||||||||||||||||||||
Sbjct: 36457 agcagctccagctcagagac 36438



to top

>gb|AC157533.2| Pan troglodytes BAC clone CH251-276N1 from chromosome unknown, complete
              sequence
          Length = 155641

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 285    gcagctccagctcagagaca 304
              ||||||||||||||||||||
Sbjct: 152506 gcagctccagctcagagaca 152525



to top

>gb|AY168763.1| Branchiostoma belcheri tsingtaunese ribosomal protein L32 mRNA,
           complete cds
          Length = 526

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 422 tcaataccctttggcctgcgccagctttgctt 453
           ||||||||||| ||| |||||||| |||||||
Sbjct: 168 tcaatacccttgggcttgcgccagttttgctt 137



to top

>gb|AY971345.1| Danaus plexippus ribosomal protein 49 mRNA, partial cds
          Length = 191

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 349 ggtcttcttgtcagaaccgtagccaatgttgggcatcaag 388
           |||||||||||  || ||||| |||||| |||||||||||
Sbjct: 84  ggtcttcttgtttgatccgtaaccaatgctgggcatcaag 45



to top

>gb|AY754569.1| Drosophila miranda strain MSH22 ribosomal protein L32 (RpL32) gene,
            complete cds
          Length = 1403

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 206  cgctcaacgatgtccttgcgcttcttggtggagacg 241
            ||||| ||||| |||||||||||||| | |||||||
Sbjct: 1244 cgctcgacgatttccttgcgcttctttgaggagacg 1209



to top

>gb|AE003772.2| Drosophila melanogaster chromosome 3R, section 110 of 118 of the
             complete sequence
          Length = 228443

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 218   tccttgcgcttcttggtggagacg 241
             |||||||||||||||| |||||||
Sbjct: 68988 tccttgcgcttcttggaggagacg 69011



to top

>emb|AL049831.2|CNS00008 Human chromosome 14 DNA sequence BAC R-330O19 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 218956

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 43     taggaacagcagatatccct 62
              ||||||||||||||||||||
Sbjct: 130691 taggaacagcagatatccct 130672



to top

>gb|AC134462.5| Mus musculus BAC clone RP23-391L12 from chromosome 12, complete sequence
          Length = 197870

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 161    agcctggcaagcttgttggt 180
              ||||||||||||||||||||
Sbjct: 144376 agcctggcaagcttgttggt 144395



to top

>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome
          Length = 4096345

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   gctcaacgatgtccttgcgc 226
             ||||||||||||||||||||
Sbjct: 60347 gctcaacgatgtccttgcgc 60328



to top

>gb|AC130824.4| Mus musculus BAC clone RP23-349B5 from 12, complete sequence
          Length = 178133

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 161    agcctggcaagcttgttggt 180
              ||||||||||||||||||||
Sbjct: 102157 agcctggcaagcttgttggt 102176



to top

>emb|Z68883.1|HSL118GB Human DNA sequence from clone LA04NC01-118G10 on chromosome 4, complete
             sequence
          Length = 27858

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 305   ttgtggacaacaaacttctt 324
             ||||||||||||||||||||
Sbjct: 14160 ttgtggacaacaaacttctt 14141



to top

>gb|U92431.1|DMU92431 Drosophila melanogaster ribosomal protein 49 mRNA, complete cds
          Length = 461

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 218 tccttgcgcttcttggtggagacg 241
           |||||||||||||||| |||||||
Sbjct: 326 tccttgcgcttcttggaggagacg 303



to top

>emb|AJ309046.1|DSI309046 Drosophila simulans RpL32 gene for ribosomal protein L32, exons
           1-2, strain SimMz43
          Length = 1339

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 206 cgctcaacgatgtccttgcgcttcttgg 233
           ||||| ||||| ||||||||||||||||
Sbjct: 760 cgctcgacgatctccttgcgcttcttgg 733



to top

>emb|AJ309045.1|DSI309045 Drosophila simulans RpL32 gene for ribosomal protein L32, exons
           1-2, strain SimMz39
          Length = 1342

