| Clone Name | rbags31l22 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full insert mRNA sequence Length = 1308 Score = 143 bits (72), Expect = 8e-31 Identities = 255/316 (80%) Strand = Plus / Minus Query: 312 ggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtgg 371 ||||| || |||||||||||||| || ||||| | |||| |||||||||||||||||| Sbjct: 952 ggcaacgcatcgtagcagttcctcagaagagtcatacagtaatcgtcggtccagttgtgg 893 Query: 372 agcatccactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcg 431 || |||||||| | || ||| ||||| || |||||| ||| ||||||| ||||||||| Sbjct: 892 aggatccacttcaggaggatagcatcgccggagggcaccttcttgaacatgtcaccggcg 833 Query: 432 acgtgctgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtta 491 | |||||||||||||||| | ||||||| || | ||||| || || || |||||||| Sbjct: 832 atgtgctgcacgccagggtagggcggcgcctcggatatgacatgcgggagatcgaagttt 773 Query: 492 attcccttaatgtgcgggtacttggaggtgatggcgcggatggtggtgccaacgccgcca 551 | ||||| |||||||||||||| |||||||||||| || |||| |||||||| || Sbjct: 772 acccccttgatgtgcgggtactttgaggtgatggcgtgggctgtggcaccaacgccaccg 713 Query: 552 ccgacgtccacgaggaaggcgatgtcgtggaagcccatgtacatctcgacgagcttcctg 611 |||| ||||||||| ||| || || ||||||| |||| | ||||| ||||||| || Sbjct: 712 gcgacatccacgagggtctcgacgttgtcgaagcccctgtagaactcgaggagcttcttg 653 Query: 612 ttgatgatggtggagt 627 ||||||||||||||| Sbjct: 652 gtgatgatggtggagt 637
>gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltransferase (OMT2) mRNA, complete cds Length = 1436 Score = 91.7 bits (46), Expect = 3e-15 Identities = 157/194 (80%) Strand = Plus / Minus Query: 415 tgaacatatcaccggcgacgtgctgcacgccagggcattgcggcgcatcagcgatgacgt 474 ||||||| |||||| |||||||| |||||| ||| | |||| || || |||||||||| Sbjct: 798 tgaacatgtcaccgctgacgtgctccacgccggggtaaggcggggcgtcggcgatgacgt 739 Query: 475 gtggcaggtcgaagttaattcccttaatgtgcgggtacttggaggtgatggcgcggatgg 534 | || ||||||||||| || ||||| ||| |||||||||||||||||||||| ||||| Sbjct: 738 ggggaaggtcgaagttgatccccttgatgctcgggtacttggaggtgatggcgtggatga 679 Query: 535 tggtgccaacgccgccaccgacgtccacgaggaaggcgatgtcgtggaagcccatgtaca 594 || ||| |||||||| | || || || ||| | ||||| ||| ||||||| |||||| Sbjct: 678 cggcgcccacgccgcctgccacatcaaccagggtgccgatgccgtcgaagcccttgtaca 619 Query: 595 tctcgacgagcttc 608 ||||| ||||||| Sbjct: 618 gctcgaggagcttc 605
>gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferase (COMT1) mRNA, complete cds Length = 1371 Score = 85.7 bits (43), Expect = 2e-13 Identities = 280/359 (77%) Strand = Plus / Minus Query: 297 accttgccgtgtggaggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcg 356 ||||||||||| | |||| ||||||||||||||| | ||||| || | |||||||||| Sbjct: 942 accttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtcgcgcagtgctcg 883 Query: 357 tcggtccagttgtggagcatccactttaagatgatggcatccccactgggcacattcctg 416 ||| |||||| |||||| |||||||| | || |||||| || || |||||| ||| | Sbjct: 882 tcgctccagtcgtggaggatccacttcatgaggatggcgtcgcccgagggcaccttctgg 823 Query: 417 aacatatcaccggcgacgtgctgcacgccagggcattgcggcgcatcagcgatgacgtgt 476 ||||| || ||| ||||||| ||||| ||| | || |||| || | ||||||||| Sbjct: 822 aacatgtcgccgccgacgtgggtgacgcccgggaacggctgcgcctcggagatgacgtgg 763 Query: 477 ggcaggtcgaagttaattcccttaatgtgcgggtacttggaggtgatggcgcggatggtg 536 || ||||||||||| || ||||| ||| ||||| || ||||||||||| || |||| Sbjct: 762 gggaggtcgaagttgatgcccttgatggcggggtaggcggcggtgatggcgccgacggtg 703 Query: 537 gtgccaacgccgccaccgacgtccacgaggaaggcgatgtcgtggaagcccatgtacatc 596 | ||| |||||||| || ||||| |||| | | ||| | | | ||||||| |||| | | Sbjct: 702 gcgcccacgccgccgcccacgtcgacgatggtgccgaggccctcgaagcccttgtagacc 643 Query: 597 tcgacgagcttcctgttgatgatggtggagtagttgttcatggcctggctgaagacgcg 655 |||| ||||||| || |||||||| |||||| ||| ||||| ||| | |||||||||| Sbjct: 642 tcgaggagcttcttggtgatgatgatggagtggttcttcatcccctcgttgaagacgcg 584 Score = 42.1 bits (21), Expect = 2.3 Identities = 48/57 (84%) Strand = Plus / Minus Query: 170 gaactccctctggctcctctccctgccggctggtgtgtgcatgagcatgatcatgtc 226 ||||||||||| | ||||||||||||| | || ||||| ||||||||||||||| Sbjct: 1069 gaactccctctcgtacctctccctgccgccggggttgtgcgcgagcatgatcatgtc 1013
>emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic acid 3-O-methyltransferase Length = 1486 Score = 79.8 bits (40), Expect = 1e-11 Identities = 196/248 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 958 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 899 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || ||||| | ||||||| || ||| |||||||| Sbjct: 898 cacttcatgaggatggcgtcgcccgccggcaccgacttgaacatgtccccgccgacgtgc 839 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagttaattccc 497 |||||||| ||| | ||||||| || | ||| ||||| || ||||||||||| || ||| Sbjct: 838 tgcacgccggggaacggcggcgcctcggagatcacgtgggggaggtcgaagttgatgccc 779 Query: 498 ttaatgtgcgggtacttggaggtgatggcgcggatggtggtgccaacgccgccaccgacg 557 || || ||||||| | |||||||||||| | | ||||| ||| | |||||| || ||| Sbjct: 778 ttgatctgcgggtggtgcgaggtgatggcgtgcagggtggcgccgatgccgccgcccacg 719 Query: 558 tccacgag 565 || ||||| Sbjct: 718 tcgacgag 711 Score = 46.1 bits (23), Expect = 0.15 Identities = 104/131 (79%) Strand = Plus / Minus Query: 96 tcgatgacccagctgttgccgtagatataggtggtcttaaaaccggtgaaccctgcggcc 155 |||||| ||||| |||| ||||||| ||||||| ||| || |||| |||||| ||| || Sbjct: 1180 tcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaacccggcgccc 1121 Query: 156 ttgccaagctcttggaactccctctggctcctctccctgccggctggtgtgtgcatgagc 215 ||| | || || |||||||||| || | || |||||||||| | || | ||| |||| Sbjct: 1120 ttggcgaggtcgtggaactcccgctcgtaccgctccctgccgccggggttatgcgcgagc 1061 Query: 216 atgatcatgtc 226 ||||||||||| Sbjct: 1060 atgatcatgtc 1050
>gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyltransferase (COMT) gene, complete cds Length = 2012 Score = 79.8 bits (40), Expect = 1e-11 Identities = 196/248 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 1777 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 1718 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || ||||| | ||||||| || ||| |||||||| Sbjct: 1717 cacttcatgaggatggcgtcgcccgccggcaccgacttgaacatgtccccgccgacgtgc 1658 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagttaattccc 497 |||||||| ||| | ||||||| || | ||| ||||| || ||||||||||| || ||| Sbjct: 1657 tgcacgccggggaacggcggcgcctcggagatcacgtgggggaggtcgaagttgatgccc 1598 Query: 498 ttaatgtgcgggtacttggaggtgatggcgcggatggtggtgccaacgccgccaccgacg 557 || || ||||||| | |||||||||||| | | ||||| ||| | |||||| || ||| Sbjct: 1597 ttgatctgcgggtggtgcgaggtgatggcgtgcagggtggcgccgatgccgccgcccacg 1538 Query: 558 tccacgag 565 || ||||| Sbjct: 1537 tcgacgag 1530 Score = 46.1 bits (23), Expect = 0.15 Identities = 104/131 (79%) Strand = Plus / Minus Query: 96 tcgatgacccagctgttgccgtagatataggtggtcttaaaaccggtgaaccctgcggcc 155 |||||| ||||| |||| ||||||| ||||||| ||| || |||| |||||| ||| || Sbjct: 1999 tcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaacccggcgccc 1940 Query: 156 ttgccaagctcttggaactccctctggctcctctccctgccggctggtgtgtgcatgagc 215 ||| | || || |||||||||| || | || |||||||||| | || | ||| |||| Sbjct: 1939 ttggcgaggtcgtggaactcccgctcgtaccgctccctgccgccggggttatgcgcgagc 1880 Query: 216 atgatcatgtc 226 ||||||||||| Sbjct: 1879 atgatcatgtc 1869
>gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase mRNA, complete cds Length = 1233 Score = 75.8 bits (38), Expect = 2e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 297 accttgccgtgtggaggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcg 356 ||||||||||| | ||||| ||||||||||||||| | ||||| || | |||||||||| Sbjct: 931 accttgccgtgcgccggcaacgcgtcgtagcagttcttgagcagcgtcgcgcagtgctcg 872 Query: 357 tcggtccagttgtggagcatccactt 382 ||| |||||| |||||| |||||||| Sbjct: 871 tcgctccagtcgtggaggatccactt 846
>gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O-methyltransferase mRNA, complete cds Length = 1440 Score = 73.8 bits (37), Expect = 7e-10 Identities = 265/341 (77%) Strand = Plus / Minus Query: 297 accttgccgtgtggaggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcg 356 ||||||||||| | |||| ||||||||||||||| | ||||| || | |||||||| | Sbjct: 939 accttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgctgg 880 Query: 357 tcggtccagttgtggagcatccactttaagatgatggcatccccactgggcacattcctg 416 ||| |||||| |||||| |||||||| | || |||||| || || |||||| | | || Sbjct: 879 tcgctccagtcgtggaggatccacttcatgaggatggcgtcgcccgagggcacctccttg 820 Query: 417 aacatatcaccggcgacgtgctgcacgccagggcattgcggcgcatcagcgatgacgtgt 476 ||||| || ||| ||||||| ||||| ||| | |||||||| || | ||||||||| Sbjct: 819 aacatgtcgccgccgacgtgggtgacgcccgggaactgcggcgcctcggagatgacgtgg 760 Query: 477 ggcaggtcgaagttaattcccttaatgtgcgggtacttggaggtgatggcgcggatggtg 536 || ||||||||||| | ||||| ||| ||||| | || || ||||||| | |||| Sbjct: 759 gggaggtcgaagttgacccccttgatggcggggtagtgggcggcgatggcggccacggtg 700 Query: 537 gtgccaacgccgccaccgacgtccacgaggaaggcgatgtcgtggaagcccatgtacatc 596 | ||| |||||||| |||||||| |||||| | ||| | | |||||||| ||| | | Sbjct: 699 gcgccgacgccgccgccgacgtcgacgagggtgccgaggccctggaagccgtggtagagc 640 Query: 597 tcgacgagcttcctgttgatgatggtggagtagttgttcat 637 |||| ||||||| || |||||||| |||||| ||| ||||| Sbjct: 639 tcgaggagcttcttggtgatgatgatggagtggttcttcat 599 Score = 42.1 bits (21), Expect = 2.3 Identities = 48/57 (84%) Strand = Plus / Minus Query: 170 gaactccctctggctcctctccctgccggctggtgtgtgcatgagcatgatcatgtc 226 ||||||||||| | ||||||||||||| | || ||||| ||||||||||||||| Sbjct: 1066 gaactccctctcgtacctctccctgccgccggggttgtgcgcgagcatgatcatgtc 1010
>gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase gene, complete cds Length = 3312 Score = 71.9 bits (36), Expect = 3e-09 Identities = 195/248 (78%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2541 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2482 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || ||||| | ||||||| || ||| |||||||| Sbjct: 2481 cacttcatgaggatggcgtcgccggccggcaccgacttgaacatgtccccgccgacgtgc 2422 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagttaattccc 497 |||||||| ||| | ||||||| || | ||| ||||| || ||||||||||| || ||| Sbjct: 2421 tgcacgccggggaacggcggcgcctcggagatcacgtgcgggaggtcgaagttgatcccc 2362 Query: 498 ttaatgtgcgggtacttggaggtgatggcgcggatggtggtgccaacgccgccaccgacg 557 | ||||| | || | ||||||||||||| | | ||||| ||| | |||||| || ||| Sbjct: 2361 ctgatgtgggagtggtgggaggtgatggcgtgtaaggtggcgccgatgccgccgcccacg 2302 Query: 558 tccacgag 565 || ||||| Sbjct: 2301 tcgacgag 2294
>gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full insert mRNA sequence Length = 1314 Score = 67.9 bits (34), Expect = 4e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 297 accttgccgtgtggaggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcg 356 ||||||||||| | |||| ||||||||||||||| | ||||| || | |||||||||| Sbjct: 862 accttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtcgcgcagtgctcg 803 Query: 357 tcggtccagttgtggagcatccactt 382 ||| |||||| |||||| |||||||| Sbjct: 802 tcgctccagtcgtggaggatccactt 777 Score = 42.1 bits (21), Expect = 2.3 Identities = 48/57 (84%) Strand = Plus / Minus Query: 170 gaactccctctggctcctctccctgccggctggtgtgtgcatgagcatgatcatgtc 226 ||||||||||| | ||||||||||||| | || ||||| ||||||||||||||| Sbjct: 989 gaactccctctcgtacctctccctgccgccggggttgtgcgcgagcatgatcatgtc 933
>gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA, complete cds Length = 1458 Score = 65.9 bits (33), Expect = 2e-07 Identities = 138/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 960 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 901 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || ||||| | ||||||| || ||| |||||||| Sbjct: 900 cacttcatgaggatggcgtcgccggccggcaccgacttgaacatgtccccgccgacgtgc 841 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 |||||||| ||| | ||||||| || | ||| ||||| || ||||||||||| Sbjct: 840 tgcacgccggggaacggcggcgcctcggagatcacgtgggggaggtcgaagtt 788
>gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-hydroxyferulic acid O-methyltransferase mRNA, complete cds Length = 1475 Score = 63.9 bits (32), Expect = 6e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | |||||||| |||| |||||| |||||| ||| Sbjct: 918 gcgtcgtagcagttcttgagcagcgtggcgcagtgctggtcgctccagtcgtggaggatc 859 Query: 378 cactttaagatgatggcatc 397 ||||| | || ||||||||| Sbjct: 858 cacttcatgaggatggcatc 839
>gb|AF502287.1| Triticum aestivum caffeic acid O-methyltransferase mRNA, partial cds Length = 604 Score = 60.0 bits (30), Expect = 1e-05 Identities = 72/86 (83%) Strand = Plus / Minus Query: 297 accttgccgtgtggaggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcg 356 ||||||||||| | |||| ||||||||||||||| | ||||| || | ||||||||| Sbjct: 494 accttgccgtgcgtcggcagcgcgtcgtagcagttcttaagcagcgttgcacagtgctcg 435 Query: 357 tcggtccagttgtggagcatccactt 382 ||| |||||| |||||| |||||||| Sbjct: 434 tcgctccagtcgtggaggatccactt 409 Score = 42.1 bits (21), Expect = 2.3 Identities = 42/49 (85%) Strand = Plus / Minus Query: 518 ggtgatggcgcggatggtggtgccaacgccgccaccgacgtccacgagg 566 ||||||||||| || ||||| ||| | |||||| || |||||||||||| Sbjct: 273 ggtgatggcgccgacggtggcgcctatgccgcctcccacgtccacgagg 225
>gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O-methyltransferase mRNA, complete cds Length = 1438 Score = 60.0 bits (30), Expect = 1e-05 Identities = 72/86 (83%) Strand = Plus / Minus Query: 297 accttgccgtgtggaggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcg 356 ||||||||||| | |||| ||||||||||||||| | ||||| || | |||||||| | Sbjct: 930 accttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgctgg 871 Query: 357 tcggtccagttgtggagcatccactt 382 ||| |||||| |||||| |||||||| Sbjct: 870 tcgctccagtcgtggaggatccactt 845
>gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O-methyltransferase mRNA, complete cds Length = 1446 Score = 60.0 bits (30), Expect = 1e-05 Identities = 72/86 (83%) Strand = Plus / Minus Query: 297 accttgccgtgtggaggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcg 356 ||||||||||| | |||| ||||||||||||||| | ||||| || | |||||||| | Sbjct: 913 accttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgctgg 854 Query: 357 tcggtccagttgtggagcatccactt 382 ||| |||||| |||||| |||||||| Sbjct: 853 tcgctccagtcgtggaggatccactt 828 Score = 46.1 bits (23), Expect = 0.15 Identities = 50/59 (84%) Strand = Plus / Minus Query: 168 tggaactccctctggctcctctccctgccggctggtgtgtgcatgagcatgatcatgtc 226 ||||||||||||| | ||||||||||||| | || ||||| ||||||||||||||| Sbjct: 1042 tggaactccctctcgtacctctccctgccgccggggttgtgcgcgagcatgatcatgtc 984
>emb|AJ586106.1| Festuca arundinacea partial mRNA for putative caffeate o-methyltransferase (comt gene) Length = 878 Score = 60.0 bits (30), Expect = 1e-05 Identities = 72/86 (83%) Strand = Plus / Minus Query: 297 accttgccgtgtggaggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcg 356 ||||||||||| | |||| ||||||||||||||| | ||||| || | |||||||| | Sbjct: 763 accttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgctgg 704 Query: 357 tcggtccagttgtggagcatccactt 382 ||| |||||| |||||| |||||||| Sbjct: 703 tcgctccagtcgtggaggatccactt 678
>emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caffeate o-methyltransferase (comt gene) Length = 878 Score = 60.0 bits (30), Expect = 1e-05 Identities = 72/86 (83%) Strand = Plus / Minus Query: 297 accttgccgtgtggaggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcg 356 ||||||||||| | |||| ||||||||||||||| | ||||| || | |||||||| | Sbjct: 763 accttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgctgg 704 Query: 357 tcggtccagttgtggagcatccactt 382 ||| |||||| |||||| |||||||| Sbjct: 703 tcgctccagtcgtggaggatccactt 678
>gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltransferase (OMT1) mRNA, complete cds Length = 1455 Score = 60.0 bits (30), Expect = 1e-05 Identities = 72/86 (83%) Strand = Plus / Minus Query: 297 accttgccgtgtggaggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcg 356 ||||||||||| | |||| ||||||||||||||| | ||||| || | |||||||| | Sbjct: 920 accttgccgtgcgccggcagcgcgtcgtagcagttcttgagcagcgtggcgcagtgctgg 861 Query: 357 tcggtccagttgtggagcatccactt 382 ||| |||||| |||||| |||||||| Sbjct: 860 tcgctccagtcgtggaggatccactt 835 Score = 46.1 bits (23), Expect = 0.15 Identities = 50/59 (84%) Strand = Plus / Minus Query: 168 tggaactccctctggctcctctccctgccggctggtgtgtgcatgagcatgatcatgtc 226 ||||||||||||| | ||||||||||||| | || ||||| ||||||||||||||| Sbjct: 1049 tggaactccctctcgtacctctccctgccgccggggttgtgcgcgagcatgatcatgtc 991
>gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-methyltransferase mRNA, complete cds Length = 1430 Score = 58.0 bits (29), Expect = 4e-05 Identities = 263/341 (77%) Strand = Plus / Minus Query: 297 accttgccgtgtggaggcaatgcgtcgtagcagttccttagcagagtagtgcagtgctcg 356 ||||||||||| | |||| ||||||||||||||| | ||||| || | ||| |||| | Sbjct: 946 accttgccgtgcgctggcagcgcgtcgtagcagttcttgagcagcgtggcgcaatgctgg 887 Query: 357 tcggtccagttgtggagcatccactttaagatgatggcatccccactgggcacattcctg 416 ||| |||||| |||||| |||||||| | | |||||| || || |||||| ||| || Sbjct: 886 tcgctccagtcgtggaggatccacttcatcaggatggcgtcgcccgagggcaccttcttg 827 Query: 417 aacatatcaccggcgacgtgctgcacgccagggcattgcggcgcatcagcgatgacgtgt 476 ||||| || ||| ||||||| ||||| ||| | ||||||| || | |||||| || Sbjct: 826 aacatgtcgccgccgacgtgggtgacgcccgggaacggcggcgcctcggagatgacatgg 767 Query: 477 ggcaggtcgaagttaattcccttaatgtgcgggtacttggaggtgatggcgcggatggtg 536 || ||||||||||| || |||| ||| ||||| | || |||||||||| | |||| Sbjct: 766 gggaggtcgaagttgatcccctcgatggcggggtagtgggcggtgatggcggccacggtg 707 Query: 537 gtgccaacgccgccaccgacgtccacgaggaaggcgatgtcgtggaagcccatgtacatc 596 | ||| |||| ||| |||||||| |||||| | ||||| | |||||||| ||| | | Sbjct: 706 gcgccgacgctgccgccgacgtcgacgagggtgccgatgccctggaagccgtcgtagagc 647 Query: 597 tcgacgagcttcctgttgatgatggtggagtagttgttcat 637 |||| ||||||| || |||||||| |||||| ||| ||||| Sbjct: 646 tcgaggagcttcttggtgatgatgatggagttgttcttcat 606
>gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (comt) gene, partial cds Length = 2782 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2568 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2509 Query: 378 cactt 382 ||||| Sbjct: 2508 cactt 2504
>gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (comt) gene, complete cds Length = 2955 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2384 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2325 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2324 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2265 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2264 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2212
>gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (comt) gene, partial cds Length = 2925 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2711 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2652 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2651 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2592 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2591 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2539
>gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (comt) gene, complete cds Length = 3282 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2711 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2652 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2651 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2592 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2591 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2539
>gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (comt) gene, partial cds Length = 2757 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2543 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2484 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2483 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2424 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2423 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2371
>gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (comt) gene, partial cds Length = 2850 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2636 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2577 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2576 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2517 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2516 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2464
>gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt) gene, partial cds Length = 2675 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2459 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2400 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2399 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2340 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2339 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2287
>gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (comt) gene, partial cds Length = 2782 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2568 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2509 Query: 378 cactt 382 ||||| Sbjct: 2508 cactt 2504
>gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (comt) gene, partial cds Length = 2927 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2711 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2652 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2651 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2592 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2591 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2539
>gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt) gene, partial cds Length = 3206 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2989 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2930 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2929 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2870 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2869 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2817
>gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (comt) gene, complete cds Length = 2676 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2429 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2370 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2369 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2310 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2309 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2257
>gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (comt) gene, partial cds Length = 2643 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2429 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2370 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2369 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2310 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2309 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2257
>gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (comt) gene, partial cds Length = 3151 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2935 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2876 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2875 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2816 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2815 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2763
>gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (comt) gene, partial cds Length = 2639 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2425 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2366 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2365 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2306 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2305 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2253
>gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt) gene, partial cds Length = 3102 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2888 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2829 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2828 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2769 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2768 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2716
>gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (comt) gene, partial cds Length = 3154 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2940 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2881 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2880 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2821 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2820 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2768
>gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (comt) gene, partial cds Length = 2892 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2678 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2619 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2618 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2559 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2558 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2506
>gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (comt) gene, partial cds Length = 2951 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2735 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2676 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2675 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2616 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2615 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2563
>gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (comt) gene, complete cds Length = 2982 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2735 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2676 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2675 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2616 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2615 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2563
>gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (comt) gene, partial cds Length = 2948 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2734 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2675 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2674 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2615 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2614 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2562
>gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt) gene, partial cds Length = 3131 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2917 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2858 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2857 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2798 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2797 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2745
>gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt) gene, complete cds Length = 3190 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2943 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2884 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2883 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2824 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2823 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2771
>gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (comt) gene, partial cds Length = 2748 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2534 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2475 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2474 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2415 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2414 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2362
>gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransferase (comt) gene, complete cds Length = 3088 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2841 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2782 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2781 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2722 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2721 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2669
>gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferase (comt) gene, complete cds Length = 3095 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2848 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2789 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2788 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2729 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2728 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2676
>gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) gene, partial cds Length = 3105 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2891 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2832 Query: 378 cactt 382 ||||| Sbjct: 2831 cactt 2827
>gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt) gene, partial cds Length = 3111 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2895 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2836 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2835 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2776 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2775 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2723
>gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gene, partial cds Length = 3146 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2930 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2871 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2870 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2811 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2810 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2758
>gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) gene, partial cds Length = 3073 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2857 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2798 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2797 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2738 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2737 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2685
>gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase (comt) gene, complete cds Length = 3061 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 2826 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 2767 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 2766 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 2707 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 2706 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 2654
>gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (comt) gene, complete cds Length = 2041 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 1806 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 1747 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 1746 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 1687 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 1686 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 1634
>gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (comt) gene, complete cds Length = 2326 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 1755 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 1696 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 1695 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 1636 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 1635 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 1583
>gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (comt) gene, complete cds Length = 2074 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 1827 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 1768 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 1767 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 1708 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 1707 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 1655
>gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (comt) gene, complete cds Length = 2326 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 1755 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 1696 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 1695 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 1636 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 1635 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 1583
>gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, complete cds Length = 2512 Score = 58.0 bits (29), Expect = 4e-05 Identities = 137/173 (79%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| || | ||||||| ||||| |||||| |||||| ||| Sbjct: 1906 gcgtcgtagcagttcttgagcagcgtggcgcagtgcgcgtcgctccagtcgtggaggatc 1847 Query: 378 cactttaagatgatggcatccccactgggcacattcctgaacatatcaccggcgacgtgc 437 ||||| | || |||||| || || |||||| | |||||| || ||| | ||||| Sbjct: 1846 cacttcatgaggatggcgtcgccggcgggcacggacgcgaacatgtccccgcccacgtgg 1787 Query: 438 tgcacgccagggcattgcggcgcatcagcgatgacgtgtggcaggtcgaagtt 490 ||||||| ||| | ||||||| || | ||||||||| |||||||||||||| Sbjct: 1786 cgcacgccggggaacggcggcgcctcggagatgacgtgcggcaggtcgaagtt 1734
>dbj|AB121046.1| Rosa chinensis var. spontanea mRNA for phloroglucinol O-methyltransferase, complete cds Length = 1393 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 459 gcatcagcgatgacgtgtggcaggtcgaagttaattcccttaatgtgcgggtacttggag 518 |||||||| | ||||||||||| || || || || ||||||||||||||||||||| | Sbjct: 755 gcatcagctaggacgtgtggcaaatcaaaattgatgcccttaatgtgcgggtacttgttg 696 Query: 519 gtgatg 524 |||||| Sbjct: 695 gtgatg 690
>ref|XM_480185.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1425 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| | ||||||||||||| |||||| |||||| ||| Sbjct: 954 gcgtcgtagcagttcttgagcagccgcgcgcagtgctcgtcgctccagtcgtggaggatc 895 Query: 378 cactt 382 ||||| Sbjct: 894 cactt 890
>dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G09, full insert sequence Length = 1227 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| | ||||||||||||| |||||| |||||| ||| Sbjct: 752 gcgtcgtagcagttcttgagcagccgcgcgcagtgctcgtcgctccagtcgtggaggatc 693 Query: 378 cactt 382 ||||| Sbjct: 692 cactt 688
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Plus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| | ||||||||||||| |||||| |||||| ||| Sbjct: 3331931 gcgtcgtagcagttcttgagcagccgcgcgcagtgctcgtcgctccagtcgtggaggatc 3331990 Query: 378 cactt 382 ||||| Sbjct: 3331991 cactt 3331995
>gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltransferase (ROMT-9) mRNA, complete cds Length = 1190 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| | ||||||||||||| |||||| |||||| ||| Sbjct: 886 gcgtcgtagcagttcttgagcagccgcgcgcagtgctcgtcgctccagtcgtggaggatc 827 Query: 378 cactt 382 ||||| Sbjct: 826 cactt 822
>dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA for caffeic acid o-methyl transferase, partial cds Length = 1067 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| | ||||||||||||| |||||| |||||| ||| Sbjct: 572 gcgtcgtagcagttcttgagcagccgcgcgcagtgctcgtcgctccagtcgtggaggatc 513 Query: 378 cactt 382 ||||| Sbjct: 512 cactt 508
>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0438H08 Length = 148626 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Plus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| | ||||||||||||| |||||| |||||| ||| Sbjct: 109498 gcgtcgtagcagttcttgagcagccgcgcgcagtgctcgtcgctccagtcgtggaggatc 109557 Query: 378 cactt 382 ||||| Sbjct: 109558 cactt 109562
>dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A05, full insert sequence Length = 1425 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Minus Query: 318 gcgtcgtagcagttccttagcagagtagtgcagtgctcgtcggtccagttgtggagcatc 377 ||||||||||||||| | ||||| | ||||||||||||| |||||| |||||| ||| Sbjct: 954 gcgtcgtagcagttcttgagcagccgcgcgcagtgctcgtcgctccagtcgtggaggatc 895 Query: 378 cactt 382 ||||| Sbjct: 894 cactt 890
>gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltransferase (OMT3) mRNA, complete cds Length = 1436 Score = 46.1 bits (23), Expect = 0.15 Identities = 47/55 (85%) Strand = Plus / Minus Query: 172 actccctctggctcctctccctgccggctggtgtgtgcatgagcatgatcatgtc 226 ||||||||| | ||||||||||||| |||| ||||| ||||||||||||||| Sbjct: 1082 actccctctcgtacctctccctgccgcctgggttgtgcgcgagcatgatcatgtc 1028 Score = 42.1 bits (21), Expect = 2.3 Identities = 90/113 (79%) Strand = Plus / Minus Query: 454 gcggcgcatcagcgatgacgtgtggcaggtcgaagttaattcccttaatgtgcgggtact 513 ||||||| || | ||||||||| || ||||||||||| || ||||| ||| ||||| | Sbjct: 800 gcggcgcctcggagatgacgtgggggaggtcgaagttgatccccttgatggtggggtagt 741 Query: 514 tggaggtgatggcgcggatggtggtgccaacgccgccaccgacgtccacgagg 566 | |||||||||| | ||||| ||| |||||||| |||||||| |||||| Sbjct: 740 gtgcggtgatggcggccacggtggcgccgacgccgccgccgacgtcgacgagg 688
>ref|XM_632378.1| Dictyostelium discoideum hypothetical protein (DDB0187197), partial mRNA Length = 15669 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 613 tgatgatggtggagtagttgtt 634 |||||||||||||||||||||| Sbjct: 393 tgatgatggtggagtagttgtt 372
>gb|AC109491.3| Homo sapiens chromosome 5 clone RP11-727F19, complete sequence Length = 127489 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 200 tggtgtgtgcatgagcatgatcatgt 225 ||||||||||||| |||||||||||| Sbjct: 89322 tggtgtgtgcatgtgcatgatcatgt 89297
>emb|AL590326.3|CNS07EG7 Human chromosome 14 DNA sequence BAC R-477I4 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 31184 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 173 ctccctctggctcctctccctgccgg 198 |||||||||||||| ||||||||||| Sbjct: 13035 ctccctctggctcccctccctgccgg 13010
>ref|XM_476894.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1615 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 565 ggaaggcgatgtcgtggaagc 585 ||||||||||||||||||||| Sbjct: 447 ggaaggcgatgtcgtggaagc 427
>ref|XM_476888.1| Oryza sativa (japonica cultivar-group), mRNA Length = 444 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 565 ggaaggcgatgtcgtggaagc 585 ||||||||||||||||||||| Sbjct: 174 ggaaggcgatgtcgtggaagc 194
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 598 cgacgagcttcctgttgatga 618 ||||||||||||||||||||| Sbjct: 12309864 cgacgagcttcctgttgatga 12309844
>gb|AY046886.1| Pichia angusta transcriptional activator Mut3p (MUT3) gene, complete cds Length = 4217 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 514 tggaggtgatggcgcggatgg 534 ||||||||||||||||||||| Sbjct: 2718 tggaggtgatggcgcggatgg 2698
>gb|AC116663.1| Rattus norvegicus, clone RP31-109I17, complete sequence Length = 165658 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 176 cctctggctcctctccctgccggctggtg 204 ||||||||||| ||||||||| ||||||| Sbjct: 72495 cctctggctccactccctgccagctggtg 72523
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 565 ggaaggcgatgtcgtggaagc 585 ||||||||||||||||||||| Sbjct: 4490209 ggaaggcgatgtcgtggaagc 4490189 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 565 ggaaggcgatgtcgtggaagc 585 ||||||||||||||||||||| Sbjct: 4443744 ggaaggcgatgtcgtggaagc 4443724
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 521 gatggcgcggatggtggtgcc 541 ||||||||||||||||||||| Sbjct: 29473036 gatggcgcggatggtggtgcc 29473056
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 598 cgacgagcttcctgttgatga 618 ||||||||||||||||||||| Sbjct: 12306627 cgacgagcttcctgttgatga 12306607
>gb|AC092960.3| Homo sapiens 3 BAC RP11-393B14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 172507 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 394 catccccactgggcacattcc 414 ||||||||||||||||||||| Sbjct: 75770 catccccactgggcacattcc 75750
>gb|AC137699.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0029K10, from chromosome 3, complete sequence Length = 135940 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 598 cgacgagcttcctgttgatga 618 ||||||||||||||||||||| Sbjct: 79397 cgacgagcttcctgttgatga 79377
>dbj|AP003861.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1046_F10 Length = 118472 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 565 ggaaggcgatgtcgtggaagc 585 ||||||||||||||||||||| Sbjct: 68928 ggaaggcgatgtcgtggaagc 68908 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 565 ggaaggcgatgtcgtggaagc 585 ||||||||||||||||||||| Sbjct: 22463 ggaaggcgatgtcgtggaagc 22443
>dbj|AP003634.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0655A07 Length = 172473 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 521 gatggcgcggatggtggtgcc 541 ||||||||||||||||||||| Sbjct: 37542 gatggcgcggatggtggtgcc 37562
>dbj|AP003835.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1506_G02 Length = 106742 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 565 ggaaggcgatgtcgtggaagc 585 ||||||||||||||||||||| Sbjct: 83593 ggaaggcgatgtcgtggaagc 83573
>dbj|AK106871.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-118-D08, full insert sequence Length = 1615 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 565 ggaaggcgatgtcgtggaagc 585 ||||||||||||||||||||| Sbjct: 447 ggaaggcgatgtcgtggaagc 427
>dbj|AK066413.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013065M24, full insert sequence Length = 1803 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 598 cgacgagcttcctgttgatga 618 ||||||||||||||||||||| Sbjct: 726 cgacgagcttcctgttgatga 746
>gb|AC114003.4| Mus musculus chromosome 18 clone RP23-174C24, complete sequence Length = 223724 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 202 gtgtgtgcatgagcatgatcatgt 225 |||||||||||||||||| ||||| Sbjct: 130170 gtgtgtgcatgagcatgagcatgt 130147
