ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags32a17
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BT018920.1| Zea mays clone Contig21.F mRNA sequence 54 6e-04
2ref|XM_600052.2| PREDICTED: Bos taurus similar to transmembrane ... 50 0.009
3dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 50 0.009
4gb|AC124301.6| Homo sapiens chromosome 11, clone RP11-358H18, co... 44 0.57
5gb|AC124056.8| Homo sapiens chromosome 11, clone RP5-1082L12, co... 44 0.57
6gb|AC004736.1|AC004736 Human Chromosome 11p14.3 PAC clone pDJ108... 44 0.57
7ref|XM_462221.1| Debaryomyces hansenii CBS767 hypothetical prote... 42 2.3
8gb|AY659174.1| Synthetic construct Peudomonas aeruginosa clone F... 42 2.3
9gb|BT012702.1| Lycopersicon esculentum clone 113577R, mRNA sequence 42 2.3
10gb|AC124987.9| Mus musculus chromosome 3, clone RP24-364E17, com... 42 2.3
11gb|AC109152.13| Mus musculus chromosome 18, clone RP23-166J4, co... 42 2.3
12emb|AL139044.15| Human DNA sequence from clone RP11-6B20 on chro... 42 2.3
13emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS... 42 2.3
14gb|AC158763.6| Mus musculus chromosome 18, clone RP23-343L17, co... 42 2.3
15gb|AC128039.4| Rattus norvegicus BAC CH230-394A24 (Children's H... 42 2.3
16gb|AC072044.9| Homo sapiens 3 BAC RP11-213O23 (Roswell Park Canc... 42 2.3
17gb|AC005831.1| Homo sapiens 12p13.3 PAC RPCI5-1180D12 (Roswell P... 42 2.3
18gb|AE004490.1| Pseudomonas aeruginosa PAO1, section 51 of 529 of... 42 2.3
19dbj|AP006628.1| Onion yellows phytoplasma OY-M DNA, complete genome 42 2.3
20gb|AF484513.1| HIV-1 isolate 98UG57146 from Uganda, partial genome 42 2.3
21dbj|AP006545.1| Homo sapiens genomic DNA, chromosome 8p11.21, cl... 42 2.3
22gb|AC141632.4| Mus musculus BAC clone RP24-100G24 from 3, comple... 42 2.3
23gb|AC155338.1| Brassica rapa subsp. pekinensis chromosome Cytoge... 42 2.3
24gb|AC160552.13| Mus musculus chromosome 3, clone RP23-326D6, com... 40 9.0
25gb|AC152889.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 40 9.0
26ref|XM_483028.1| Oryza sativa (japonica cultivar-group), mRNA 40 9.0
27ref|NM_053485.2| Rattus norvegicus S100 calcium binding protein ... 40 9.0
28gb|AF140232.1| Rattus norvegicus calcium binding protein (S100A6... 40 9.0
29gb|AY159316.1| Homo sapiens lung cancer oncogene 7 mRNA, complet... 40 9.0
30gb|BC009017.1| Homo sapiens S100 calcium binding protein A6 (cal... 40 9.0
31gb|AC168064.3| Mus musculus BAC clone RP23-182K16 from chromosom... 40 9.0
32gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's ... 40 9.0
33gb|BC001431.2| Homo sapiens S100 calcium binding protein A6 (cal... 40 9.0
34gb|BC010774.1| Mus musculus S100 calcium binding protein A6 (cal... 40 9.0
35ref|NM_011313.1| Mus musculus S100 calcium binding protein A6 (c... 40 9.0
36ref|XM_676809.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 9.0
37gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl... 40 9.0
38gb|AC102575.11| Mus musculus chromosome 14, clone RP23-239P22, c... 40 9.0
39gb|BC003832.1| Mus musculus S100 calcium binding protein A6 (cal... 40 9.0
40emb|CR848682.9| Zebrafish DNA sequence from clone CH211-286K10 i... 40 9.0
41emb|CR538727.16| Zebrafish DNA sequence from clone DKEY-9G20 in ... 40 9.0
42gb|AC132330.5| Mus musculus BAC clone RP24-213O22 from chromosom... 40 9.0
43gb|AF549497.1| Mus musculus MC3T3-E1 calcyclin mRNA, complete cds 40 9.0
44emb|BX470102.12| Human DNA sequence from clone RP11-49N14 on chr... 40 9.0
45emb|AL592063.10| Human DNA sequence from clone RP11-575F9 on chr... 40 9.0
46ref|XM_503547.1| Yarrowia lipolytica CLIB122, YALI0E04576g predi... 40 9.0
47ref|XM_504224.1| Yarrowia lipolytica CLIB122, YALI0E21307g predi... 40 9.0