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 206 cgctcaacgatgtccttgcgcttcttgg 233
           ||||| ||||| ||||||||||||||||
Sbjct: 760 cgctcgacgatctccttgcgcttcttgg 733



to top

>emb|AJ309044.1|DSI309044 Drosophila simulans RpL32 gene for ribosomal protein L32, exons
           1-2, strain SimMz25
          Length = 1360

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 206 cgctcaacgatgtccttgcgcttcttgg 233
           ||||| ||||| ||||||||||||||||
Sbjct: 760 cgctcgacgatctccttgcgcttcttgg 733



to top

>emb|AJ309043.1|DSI309043 Drosophila simulans RpL32 gene for ribosomal protein L32, exons
           1-2, strain SimMz22
          Length = 1324

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 206 cgctcaacgatgtccttgcgcttcttgg 233
           ||||| ||||| ||||||||||||||||
Sbjct: 760 cgctcgacgatctccttgcgcttcttgg 733



to top

>emb|AJ309042.1|DSI309042 Drosophila simulans RpL32 gene for ribosomal protein L32, exons
           1-2, strain SimMz47
          Length = 1331

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 206 cgctcaacgatgtccttgcgcttcttgg 233
           ||||| ||||| ||||||||||||||||
Sbjct: 760 cgctcgacgatctccttgcgcttcttgg 733



to top

>emb|AJ309041.1|DSI309041 Drosophila simulans RpL32 gene for ribosomal protein L32, exons
           1-2, strain SimMz35
          Length = 1331

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 206 cgctcaacgatgtccttgcgcttcttgg 233
           ||||| ||||| ||||||||||||||||
Sbjct: 760 cgctcgacgatctccttgcgcttcttgg 733



to top

>emb|AJ309040.1|DSI309040 Drosophila simulans RpL32 gene for ribosomal protein L32, exons
           1-2, strain SimMz34
          Length = 1324

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 206 cgctcaacgatgtccttgcgcttcttgg 233
           ||||| ||||| ||||||||||||||||
Sbjct: 760 cgctcgacgatctccttgcgcttcttgg 733



to top

>emb|AJ309039.1|DSI309039 Drosophila simulans RpL32 gene for ribosomal protein L32, exons
           1-2, strain SimMz16
          Length = 1331

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 206 cgctcaacgatgtccttgcgcttcttgg 233
           ||||| ||||| ||||||||||||||||
Sbjct: 760 cgctcgacgatctccttgcgcttcttgg 733



to top

>emb|AJ309038.1|DSI309038 Drosophila simulans RpL32 gene for ribosomal protein L32, exons
           1-2, strain SimMz12
          Length = 1324

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 206 cgctcaacgatgtccttgcgcttcttgg 233
           ||||| ||||| ||||||||||||||||
Sbjct: 760 cgctcgacgatctccttgcgcttcttgg 733



to top

>emb|AJ309037.1|DSI309037 Drosophila simulans RpL32 gene for ribosomal protein L32, exons
           1-2, strain SimMz54
          Length = 1342

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 206 cgctcaacgatgtccttgcgcttcttgg 233
           ||||| ||||| ||||||||||||||||
Sbjct: 760 cgctcgacgatctccttgcgcttcttgg 733



to top

>emb|AJ309036.1|DSI309036 Drosophila simulans RpL32 gene for ribosomal protein L32, exons
           1-2, strain SimMz37
          Length = 1342

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 206 cgctcaacgatgtccttgcgcttcttgg 233
           ||||| ||||| ||||||||||||||||
Sbjct: 760 cgctcgacgatctccttgcgcttcttgg 733


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,447,358
Number of Sequences: 3902068
Number of extensions: 4447358
Number of successful extensions: 97821
Number of sequences better than 10.0: 345
Number of HSP's better than 10.0 without gapping: 343
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 97126
Number of HSP's gapped (non-prelim): 611
length of query: 594
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 571
effective length of database: 17,143,297,704
effective search space: 9788822988984
effective search space used: 9788822988984
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top