ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags31l05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009488.1| Triticum aestivum clone wr1.pk0058.g3:fis, full i... 561 e-157
2emb|X00043.1|TAHI01 Wheat histone H4 gene 519 e-144
3gb|AC108500.3| Oryza sativa (japonica cultivar-group) chromosome... 517 e-143
4gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome... 517 e-143
5dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 517 e-143
6dbj|AK105816.1| Oryza sativa (japonica cultivar-group) cDNA clon... 517 e-143
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 515 e-143
8dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 515 e-143
9gb|AC118980.2| Oryza sativa (japonica cultivar-group) chromosome... 515 e-143
10dbj|AK058741.1| Oryza sativa (japonica cultivar-group) cDNA clon... 515 e-143
11ref|XM_475383.1| Oryza sativa (japonica cultivar-group), predic... 511 e-142
12gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome... 502 e-139
13gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome... 502 e-139
14dbj|AK119240.1| Oryza sativa (japonica cultivar-group) cDNA clon... 502 e-139
15ref|XM_475394.1| Oryza sativa (japonica cultivar-group), predic... 496 e-137
16ref|NM_187563.1| Oryza sativa (japonica cultivar-group), predic... 496 e-137
17ref|XM_473659.1| Oryza sativa (japonica cultivar-group), predic... 484 e-133
18emb|AL662987.3|OSJN00188 Oryza sativa genomic DNA, chromosome 4,... 484 e-133
19dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 484 e-133
20dbj|AK059019.1| Oryza sativa (japonica cultivar-group) cDNA clon... 484 e-133
21gb|BT017776.1| Zea mays clone EL01N0503B03.c mRNA sequence 480 e-132
22dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 478 e-132
23dbj|AP005551.3| Oryza sativa (japonica cultivar-group) genomic D... 478 e-132
24dbj|AK058686.1| Oryza sativa (japonica cultivar-group) cDNA clon... 478 e-132
25emb|X79715.1|LTMRHISH4 L.temulentum mRNA for histone H4 474 e-130
26gb|M12277.1|WHTH4091 Wheat histone H4 TH091 gene, complete cds 474 e-130
27ref|XM_467181.1| Oryza sativa (japonica cultivar-group), mRNA 472 e-130
28dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 472 e-130
29dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 472 e-130
30dbj|AP004401.5| Oryza sativa (japonica cultivar-group) genomic D... 472 e-130
31dbj|AP004255.3| Oryza sativa (japonica cultivar-group) genomic D... 472 e-130
32dbj|AP004071.3| Oryza sativa (japonica cultivar-group) genomic D... 472 e-130
33gb|M13370.1|MZEH4C14 Maize (Zea mays) histone H4 gene (H4C14), c... 472 e-130
34dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 470 e-129
35dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic D... 470 e-129
36dbj|AK058436.1| Oryza sativa (japonica cultivar-group) cDNA clon... 470 e-129
37ref|NM_185758.1| Oryza sativa (japonica cultivar-group), mRNA 468 e-129
38ref|NM_190485.1| Oryza sativa (japonica cultivar-group), predic... 464 e-127
39gb|AC137596.2| Oryza sativa (japonica cultivar-group) chromosome... 456 e-125
40dbj|AP005564.2| Oryza sativa (japonica cultivar-group) genomic D... 456 e-125
41ref|NM_197569.1| Oryza sativa (japonica cultivar-group) histone ... 450 e-123
42gb|AC096782.6| Oryza sativa chromosome 10 BAC OSJNBa0025B05 geno... 450 e-123
43gb|AC073166.7| Oryza sativa chromosome 10 BAC OSJNBb0064P21 geno... 450 e-123
44dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 450 e-123
45dbj|AK119699.1| Oryza sativa (japonica cultivar-group) cDNA clon... 450 e-123
46dbj|AK059098.1| Oryza sativa (japonica cultivar-group) cDNA clon... 450 e-123
47gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 450 e-123
48emb|X84376.1|ZMHIS4DNA Z.mays histone H4 gene 434 e-118
49gb|BT018251.1| Zea mays clone EL01N0563H01.c mRNA sequence 426 e-116
50gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H... 418 e-114
51ref|NM_001037845.1| Gallus gallus germinal histone H4 gene (LOC4... 418 e-114
52ref|NM_001037843.1| Gallus gallus similar to germinal histone H4... 418 e-114
53gb|M74534.1|CHKHIST4B Chicken histone H4 protein gene, complete cds 418 e-114
54ref|XM_425463.1| PREDICTED: Gallus gallus similar to germinal hi... 412 e-112
55ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi... 412 e-112
56emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 412 e-112
57ref|XM_425458.1| PREDICTED: Gallus gallus similar to germinal hi... 410 e-111
58gb|M74533.1|CHKHIST4A Chicken histone H4 protein gene, complete cds 410 e-111
59gb|M13377.1|MZEH4C7 Maize (Zea mays) histone H4 gene (H4C7), com... 404 e-109
60gb|M36659.1|MZEH4A Corn histone H4 (H4C13) gene, complete cds 404 e-109
61ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 402 e-109
62emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes 398 e-108
63gb|U37576.1|GGU37576 Gallus gallus histone H4-VIII gene, complet... 396 e-107
64gb|DQ213262.1| Taeniopygia guttata clone 0061P0011F09 histone 1 ... 373 e-100
65gb|J00866.1|CHKH43D8 Chicken histone H4 gene, clone pch3dr8 373 e-100
66ref|XM_849156.1| PREDICTED: Canis familiaris similar to germinal... 367 2e-98
67ref|XM_849188.1| PREDICTED: Canis familiaris similar to germinal... 361 1e-96
68ref|XM_849161.1| PREDICTED: Canis familiaris similar to germinal... 361 1e-96
69ref|XM_848746.1| PREDICTED: Canis familiaris similar to germinal... 361 1e-96
70ref|XM_545382.1| PREDICTED: Canis familiaris similar to germinal... 361 1e-96
71gb|BT017111.1| Zea mays clone EL01N0363F03.c mRNA sequence 359 6e-96
72gb|AY105603.1| Zea mays PCO094685 mRNA sequence 359 6e-96
73ref|XM_545387.2| PREDICTED: Canis familiaris similar to germinal... 357 2e-95
74ref|XM_848792.1| PREDICTED: Canis familiaris similar to germinal... 355 9e-95
75ref|XM_848870.1| PREDICTED: Canis familiaris similar to germinal... 353 4e-94
76gb|BT017112.1| Zea mays clone EL01N0363G04.c mRNA sequence 351 1e-93
77ref|XM_848834.1| PREDICTED: Canis familiaris similar to germinal... 347 2e-92
78emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his... 341 1e-90
79emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 341 1e-90
80gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist... 341 1e-90
81gb|AY158965.1| Mus musculus histone protein Hist1h4a gene, compl... 341 1e-90
82ref|NM_178192.1| Mus musculus histone 1, H4a (Hist1h4a), mRNA 339 5e-90
83ref|XM_849000.1| PREDICTED: Canis familiaris similar to germinal... 339 5e-90
84ref|NM_153173.1| Mus musculus histone 1, H4h (Hist1h4h), mRNA 337 2e-89
85gb|BC058529.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA... 337 2e-89
86gb|BC028550.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA... 337 2e-89
87gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 337 2e-89
88emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 337 2e-89
89gb|BC087952.1| Mus musculus histone 1, H4h, mRNA (cDNA clone MGC... 337 2e-89
90dbj|AK007642.1| Mus musculus 10 day old male pancreas cDNA, RIKE... 337 2e-89
91gb|AY158960.1| Mus musculus histone protein Hist1h4h gene, compl... 337 2e-89
92ref|NM_178193.1| Mus musculus histone 1, H4b (Hist1h4b), mRNA 327 2e-86
93dbj|AK016310.1| Mus musculus adult male testis cDNA, RIKEN full-... 327 2e-86
94gb|AY158964.1| Mus musculus histone protein Hist1h4b gene, compl... 327 2e-86
95emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 325 8e-86
96gb|AY158962.1| Mus musculus histone protein Hist1h4d gene, compl... 325 8e-86
97gb|AY158958.1| Mus musculus histone protein Hist1h4m gene, compl... 325 8e-86
98ref|NM_175657.1| Mus musculus histone 1, H4m (Hist1h4m), mRNA 323 3e-85
99ref|NM_175654.1| Mus musculus histone 1, H4d (Hist1h4d), mRNA 323 3e-85
100emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 319 5e-84
101dbj|AK139521.1| Mus musculus 2 cells egg cDNA, RIKEN full-length... 319 5e-84
102gb|BC096767.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG... 319 5e-84
103gb|AY158957.1| Mus musculus histone protein Hist1h4k gene, compl... 319 5e-84
104ref|NM_178211.1| Mus musculus histone 1, H4k (Hist1h4k), mRNA 319 5e-84
105ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (p... 317 2e-83
106gb|AY158961.1| Mus musculus histone protein Hist1h4f gene, compl... 317 2e-83
107ref|NM_175655.1| Mus musculus histone 1, H4f (Hist1h4f), mRNA 311 1e-81
108ref|NM_178210.1| Mus musculus histone 1, H4j (Hist1h4j), mRNA 311 1e-81
109gb|AY158956.1| Mus musculus histone protein Hist1h4j gene, compl... 311 1e-81
110gb|AF140034.1|AF140034 Phreatamoeba balamuthi histone H4 mRNA, c... 311 1e-81
111ref|XM_543797.1| PREDICTED: Canis familiaris similar to germinal... 305 8e-80
112emb|CR719166.2|CNS0GHUS Tetraodon nigroviridis full-length cDNA 305 8e-80
113emb|CR707537.2|CNS0G8VX Tetraodon nigroviridis full-length cDNA 305 8e-80
114emb|X13235.1|MMHIS412 Mouse histone H4 gene (clone 12) 305 8e-80
115dbj|AK010085.1| Mus musculus adult male tongue cDNA, RIKEN full-... 303 3e-79
116gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I... 301 1e-78
117gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 301 1e-78
118emb|X13236.1|MMHIS453 Mouse histone H4 gene 299 5e-78
119gb|BC052219.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC... 295 7e-77
120emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom... 295 7e-77
121gb|BC092144.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC... 295 7e-77
122ref|NM_175656.2| Mus musculus histone 1, H4i (Hist1h4i), mRNA 295 7e-77
123gb|AY158959.1| Mus musculus histone protein Hist1h4i gene, compl... 295 7e-77
124gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 293 3e-76
125gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 293 3e-76
126ref|NM_178208.1| Mus musculus histone 1, H4c (Hist1h4c), mRNA 287 2e-74
127emb|AJ249813.1|MAL249813 Mortierella alpina histone H3.2 and H4.... 287 2e-74
128gb|BC019757.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG... 287 2e-74
129dbj|AB179406.1| Macaca fascicularis testis cDNA clone: QtsA-1932... 287 2e-74
130dbj|AK011560.1| Mus musculus 10 days embryo whole body cDNA, RIK... 287 2e-74
131gb|AY158963.1| Mus musculus histone protein Hist1h4c gene, compl... 287 2e-74
132gb|BC062345.1| Homo sapiens cDNA clone IMAGE:6597408 281 1e-72
133ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 281 1e-72
134gb|BC100619.1| Rattus norvegicus germinal histone H4 gene, mRNA ... 281 1e-72
135gb|AY128664.1| Homo sapiens clone HIST1H4K histone H4 gene, comp... 281 1e-72
136gb|AY128663.1| Homo sapiens clone HIST1H4J histone H4 gene, comp... 281 1e-72
137ref|NM_022686.2| Rattus norvegicus germinal histone H4 gene (His... 281 1e-72
138emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A... 281 1e-72
139emb|X60484.1|HSH4EHIS H.sapiens H4/e gene for H4 histone 281 1e-72
140emb|X60483.1|HSH4DHIS H.sapiens H4/d gene for H4 histone 281 1e-72
141gb|BC017361.2| Homo sapiens cDNA clone MGC:29783 IMAGE:4647914, ... 281 1e-72
142gb|AY936209.1| Rattus norvegicus histone H4 variant H4-v.1 mRNA,... 281 1e-72
143gb|AF086564.1|HUMZE16D01 Homo sapiens full length insert cDNA cl... 281 1e-72
144ref|NM_021968.3| Homo sapiens histone 1, H4j (HIST1H4J), mRNA 280 4e-72
145ref|NM_003541.2| Homo sapiens histone 1, H4k (HIST1H4K), mRNA 280 4e-72
146emb|CR657174.2|CNS0F61O Tetraodon nigroviridis full-length cDNA 280 4e-72
147emb|CR657322.2|CNS0F65S Tetraodon nigroviridis full-length cDNA 280 4e-72
148gb|AY263810.1| Eucalyptus globulus histone H4 mRNA, complete cds 274 3e-70
149gb|DQ400915.1| Elaeis guineensis histone 4 mRNA, complete cds 272 1e-69
150gb|AF457966.1| Zea mays clone cho1c.pk003.e4, mRNA sequence 272 1e-69
151gb|BC016336.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC... 268 2e-68
152gb|AY128662.1| Homo sapiens clone HIST1H4I histone H4 gene, comp... 268 2e-68
153gb|BC075806.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC... 268 2e-68
154gb|BC066250.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC... 268 2e-68
155emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o... 268 2e-68
156emb|CR599017.1| full-length cDNA clone CS0DC001YE12 of Neuroblas... 268 2e-68
157gb|BC067497.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC... 268 2e-68
158ref|NG_000827.2| Homo sapiens genomic histone family microcluste... 268 2e-68
159ref|NM_003495.2| Homo sapiens histone 1, H4i (HIST1H4I), mRNA 268 2e-68
160dbj|AB000905.1| Homo sapiens DNA for H4 histone, complete cds 268 2e-68
161gb|AY389612.1| Hyacinthus orientalis unknown mRNA 266 7e-68
162ref|XM_976380.1| PREDICTED: Mus musculus similar to germinal his... 266 7e-68
163gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple... 266 7e-68
164ref|XM_225382.1| PREDICTED: Rattus norvegicus histone 1, H4m (pr... 266 7e-68
165gb|AY158967.1| Mus musculus histone protein Hist4h4 gene, comple... 266 7e-68
166gb|BC111813.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG... 266 7e-68
167ref|NM_175652.1| Mus musculus histone 4, H4 (Hist4h4), mRNA 266 7e-68
168gb|BC057955.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA... 264 3e-67
169emb|V00753.1|MMHI01 Mouse gene encoding the mouse histone H4 264 3e-67