48ref|NM_014624.3| Homo sapiens S100 calcium binding protein A6 (c... 40 9.0
49emb|X52278.1|MM5B10 Mouse 5B10 mRNA for calcyclin 40 9.0
50emb|X66449.1|MMCALC M.musculus mRNA for calcyclin 40 9.0
51emb|AJ132717.1|RNO132717 Rattus norvegicus mRNA for calcyclin 40 9.0
52gb|BT007814.1| Synthetic construct Homo sapiens S100 calcium bin... 40 9.0
53gb|BT006965.1| Homo sapiens S100 calcium binding protein A6 (cal... 40 9.0
54emb|AL645844.18| Mouse DNA sequence from clone RP23-82B4 on chro... 40 9.0
55emb|BX548160.13| Zebrafish DNA sequence from clone DKEY-25G11 in... 40 9.0
56emb|BX546482.15| Zebrafish DNA sequence from clone DKEY-226B20 i... 40 9.0
57gb|AC105350.2| Drosophila melanogaster X BAC RP98-30C13 (Roswell... 40 9.0
58gb|AC148584.23| Gasterosteus aculeatus clone ch213-278g3, comple... 40 9.0
59gb|AC015724.9| Homo sapiens chromosome 17, clone RP11-45J24, com... 40 9.0
60dbj|AK151587.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 9.0
61dbj|AK150408.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 9.0
62dbj|AK151144.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 9.0
63gb|AF422844.1|AF422844 Yucaipa virus F protein and HN protein ge... 40 9.0
64emb|AL626778.12| Mouse DNA sequence from clone RP23-326E2 on chr... 40 9.0
65dbj|AK008941.1| Mus musculus adult male stomach cDNA, RIKEN full... 40 9.0
66gb|AY034480.1| Homo sapiens S100 calcium-binding protein A6 gene... 40 9.0
67dbj|AK008241.1| Mus musculus adult male small intestine cDNA, RI... 40 9.0
68dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.0
69gb|AC010890.9| Homo sapiens BAC clone RP11-449L24 from 2, comple... 40 9.0
70gb|AF252955.1|AF252955 HIV-1 isolate 07c02 from USA nef protein ... 40 9.0
71gb|AC090949.2| Homo sapiens chromosome 3 clone RP11-421B21 map 3... 40 9.0
72gb|AC087590.2| Homo sapiens chromosome 3 clone RP11-321I9 map 3p... 40 9.0
73gb|AY891800.1| Synthetic construct Homo sapiens clone FLH110757.... 40 9.0
74gb|AY891799.1| Synthetic construct Homo sapiens clone FLH110756.... 40 9.0
75gb|AY889312.1| Synthetic construct Homo sapiens clone FLH110761.... 40 9.0
76gb|AY889311.1| Synthetic construct Homo sapiens clone FLH110760.... 40 9.0
77emb|AL929559.12| Zebrafish DNA sequence from clone CH211-106G5 i... 40 9.0
78dbj|AP005918.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.0
79gb|AF484515.1| HIV-1 isolate 99UGE13613 from Uganda, partial genome 40 9.0
80gb|AE003446.4| Drosophila melanogaster chromosome X, section 30 ... 40 9.0
81gb|AC005553.1|AC005553 Homo sapiens chromosome 17, clone hRPK.11... 40 9.0
82emb|AL845274.17| Mouse DNA sequence from clone RP23-146F24 on ch... 40 9.0
83gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome 40 9.0
84gb|AF064672.1|AF064672 HIV-1 patient 26 clone 26-P7 from Austral... 40 9.0
85gb|AF064671.1|AF064671 HIV-1 patient 26 clone 26-P6 from Austral... 40 9.0
86gb|AF064670.1|AF064670 HIV-1 patient 26 clone 26-P4 from Austral... 40 9.0
87emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 40 9.0
88gb|AF462775.1| HIV-1 isolate 93KBH7 from South Korea nef-like ge... 40 9.0
89gb|U31867.1|RNU31867 Rattus norvegicus Tclone15 mRNA 40 9.0
90emb|AL935136.4| Zebrafish DNA sequence from clone CH211-180B2, c... 40 9.0
91gb|M18981.1|HUMCACYA Human prolactin receptor-associated protein... 40 9.0
92gb|J02763.1|HUMCACY Human calcyclin gene, complete cds 40 9.0
93gb|M37761.1|MUSCALC23 Mouse calcyclin mRNA, complete cds 40 9.0
94gb|M14300.1|HUMGFI2A9 Human growth factor-inducible 2A9 gene, co... 40 9.0
95dbj|D14030.1|APFHENE2 Avian parainfluenza virus type2 RNA for he... 40 9.0
96gb|U04815.1|HSU04815 Human protein kinase PITSLRE alpha 1 mRNA, ... 40 9.0 
>gb|BT018920.1| Zea mays clone Contig21.F mRNA sequence
          Length = 931