>ref|NM_022913.1| Homo sapiens GC-rich promoter binding protein 1 (GPBP1), mRNA Length = 2858 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 1165 tgttgatgatggtggagtag 1146
>gb|AY389608.1| Hyacinthus orientalis O-methyltransferase mRNA, partial cds Length = 746 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 467 gatgacgtgtggcaggtcgaagtt 490 ||||||||| |||||||||||||| Sbjct: 207 gatgacgtgaggcaggtcgaagtt 184
>ref|XM_865972.1| PREDICTED: Bos taurus similar to ATP-binding cassette, sub-family B (MDR/TAP), member 9 isoform 2, transcript variant 3 (LOC529923), mRNA Length = 2313 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 559 ccacgaggaaggcgatgtcg 578 |||||||||||||||||||| Sbjct: 580 ccacgaggaaggcgatgtcg 561
>ref|XM_608385.2| PREDICTED: Bos taurus similar to ATP-binding cassette, sub-family B (MDR/TAP), member 9 isoform 2, transcript variant 2 (LOC529923), mRNA Length = 2184 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 559 ccacgaggaaggcgatgtcg 578 |||||||||||||||||||| Sbjct: 580 ccacgaggaaggcgatgtcg 561
>ref|XM_877301.1| PREDICTED: Bos taurus similar to ATP-binding cassette, sub-family B (MDR/TAP), member 9 isoform 2, transcript variant 4 (LOC529923), mRNA Length = 2340 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 559 ccacgaggaaggcgatgtcg 578 |||||||||||||||||||| Sbjct: 580 ccacgaggaaggcgatgtcg 561
>ref|XM_323414.1| Neurospora crassa OR74A hypothetical protein (NCU10048.1) partial mRNA Length = 930 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 518 ggtgatggcgcggatggtgg 537 |||||||||||||||||||| Sbjct: 411 ggtgatggcgcggatggtgg 392
>ref|XM_952862.1| Neurospora crassa OR74A hypothetical protein (NCU10048.1) partial mRNA Length = 930 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 518 ggtgatggcgcggatggtgg 537 |||||||||||||||||||| Sbjct: 411 ggtgatggcgcggatggtgg 392
>gb|AC144671.3| Mus musculus BAC clone RP24-292O2 from chromosome 9, complete sequence Length = 153253 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 202 gtgtgtgcatgagcatgatcatgt 225 |||||||||||||||||| ||||| Sbjct: 64820 gtgtgtgcatgagcatgagcatgt 64797
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome Length = 3928089 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 aggaaggcgatgtcgtggaa 583 |||||||||||||||||||| Sbjct: 2445731 aggaaggcgatgtcgtggaa 2445712
>gb|AY226828.1| Homo sapiens vasculin mRNA, complete cds Length = 2858 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 1165 tgttgatgatggtggagtag 1146
>ref|XM_535241.2| PREDICTED: Canis familiaris similar to G+C-rich promoter-binding protein, transcript variant 1 (LOC478062), mRNA Length = 3470 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 1259 tgttgatgatggtggagtag 1240
>ref|XM_854690.1| PREDICTED: Canis familiaris similar to G+C-rich promoter-binding protein, transcript variant 5 (LOC478062), mRNA Length = 2215 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 1259 tgttgatgatggtggagtag 1240
>ref|XM_854624.1| PREDICTED: Canis familiaris similar to G+C-rich promoter-binding protein, transcript variant 3 (LOC478062), mRNA Length = 3410 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 1259 tgttgatgatggtggagtag 1240
>ref|XM_854591.1| PREDICTED: Canis familiaris similar to G+C-rich promoter-binding protein, transcript variant 2 (LOC478062), mRNA Length = 2410 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 1259 tgttgatgatggtggagtag 1240
>gb|BC113004.1| Homo sapiens GC-rich promoter binding protein 1, mRNA (cDNA clone MGC:126339 IMAGE:40034860), complete cds Length = 2677 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 1083 tgttgatgatggtggagtag 1064
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 aggaaggcgatgtcgtggaa 583 |||||||||||||||||||| Sbjct: 2438524 aggaaggcgatgtcgtggaa 2438505
>emb|BX053381.1|CNS09DCP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 926 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 890 ggcgcggatggtggtgccaa 871
>emb|BX064112.1|CNS09LMS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1042 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 428 ggcgcggatggtggtgccaa 409
>emb|BX063634.1|CNS09L9I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 741 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 696 ggcgcggatggtggtgccaa 677
>emb|BX060802.1|CNS09J2U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 424 ggcgcggatggtggtgccaa 405
>emb|BX060050.1|CNS09IHY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1022 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 890 ggcgcggatggtggtgccaa 871
>emb|BX055661.1|CNS09F41 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 887 ggcgcggatggtggtgccaa 868
>emb|BX055571.1|CNS09F1J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 358 ggcgcggatggtggtgccaa 339
>emb|BX050775.1|CNS09BCB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27BG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 850 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 818 ggcgcggatggtggtgccaa 799
>emb|BX039691.1|CNS092SF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC10AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 735 ggcgcggatggtggtgccaa 716
>emb|BX034868.1|CNS08Z2G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50DH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 797 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 751 ggcgcggatggtggtgccaa 732
>emb|BX033413.1|CNS08XY1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 700 ggcgcggatggtggtgccaa 681
>emb|BX028652.1|CNS08U9S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA42DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 383 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 319 ggcgcggatggtggtgccaa 300
>emb|BX023142.1|CNS08Q0Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 800 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 732 ggcgcggatggtggtgccaa 713
>emb|BX014766.1|CNS08JK2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA22AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 408 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 185 ggcgcggatggtggtgccaa 166
>emb|BX012886.1|CNS08I3U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA2BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 887 ggcgcggatggtggtgccaa 868
>emb|X62096.1|PTLBCA P. tremuloides mRNA for lignin bispecific caffeic acid/5-hydroxyferulic acid O-methyl transferase Length = 1503 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 468 atgacgtgtggcaggtcgaagttaattccctt 499 |||||||| ||||| ||||||||||| ||||| Sbjct: 771 atgacgtggggcagatcgaagttaatgccctt 740
>gb|BC000267.1| Homo sapiens GC-rich promoter binding protein 1, mRNA (cDNA clone IMAGE:3357748), complete cds Length = 2258 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 572 tgttgatgatggtggagtag 553
>emb|BX640443.1| Bordetella bronchiseptica strain RB50, complete genome; segment 7/16 Length = 346274 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 520 tgatggcgcggatggtggtg 539 |||||||||||||||||||| Sbjct: 160593 tgatggcgcggatggtggtg 160612