170ref|NM_033596.1| Mus musculus histone 2, H4 (Hist2h4), mRNA 264 3e-67
171gb|AY158966.1| Mus musculus histone protein Hist2h4 gene, comple... 264 3e-67
172gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 264 3e-67
173gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 264 3e-67
174gb|BC051566.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG... 264 3e-67
175gb|BC114196.1| Bos taurus histone H4, mRNA (cDNA clone IMAGE:818... 260 4e-66
176gb|BC067496.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC... 260 4e-66
177ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H... 258 2e-65
178ref|XM_868981.1| PREDICTED: Bos taurus similar to germinal histo... 258 2e-65
179emb|AJ249812.1|MAL249812 Mortierella alpina H3.1 and H4.1 genes ... 258 2e-65
180gb|AY104535.1| Zea mays PCO094675 mRNA sequence 254 2e-64
181dbj|AK045187.1| Mus musculus 9.5 days embryo parthenogenote cDNA... 252 1e-63
182ref|XM_606749.2| PREDICTED: Bos taurus similar to germinal histo... 250 4e-63
183emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes 244 2e-61
184dbj|AB197150.1| Fragaria x ananassa mRNA for histone H4, partial... 240 4e-60
185ref|NM_001016869.2| Xenopus tropicalis hypothetical protein LOC5... 238 1e-59
186emb|CR848633.2| Xenopus tropicalis finished cDNA, clone TGas006m08 238 1e-59
187gb|M27433.1|RATHIS4G Rattus norvegicus histone H4 gene, complete... 236 6e-59
188gb|M28409.1|RATH1TH4T Rat testis-specific histone H1t and histon... 236 6e-59
189gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 228 1e-56
190ref|XM_227462.3| PREDICTED: Rattus norvegicus histone 2, H4 (pre... 228 1e-56
191ref|NM_210226.1| Eremothecium gossypii AER012Cp (AER012C), mRNA 228 1e-56
192ref|NG_001335.1| Homo sapiens genomic large histone family clust... 226 6e-56
193ref|NM_003538.3| Homo sapiens histone 1, H4a (HIST1H4A), mRNA 226 6e-56
194gb|AY128654.1| Homo sapiens clone HIST1H4A histone H4 gene, comp... 226 6e-56
195gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 226 6e-56
196gb|BC069654.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC... 226 6e-56
197gb|BC067495.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC... 226 6e-56
198emb|X00091.1|HSHISH4 Human histone H4 gene 226 6e-56
199gb|BC066248.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC... 226 6e-56
200gb|BC066249.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC... 226 6e-56
201emb|BX061454.1|CNS09JKY Single read from an extremity of a full-... 224 2e-55
202emb|BX057867.1|CNS09GTB Single read from an extremity of a full-... 224 2e-55
203emb|BX053174.1|CNS09D6Y Single read from an extremity of a full-... 224 2e-55
204emb|BX048034.1|CNS09986 Single read from an extremity of a full-... 224 2e-55
205emb|BX037780.1|CNS091BC Single read from an extremity of a full-... 224 2e-55
206emb|BX037779.1|CNS091BB Single read from an extremity of a full-... 224 2e-55
207emb|BX020583.1|CNS08O1N Single read from an extremity of a full-... 224 2e-55
208emb|BX009114.1|CNS08F72 Single read from an extremity of a full-... 224 2e-55
209ref|XM_306825.2| Anopheles gambiae str. PEST ENSANGP00000000125 ... 224 2e-55
210gb|BC078038.1| Xenopus laevis histone 1, H4l, mRNA (cDNA clone M... 222 9e-55
211ref|XM_595302.1| PREDICTED: Bos taurus similar to germinal histo... 222 9e-55
212gb|AC150544.3| Bos taurus BAC CH240-75C8 (Children's Hospital O... 218 1e-53
213emb|X60481.1|HSH4AHIS H.sapiens H4/a gene for H4 histone 218 1e-53
214emb|BX039313.1|CNS092HX Single read from an extremity of a full-... 216 5e-53
215emb|BX032921.1|CNS08XKD Single read from an extremity of a full-... 216 5e-53
216ref|XM_311439.2| Anopheles gambiae str. PEST ENSANGP00000018626 ... 216 5e-53
217gb|J00986.1|XELHIS4L xenopus laevis h4 histone mrna 216 5e-53
218ref|XM_604220.1| PREDICTED: Bos taurus similar to germinal histo... 214 2e-52
219gb|AY450353.1| Bos grunniens histone H4.1 mRNA, partial cds 214 2e-52
220emb|BX061529.1|CNS09JN1 Single read from an extremity of a full-... 214 2e-52
221emb|BX060419.1|CNS09IS7 Single read from an extremity of a full-... 214 2e-52
222emb|X00224.1|XLHIS4 Xenopus laevis H4 histone gene and flanking ... 214 2e-52
223ref|XM_601250.2| PREDICTED: Bos taurus similar to germinal histo... 210 3e-51
224emb|BX053210.1|CNS09D7Y Single read from an extremity of a full-... 210 3e-51
225emb|BX052400.1|CNS09CLG Single read from an extremity of a full-... 210 3e-51
226ref|XM_545396.2| PREDICTED: Canis familiaris similar to germinal... 208 1e-50
227emb|BX066856.1|CNS09NR0 Single read from an extremity of a full-... 208 1e-50
228emb|BX053099.1|CNS09D4V Single read from an extremity of a full-... 208 1e-50
229emb|BX047092.1|CNS098I0 Single read from an extremity of a full-... 208 1e-50
230emb|BX043671.1|CNS095UZ Single read from an extremity of a full-... 208 1e-50
231emb|BX036322.1|CNS0906U Single read from an extremity of a full-... 208 1e-50
232emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 208 1e-50
233ref|NM_173880.2| Bos taurus histone H4 (H4), mRNA 208 1e-50
234gb|AF001288.1|AF001288 Bos taurus histone H4.1 mRNA, complete cds 208 1e-50
235gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 208 1e-50
236ref|XM_602616.1| PREDICTED: Bos taurus similar to germinal histo... 206 5e-50
237emb|BX054530.1|CNS09E8M Single read from an extremity of a full-... 206 5e-50
238emb|BX047203.1|CNS098L3 Single read from an extremity of a full-... 206 5e-50
239gb|DQ066258.1| Ixodes scapularis isolate ISN-L-157 hist1h4i prot... 206 5e-50
240gb|J00987.1|XELHIS4LB x.laevis histone gene h4 and flanks 206 5e-50
241ref|NM_003546.2| Homo sapiens histone 1, H4l (HIST1H4L), mRNA 204 2e-49
242gb|AY128665.1| Homo sapiens clone HIST1H4L histone H4 gene, comp... 204 2e-49
243emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones 204 2e-49
244emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o... 204 2e-49
245emb|X83548.1|HSHISTN4 H.sapiens gene for histone H4 204 2e-49
246emb|CR542172.1| Homo sapiens full open reading frame cDNA clone ... 204 2e-49
247gb|BC069392.1| Homo sapiens histone 1, H4l, mRNA (cDNA clone MGC... 204 2e-49
248gb|BC019846.1| Homo sapiens cDNA clone IMAGE:5113140 202 8e-49
249ref|XM_520759.1| PREDICTED: Pan troglodytes similar to germinal ... 202 8e-49
250ref|NM_003548.2| Homo sapiens histone 2, H4 (HIST2H4), mRNA 202 8e-49
251ref|XM_513765.1| PREDICTED: Pan troglodytes LOC457262 (LOC457262... 202 8e-49
252ref|NM_001034077.3| Homo sapiens histone H4/o (H4/o), mRNA 202 8e-49
253gb|AF525682.1| Homo sapiens histone H4 (HIST2H4) gene, complete cds 202 8e-49
254gb|BC112193.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:1... 202 8e-49
255emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 202 8e-49
256emb|BX053377.1|CNS09DCL Single read from an extremity of a full-... 202 8e-49
257ref|XM_942850.1| PREDICTED: Homo sapiens similar to germinal his... 202 8e-49
258ref|XM_942844.1| PREDICTED: Homo sapiens similar to germinal his... 202 8e-49
259ref|XM_942841.1| PREDICTED: Homo sapiens similar to germinal his... 202 8e-49
260ref|XM_936503.1| PREDICTED: Homo sapiens similar to germinal his... 202 8e-49
261gb|BC093969.1| Homo sapiens histone 2, H4, mRNA (cDNA clone MGC:... 202 8e-49
262gb|BC108260.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:1... 202 8e-49
263ref|XM_527285.1| PREDICTED: Pan troglodytes similar to HIST1H3I ... 200 3e-48
264ref|XM_540284.1| PREDICTED: Canis familiaris similar to germinal... 200 3e-48
265emb|BX061455.1|CNS09JKZ Single read from an extremity of a full-... 200 3e-48
266dbj|AK133404.1| Mus musculus adult male testis cDNA, RIKEN full-... 200 3e-48
267ref|XM_870205.1| PREDICTED: Bos taurus similar to germinal histo... 198 1e-47
268emb|BX041120.1|CNS093W4 Single read from an extremity of a full-... 198 1e-47
269ref|XM_950909.1| Neurospora crassa OR74A HISTONE H4 (NCU01634.1)... 196 5e-47
270ref|XM_328072.1| Neurospora crassa OR74A HISTONE H4 (NCU01634.1)... 196 5e-47
271emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for hist... 196 5e-47
272gb|AY890621.1| Synthetic construct Homo sapiens clone FLH141160.... 196 5e-47
273emb|Z46226.1|HTHISH4 H.tubulosa gene encoding histone H4 194 2e-46
274emb|BX061530.1|CNS09JN2 Single read from an extremity of a full-... 192 8e-46
275gb|AY893103.1| Synthetic construct Homo sapiens clone FLH141156.... 192 8e-46
276ref|XM_315129.2| Anopheles gambiae str. PEST ENSANGP00000015255 ... 192 8e-46
277gb|AY648850.1| Homo sapiens histone H4/o gene, complete cds 190 3e-45
278gb|AY128653.1| Homo sapiens clone HIST4H4 histone H4 gene, compl... 190 3e-45
279gb|AC010168.6| Homo sapiens 12p12-31.7-32.2 BAC RP11-174G6 (Rose... 190 3e-45
280ref|NM_175054.2| Homo sapiens histone 4, H4 (HIST4H4), mRNA 190 3e-45
281gb|BC020884.1| Homo sapiens histone 4, H4, mRNA (cDNA clone MGC:... 190 3e-45
282ref|XM_527602.1| PREDICTED: Pan troglodytes similar to germinal ... 188 1e-44
283ref|NM_003540.3| Homo sapiens histone 1, H4f (HIST1H4F), mRNA 188 1e-44
284gb|AY128659.1| Homo sapiens clone HIST1H4F histone H4 gene, comp... 188 1e-44
285emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o... 188 1e-44
286gb|BC093765.1| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC... 188 1e-44
287gb|BC093763.1| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC... 188 1e-44
288gb|M60749.1|HUMHISAD Human histone H4 (H4) gene, complete cds 188 1e-44
289gb|BC069288.1| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC... 188 1e-44
290emb|BX047204.1|CNS098L4 Single read from an extremity of a full-... 186 5e-44
291emb|X77806.1|PSHISTH4 P.salina histone H4 gene 186 5e-44
292gb|AY675260.1| Gallus gallus histone H4 gene, partial cds 186 5e-44
293gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H... 186 5e-44
294emb|BX057868.1|CNS09GTC Single read from an extremity of a full-... 184 2e-43
295emb|X13554.1|RNH4G Rat H4 gene for somatic histone H4 184 2e-43
296dbj|AK016178.1| Mus musculus adult male testis cDNA, RIKEN full-... 184 2e-43
297gb|J00985.1|XELHIS4B Xenopus borealis h4 histone mRNA 184 2e-43
298ref|XM_595652.2| PREDICTED: Bos taurus similar to germinal histo... 182 8e-43
299emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 wi... 178 1e-41
300gb|M21286.1|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 gene... 178 1e-41
301emb|BX032922.1|CNS08XKE Single read from an extremity of a full-... 176 5e-41
302emb|AJ626748.1| Oikopleura dioica mRNA for histone H4.2 176 5e-41
303ref|XM_578415.1| PREDICTED: Rattus norvegicus similar to germina... 176 5e-41
304ref|XM_575704.1| PREDICTED: Rattus norvegicus similar to germina... 176 5e-41
305ref|XM_307600.2| Anopheles gambiae str. PEST ENSANGP00000016197 ... 176 5e-41
306gb|AF007904.1|CVHIST2 Chaetopterus variopedatus histone H4 and h... 176 5e-41
307emb|X04652.1|MMHISH4S Mouse histone H4 gene 3' region with signa... 176 5e-41
308gb|M16707.1|HUMHIS4 Human histone H4 gene, complete cds, clone F... 176 5e-41
309ref|XM_865919.1| PREDICTED: Bos taurus similar to germinal histo... 174 2e-40
310emb|BX054531.1|CNS09E8N Single read from an extremity of a full-... 172 7e-40
311emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for h... 172 7e-40
312ref|XM_703205.1| PREDICTED: Danio rerio similar to germinal hist... 172 7e-40
313ref|XM_605779.2| PREDICTED: Bos taurus similar to germinal histo... 170 3e-39
314ref|XM_597168.2| PREDICTED: Bos taurus similar to germinal histo... 170 3e-39
315ref|XM_869215.1| PREDICTED: Bos taurus similar to germinal histo... 170 3e-39
316ref|NM_214550.1| Strongylocentrotus purpuratus late histone gene... 170 3e-39
317emb|X06641.1|SPH4L2 Strongylocentrotus purpuratus late histone g... 170 3e-39
318gb|BT015217.1| Drosophila melanogaster RE42129 full insert cDNA 168 1e-38
319gb|AY559151.1| Truncatellina cylindrica histone H3 and histone H... 168 1e-38
320emb|BX055407.1|CNS09EWZ Single read from an extremity of a full-... 168 1e-38
321emb|AJ626751.1| Oikopleura dioica mRNA for histone H4.5 168 1e-38
322ref|NM_169593.1| Drosophila melanogaster Histone H4 replacement ... 168 1e-38
323ref|NM_169592.1| Drosophila melanogaster Histone H4 replacement ... 168 1e-38
324ref|NM_079628.2| Drosophila melanogaster Histone H4 replacement ... 168 1e-38
325gb|BT001842.1| Drosophila melanogaster RH52884 full insert cDNA 168 1e-38
326emb|X00038.1|HSHIH4 Human H4 histone gene 168 1e-38
327ref|XM_871414.1| PREDICTED: Bos taurus similar to germinal histo... 167 5e-38
328ref|XM_322297.1| Neurospora crassa OR74A hypothetical protein ( ... 167 5e-38
329ref|XM_951504.1| Neurospora crassa OR74A hypothetical protein ( ... 167 5e-38
330emb|X97438.1|DMHISH4 D.melanogaster mRNA for histone H4 167 5e-38
331gb|AY559154.1| Columella edentula isolate 15 histone H3 and hist... 165 2e-37
332emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ... 165 2e-37
333ref|XM_681121.1| PREDICTED: Danio rerio similar to germinal hist... 165 2e-37
334ref|XM_608100.2| PREDICTED: Bos taurus similar to germinal histo... 163 7e-37
335emb|BX057964.1|CNS09GW0 Single read from an extremity of a full-... 163 7e-37