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 278 cgcagcctgcttgcgacgcagtcagggcttc 308
           |||||||||||||||| ||||||||||||||
Sbjct: 438 cgcagcctgcttgcgatgcagtcagggcttc 468
to top
>ref|XM_600052.2| PREDICTED: Bos taurus similar to transmembrane protein 16F
            (LOC521784), mRNA
          Length = 3405

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 98   gccacatccatcactgcttccctca 122
            |||||||||||||||||||||||||
Sbjct: 2176 gccacatccatcactgcttccctca 2200
to top
>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                        
Query: 145     acaaccaacaaacccaaaacacacc 169
               |||||||||||||||||||||||||
Sbjct: 3680040 acaaccaacaaacccaaaacacacc 3680064
to top
>gb|AC124301.6| Homo sapiens chromosome 11, clone RP11-358H18, complete sequence
          Length = 145713

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 527   ttcttcatgtttccttccttct 548
             ||||||||||||||||||||||
Sbjct: 80280 ttcttcatgtttccttccttct 80259
to top
>gb|AC124056.8| Homo sapiens chromosome 11, clone RP5-1082L12, complete sequence
          Length = 115971

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 527   ttcttcatgtttccttccttct 548
             ||||||||||||||||||||||
Sbjct: 10037 ttcttcatgtttccttccttct 10058
to top
>gb|AC004736.1|AC004736 Human Chromosome 11p14.3 PAC clone pDJ1082L12 containing KNCN1 and MyoD,
              complete sequence
          Length = 115958

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 527    ttcttcatgtttccttccttct 548
              ||||||||||||||||||||||
Sbjct: 105926 ttcttcatgtttccttccttct 105905
to top
>ref|XM_462221.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G16676g)
           partial mRNA
          Length = 3801

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 319 ccacttcctcttcttcttcggctcc 343
           ||||||| |||||||||||||||||
Sbjct: 76  ccacttcttcttcttcttcggctcc 52
to top
>gb|AY659174.1| Synthetic construct Peudomonas aeruginosa clone FLH036934.01F
           PA0536 gene, partial cds
          Length = 1026

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 326 ctcttcttcttcggctccggc 346
           |||||||||||||||||||||
Sbjct: 620 ctcttcttcttcggctccggc 600
to top
>gb|BT012702.1| Lycopersicon esculentum clone 113577R, mRNA sequence
          Length = 1952

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 427  cttgcagaccacatcagcagt 447
            |||||||||||||||||||||
Sbjct: 1041 cttgcagaccacatcagcagt 1021
to top
>gb|AC124987.9| Mus musculus chromosome 3, clone RP24-364E17, complete sequence
          Length = 165330

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 527    ttcttcatgtttccttccttc 547
              |||||||||||||||||||||
Sbjct: 154799 ttcttcatgtttccttccttc 154779
to top
>gb|AC109152.13| Mus musculus chromosome 18, clone RP23-166J4, complete sequence
          Length = 206894

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 511    gacttcatccttggccttctt 531
              |||||||||||||||||||||
Sbjct: 124594 gacttcatccttggccttctt 124574
to top
>emb|AL139044.15| Human DNA sequence from clone RP11-6B20 on chromosome 6 Contains the
             ITPR3 gene for inositol 1,4,5-triphosphate receptor type
             3, a novel gene and the IHPK3 gene for inositol
             hexaphosphate kinase 3, complete sequence
          Length = 134250

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 524   gccttcttcatgtttccttccttct 548
             |||||||||||||||| ||||||||
Sbjct: 87852 gccttcttcatgtttctttccttct 87828
to top
>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces
               hansenii
          Length = 2051428

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 319     ccacttcctcttcttcttcggctcc 343
               ||||||| |||||||||||||||||
Sbjct: 1277411 ccacttcttcttcttcttcggctcc 1277387
to top
>gb|AC158763.6| Mus musculus chromosome 18, clone RP23-343L17, complete sequence
          Length = 204022