>emb|BX640428.1| Bordetella parapertussis strain 12822, complete genome; segment 6/14 Length = 348525 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 520 tgatggcgcggatggtggtg 539 |||||||||||||||||||| Sbjct: 307973 tgatggcgcggatggtggtg 307992
>emb|BX640414.1| Bordetella pertussis strain Tohama I, complete genome; segment 4/12 Length = 343243 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 520 tgatggcgcggatggtggtg 539 |||||||||||||||||||| Sbjct: 92042 tgatggcgcggatggtggtg 92061
>emb|AL162755.2|NMA4Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment 4/7 Length = 331801 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 gaaaagatatgagacggatt 83 |||||||||||||||||||| Sbjct: 41888 gaaaagatatgagacggatt 41869
>gb|AC121161.2| Homo sapiens BAC clone RP11-781M16 from 4, complete sequence Length = 167561 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 76674 tgttgatgatggtggagtag 76655
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 540 ccaacgccgccaccgacgtc 559 |||||||||||||||||||| Sbjct: 652085 ccaacgccgccaccgacgtc 652066
>emb|CR861300.1| Pongo pygmaeus mRNA; cDNA DKFZp459A203 (from clone DKFZp459A203) Length = 3406 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 1195 tgttgatgatggtggagtag 1176
>emb|AL136844.1|HSM801812 Homo sapiens mRNA; cDNA DKFZp434G1730 (from clone DKFZp434G1730) Length = 1892 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 70 tgttgatgatggtggagtag 51
>gb|AC116646.5| Homo sapiens BAC clone RP11-714J18 from 4, complete sequence Length = 49367 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 36 ggcatgcagatttggaaagc 55 |||||||||||||||||||| Sbjct: 44659 ggcatgcagatttggaaagc 44678
>gb|AC125289.1| Homo sapiens chromosome 4 clone RP11-781M16, complete sequence Length = 167561 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 76674 tgttgatgatggtggagtag 76655
>gb|AE005840.1| Caulobacter crescentus CB15 section 166 of 359 of the complete genome Length = 12262 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 517 aggtgatggcgcggatggtg 536 |||||||||||||||||||| Sbjct: 4105 aggtgatggcgcggatggtg 4086
>gb|AC110989.3| Homo sapiens 3q BAC RP11-15M16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 161520 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 628 agttgttcatggcctggctg 647 |||||||||||||||||||| Sbjct: 1023 agttgttcatggcctggctg 1004
>gb|AC084235.13| Homo sapiens 3 BAC RP11-71H9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 172641 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 628 agttgttcatggcctggctg 647 |||||||||||||||||||| Sbjct: 172507 agttgttcatggcctggctg 172488
>gb|AC108680.5| Homo sapiens 3 BAC RP11-169I18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 75000 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 628 agttgttcatggcctggctg 647 |||||||||||||||||||| Sbjct: 72754 agttgttcatggcctggctg 72773
>gb|AC108093.2| Homo sapiens chromosome 5 clone CTD-2541K6, complete sequence Length = 71915 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 45 atttggaaagcaacaatgagaaaa 68 |||||||||| ||||||||||||| Sbjct: 35645 atttggaaagaaacaatgagaaaa 35668
>gb|AC019341.6| Homo sapiens BAC clone RP11-719M18 from 4, complete sequence Length = 190122 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 73178 tgttgatgatggtggagtag 73159
>dbj|AB168827.1| Macaca fascicularis testis cDNA, clone: QtsA-15127, similar to human vasculin (DKFZp761C169), mRNA, RefSeq: NM_022913.1 Length = 2369 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 1707 tgttgatgatggtggagtag 1688
>gb|AC026784.5| Homo sapiens chromosome 5 clone CTD-2138O14, complete sequence Length = 132278 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 45 atttggaaagcaacaatgagaaaa 68 |||||||||| ||||||||||||| Sbjct: 131938 atttggaaagaaacaatgagaaaa 131915
>emb|BX248230.21| Zebrafish DNA sequence from clone CH211-213O11 in linkage group 11, complete sequence Length = 217432 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 13 accaggaaaggatgctaaaa 32 |||||||||||||||||||| Sbjct: 101567 accaggaaaggatgctaaaa 101548
>gb|AE002098.2| Neisseria meningitidis MC58, complete genome Length = 2272360 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 gaaaagatatgagacggatt 83 |||||||||||||||||||| Sbjct: 896240 gaaaagatatgagacggatt 896221
>gb|AC144940.5| Mus musculus BAC clone RP23-429A10 from chromosome 9, complete sequence Length = 213669 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 caacaatgagaaaagatatg 74 |||||||||||||||||||| Sbjct: 208832 caacaatgagaaaagatatg 208851
>gb|AC079245.35| Mus musculus strain C57BL/6J chromosome 9 clone rp23-426k2, complete sequence Length = 213098 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 caacaatgagaaaagatatg 74 |||||||||||||||||||| Sbjct: 13064 caacaatgagaaaagatatg 13083
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 caccggcgacgtgctgcacg 443 |||||||||||||||||||| Sbjct: 313854 caccggcgacgtgctgcacg 313835
>ref|XM_315641.2| Anopheles gambiae str. PEST ENSANGP00000023852 (ENSANGG00000019341), partial mRNA Length = 2055 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 ggcgcggatggtggtgccaa 543 |||||||||||||||||||| Sbjct: 852 ggcgcggatggtggtgccaa 833
>gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome Length = 2153922 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 gaaaagatatgagacggatt 83 |||||||||||||||||||| Sbjct: 436431 gaaaagatatgagacggatt 436412
>emb|AL591373.8| Mouse DNA sequence from clone RP23-268M6 on chromosome 18, complete sequence Length = 174264 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 202 gtgtgtgcatgagcatgatcatgt 225 |||||||||||||||||| ||||| Sbjct: 151546 gtgtgtgcatgagcatgagcatgt 151569
>gb|AC008435.6| Homo sapiens chromosome 5 clone CTC-326G7, complete sequence Length = 88546 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 610 tgttgatgatggtggagtag 629 |||||||||||||||||||| Sbjct: 84834 tgttgatgatggtggagtag 84853
>dbj|AB042261.1| Zea mays ZmRR4 mRNA for response regulator 4, complete cds Length = 891 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 593 catctcgacgagcttcctgttgatgatg 620 |||||||| ||||||||||| ||||||| Sbjct: 128 catctcgatgagcttcctgtcgatgatg 101 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,972,127 Number of Sequences: 3902068 Number of extensions: 4972127 Number of successful extensions: 92691 Number of sequences better than 10.0: 142 Number of HSP's better than 10.0 without gapping: 142 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 91869 Number of HSP's gapped (non-prelim): 808 length of query: 665 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 642 effective length of database: 17,143,297,704 effective search space: 11005997125968 effective search space used: 11005997125968 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)