336emb|X15142.1|PPHISH41 Physarum polycephalum H41 gene for histone... 163 7e-37
337emb|X00449.1|PPHI01 Physarum polycephalum histone H4 gene 163 7e-37
338gb|AC084653.1|CBRG45O14 Caenorhabditis briggsae cosmid G45O14, c... 163 7e-37
339ref|NM_214551.1| Strongylocentrotus purpuratus late histone gene... 163 7e-37
340emb|X06639.1|SPH4L1 Strongylocentrotus purpuratus late histone g... 163 7e-37
341gb|AY389648.1| Hyacinthus orientalis histone H4 mRNA, complete cds 161 3e-36
342emb|AJ626750.1| Oikopleura dioica mRNA for histone H4.4 161 3e-36
343emb|AJ494855.1|ODI494855 Oikopleura dioica partial mRNA for hist... 161 3e-36
344emb|X52393.1|TCH3H4 Tigriopus californicus DNA for histone H3 an... 159 1e-35
345gb|M84797.1|TIGH1234A Tigriopus californicus histone H1 gene, co... 159 1e-35
346gb|AY559153.1| Columella edentula isolate 48 histone H3 and hist... 157 4e-35
347ref|XM_569504.1| Cryptococcus neoformans var. neoformans JEC21 h... 157 4e-35
348emb|X01611.1|NCHISH4 Neurospora crassa DNA for histone H4 157 4e-35
349emb|AL670001.1|NCB14H13 Neurospora crassa DNA linkage group II B... 157 4e-35
350emb|AL670543.1|NCB7K22 Neurospora crassa DNA linkage group II BA... 157 4e-35
351gb|AY062173.1| Neurospora crassa histone H3 (hh3) and histone H4... 157 4e-35
352gb|AY062172.1| Neurospora crassa histone H4 (hh4-2) gene, comple... 157 4e-35
353emb|Z61847.1|HS59H5F H.sapiens CpG island DNA genomic Mse1 fragm... 157 4e-35
354ref|NM_003539.3| Homo sapiens histone 1, H4d (HIST1H4D), mRNA 155 2e-34
355gb|AY128657.1| Homo sapiens clone HIST1H4D histone H4 gene, comp... 155 2e-34
356emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro... 155 2e-34
357emb|X60482.1|HSH4BHIS H.sapiens H4/b gene for H4 histone 155 2e-34
358emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene 155 2e-34
359ref|XM_753764.1| Ustilago maydis 521 histone H4 (UM02710.1) part... 153 7e-34
360emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic ... 153 7e-34
361ref|NM_214548.1| Strongylocentrotus purpuratus late embryonic hi... 153 7e-34
362gb|AY675261.1| Coturnix japonica histone H4 gene, partial cds 153 7e-34
363ref|XM_594900.2| PREDICTED: Bos taurus similar to germinal histo... 151 3e-33
364emb|Y16588.1|PLY16588 Paracentrotus lividus histone H4 gene, ear... 151 3e-33
365emb|Y16587.1|PLY16587 Paracentrotus lividus histone H4 gene, par... 151 3e-33
366emb|BX045468.1|CNS0978W Single read from an extremity of a full-... 149 1e-32
367emb|X91511.1|DPINH41 D.pini mRNA for histone H4, isoforme 1 149 1e-32
368dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 149 1e-32
369gb|AF297469.1|AF297469 Schistosoma mansoni strain LE histone H4 ... 149 1e-32
370emb|BX066857.1|CNS09NR1 Single read from an extremity of a full-... 147 4e-32
371emb|BX060420.1|CNS09IS8 Single read from an extremity of a full-... 147 4e-32
372ref|XM_578442.1| PREDICTED: Rattus norvegicus similar to germina... 147 4e-32
373gb|AY936210.1| Rattus norvegicus pro-histogranin mRNA, complete cds 147 4e-32
374dbj|AB033943.1| Aspergillus oryzae mRNA for histone H4, complete... 147 4e-32
375ref|XM_527254.1| PREDICTED: Pan troglodytes similar to HIST2H3C ... 145 2e-31
376gb|AY128655.1| Homo sapiens clone HIST1H4B histone H4 gene, comp... 145 2e-31
377emb|X97437.1|DMH4R D.melanogaster H4r gene 145 2e-31
378emb|X67081.1|HSH4HIST H.sapiens histone H4 gene 145 2e-31
379emb|AJ626749.1| Oikopleura dioica mRNA for histone H4.3 145 2e-31
380ref|XM_702708.1| PREDICTED: Danio rerio similar to germinal hist... 145 2e-31
381ref|XM_680087.1| PREDICTED: Danio rerio similar to germinal hist... 145 2e-31
382gb|AC007809.8|AC007809 Drosophila melanogaster, chromosome 3R, r... 145 2e-31
383gb|AE003705.3| Drosophila melanogaster chromosome 3R, section 43... 145 2e-31
384ref|XM_654938.1| Aspergillus nidulans FGSC A4 histone H4.2 (AN24... 143 7e-31
385ref|NM_003544.2| Homo sapiens histone 1, H4b (HIST1H4B), mRNA 143 7e-31
386ref|XM_568101.1| Cryptococcus neoformans var. neoformans JEC21 h... 143 7e-31
387emb|BX036319.1|CNS0906R Single read from an extremity of a full-... 143 7e-31
388gb|BC069467.1| Homo sapiens histone 1, H4b, mRNA (cDNA clone MGC... 143 7e-31
389dbj|AB050889.1| Citrus jambhiri mRNA for histone H4, partial cds 143 7e-31
390gb|AY559152.1| Columella edentula isolate 1 histone H3 and histo... 141 3e-30
391emb|X55550.1|ANH4GE A.nidulans gene for core histone H4.2 141 3e-30
392emb|X54078.1|TNHISTH4 T.nilotica gene for histone H4 141 3e-30
393gb|AF361948.1| Eimeria tenella histone 4 (H4) gene, complete cds 141 3e-30
394gb|U12631.1|ENU12631 Emericella nidulans R153 core histone H4.2 ... 141 3e-30
395emb|BX069194.1|CNS09PJY Single read from an extremity of a full-... 139 1e-29
396ref|XM_687122.1| PREDICTED: Danio rerio similar to germinal hist... 139 1e-29
397emb|AJ314735.1|CSP314735 Colletotrichum sp. partial H4 gene, exo... 139 1e-29
398emb|AJ314731.1|CAC314731 Colletotrichum acutatum partial H4 gene... 139 1e-29
399gb|AC084502.1|CBRG14F21 Caenorhabditis briggsae cosmid G14F21, c... 137 4e-29
400gb|AY675269.1| Marmota monax histone H4 gene, partial cds 137 4e-29
401emb|X55549.1|ANH4GENE A.nidulans gene for core histone H4.1 135 2e-28
402emb|CR858191.1| Pongo pygmaeus mRNA; cDNA DKFZp469B0137 (from cl... 135 2e-28
403gb|U12630.1|ENU12630 Emericella nidulans R153 core histone H3 (H... 135 2e-28
404ref|XM_653246.1| Aspergillus nidulans FGSC A4 histone H4 (AN0734... 133 6e-28
405gb|M36923.1|PALH49A P.lividus H4 histone, clone h19 133 6e-28
406emb|BX047093.1|CNS098I1 Single read from an extremity of a full-... 131 2e-27
407ref|XM_701706.1| PREDICTED: Danio rerio similar to germinal hist... 131 2e-27
408ref|XM_677902.1| PREDICTED: Danio rerio similar to germinal hist... 131 2e-27
409emb|AJ314734.1|CSP314734 Colletotrichum sp. partial H4 gene, exo... 131 2e-27
410emb|AJ314733.1|CSP314733 Colletotrichum sp. partial H4 gene, exo... 131 2e-27
411emb|AJ314727.1|CSP314727 Colletotrichum sp. partial H4 gene, exo... 131 2e-27
412emb|AJ314724.1|CSP314724 Colletotrichum sp. partial H4 gene, exo... 131 2e-27
413emb|AJ314723.1|CAC314723 Colletotrichum acutatum partial H4 gene... 131 2e-27
414emb|AJ132597.1|DME132597 Drosophila melanogaster H4r gene,3'-fla... 131 2e-27
415ref|XM_684085.1| PREDICTED: Danio rerio similar to germinal hist... 129 1e-26
416ref|XM_688078.1| PREDICTED: Danio rerio similar to germinal hist... 129 1e-26
417gb|AC084589.1|CBRG41K24 Caenorhabditis briggsae cosmid G41K24, c... 129 1e-26
418gb|AY675264.1| Vulpes zerda histone H4 gene, partial cds 129 1e-26
419gb|AY675263.1| Felis catus histone H4 gene, partial cds 129 1e-26
420emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 129 1e-26
421gb|DQ445629.1| Giardia intestinalis strain WP clone 1267 histone... 127 4e-26
422dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012 127 4e-26
423ref|XM_518290.1| PREDICTED: Pan troglodytes similar to germinal ... 125 2e-25
424ref|XM_369778.1| Magnaporthe grisea 70-15 hypothetical protein (... 125 2e-25
425ref|XM_871249.1| PREDICTED: Bos taurus similar to germinal histo... 123 6e-25
426ref|XM_607251.2| PREDICTED: Bos taurus similar to germinal histo... 123 6e-25
427ref|XM_609250.2| PREDICTED: Bos taurus similar to germinal histo... 123 6e-25
428emb|BX039314.1|CNS092HY Single read from an extremity of a full-... 123 6e-25
429ref|XM_684447.1| PREDICTED: Danio rerio similar to germinal hist... 123 6e-25
430ref|XM_682981.1| PREDICTED: Danio rerio similar to germinal hist... 123 6e-25
431ref|XM_687827.1| PREDICTED: Danio rerio similar to germinal hist... 123 6e-25
432dbj|AB183301.1| Lactuca sativa LetH4 mRNA for histone H4, partia... 123 6e-25
433emb|AJ314730.1|CAC314730 Colletotrichum acutatum partial H4 gene... 123 6e-25
434emb|AJ314729.1|CAC314729 Colletotrichum acutatum partial H4 gene... 123 6e-25
435emb|AJ314725.1|CSP314725 Colletotrichum sp. partial H4 gene, exo... 123 6e-25
436emb|X01343.1|PMHISH4 Psammechinus miliaris gene for histone H4 (... 123 6e-25
437gb|M10556.1|SUPHISB1 P.miliaris histone H4 gene, clone h19, comp... 123 6e-25
438ref|NM_125390.3| Arabidopsis thaliana DNA binding AT5G59970 mRNA... 121 2e-24
439ref|XM_601239.2| PREDICTED: Bos taurus similar to germinal histo... 121 2e-24
440emb|BX833385.1|CNS0A0GW Arabidopsis thaliana Full-length cDNA Co... 121 2e-24
441gb|BT004970.1| Arabidopsis thaliana clone U20714 putative histon... 121 2e-24
442gb|BT003931.1| Arabidopsis thaliana clone RAFL15-21-O07 (R20714)... 121 2e-24
443gb|AY087061.1| Arabidopsis thaliana clone 31173 mRNA, complete s... 121 2e-24
444dbj|AB015475.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 121 2e-24
445gb|AY675265.1| Canis familiaris histone H4 gene, partial cds 121 2e-24
446gb|M32426.1|SUSH4AA S.purpuratus H4 histone mRNA, complete cds 121 2e-24
447ref|XM_385667.1| Gibberella zeae PH-1 chromosome 3 H4_NEUCR Hist... 119 9e-24
448dbj|AB226301.1| Aspergillus oryzae cDNA, contig sequence: AoEST3163 119 9e-24
449ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2a... 117 4e-23
450ref|XM_871144.1| PREDICTED: Bos taurus similar to germinal histo... 117 4e-23
451ref|XM_384465.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 117 4e-23
452ref|XM_600437.2| PREDICTED: Bos taurus similar to germinal histo... 115 1e-22
453gb|AY559155.1| Pupilla muscorum histone H3 and histone H4 genes,... 115 1e-22
454gb|AY559147.1| Trichia villosa histone H3 and histone H4 genes, ... 115 1e-22
455emb|AJ646896.1| Ustilago maydis h4 gene for histone 4, exons 1-2 115 1e-22
456emb|BX052401.1|CNS09CLH Single read from an extremity of a full-... 115 1e-22
457emb|CR542187.1| Homo sapiens full open reading frame cDNA clone ... 115 1e-22
458emb|Z63591.1|HS87F10F H.sapiens CpG island DNA genomic Mse1 frag... 115 1e-22
459emb|Z61848.1|HS59H5R H.sapiens CpG island DNA genomic Mse1 fragm... 115 1e-22
460gb|M17133.1|ATHH4GB A.thaliana histone H4 gene, complete cds 115 1e-22
461emb|Z73102.1|CEB0035 Caenorhabditis elegans Cosmid B0035, comple... 113 6e-22
462emb|Z82271.1|CEF54E12 Caenorhabditis elegans Cosmid F54E12, comp... 113 6e-22
463ref|XM_683555.1| PREDICTED: Danio rerio similar to germinal hist... 113 6e-22
464ref|NM_069738.1| Caenorhabditis elegans HIStone family member (h... 113 6e-22
465ref|NM_069732.1| Caenorhabditis elegans HIStone family member (h... 113 6e-22
466dbj|D10397.1|RICT127 Oryza sativa mRNA for histone H4 (T127 gene... 113 6e-22
467gb|AY675272.1| Mus musculus histone H4 gene, partial cds 113 6e-22
468gb|J00988.1|XELHIS4Z1 xenopus laevis histone 4 mrna (gene h4), a... 113 6e-22
469gb|J00189.1|HUMHIS4A2 human histone gene h4a segment 2 113 6e-22
470gb|BC010926.1| Homo sapiens histone 1, H4h, mRNA (cDNA clone MGC... 111 2e-21
471ref|NM_003543.3| Homo sapiens histone 1, H4h (HIST1H4H), mRNA 111 2e-21
472gb|AY128661.1| Homo sapiens clone HIST1H4H histone H4 gene, comp... 111 2e-21
473emb|AL021917.4|HS45P21 Human DNA sequence from clone RP1-45P21 o... 111 2e-21
474emb|X60487.1|HSH4HHIS H.sapiens H4/h gene for H4 histone 111 2e-21
475emb|CR542169.1| Homo sapiens full open reading frame cDNA clone ... 111 2e-21
476emb|X95689.1|ACHISTOH4 A.cepa mRNA for histone H4 111 2e-21
477emb|AJ314736.1|CSP314736 Colletotrichum sp. partial H4 gene, exo... 111 2e-21
478gb|AY559170.1| Vallonia excentrica isolate 23 histone H3 and his... 109 9e-21
479gb|AY559169.1| Vallonia excentrica isolate 17 histone H3 and his... 109 9e-21
480gb|AY559168.1| Vallonia pulchella isolate 9 histone H3 and histo... 109 9e-21
481gb|AY559167.1| Vallonia pulchella isolate 55 histone H3 and hist... 109 9e-21
482gb|AY559166.1| Vallonia enniensis histone H3 and histone H4 gene... 109 9e-21
483emb|V01355.1|SPHIH4 Sea urchin gene for histone H4 109 9e-21
484emb|X97436.1|DHHISH4 D.hydei mRNA for histone H4 109 9e-21
485ref|NM_214542.1| Strongylocentrotus purpuratus H4 histone protei... 109 9e-21
486gb|AY675274.1| Lonchura domestica histone H4 gene, partial cds 109 9e-21
487gb|AY675279.1| Suricata suricatta histone H4 gene, partial cds 109 9e-21
488ref|NM_100639.1| Arabidopsis thaliana DNA binding AT1G07660 mRNA... 107 4e-20
489ref|NM_125361.2| Arabidopsis thaliana DNA binding AT5G59690 mRNA... 107 4e-20
490ref|XM_368084.1| Magnaporthe grisea 70-15 chromosome VI hypothet... 107 4e-20
491gb|AY559165.1| Vallonia costata histone H3 and histone H4 genes,... 107 4e-20
492gb|AY124836.1| Arabidopsis thaliana AT5g59690/mth12_90 mRNA, com... 107 4e-20
493ref|XM_683785.1| PREDICTED: Danio rerio similar to germinal hist... 107 4e-20
494gb|AY057609.1| Arabidopsis thaliana AT5g59690/mth12_90 mRNA, com... 107 4e-20
495gb|AF334729.1| Arabidopsis thaliana clone C00146 (f) putative hi... 107 4e-20
496gb|AF325058.2|AF325058 Arabidopsis thaliana AT5g59690 (AT5g59690... 107 4e-20
497gb|AY085495.1| Arabidopsis thaliana clone 15418 mRNA, complete s... 107 4e-20
498gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 ... 107 4e-20
499dbj|AK176147.1| Arabidopsis thaliana mRNA for histone H4, comple... 107 4e-20
500dbj|AK175843.1| Arabidopsis thaliana mRNA for histone H4, comple... 107 4e-20