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 511    gacttcatccttggccttctt 531
              |||||||||||||||||||||
Sbjct: 197255 gacttcatccttggccttctt 197275
to top
>gb|AC128039.4| Rattus norvegicus  BAC CH230-394A24 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 164278

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 145    acaaccaacaaacccaaaaca 165
              |||||||||||||||||||||
Sbjct: 121583 acaaccaacaaacccaaaaca 121563
to top
>gb|AC072044.9| Homo sapiens 3 BAC RP11-213O23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 178453

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 579    tgctgctcagatcagcatcctgctt 603
              |||||||||||||||| ||||||||
Sbjct: 170517 tgctgctcagatcagcttcctgctt 170493
to top
>gb|AC005831.1| Homo sapiens 12p13.3 PAC RPCI5-1180D12 (Roswell Park Cancer Institute
              Human PAC Library) complete sequence
          Length = 144515

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 541    ttccttctgctcaacttcacc 561
              |||||||||||||||||||||
Sbjct: 102772 ttccttctgctcaacttcacc 102792
to top
>gb|AE004490.1| Pseudomonas aeruginosa PAO1, section 51 of 529 of the complete genome
          Length = 11445

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 326  ctcttcttcttcggctccggc 346
            |||||||||||||||||||||
Sbjct: 4823 ctcttcttcttcggctccggc 4843
to top
>dbj|AP006628.1| Onion yellows phytoplasma OY-M DNA, complete genome
          Length = 860631

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 550    ctcaacttcaccagcatcatt 570
              |||||||||||||||||||||
Sbjct: 470197 ctcaacttcaccagcatcatt 470177
to top
>gb|AF484513.1| HIV-1 isolate 98UG57146 from Uganda, partial genome
          Length = 8768

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 317  acccacttcctcttcttcttc 337
            |||||||||||||||||||||
Sbjct: 8162 acccacttcctcttcttcttc 8142
to top
>dbj|AP006545.1| Homo sapiens genomic DNA, chromosome 8p11.21, clone: KB1836B05, complete
              sequence
          Length = 156888

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 317    acccacttcctcttcttcttc 337
              |||||||||||||||||||||
Sbjct: 110842 acccacttcctcttcttcttc 110822
to top
>gb|AC141632.4| Mus musculus BAC clone RP24-100G24 from 3, complete sequence
          Length = 180488

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 527    ttcttcatgtttccttccttc 547
              |||||||||||||||||||||
Sbjct: 171257 ttcttcatgtttccttccttc 171277
to top
>gb|AC155338.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1
             clone KBrH138P04, complete sequence
          Length = 137697

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 317   acccacttcctcttcttcttc 337
             |||||||||||||||||||||
Sbjct: 95960 acccacttcctcttcttcttc 95940
to top
>gb|AC160552.13| Mus musculus chromosome 3, clone RP23-326D6, complete sequence
          Length = 210051

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 454    cttcctgggggccttggctt 473
              ||||||||||||||||||||
Sbjct: 173957 cttcctgggggccttggctt 173976
to top
>gb|AC152889.1| Ornithorhynchus anatinus chromosome UNK clone OABb-513A1, complete
             sequence
          Length = 115833

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 545   ttctgctcaacttcaccagc 564
             ||||||||||||||||||||
Sbjct: 67325 ttctgctcaacttcaccagc 67306
to top
>ref|XM_483028.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 948

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 319 ccacttcctcttcttcttcg 338
           ||||||||||||||||||||
Sbjct: 469 ccacttcctcttcttcttcg 450
to top
>ref|NM_053485.2| Rattus norvegicus S100 calcium binding protein A6 (calcyclin)
           (S100a6), mRNA
          Length = 402

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 264 cttcctgggggccttggctt 283
to top
>gb|AF140232.1| Rattus norvegicus calcium binding protein (S100A6) mRNA, complete
           cds
          Length = 402

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 264 cttcctgggggccttggctt 283
to top
>gb|AY159316.1| Homo sapiens lung cancer oncogene 7 mRNA, complete cds
          Length = 1616

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 221 cttcctgggggccttggctt 202
to top
>gb|BC009017.1| Homo sapiens S100 calcium binding protein A6 (calcyclin), mRNA
           (cDNA clone MGC:18233 IMAGE:4157026), complete cds
          Length = 679

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 520 cttcctgggggccttggctt 539
to top
>gb|AC168064.3| Mus musculus BAC clone RP23-182K16 from chromosome 14, complete
             sequence
          Length = 220900