>gb|BT009488.1| Triticum aestivum clone wr1.pk0058.g3:fis, full insert mRNA sequence
          Length = 1768

 Score =  561 bits (283), Expect = e-157
 Identities = 348/367 (94%), Gaps = 2/367 (0%)
 Strand = Plus / Minus

                                                                        
Query: 122  ggaatctgcaggcggcgacgaagactggcgac-gacg-aggggcctagccgccgaatccg 179
            ||||||||||||||||||| ||||| | |||| | || | || ||||||||||||| |||
Sbjct: 1644 ggaatctgcaggcggcgacaaagaccgacgaccgtcggacggccctagccgccgaagccg 1585

                                                                        
Query: 180  tagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttg 239
            ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 1584 tagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggccgtgacggtcttg 1525

                                                                        
Query: 240  cggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttg 299
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1524 cggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttg 1465

                                                                        
Query: 300  aggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctc 359
            || |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
Sbjct: 1464 agcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccccgccgc 1405

                                                                        
Query: 360  gccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccgg 419
            ||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1404 gccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccgg 1345

                                                                        
Query: 420  tggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccggacatggct 479
            |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||
Sbjct: 1344 tggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcggccggacatggct 1285

                   
Query: 480  gacgatc 486
            |||||||
Sbjct: 1284 gacgatc 1278



to top

>emb|X00043.1|TAHI01 Wheat histone H4 gene
          Length = 1200

 Score =  519 bits (262), Expect = e-144
 Identities = 307/322 (95%)
 Strand = Plus / Minus

                                                                        
Query: 165  tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
            ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1046 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 987

                                                                        
Query: 225  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 986  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcatcgcggatgacgttc 927

                                                                        
Query: 285  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 926  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 867

                                                                        
Query: 345  acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
            |||||||||| || |||||| || ||||| |||||||||||||||||||||||||| |||
Sbjct: 866  acgccgccccgccgcgccagccgccggatcgccggcttggtgatgccctggatgttatcg 807

                                                                        
Query: 405  cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
            || || |||||||||||||||||||||||||||||||| || ||||||||||||||||||
Sbjct: 806  cggaggaccttccggtggcgcttggcgccgcccttgcctaggcccttgcctcccttgccg 747

                                  
Query: 465  cgcccggacatggctgacgatc 486
            |||||||||||||| |||||||
Sbjct: 746  cgcccggacatggccgacgatc 725



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 122  ggaatctgcaggcggcgacgaaga 145
            ||||||||||||||||||| ||||
Sbjct: 1096 ggaatctgcaggcggcgacaaaga 1073



to top

>gb|AC108500.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1280_A04,
            complete sequence
          Length = 88553

 Score =  517 bits (261), Expect = e-143
 Identities = 300/313 (95%)
 Strand = Plus / Plus

                                                                        
Query: 166  agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
            |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 4260 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 4319

                                                                        
Query: 226  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4320 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 4379

                                                                        
Query: 286  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
            |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 4380 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 4439

                                                                        
Query: 346  cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
            ||||||||||||||||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 4440 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 4499

                                                                        
Query: 406  gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
            | |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 4500 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 4559

                         
Query: 466  gcccggacatggc 478
            |||| ||||||||
Sbjct: 4560 gccccgacatggc 4572



 Score =  143 bits (72), Expect = 7e-31
 Identities = 183/220 (83%)
 Strand = Plus / Plus

                                                                         
Query: 180   tagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttg 239
             |||| |||||| |||||  |||||||||| || ||||| ||||||||  |||| ||||||
Sbjct: 11298 tagatggtgcggccctgaagcttgagcgcatatacgacatccatggccatgacagtcttg 11357

                                                                         
Query: 240   cggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttg 299
             ||| | || |||||||||||||| | ||| |||| |||||| |||| ||||||||||| |
Sbjct: 11358 cggtgagcatgctcggtgtaggtaatggcatcgcagatgacattcttgaggaagatctcg 11417

                                                                         
Query: 300   aggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctc 359
             || ||||| || ||||| | |||||| | ||| ||||||||||||||||| ||| |||| 
Sbjct: 11418 agcacgccacgagtctctttgtagatcaaccctgagatgcgcttcacgccacccttcctt 11477

                                                     
Query: 360   gccaggcgacggatggccggcttggtgatgccctggatgt 399
             || ||||| |||||  ||||||||| |||||| |||||||
Sbjct: 11478 gcaaggcgtcggatcaccggcttggcgatgccttggatgt 11517



to top

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
             complete sequence
          Length = 93826

 Score =  517 bits (261), Expect = e-143
 Identities = 300/313 (95%)
 Strand = Plus / Plus

                                                                         
Query: 166   agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
             |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 86772 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 86831

                                                                         
Query: 226   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86832 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 86891

                                                                         
Query: 286   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
             |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 86892 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 86951

                                                                         
Query: 346   cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
             ||||||||||||||||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 86952 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 87011

                                                                         
Query: 406   gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
             | |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 87012 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 87071

                          
Query: 466   gcccggacatggc 478
             |||| ||||||||
Sbjct: 87072 gccccgacatggc 87084



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  517 bits (261), Expect = e-143
 Identities = 300/313 (95%)
 Strand = Plus / Plus

                                                                            
Query: 166      agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
                |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 22591722 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 22591781

                                                                            
Query: 226      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22591782 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 22591841

                                                                            
Query: 286      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
                |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 22591842 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 22591901

                                                                            
Query: 346      cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
                ||||||||||||||||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 22591902 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 22591961

                                                                            
Query: 406      gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
                | |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 22591962 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 22592021

                             
Query: 466      gcccggacatggc 478
                |||| ||||||||
Sbjct: 22592022 gccccgacatggc 22592034



 Score =  502 bits (253), Expect = e-139
 Identities = 298/313 (95%)
 Strand = Plus / Minus

                                                                            
Query: 166      agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
                |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 22758369 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 22758310

                                                                            
Query: 226      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22758309 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 22758250

                                                                            
Query: 286      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
                |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 22758249 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 22758190

                                                                            
Query: 346      cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
                ||||||||||||| ||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 22758189 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 22758130

                                                                            
Query: 406      gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
                | |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 22758129 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 22758070

                             
Query: 466      gcccggacatggc 478
                |||| ||||||||
Sbjct: 22758069 gccccgacatggc 22758057



 Score =  143 bits (72), Expect = 7e-31
 Identities = 183/220 (83%)
 Strand = Plus / Plus

                                                                            
Query: 180      tagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttg 239
                |||| |||||| |||||  |||||||||| || ||||| ||||||||  |||| ||||||
Sbjct: 22598760 tagatggtgcggccctgaagcttgagcgcatatacgacatccatggccatgacagtcttg 22598819

                                                                            
Query: 240      cggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttg 299
                ||| | || |||||||||||||| | ||| |||| |||||| |||| ||||||||||| |
Sbjct: 22598820 cggtgagcatgctcggtgtaggtaatggcatcgcagatgacattcttgaggaagatctcg 22598879

                                                                            
Query: 300      aggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctc 359
                || ||||| || ||||| | |||||| | ||| ||||||||||||||||| ||| |||| 
Sbjct: 22598880 agcacgccacgagtctctttgtagatcaaccctgagatgcgcttcacgccacccttcctt 22598939

                                                        
Query: 360      gccaggcgacggatggccggcttggtgatgccctggatgt 399
                || ||||| |||||  ||||||||| |||||| |||||||
Sbjct: 22598940 gcaaggcgtcggatcaccggcttggcgatgccttggatgt 22598979



to top

>dbj|AK105816.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-C11, full
           insert sequence
          Length = 588

 Score =  517 bits (261), Expect = e-143
 Identities = 300/313 (95%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 414 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 355

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 354 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 295

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 294 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 235

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||||||||||||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 234 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 175

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 174 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 115

                        
Query: 466 gcccggacatggc 478
           |||| ||||||||
Sbjct: 114 gccccgacatggc 102



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  515 bits (260), Expect = e-143
 Identities = 305/320 (95%)
 Strand = Plus / Minus

                                                                           
Query: 166     agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
               |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 1060862 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 1060803

                                                                           
Query: 226     cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1060802 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 1060743

                                                                           
Query: 286     cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
               |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 1060742 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 1060683

                                                                           
Query: 346     cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
               ||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||
Sbjct: 1060682 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 1060623

                                                                           
Query: 406     gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
               |||||||||||| ||| ||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 1060622 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 1060563

                                   
Query: 466     gcccggacatggctgacgat 485
               | || |||||||||||||||
Sbjct: 1060562 ggcccgacatggctgacgat 1060543



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 82/96 (85%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                            
Query: 248      gtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgaggacgcc 307
                |||||||||||||||||| | ||||  | ||||||||| ||||||||||||||  |||||
Sbjct: 25649298 gtgctcggtgtaggtgacagtgtcgtaggtgacgttcttgaggaagatcttgatcacgcc 25649239

                                                    
Query: 308      gcgggtctcctcgtagatgagccccgagatgcgctt 343
                 |  || ||||||||||||||||  |||||||||||
Sbjct: 25649238 acatgt-tcctcgtagatgagcctggagatgcgctt 25649204



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  515 bits (260), Expect = e-143
 Identities = 305/320 (95%)
 Strand = Plus / Minus

                                                                           
Query: 166     agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
               |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 1060860 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 1060801

                                                                           
Query: 226     cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1060800 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 1060741

                                                                           
Query: 286     cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
               |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 1060740 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 1060681

                                                                           
Query: 346     cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
               ||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||
Sbjct: 1060680 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 1060621

                                                                           
Query: 406     gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
               |||||||||||| ||| ||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 1060620 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 1060561

                                   
Query: 466     gcccggacatggctgacgat 485
               | || |||||||||||||||
Sbjct: 1060560 ggcccgacatggctgacgat 1060541



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 82/96 (85%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                            
Query: 248      gtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgaggacgcc 307
                |||||||||||||||||| | ||||  | ||||||||| ||||||||||||||  |||||
Sbjct: 25740607 gtgctcggtgtaggtgacagtgtcgtaggtgacgttcttgaggaagatcttgatcacgcc 25740548

                                                    
Query: 308      gcgggtctcctcgtagatgagccccgagatgcgctt 343
                 |  || ||||||||||||||||  |||||||||||
Sbjct: 25740547 acatgt-tcctcgtagatgagcctggagatgcgctt 25740513



to top

>gb|AC118980.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1263H11,
             complete sequence
          Length = 126827

 Score =  515 bits (260), Expect = e-143
 Identities = 305/320 (95%)
 Strand = Plus / Minus

                                                                         
Query: 166   agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
             |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 81077 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 81018

                                                                         
Query: 226   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 81017 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 80958

                                                                         
Query: 286   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
             |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 80957 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 80898

                                                                         
Query: 346   cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
             ||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||
Sbjct: 80897 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 80838

                                                                         
Query: 406   gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
             |||||||||||| ||| ||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 80837 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 80778

                                 
Query: 466   gcccggacatggctgacgat 485
             | || |||||||||||||||
Sbjct: 80777 ggcccgacatggctgacgat 80758



to top

>dbj|AK058741.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-G08, full
           insert sequence
          Length = 526

 Score =  515 bits (260), Expect = e-143
 Identities = 305/320 (95%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 377 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 318

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 317 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 258

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 257 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 198

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||
Sbjct: 197 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 138

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||||||||||| ||| ||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 137 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 78

                               
Query: 466 gcccggacatggctgacgat 485
           | || |||||||||||||||
Sbjct: 77  ggcccgacatggctgacgat 58



to top

>ref|XM_475383.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  511 bits (258), Expect = e-142
 Identities = 297/310 (95%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||||||||||||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 130 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 71

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 70  ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 11

                     
Query: 466 gcccggacat 475
           |||| |||||
Sbjct: 10  gccccgacat 1



to top

>gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009E21,
              complete sequence
          Length = 153214

 Score =  502 bits (253), Expect = e-139
 Identities = 298/313 (95%)
 Strand = Plus / Minus

                                                                          
Query: 166    agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
              |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 113568 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 113509

                                                                          
Query: 226    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113508 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 113449

                                                                          
Query: 286    cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
              |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 113448 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 113389

                                                                          
Query: 346    cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
              ||||||||||||| ||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 113388 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 113329

                                                                          
Query: 406    gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
              | |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 113328 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 113269

                           
Query: 466    gcccggacatggc 478
              |||| ||||||||
Sbjct: 113268 gccccgacatggc 113256



to top

>gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1387_F08,
             complete sequence
          Length = 141535

 Score =  502 bits (253), Expect = e-139
 Identities = 298/313 (95%)
 Strand = Plus / Minus

                                                                         
Query: 166   agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
             |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 67819 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 67760

                                                                         
Query: 226   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67759 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 67700

                                                                         
Query: 286   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
             |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 67699 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 67640

                                                                         
Query: 346   cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
             ||||||||||||| ||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 67639 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 67580

                                                                         
Query: 406   gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
             | |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 67579 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 67520

                          
Query: 466   gcccggacatggc 478
             |||| ||||||||
Sbjct: 67519 gccccgacatggc 67507



to top

>dbj|AK119240.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-A04, full
           insert sequence
          Length = 672

 Score =  502 bits (253), Expect = e-139
 Identities = 298/313 (95%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 400 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 341

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 340 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 281

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 280 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 221

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||||||||| ||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 220 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 161

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 160 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 101

                        
Query: 466 gcccggacatggc 478
           |||| ||||||||
Sbjct: 100 gccccgacatggc 88



to top

>ref|XM_475394.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  496 bits (250), Expect = e-137
 Identities = 295/310 (95%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||||||||| ||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 130 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 71

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 70  ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 11

                     
Query: 466 gcccggacat 475
           |||| |||||
Sbjct: 10  gccccgacat 1



to top

>ref|NM_187563.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  496 bits (250), Expect = e-137
 Identities = 295/310 (95%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||
Sbjct: 130 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||||||||||| ||| ||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 70  gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 11

                     
Query: 466 gcccggacat 475
           | || |||||
Sbjct: 10  ggcccgacat 1



to top

>ref|XM_473659.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  484 bits (244), Expect = e-133
 Identities = 295/312 (94%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 312 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 253

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 252 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 193

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||
Sbjct: 192 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 133

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
            |||||||||||||||||||| |  ||||| |||||||||||||| ||||||||||||||
Sbjct: 132 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 73

                                                                       
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||| |||||||| ||||||||||| |||||||||||||| || |||||||||||||||||
Sbjct: 72  gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 13

                       
Query: 464 gcgcccggacat 475
           |||||| |||||
Sbjct: 12  gcgccccgacat 1



to top

>emb|AL662987.3|OSJN00188 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088A01,
              complete sequence
          Length = 186325

 Score =  484 bits (244), Expect = e-133
 Identities = 295/312 (94%)
 Strand = Plus / Plus

                                                                          
Query: 164    ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
              |||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 135379 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 135438

                                                                          
Query: 224    ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135439 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 135498

                                                                          
Query: 284    ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
              |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||
Sbjct: 135499 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 135558

                                                                          
Query: 344    cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
               |||||||||||||||||||| |  ||||| |||||||||||||| ||||||||||||||
Sbjct: 135559 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 135618

                                                                          
Query: 404    gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
              ||| |||||||| ||||||||||| |||||||||||||| || |||||||||||||||||
Sbjct: 135619 gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 135678

                          
Query: 464    gcgcccggacat 475
              |||||| |||||
Sbjct: 135679 gcgccccgacat 135690



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  484 bits (244), Expect = e-133
 Identities = 295/312 (94%)
 Strand = Plus / Plus

                                                                            
Query: 164      ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
                |||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 29462363 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 29462422

                                                                            
Query: 224      ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29462423 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 29462482

                                                                            
Query: 284      ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
                |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||
Sbjct: 29462483 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 29462542

                                                                            
Query: 344      cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
                 |||||||||||||||||||| |  ||||| |||||||||||||| ||||||||||||||
Sbjct: 29462543 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 29462602

                                                                            
Query: 404      gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
                ||| |||||||| ||||||||||| |||||||||||||| || |||||||||||||||||
Sbjct: 29462603 gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 29462662

                            
Query: 464      gcgcccggacat 475
                |||||| |||||
Sbjct: 29462663 gcgccccgacat 29462674



to top

>dbj|AK059019.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-B02, full
           insert sequence
          Length = 594

 Score =  484 bits (244), Expect = e-133
 Identities = 295/312 (94%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 388 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 329

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 269

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||
Sbjct: 268 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 209

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
            |||||||||||||||||||| |  ||||| |||||||||||||| ||||||||||||||
Sbjct: 208 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 149

                                                                       
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||| |||||||| ||||||||||| |||||||||||||| || |||||||||||||||||
Sbjct: 148 gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 89

                       
Query: 464 gcgcccggacat 475
           |||||| |||||
Sbjct: 88  gcgccccgacat 77



to top

>gb|BT017776.1| Zea mays clone EL01N0503B03.c mRNA sequence
          Length = 622

 Score =  480 bits (242), Expect = e-132
 Identities = 296/314 (94%)
 Strand = Plus / Minus

                                                                       
Query: 162 gcctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcc 221
           |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 384 gcctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 325

                                                                       
Query: 222 atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 281
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 324 atggcggtcacggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacg 265

                                                                       
Query: 282 ttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgc 341
           |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 264 ttctcgagaaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 205

                                                                       
Query: 342 ttcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttg 401
           |||||||| |||||||| ||||| |  ||||| |||||||||||||||||||||||||||
Sbjct: 204 ttcacgccacccctcctagccagcctccggatcgccggcttggtgatgccctggatgttg 145

                                                                       
Query: 402 tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttg 461
           ||||| |||||||||||||||||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 144 tcgcggagcaccttccggtggcgcttcgcgccgcccttgcccagacccttgccgcccttg 85

                         
Query: 462 ccgcgcccggacat 475
           |||||||| |||||
Sbjct: 84  ccgcgcccagacat 71



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  478 bits (241), Expect = e-132
 Identities = 295/313 (94%)
 Strand = Plus / Minus

                                                                            
Query: 163      cctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcca 222
                ||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 15861722 cctagccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtcca 15861663

                                                                            
Query: 223      tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 282
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15861662 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 15861603

                                                                            
Query: 283      tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgct 342
                ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 15861602 tctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgct 15861543

                                                                            
Query: 343      tcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgt 402
                |||| ||||||||||||||||| |  ||||| |||||||| ||||| |||||||||||||
Sbjct: 15861542 tcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 15861483

                                                                            
Query: 403      cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgc 462
                |||| |||||||||||||| ||||| || |||||||||||||||||||| ||||||||||
Sbjct: 15861482 cgcggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgc 15861423

                             
Query: 463      cgcgcccggacat 475
                ||||||| |||||
Sbjct: 15861422 cgcgccccgacat 15861410



 Score =  456 bits (230), Expect = e-125
 Identities = 284/302 (94%)
 Strand = Plus / Plus

                                                                            
Query: 162      gcctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcc 221
                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 21610885 gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 21610944

                                                                            
Query: 222      atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 281
                |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 21610945 atggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacg 21611004

                                                                            
Query: 282      ttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgc 341
                |||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||
Sbjct: 21611005 ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgc 21611064