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 151   aacaaacccaaaacacacca 170
             ||||||||||||||||||||
Sbjct: 34257 aacaaacccaaaacacacca 34276
to top
>gb|AC128270.3| Rattus norvegicus 12 BAC CH230-48A22 (Children's Hospital Oakland
              Research Institute Rat (BN/SsNHsd/MCW) BAC library)
              complete sequence
          Length = 236843

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    catccatcactgcttccctc 121
              ||||||||||||||||||||
Sbjct: 154444 catccatcactgcttccctc 154425



 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    catccatcactgcttccctc 121
              ||||||||||||||||||||
Sbjct: 154064 catccatcactgcttccctc 154045



 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    catccatcactgcttccctc 121
              ||||||||||||||||||||
Sbjct: 153980 catccatcactgcttccctc 153961



 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    catccatcactgcttccctc 121
              ||||||||||||||||||||
Sbjct: 153896 catccatcactgcttccctc 153877



 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    catccatcactgcttccctc 121
              ||||||||||||||||||||
Sbjct: 153608 catccatcactgcttccctc 153589
to top
>gb|BC001431.2| Homo sapiens S100 calcium binding protein A6 (calcyclin), mRNA
           (cDNA clone MGC:2187 IMAGE:3138609), complete cds
          Length = 506

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 344 cttcctgggggccttggctt 363
to top
>gb|BC010774.1| Mus musculus S100 calcium binding protein A6 (calcyclin), mRNA
           (cDNA clone MGC:18644 IMAGE:4219642), complete cds
          Length = 470

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 307 cttcctgggggccttggctt 326
to top
>ref|NM_011313.1| Mus musculus S100 calcium binding protein A6 (calcyclin) (S100a6),
           mRNA
          Length = 551

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 384 cttcctgggggccttggctt 403
to top
>ref|XM_676809.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8632.2), mRNA
          Length = 2982

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 505 ggccttgacttcatccttggccttcttc 532
           |||||||| |||||||||||| ||||||
Sbjct: 996 ggccttgagttcatccttggctttcttc 969
to top
>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 569    ttcatcgtgttgctgctcag 588
              ||||||||||||||||||||
Sbjct: 272929 ttcatcgtgttgctgctcag 272948
to top
>gb|AC102575.11| Mus musculus chromosome 14, clone RP23-239P22, complete sequence
          Length = 238123

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 570    tcatcgtgttgctgctcaga 589
              ||||||||||||||||||||
Sbjct: 137067 tcatcgtgttgctgctcaga 137048
to top
>gb|BC003832.1| Mus musculus S100 calcium binding protein A6 (calcyclin), mRNA
           (cDNA clone MGC:6260 IMAGE:3490662), complete cds
          Length = 499

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 345 cttcctgggggccttggctt 364
to top
>emb|CR848682.9| Zebrafish DNA sequence from clone CH211-286K10 in linkage group 9,
             complete sequence
          Length = 84943

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 151   aacaaacccaaaacacacca 170
             ||||||||||||||||||||
Sbjct: 52508 aacaaacccaaaacacacca 52527
to top
>emb|CR538727.16| Zebrafish DNA sequence from clone DKEY-9G20 in linkage group 9,
             complete sequence
          Length = 155321

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 151   aacaaacccaaaacacacca 170
             ||||||||||||||||||||
Sbjct: 38534 aacaaacccaaaacacacca 38553
to top
>gb|AC132330.5| Mus musculus BAC clone RP24-213O22 from chromosome 14, complete
             sequence
          Length = 178081

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 151   aacaaacccaaaacacacca 170
             ||||||||||||||||||||
Sbjct: 85124 aacaaacccaaaacacacca 85105
to top
>gb|AF549497.1| Mus musculus MC3T3-E1 calcyclin mRNA, complete cds
          Length = 445

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 290 cttcctgggggccttggctt 309
to top
>emb|BX470102.12| Human DNA sequence from clone RP11-49N14 on chromosome 1 Contains the
            S100A6 gene for S100 calcium binding protein A6
            (calcyclin), a novel gene, the S100A5 gene for S100
            calcium binding protein A5, the S100A4 gene for S100
            calcium binding protein A4 (calcium protein, calvasculin,
            metastasin, murine placental homolog), the S100A3 gene
            for S100 calcium binding protein A3, the S100A2 gene for
            S100 calcium binding protein A2, the S100A16 gene for
            S100 calcium binding protein A16, the S100A14 gene for
            S100 calcium binding protein A14, and the 3' end of the
            S100A13 gene for S100 calcium binding protein A13,
            complete sequence
          Length = 100590