                                                                            
Query: 342      ttcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttg 401
                ||||||||||||||||||||||| |  ||||| |||||||| ||||| ||||||||||||
Sbjct: 21611065 ttcacgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttg 21611124

                                                                            
Query: 402      tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttg 461
                |||||||||||||||| ||| | ||| ||||||||||| ||||| |||||||| ||||||
Sbjct: 21611125 tcgcgcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttg 21611184

                  
Query: 462      cc 463
                ||
Sbjct: 21611185 cc 21611186



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 346     cgccgcccctcctcgccagg 365
               ||||||||||||||||||||
Sbjct: 9864392 cgccgcccctcctcgccagg 9864411



to top

>dbj|AP005551.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1081_G10
          Length = 107955

 Score =  478 bits (241), Expect = e-132
 Identities = 295/313 (94%)
 Strand = Plus / Minus

                                                                         
Query: 163   cctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcca 222
             ||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 24848 cctagccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtcca 24789

                                                                         
Query: 223   tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 282
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24788 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 24729

                                                                         
Query: 283   tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgct 342
             ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 24728 tctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgct 24669

                                                                         
Query: 343   tcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgt 402
             |||| ||||||||||||||||| |  ||||| |||||||| ||||| |||||||||||||
Sbjct: 24668 tcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 24609

                                                                         
Query: 403   cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgc 462
             |||| |||||||||||||| ||||| || |||||||||||||||||||| ||||||||||
Sbjct: 24608 cgcggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgc 24549

                          
Query: 463   cgcgcccggacat 475
             ||||||| |||||
Sbjct: 24548 cgcgccccgacat 24536



to top

>dbj|AK058686.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-A10, full
           insert sequence
          Length = 469

 Score =  478 bits (241), Expect = e-132
 Identities = 295/313 (94%)
 Strand = Plus / Minus

                                                                       
Query: 163 cctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcca 222
           ||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 363 cctagccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtcca 304

                                                                       
Query: 223 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 282
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 303 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 244

                                                                       
Query: 283 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgct 342
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 243 tctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgct 184

                                                                       
Query: 343 tcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgt 402
           |||| ||||||||||||||||| |  ||||| |||||||| ||||| |||||||||||||
Sbjct: 183 tcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 124

                                                                       
Query: 403 cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgc 462
           |||| |||||||||||||| ||||| || |||||||||||||||||||| ||||||||||
Sbjct: 123 cgcggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgc 64

                        
Query: 463 cgcgcccggacat 475
           ||||||| |||||
Sbjct: 63  cgcgccccgacat 51



to top

>emb|X79715.1|LTMRHISH4 L.temulentum mRNA for histone H4
          Length = 616

 Score =  474 bits (239), Expect = e-130
 Identities = 300/321 (93%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 361 ctagccgccgaagccgtagagagtgcgaccctggcgcttgagcgcgtagactacgtccat 302

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 301 ggcggtgacggtcttgcggcsggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 242

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           |||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 241 ctcgaggaagatcttgagcacgccacgggtctcctcgtagatgagcccggagatgcgctt 182

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
           ||||||||| |  |  |||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 181 cacgccgccgcggcgagccaggcggcggatggccggcttggtgatgccctggatgttgtc 122

                                                                       
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||| || ||||| ||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 121 gcggaggaccttgcggtggcgcttggcgccgcccttgccgagcccctttcctcccttgcc 62

                                
Query: 464 gcgcccggacatggctgacga 484
           ||| || ||||||||||||||
Sbjct: 61  gcggcccgacatggctgacga 41



to top

>gb|M12277.1|WHTH4091 Wheat histone H4 TH091 gene, complete cds
          Length = 727

 Score =  474 bits (239), Expect = e-130
 Identities = 296/315 (93%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 564 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 505

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 504 ggcggtgacggttttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 445

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 444 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 385

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
           ||||||||||||||| ||||| |  ||||| |||||||||||||||||||||||||||||
Sbjct: 384 cacgccgcccctcctggccagcctccggatcgccggcttggtgatgccctggatgttgtc 325

                                                                       
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||| || ||||||||||| |||||||||||||||||||| || |||||||| |||||| |
Sbjct: 324 gcggaggaccttccggtgccgcttggcgccgcccttgcccagccccttgccgcccttgtc 265

                          
Query: 464 gcgcccggacatggc 478
           |||||| ||||||||
Sbjct: 264 gcgcccagacatggc 250



to top

>ref|XM_467181.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 312

 Score =  472 bits (238), Expect = e-130
 Identities = 292/310 (94%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           |||| |||||||||||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 130 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 71

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | |||||||| ||||||||||| || ||||||||||| || |||||||||||||||||||
Sbjct: 70  ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 11

                     
Query: 466 gcccggacat 475
           |||| |||||
Sbjct: 10  gcccagacat 1



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  472 bits (238), Expect = e-130
 Identities = 295/314 (93%)
 Strand = Plus / Minus

                                                                            
Query: 162      gcctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcc 221
                |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 21774023 gcctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 21773964

                                                                            
Query: 222      atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 281
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21773963 atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 21773904

                                                                            
Query: 282      ttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgc 341
                |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 21773903 ttctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgc 21773844

                                                                            
Query: 342      ttcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttg 401
                ||||| ||||||||||||||||| |  ||||| |||||||| ||||| ||||||||||||
Sbjct: 21773843 ttcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttg 21773784

                                                                            
Query: 402      tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttg 461
                ||||| |||||||||||||||||||| ||||| |||||||| || ||||| |||||||| 
Sbjct: 21773783 tcgcggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctcccttc 21773724

                              
Query: 462      ccgcgcccggacat 475
                |||||||| |||||
Sbjct: 21773723 ccgcgcccagacat 21773710



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  472 bits (238), Expect = e-130
 Identities = 292/310 (94%)
 Strand = Plus / Plus

                                                                            
Query: 166      agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
                |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 28012831 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 28012890

                                                                            
Query: 226      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 28012891 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 28012950

                                                                            
Query: 286      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
                |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 28012951 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 28013010

                                                                            
Query: 346      cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
                |||| |||||||||||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 28013011 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 28013070

                                                                            
Query: 406      gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
                | |||||||| ||||||||||| || ||||||||||| || |||||||||||||||||||
Sbjct: 28013071 ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 28013130

                          
Query: 466      gcccggacat 475
                |||| |||||
Sbjct: 28013131 gcccagacat 28013140



to top

>dbj|AP004401.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0534A03
          Length = 153170

 Score =  472 bits (238), Expect = e-130
 Identities = 295/314 (93%)
 Strand = Plus / Minus

                                                                         
Query: 162   gcctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcc 221
             |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 91206 gcctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 91147

                                                                         
Query: 222   atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 281
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 91146 atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 91087

                                                                         
Query: 282   ttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgc 341
             |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 91086 ttctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgc 91027

                                                                         
Query: 342   ttcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttg 401
             ||||| ||||||||||||||||| |  ||||| |||||||| ||||| ||||||||||||
Sbjct: 91026 ttcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttg 90967

                                                                         
Query: 402   tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttg 461
             ||||| |||||||||||||||||||| ||||| |||||||| || ||||| |||||||| 
Sbjct: 90966 tcgcggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctcccttc 90907

                           
Query: 462   ccgcgcccggacat 475
             |||||||| |||||
Sbjct: 90906 ccgcgcccagacat 90893



to top

>dbj|AP004255.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1212_A08
          Length = 119304

 Score =  472 bits (238), Expect = e-130
 Identities = 292/310 (94%)
 Strand = Plus / Plus

                                                                         
Query: 166   agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
             |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 56493 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 56552

                                                                         
Query: 226   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 56553 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 56612

                                                                         
Query: 286   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
             |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 56613 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 56672

                                                                         
Query: 346   cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
             |||| |||||||||||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 56673 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 56732

                                                                         
Query: 406   gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
             | |||||||| ||||||||||| || ||||||||||| || |||||||||||||||||||
Sbjct: 56733 ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 56792

                       
Query: 466   gcccggacat 475
             |||| |||||
Sbjct: 56793 gcccagacat 56802



to top

>dbj|AP004071.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1717_A09
          Length = 203132

 Score =  472 bits (238), Expect = e-130
 Identities = 292/310 (94%)
 Strand = Plus / Plus

                                                                        
Query: 166  agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
            |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 2478 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 2537

                                                                        
Query: 226  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2538 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 2597

                                                                        
Query: 286  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
            |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 2598 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 2657

                                                                        
Query: 346  cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
            |||| |||||||||||||| |  ||||| |||||||||||||| ||||||||||||||||
Sbjct: 2658 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 2717

                                                                        
Query: 406  gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
            | |||||||| ||||||||||| || ||||||||||| || |||||||||||||||||||
Sbjct: 2718 ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 2777

                      
Query: 466  gcccggacat 475
            |||| |||||
Sbjct: 2778 gcccagacat 2787



to top

>gb|M13370.1|MZEH4C14 Maize (Zea mays) histone H4 gene (H4C14), complete cds
          Length = 1135

 Score =  472 bits (238), Expect = e-130
 Identities = 295/314 (93%)
 Strand = Plus / Minus

                                                                       
Query: 162 gcctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcc 221
           ||||| || ||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 785 gcctaccctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 726

                                                                       
Query: 222 atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 281
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 725 atggcggtcacggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacg 666

                                                                       
Query: 282 ttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgc 341
           |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 665 ttctcgagaaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 606

                                                                       
Query: 342 ttcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttg 401
           |||||||| |||||||| ||||| |  ||||| |||||||||||||||||||||||||||
Sbjct: 605 ttcacgccacccctcctagccagcctccggatcgccggcttggtgatgccctggatgttg 546

                                                                       
Query: 402 tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttg 461
           ||||| |||||||||||||||||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 545 tcgcggagcaccttccggtggcgcttcgcgccgcccttgcccagacccttgccgcccttg 486

                         
Query: 462 ccgcgcccggacat 475
           |||||||| |||||
Sbjct: 485 ccgcgcccagacat 472



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  470 bits (237), Expect = e-129
 Identities = 294/313 (93%)
 Strand = Plus / Minus

                                                                            
Query: 166      agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
                |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 35834191 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 35834132

                                                                            
Query: 226      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 35834131 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 35834072

                                                                            
Query: 286      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
                |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 35834071 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 35834012

                                                                            
Query: 346      cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
                ||||||||||||||||||| |  ||||| |||||||||||||||||||||||||||||||
Sbjct: 35834011 cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 35833952

                                                                            
Query: 406      gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
                | |||||||| || || | ||| ||||||||||||||||| |||||||| ||||||||||
Sbjct: 35833951 ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 35833892

                             
Query: 466      gcccggacatggc 478
                |||| ||||||||
Sbjct: 35833891 gccccgacatggc 35833879



to top

>dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0506B12
          Length = 170759

 Score =  470 bits (237), Expect = e-129
 Identities = 294/313 (93%)
 Strand = Plus / Minus

                                                                         
Query: 166   agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
             |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 98649 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 98590

                                                                         
Query: 226   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 98589 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 98530

                                                                         
Query: 286   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
             |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 98529 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 98470

                                                                         
Query: 346   cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
             ||||||||||||||||||| |  ||||| |||||||||||||||||||||||||||||||
Sbjct: 98469 cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 98410

                                                                         
Query: 406   gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
             | |||||||| || || | ||| ||||||||||||||||| |||||||| ||||||||||
Sbjct: 98409 ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 98350

                          
Query: 466   gcccggacatggc 478
             |||| ||||||||
Sbjct: 98349 gccccgacatggc 98337



to top

>dbj|AK058436.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-F07, full
            insert sequence
          Length = 1449

 Score =  470 bits (237), Expect = e-129
 Identities = 294/313 (93%)
 Strand = Plus / Minus

                                                                        
Query: 166  agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
            |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 1156 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 1097

                                                                        
Query: 226  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1096 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 1037

                                                                        
Query: 286  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
            |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 1036 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 977

                                                                        
Query: 346  cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
            ||||||||||||||||||| |  ||||| |||||||||||||||||||||||||||||||
Sbjct: 976  cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 917

                                                                        
Query: 406  gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
            | |||||||| || || | ||| ||||||||||||||||| |||||||| ||||||||||
Sbjct: 916  ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 857

                         
Query: 466  gcccggacatggc 478
            |||| ||||||||
Sbjct: 856  gccccgacatggc 844



to top

>ref|NM_185758.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 312

 Score =  468 bits (236), Expect = e-129
 Identities = 293/312 (93%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 312 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 253

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 252 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 193

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 192 ctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgctt 133

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
           ||| ||||||||||||||||| |  ||||| |||||||| ||||| ||||||||||||||
Sbjct: 132 caccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtc 73

                                                                       
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||| |||||||||||||||||||| ||||| |||||||| || ||||| |||||||| ||
Sbjct: 72  gcggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctcccttccc 13

                       
Query: 464 gcgcccggacat 475
           |||||| |||||
Sbjct: 12  gcgcccagacat 1



to top

>ref|NM_190485.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  464 bits (234), Expect = e-127
 Identities = 291/310 (93%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||||||||||||||| |  ||||| |||||||||||||||||||||||||||||||
Sbjct: 130 cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | |||||||| || || | ||| ||||||||||||||||| |||||||| ||||||||||
Sbjct: 70  ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 11

                     
Query: 466 gcccggacat 475
           |||| |||||
Sbjct: 10  gccccgacat 1



to top

>gb|AC137596.2| Oryza sativa (japonica cultivar-group) chromosome 9 clone
             OSJNBb0031H05, complete sequence
          Length = 141200

 Score =  456 bits (230), Expect = e-125
 Identities = 284/302 (94%)
 Strand = Plus / Plus

                                                                         
Query: 162   gcctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcc 221
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 67511 gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 67570

                                                                         
Query: 222   atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 281
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 67571 atggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacg 67630

                                                                         
Query: 282   ttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgc 341
             |||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||
Sbjct: 67631 ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgc 67690

                                                                         
Query: 342   ttcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttg 401
             ||||||||||||||||||||||| |  ||||| |||||||| ||||| ||||||||||||
Sbjct: 67691 ttcacgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttg 67750

                                                                         
Query: 402   tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttg 461
             |||||||||||||||| ||| | ||| ||||||||||| ||||| |||||||| ||||||
Sbjct: 67751 tcgcgcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttg 67810

               
Query: 462   cc 463
             ||
Sbjct: 67811 cc 67812



to top

>dbj|AP005564.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1228_C03, complete sequence
          Length = 31468

 Score =  456 bits (230), Expect = e-125
 Identities = 284/302 (94%)
 Strand = Plus / Plus

                                                                         
Query: 162   gcctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcc 221
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 19209 gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 19268

                                                                         
Query: 222   atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 281
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 19269 atggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacg 19328

                                                                         
Query: 282   ttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgc 341
             |||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||
Sbjct: 19329 ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgc 19388

                                                                         
Query: 342   ttcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttg 401
             ||||||||||||||||||||||| |  ||||| |||||||| ||||| ||||||||||||
Sbjct: 19389 ttcacgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttg 19448

                                                                         
Query: 402   tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttg 461
             |||||||||||||||| ||| | ||| ||||||||||| ||||| |||||||| ||||||
Sbjct: 19449 tcgcgcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttg 19508

               
Query: 462   cc 463
             ||
Sbjct: 19509 cc 19510



to top

>ref|NM_197569.1| Oryza sativa (japonica cultivar-group) histone H4
           (OSJNBb0064P21.1), mRNA
          Length = 372

 Score =  450 bits (227), Expect = e-123
 Identities = 296/319 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 370 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 311

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 251

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 250 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 191

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||||||||||||||| |  ||||| || ||||| ||||| ||||||||||||||||
Sbjct: 190 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 131

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||||||||||| ||| | ||| ||||| |||||||| || ||||||||||||||||| |
Sbjct: 130 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 71

                              
Query: 466 gcccggacatggctgacga 484
           | || |||||| |||||||
Sbjct: 70  ggcccgacatgtctgacga 52



to top

>gb|AC096782.6| Oryza sativa chromosome 10 BAC OSJNBa0025B05 genomic sequence,
            complete sequence
          Length = 14849

 Score =  450 bits (227), Expect = e-123
 Identities = 296/319 (92%)
 Strand = Plus / Minus

                                                                        
Query: 166  agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
            |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 4262 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 4203

                                                                        
Query: 226  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4202 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 4143

                                                                        
Query: 286  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
            |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 4142 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 4083

                                                                        
Query: 346  cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
            ||||||||||||||||||| |  ||||| || ||||| ||||| ||||||||||||||||
Sbjct: 4082 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 4023

                                                                        
Query: 406  gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
            |||||||||||| ||| | ||| ||||| |||||||| || ||||||||||||||||| |
Sbjct: 4022 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 3963

                               
Query: 466  gcccggacatggctgacga 484
            | || |||||| |||||||
Sbjct: 3962 ggcccgacatgtctgacga 3944



to top

>gb|AC073166.7| Oryza sativa chromosome 10 BAC OSJNBb0064P21 genomic sequence,
            complete sequence
          Length = 142114

 Score =  450 bits (227), Expect = e-123
 Identities = 296/319 (92%)
 Strand = Plus / Plus

                                                                        
Query: 166  agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
            |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 5636 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 5695

                                                                        
Query: 226  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5696 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 5755

                                                                        
Query: 286  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
            |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 5756 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 5815

                                                                        
Query: 346  cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
            ||||||||||||||||||| |  ||||| || ||||| ||||| ||||||||||||||||
Sbjct: 5816 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 5875

                                                                        
Query: 406  gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
            |||||||||||| ||| | ||| ||||| |||||||| || ||||||||||||||||| |
Sbjct: 5876 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 5935

                               
Query: 466  gcccggacatggctgacga 484
            | || |||||| |||||||
Sbjct: 5936 ggcccgacatgtctgacga 5954



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  450 bits (227), Expect = e-123
 Identities = 296/319 (92%)
 Strand = Plus / Plus

                                                                            
Query: 166      agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
                |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 20500346 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 20500405

                                                                            
Query: 226      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20500406 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 20500465

                                                                            
Query: 286      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
                |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 20500466 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 20500525

                                                                            
Query: 346      cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
                ||||||||||||||||||| |  ||||| || ||||| ||||| ||||||||||||||||
Sbjct: 20500526 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 20500585

                                                                            
Query: 406      gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
                |||||||||||| ||| | ||| ||||| |||||||| || ||||||||||||||||| |
Sbjct: 20500586 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 20500645

                                   
Query: 466      gcccggacatggctgacga 484
                | || |||||| |||||||
Sbjct: 20500646 ggcccgacatgtctgacga 20500664



to top

>dbj|AK119699.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-D04, full
           insert sequence
          Length = 544

 Score =  450 bits (227), Expect = e-123
 Identities = 296/319 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 384 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 325

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 265

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 264 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 205

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||||||||||||||| |  ||||| || ||||| ||||| ||||||||||||||||
Sbjct: 204 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 145

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||||||||||| ||| | ||| ||||| |||||||| || ||||||||||||||||| |
Sbjct: 144 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 85

                              
Query: 466 gcccggacatggctgacga 484
           | || |||||| |||||||
Sbjct: 84  ggcccgacatgtctgacga 66



to top

>dbj|AK059098.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-C07, full
           insert sequence
          Length = 531

 Score =  450 bits (227), Expect = e-123
 Identities = 296/319 (92%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 380 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 321

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 320 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 261

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 260 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 201

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||||||||||||||| |  ||||| || ||||| ||||| ||||||||||||||||
Sbjct: 200 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 141

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||||||||||| ||| | ||| ||||| |||||||| || ||||||||||||||||| |
Sbjct: 140 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 81

                              
Query: 466 gcccggacatggctgacga 484
           | || |||||| |||||||
Sbjct: 80  ggcccgacatgtctgacga 62



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  450 bits (227), Expect = e-123
 Identities = 296/319 (92%)
 Strand = Plus / Plus

                                                                            
Query: 166      agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
                |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 20511618 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 20511677

                                                                            
Query: 226      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20511678 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 20511737

                                                                            
Query: 286      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
                |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 20511738 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 20511797

                                                                            
Query: 346      cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
                ||||||||||||||||||| |  ||||| || ||||| ||||| ||||||||||||||||
Sbjct: 20511798 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 20511857

                                                                            
Query: 406      gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
                |||||||||||| ||| | ||| ||||| |||||||| || ||||||||||||||||| |
Sbjct: 20511858 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 20511917

                                   
Query: 466      gcccggacatggctgacga 484
                | || |||||| |||||||
Sbjct: 20511918 ggcccgacatgtctgacga 20511936



to top

>emb|X84376.1|ZMHIS4DNA Z.mays histone H4 gene
          Length = 1029

 Score =  434 bits (219), Expect = e-118
 Identities = 293/315 (93%), Gaps = 2/315 (0%)
 Strand = Plus / Minus

                                                                       
Query: 162 gcctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcc 221
           |||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 648 gcctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 589

                                                                       
Query: 222 atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 281
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 588 atggcggtcacggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacg 529

                                                                       
Query: 282 ttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgc 341
           |||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||
Sbjct: 528 ttctcgagaaagatcttgcgcacgccgcgggtctcctcgtagatgagccccgagatgcgc 469

                                                                       
Query: 342 ttcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttg 401
           |||||||| |||||||| ||||| |  ||||| |||||||||||||||||||||||||||
Sbjct: 468 ttcacgccacccctcctagccagcctccggatcgccggcttggtgatgccctggatgttg 409

                                                                       
Query: 402 tcgcgcagcaccttccggtggcgctt-ggcgccgcccttgccgagacccttgcctccctt 460
           ||||| ||||||||||||||||||||  ||| ||||||| || ||||||||||| |||||
Sbjct: 408 tcgcggagcaccttccggtggcgcttccgcg-cgccctttcccagacccttgccgccctt 350

                          
Query: 461 gccgcgcccggacat 475
           ||||||||| |||||
Sbjct: 349 gccgcgcccagacat 335



to top

>gb|BT018251.1| Zea mays clone EL01N0563H01.c mRNA sequence
          Length = 594

 Score =  426 bits (215), Expect = e-116
 Identities = 287/311 (92%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 354 tagccgccgaacccgtagagggtgcggccctggcgcttgagggcgtagacgacgtccatg 295

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           ||||||||||| || || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 294 gcggtgacggtttttcgacgggcgtgctcagtgtaggtgacggcgtcgcggatgacgttc 235

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 234 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttc 175

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           ||||||||||||||||| || |  ||||| |||||||| ||||| || ||||||||||||
Sbjct: 174 acgccgcccctcctcgcaagcctccggatcgccggcttcgtgatcccttggatgttgtcg 115

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           || |||||||| ||||| |||||||||||||||||||| || |||||||| |||||||||
Sbjct: 114 cggagcaccttgcggtgccgcttggcgccgcccttgcccagccccttgccgcccttgccg 55

                      
Query: 465 cgcccggacat 475
           ||||| |||||
Sbjct: 54  cgcccagacat 44



to top

>gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H4-VII genes, complete cds
          Length = 2297

 Score =  418 bits (211), Expect = e-114
 Identities = 277/299 (92%)
 Strand = Plus / Plus

                                                                        
Query: 165  tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
            ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1689 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 1748

                                                                        
Query: 225  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
            || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1749 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 1808

                                                                        
Query: 285  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
            || ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 1809 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 1868

                                                                        
Query: 345  acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
            |||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1869 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 1928

                                                                       
Query: 405  cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
            ||||||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 1929 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 1987



 Score =  418 bits (211), Expect = e-114
 Identities = 277/299 (92%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 511 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 452

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 451 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 392

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 391 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 332

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 331 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 272

                                                                      
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 271 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 213



to top

>ref|NM_001037845.1| Gallus gallus germinal histone H4 gene (LOC417946), mRNA
          Length = 312

 Score =  418 bits (211), Expect = e-114
 Identities = 277/299 (92%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 191 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 131 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 72

                                                                      
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13



to top

>ref|NM_001037843.1| Gallus gallus similar to germinal histone H4 gene (LOC417950), mRNA
          Length = 312

 Score =  418 bits (211), Expect = e-114
 Identities = 277/299 (92%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 191 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 131 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 72

                                                                      
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13



to top

>gb|M74534.1|CHKHIST4B Chicken histone H4 protein gene, complete cds
          Length = 661

 Score =  418 bits (211), Expect = e-114
 Identities = 277/299 (92%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 471 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 412

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 352

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 351 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 292

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 291 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 232

                                                                      
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 231 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 173



to top

>ref|XM_425463.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC427889), mRNA
          Length = 312

 Score =  412 bits (208), Expect = e-112
 Identities = 274/296 (92%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 308 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 249

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 248 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 189

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 188 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 129

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           ||||| | || ||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 128 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 69

                                                                   
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           |||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 68  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13



to top

>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC417952), mRNA
          Length = 1374

 Score =  412 bits (208), Expect = e-112
 Identities = 274/296 (92%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 308 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 249

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 248 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 189

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 188 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 129

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           ||||| | || ||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 128 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 69

                                                                   
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           |||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 68  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13



to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  412 bits (208), Expect = e-112
 Identities = 274/296 (92%)
 Strand = Plus / Plus

                                                                        
Query: 168  ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
            |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 6357 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 6416

                                                                        
Query: 228  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
            ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 6417 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 6476

                                                                        
Query: 288  aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
            ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 6477 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 6536

                                                                        
Query: 348  ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
            ||||| | || ||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 6537 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 6596

                                                                    
Query: 408  agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
            |||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 6597 agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 6652



 Score =  404 bits (204), Expect = e-109
 Identities = 273/296 (92%)
 Strand = Plus / Minus

                                                                        
Query: 168  ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
            |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 1095 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 1036

                                                                        
Query: 228  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
            ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1035 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 976

                                                                        
Query: 288  aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
            ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 975  aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 916

                                                                        
Query: 348  ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
            ||||| | || ||||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 915  ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatattgtcgcgc 856

                                                                    
Query: 408  agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
            |||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 855  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 800



to top

>ref|XM_425458.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC427884), mRNA
          Length = 516

 Score =  410 bits (207), Expect = e-111
 Identities = 276/299 (92%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 515 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 456

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 455 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggataacgttc 396

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 395 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 336

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 335 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 276