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 454  cttcctgggggccttggctt 473
            ||||||||||||||||||||
Sbjct: 8842 cttcctgggggccttggctt 8823
to top
>emb|AL592063.10| Human DNA sequence from clone RP11-575F9 on chromosome 1, complete
             sequence
          Length = 160396

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 371   tcctggtgacattccagaga 390
             ||||||||||||||||||||
Sbjct: 82964 tcctggtgacattccagaga 82983
to top
>ref|XM_503547.1| Yarrowia lipolytica CLIB122, YALI0E04576g predicted mRNA
          Length = 3078

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 549 gctcaacttcaccagcatcattca 572
           ||||||| ||||||||||||||||
Sbjct: 873 gctcaacctcaccagcatcattca 896
to top
>ref|XM_504224.1| Yarrowia lipolytica CLIB122, YALI0E21307g predicted mRNA
          Length = 1482

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 321 acttcctcttcttcttcggc 340
           ||||||||||||||||||||
Sbjct: 260 acttcctcttcttcttcggc 241
to top
>ref|NM_014624.3| Homo sapiens S100 calcium binding protein A6 (calcyclin) (S100A6),
           mRNA
          Length = 683

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 539 cttcctgggggccttggctt 558
to top
>emb|X52278.1|MM5B10 Mouse 5B10 mRNA for calcyclin
          Length = 434

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 300 cttcctgggggccttggctt 319
to top
>emb|X66449.1|MMCALC M.musculus mRNA for calcyclin
          Length = 551

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 384 cttcctgggggccttggctt 403
to top
>emb|AJ132717.1|RNO132717 Rattus norvegicus mRNA for calcyclin
          Length = 291

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 237 cttcctgggggccttggctt 256
to top
>gb|BT007814.1| Synthetic construct Homo sapiens S100 calcium binding protein A6
           (calcyclin) mRNA, partial cds
          Length = 273

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244
to top
>gb|BT006965.1| Homo sapiens S100 calcium binding protein A6 (calcyclin) mRNA,
           complete cds
          Length = 273

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244
to top
>emb|AL645844.18| Mouse DNA sequence from clone RP23-82B4 on chromosome 11 Contains a
             heat shock protein Hsp90 family pseudogene, complete
             sequence
          Length = 146832

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 63    ccacaacaaaatgatagcaa 82
             ||||||||||||||||||||
Sbjct: 17212 ccacaacaaaatgatagcaa 17193
to top
>emb|BX548160.13| Zebrafish DNA sequence from clone DKEY-25G11 in linkage group 11,
              complete sequence
          Length = 237930

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 155    aacccaaaacacaccaccaa 174
              ||||||||||||||||||||
Sbjct: 236729 aacccaaaacacaccaccaa 236710
to top
>emb|BX546482.15| Zebrafish DNA sequence from clone DKEY-226B20 in linkage group 13,
             complete sequence
          Length = 206949

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 529   cttcatgtttccttccttct 548
             ||||||||||||||||||||
Sbjct: 31251 cttcatgtttccttccttct 31270
to top
>gb|AC105350.2| Drosophila melanogaster X BAC RP98-30C13 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 184334

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 322   cttcctcttcttcttcggct 341
             ||||||||||||||||||||
Sbjct: 36788 cttcctcttcttcttcggct 36807
to top
>gb|AC148584.23| Gasterosteus aculeatus clone ch213-278g3, complete sequence
          Length = 169579

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   ccatcactgcttccctcaat 124
             ||||||||||||||||||||
Sbjct: 71009 ccatcactgcttccctcaat 70990
to top
>gb|AC015724.9| Homo sapiens chromosome 17, clone RP11-45J24, complete sequence
          Length = 189055

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   catccatcactgcttccctc 121
             ||||||||||||||||||||
Sbjct: 85299 catccatcactgcttccctc 85318
to top
>dbj|AK151587.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830031P06 product:S100 calcium
           binding protein A6 (calcyclin), full insert sequence
          Length = 429

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 293 cttcctgggggccttggctt 312
to top
>dbj|AK150408.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830006O04 product:S100 calcium
           binding protein A6 (calcyclin), full insert sequence
          Length = 430

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 293 cttcctgggggccttggctt 312
to top
>dbj|AK151144.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830026A04 product:S100 calcium
           binding protein A6 (calcyclin), full insert sequence
          Length = 430

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 293 cttcctgggggccttggctt 312
to top
>gb|AF422844.1|AF422844 Yucaipa virus F protein and HN protein genes, complete cds
          Length = 3615

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 232  caagtcacaagatcaagttg 251
            ||||||||||||||||||||
Sbjct: 1772 caagtcacaagatcaagttg 1753
to top
>emb|AL626778.12| Mouse DNA sequence from clone RP23-326E2 on chromosome 4, complete
             sequence
          Length = 186208

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 526   cttcttcatgtttccttcct 545
             ||||||||||||||||||||
Sbjct: 14549 cttcttcatgtttccttcct 14568
to top
>dbj|AK008941.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched
           library, clone:2210415I10 product:S100 calcium binding
           protein A6 (calcyclin), full insert sequence
          Length = 430

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 293 cttcctgggggccttggctt 312
to top
>gb|AY034480.1| Homo sapiens S100 calcium-binding protein A6 gene, complete cds
          Length = 274

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244
to top
>dbj|AK008241.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010015A02 product:S100 calcium
           binding protein A6 (calcyclin), full insert sequence
          Length = 430

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 293 cttcctgggggccttggctt 312
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 319      ccacttcctcttcttcttcg 338
                ||||||||||||||||||||
Sbjct: 23944994 ccacttcctcttcttcttcg 23944975
to top
>gb|AC010890.9| Homo sapiens BAC clone RP11-449L24 from 2, complete sequence
          Length = 62764

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 89   accacaccagccacatccatcact 112
            |||||||||||| |||||||||||
Sbjct: 4224 accacaccagcctcatccatcact 4247
to top
>gb|AF252955.1|AF252955 HIV-1 isolate 07c02 from USA nef protein (nef) gene, complete cds
          Length = 621

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 317 acccacttcctcttcttctt 336
           ||||||||||||||||||||
Sbjct: 201 acccacttcctcttcttctt 182
to top
>gb|AC090949.2| Homo sapiens chromosome 3 clone RP11-421B21 map 3p, complete sequence
          Length = 176751

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 533    atgtttccttccttctgctcaact 556
              |||||||||||||||| |||||||
Sbjct: 160946 atgtttccttccttcttctcaact 160923
to top
>gb|AC087590.2| Homo sapiens chromosome 3 clone RP11-321I9 map 3p, complete sequence
          Length = 188132

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 533   atgtttccttccttctgctcaact 556
             |||||||||||||||| |||||||
Sbjct: 75961 atgtttccttccttcttctcaact 75984
to top
>gb|AY891800.1| Synthetic construct Homo sapiens clone FLH110757.01L S100 calcium
           binding protein A6 (S100A6) mRNA, partial cds
          Length = 273

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244
to top
>gb|AY891799.1| Synthetic construct Homo sapiens clone FLH110756.01L S100 calcium
           binding protein A6 (S100A6) mRNA, partial cds
          Length = 273

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244
to top
>gb|AY889312.1| Synthetic construct Homo sapiens clone FLH110761.01X S100 calcium
           binding protein A6 (S100A6) mRNA, complete cds
          Length = 273

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244
to top
>gb|AY889311.1| Synthetic construct Homo sapiens clone FLH110760.01X S100 calcium
           binding protein A6 (S100A6) mRNA, complete cds
          Length = 273

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 225 cttcctgggggccttggctt 244
to top
>emb|AL929559.12| Zebrafish DNA sequence from clone CH211-106G5 in linkage group 1,
             complete sequence
          Length = 163933

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   acccaaaacacaccaccaac 175
             ||||||||||||||||||||
Sbjct: 66997 acccaaaacacaccaccaac 66978
to top
>dbj|AP005918.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0419H09
          Length = 143533

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 319   ccacttcctcttcttcttcg 338
             ||||||||||||||||||||
Sbjct: 78145 ccacttcctcttcttcttcg 78126
to top
>gb|AF484515.1| HIV-1 isolate 99UGE13613 from Uganda, partial genome
          Length = 8774

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 317  acccacttcctcttcttctt 336
            ||||||||||||||||||||
Sbjct: 8171 acccacttcctcttcttctt 8152
to top
>gb|AE003446.4| Drosophila melanogaster chromosome X, section 30 of 74 of the complete
              sequence
          Length = 290970

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 322    cttcctcttcttcttcggct 341
              ||||||||||||||||||||
Sbjct: 286933 cttcctcttcttcttcggct 286914
to top
>gb|AC005553.1|AC005553 Homo sapiens chromosome 17, clone hRPK.112_J_9, complete sequence
          Length = 179651

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 102    catccatcactgcttccctc 121
              ||||||||||||||||||||
Sbjct: 169920 catccatcactgcttccctc 169939
to top
>emb|AL845274.17| Mouse DNA sequence from clone RP23-146F24 on chromosome 2, complete
              sequence
          Length = 230151

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 389    gaatcaaatgtcaccccgga 408
              ||||||||||||||||||||
Sbjct: 181874 gaatcaaatgtcaccccgga 181855
to top
>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome
          Length = 2519802

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 463     ggccttggcttcatccttga 482
               ||||||||||||||||||||
Sbjct: 2460940 ggccttggcttcatccttga 2460959
to top
>gb|AF064672.1|AF064672 HIV-1 patient 26 clone 26-P7 from Australia, nef protein (nef)
           gene, complete cds
          Length = 621

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 317 acccacttcctcttcttctt 336
           ||||||||||||||||||||
Sbjct: 201 acccacttcctcttcttctt 182
to top
>gb|AF064671.1|AF064671 HIV-1 patient 26 clone 26-P6 from Australia, nef protein (nef)
           gene, complete cds
          Length = 621

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 317 acccacttcctcttcttctt 336
           ||||||||||||||||||||
Sbjct: 201 acccacttcctcttcttctt 182
to top
>gb|AF064670.1|AF064670 HIV-1 patient 26 clone 26-P4 from Australia, nef protein (nef)
           gene, complete cds
          Length = 621

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 317 acccacttcctcttcttctt 336
           ||||||||||||||||||||
Sbjct: 201 acccacttcctcttcttctt 182
to top
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 321     acttcctcttcttcttcggc 340
               ||||||||||||||||||||
Sbjct: 2535120 acttcctcttcttcttcggc 2535101



 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 549    gctcaacttcaccagcatcattca 572
              ||||||| ||||||||||||||||
Sbjct: 523099 gctcaacctcaccagcatcattca 523076
to top
>gb|AF462775.1| HIV-1 isolate 93KBH7 from South Korea nef-like gene, complete
           sequence; and long terminal repeat, partial sequence
          Length = 798

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 317 acccacttcctcttcttctt 336
           ||||||||||||||||||||
Sbjct: 189 acccacttcctcttcttctt 170
to top
>gb|U31867.1|RNU31867 Rattus norvegicus Tclone15 mRNA
          Length = 393

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 255 cttcctgggggccttggctt 274
to top
>emb|AL935136.4| Zebrafish DNA sequence from clone CH211-180B2, complete sequence
          Length = 146712

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 529   cttcatgtttccttccttct 548
             ||||||||||||||||||||
Sbjct: 49328 cttcatgtttccttccttct 49347
to top
>gb|M18981.1|HUMCACYA Human prolactin receptor-associated protein (PRA) gene, complete
           cds
          Length = 470

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 327 cttcctgggggccttggctt 346
to top
>gb|J02763.1|HUMCACY Human calcyclin gene, complete cds
          Length = 3671

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 454  cttcctgggggccttggctt 473
            ||||||||||||||||||||
Sbjct: 2620 cttcctgggggccttggctt 2639
to top
>gb|M37761.1|MUSCALC23 Mouse calcyclin mRNA, complete cds
          Length = 428

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 291 cttcctgggggccttggctt 310
to top
>gb|M14300.1|HUMGFI2A9 Human growth factor-inducible 2A9 gene, complete cds
          Length = 434

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 290 cttcctgggggccttggctt 309
to top
>dbj|D14030.1|APFHENE2 Avian parainfluenza virus type2 RNA for hemagglutinin-neuraminidase
          Length = 1899

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 232 caagtcacaagatcaagttg 251
           ||||||||||||||||||||
Sbjct: 56  caagtcacaagatcaagttg 37
to top
>gb|U04815.1|HSU04815 Human protein kinase PITSLRE alpha 1 mRNA, complete cds
          Length = 1805

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 454 cttcctgggggccttggctt 473
           ||||||||||||||||||||
Sbjct: 125 cttcctgggggccttggctt 106


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,617,675
Number of Sequences: 3902068
Number of extensions: 7617675
Number of successful extensions: 156275
Number of sequences better than 10.0: 96
Number of HSP's better than 10.0 without gapping: 96
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 155839
Number of HSP's gapped (non-prelim): 436
length of query: 656
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 633
effective length of database: 17,143,297,704
effective search space: 10851707446632
effective search space used: 10851707446632
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top