                                                                      
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 275 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 217



to top

>gb|M74533.1|CHKHIST4A Chicken histone H4 protein gene, complete cds
          Length = 630

 Score =  410 bits (207), Expect = e-111
 Identities = 276/299 (92%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 454 tagccgccgaagccgtagagagtgcgtccctggcgcttgagcgcgtagaccacgtccatg 395

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 335

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 334 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 275

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 274 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 215

                                                                      
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 214 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 156



to top

>gb|M13377.1|MZEH4C7 Maize (Zea mays) histone H4 gene (H4C7), complete cds
          Length = 868

 Score =  404 bits (204), Expect = e-109
 Identities = 285/312 (91%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 659 agccgccaaatccgtagagggtgcggccctgccgcttgagcgcgtagacgacgtccatgg 600

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||| ||||
Sbjct: 599 cggtgacggtcttacggcgggcgtgctccgtgtaggtgacagcgtcgcgaatgacattct 540

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 539 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 480

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           |||||||||| |||||||| |  ||||| |||||||| || |||||||||||||||||||
Sbjct: 479 cgccgccccttctcgccagcctccggatcgccggcttcgtaatgccctggatgttgtcgc 420

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | || ||||| ||||| ||||| |||||||||||||| || ||||| || ||||| ||||
Sbjct: 419 ggaggaccttgcggtgacgcttcgcgccgcccttgcccagccccttcccgccctttccgc 360

                       
Query: 466 gcccggacatgg 477
           |||| |||||||
Sbjct: 359 gccccgacatgg 348



to top

>gb|M36659.1|MZEH4A Corn histone H4 (H4C13) gene, complete cds
          Length = 949

 Score =  404 bits (204), Expect = e-109
 Identities = 285/312 (91%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 647 agccgccaaatccgtagagggtgcggccctgccgcttgagcgcgtagacgacgtccatgg 588

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||||||||
Sbjct: 587 cggtgacggtcttacggcgggcgtgctccgtgtaggtgacagcgtcgcgaatgacgttct 528

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 527 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 468

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           |||||||||| |||||||| |  ||||| |||||||| || |||||||||||||||||||
Sbjct: 467 cgccgccccttctcgccagcctccggatcgccggcttcgtaatgccctggatgttgtcgc 408

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | || ||||| ||||| ||||| ||||||||||| || || ||||| || ||||| ||||
Sbjct: 407 ggaggaccttgcggtgacgcttcgcgccgccctttcccagccccttcccgccctttccgc 348

                       
Query: 466 gcccggacatgg 477
           |||| |||||||
Sbjct: 347 gccccgacatgg 336



to top

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC417953), mRNA
          Length = 2271

 Score =  402 bits (203), Expect = e-109
 Identities = 272/295 (92%)
 Strand = Plus / Minus

                                                                       
Query: 169 cgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcgg 228
           ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct: 640 cgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggccg 581

                                                                       
Query: 229 tgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcga 288
           |||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 580 tgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcca 521

                                                                       
Query: 289 ggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgc 348
           |||||| |||||| |||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 520 ggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacgc 461

                                                                       
Query: 349 cgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgca 408
           |||| | || ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 460 cgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgca 401

                                                                  
Query: 409 gcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||||| ||||||||||||||||||||||| ||||| ||||| || ||||||||
Sbjct: 400 gcaccttgcggtggcgcttggcgccgcccttaccgagccccttcccgcccttgcc 346



to top

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  398 bits (201), Expect = e-108
 Identities = 285/313 (91%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 429 tagccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagaccacgtccatg 370

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| ||||||||   ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 369 gccgtgaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttc 310

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | |||||| |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 309 tccaggaacaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 250

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 249 acgccgccgcgccgcgccaggcgccggatggccggcttggtgatgccctggatgttgtcg 190

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||||||||| ||||| ||||||||||| ||||||||||| ||||| || |||||||| 
Sbjct: 189 cgcagcaccttgcggtgccgcttggcgccccccttgccgagccccttcccgcccttgcct 130

                        
Query: 465 cgcccggacatgg 477
           |  ||||||||||
Sbjct: 129 ctgccggacatgg 117



 Score =  391 bits (197), Expect = e-105
 Identities = 284/313 (90%)
 Strand = Plus / Plus

                                                                        
Query: 165  tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
            ||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 4289 tagccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagaccacgtccatg 4348

                                                                        
Query: 225  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
            || ||||| ||||||||   ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 4349 gccgtgaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttc 4408

                                                                        
Query: 285  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
            || ||||| | |||||| |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 4409 tccaggaacaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 4468

                                                                        
Query: 345  acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
            |||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 4469 acgccgccgcgccgcgccaggcgccggatggccggcttggtgatgccctggatgttgtcg 4528

                                                                        
Query: 405  cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
            |||| |||||| ||||| ||||||||||| ||||||||||| ||||| || |||||||| 
Sbjct: 4529 cgcaacaccttgcggtgccgcttggcgccccccttgccgagccccttcccgcccttgcct 4588

                         
Query: 465  cgcccggacatgg 477
            |  ||||||||||
Sbjct: 4589 ctgccggacatgg 4601



to top

>gb|U37576.1|GGU37576 Gallus gallus histone H4-VIII gene, complete cds
          Length = 1481

 Score =  396 bits (200), Expect = e-107
 Identities = 272/296 (91%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||| 
Sbjct: 671 ccgccgaagccgtagagggtgcgttcctggcgcttgagcgcgtagaccacgtccatggcc 612

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 611 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 552

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||||| |||||| |||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 551 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgaaatgcgcttgacg 492

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           ||||| | || ||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 491 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 432

                                                                   
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           |||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 431 agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 376



to top

>gb|DQ213262.1| Taeniopygia guttata clone 0061P0011F09 histone 1 H4h-like mRNA,
           complete sequence
          Length = 874

 Score =  373 bits (188), Expect = e-100
 Identities = 281/312 (90%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||||||||| |||||||||||||| |||||||| |||||||||
Sbjct: 350 tagccgccgaagccgtagagggtgcgaccctggcgcttgagggcgtagaccacgtccatg 291

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| ||||| |    ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 290 gccgtgaccgtcttcctcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 231

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 230 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 171

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | ||  |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 170 acgccgccgcgccgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 111

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||||||||| ||||||||||||||||||||||||||||| || ||||| |||||||| 
Sbjct: 110 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccctttgccgcccttgccc 51

                       
Query: 465 cgcccggacatg 476
           || || ||||||
Sbjct: 50  cggccagacatg 39



to top

>gb|J00866.1|CHKH43D8 Chicken histone H4 gene, clone pch3dr8
          Length = 675

 Score =  373 bits (188), Expect = e-100
 Identities = 269/296 (90%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 578 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 519

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 518 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctca 459

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 458 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 399

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           ||||| | || ||||||||| || |||||||||||||||||||||||||| |||||||||
Sbjct: 398 ccgccgcgccgcgccaggcggcgaatggccggcttggtgatgccctggatattgtcgcgc 339

                                                                   
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           |||||||| |||||||||||||| || || |||||||| ||||| || ||||||||
Sbjct: 338 agcaccttgcggtggcgcttggcaccccctttgccgagccccttcccgcccttgcc 283



to top

>ref|XM_849156.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611486), mRNA
          Length = 444

 Score =  367 bits (185), Expect = 2e-98
 Identities = 272/301 (90%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 442 agccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatgg 383

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 382 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 323

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | |||||| || ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 322 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 263

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||| | ||  ||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 262 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 203

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||||||||| |||||||||||||||||||||||||| || ||||| || ||||||||||
Sbjct: 202 gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 143

            
Query: 466 g 466
           |
Sbjct: 142 g 142



to top

>ref|XM_849188.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611513), mRNA
          Length = 450

 Score =  361 bits (182), Expect = 1e-96
 Identities = 278/310 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 448 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 389

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 388 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 329

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | |||||| || ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 328 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 269

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||| | ||  ||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 268 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 209

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||||||||| |||||||||||||||||||||||||| || ||||| || ||||||||||
Sbjct: 208 gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 149

                     
Query: 466 gcccggacat 475
           | || |||||
Sbjct: 148 gaccagacat 139



to top

>ref|XM_849161.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611490), mRNA
          Length = 312

 Score =  361 bits (182), Expect = 1e-96
 Identities = 278/310 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 250 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | |||||| || ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 190 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||| | ||  ||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||||||||| |||||||||||||||||||||||||| || ||||| || ||||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 11

                     
Query: 466 gcccggacat 475
           | || |||||
Sbjct: 10  gaccagacat 1



to top

>ref|XM_848746.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611106), mRNA
          Length = 312

 Score =  361 bits (182), Expect = 1e-96
 Identities = 278/310 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 250 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | |||||| || ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 190 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||| | ||  ||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||||||||| |||||||||||||||||||||||||| || ||||| || ||||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 11

                     
Query: 466 gcccggacat 475
           | || |||||
Sbjct: 10  gaccagacat 1



to top

>ref|XM_545382.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488260), mRNA
          Length = 312

 Score =  361 bits (182), Expect = 1e-96
 Identities = 278/310 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 250 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | |||||| || ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 190 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||| | ||  ||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||||||||| |||||||||||||||||||||||||| || ||||| || ||||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 11

                     
Query: 466 gcccggacat 475
           | || |||||
Sbjct: 10  gaccagacat 1



to top

>gb|BT017111.1| Zea mays clone EL01N0363F03.c mRNA sequence
          Length = 525

 Score =  359 bits (181), Expect = 6e-96
 Identities = 271/301 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 cctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcca 222
           ||||||||||||| || ||||| ||||| |||||||| ||||| ||||| ||||||||||
Sbjct: 367 cctagccgccgaagccatagagagtgcggccctggcgtttgagggcgtacacgacgtcca 308

                                                                       
Query: 223 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 282
           | ||||||||||| ||||| ||||||||||| |||||||| || |||||||||||||| |
Sbjct: 307 tagcggtgacggttttgcgacgggcgtgctccgtgtaggtcacagcgtcgcggatgacat 248

                                                                       
Query: 283 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgct 342
           ||||||| ||||||||||| ||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 247 tctcgagaaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgct 188

                                                                       
Query: 343 tcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgt 402
           ||||||| |||||||||||||| |  ||||| |||||||| ||||| |||||||||||||
Sbjct: 187 tcacgccacccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 128

                                                                       
Query: 403 cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgc 462
           ||||||||||||||||||| ||||| ||||||||||| ||||| |||||||| |||||||
Sbjct: 127 cgcgcagcaccttccggtgacgcttcgcgccgcccttcccgagccccttgccgcccttgc 68

            
Query: 463 c 463
           |
Sbjct: 67  c 67



to top

>gb|AY105603.1| Zea mays PCO094685 mRNA sequence
          Length = 731

 Score =  359 bits (181), Expect = 6e-96
 Identities = 274/305 (89%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| ||||| || ||||| |||||||||||||| ||||| || || ||||||||||||
Sbjct: 385 ccgaacccgtacagagtgcggccctggcgcttgagggcgtacacaacatccatggcggtg 326

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           |||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 325 acggtcttgcggcgagcgtgctcggtgtaggtgaccgcgtcgcggatgacattctcgagg 266

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           ||||||||||| ||||||||||| ||||||||||| ||||| ||||| ||||||||||||
Sbjct: 265 aagatcttgagcacgccgcgggtttcctcgtagataagcccggagatacgcttcacgccg 206

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           |||||||||||||| |  ||||| |||||||| ||||| ||||||||||||||||| || 
Sbjct: 205 cccctcctcgccagcctccggattgccggcttcgtgataccctggatgttgtcgcggaga 146

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| |||||||| || |||||||||||||| || |||||||| |||||||||||||| 
Sbjct: 145 accttacggtggcgtttcgcgccgcccttgcccagccccttgccgcccttgccgcgccca 86

                
Query: 471 gacat 475
           |||||
Sbjct: 85  gacat 81



to top

>ref|XM_545387.2| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488265), mRNA
          Length = 714

 Score =  357 bits (180), Expect = 2e-95
 Identities = 276/308 (89%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||| |||
Sbjct: 707 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggccgtg 648

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||| |||
Sbjct: 647 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttctccagg 588

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | |||||| || ||||||||||||||||||||||| |||||||||||||| ||||||
Sbjct: 587 aacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccg 528

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || | ||  ||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 527 ccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgcgcagc 468

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| |||||||||||||||||||||||||| || ||||| || ||||||||||| || 
Sbjct: 467 accttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgcgacca 408

                   
Query: 471 gacatggc 478
           ||||||||
Sbjct: 407 gacatggc 400



to top

>ref|XM_848792.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611148), mRNA
          Length = 312

 Score =  355 bits (179), Expect = 9e-95
 Identities = 269/299 (89%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| ||||||
Sbjct: 251 gccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | |||||| || ||||||||||||||||||||||| |||||||||||||| 
Sbjct: 191 tccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttg 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | ||  ||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 131 acgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcg 72

                                                                      
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||||||||| |||||||||||||||||||||||||| || ||||| || ||||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgcc 13



to top

>ref|XM_848870.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
            (LOC611231), mRNA
          Length = 1428

 Score =  353 bits (178), Expect = 4e-94
 Identities = 277/310 (89%)
 Strand = Plus / Minus

                                                                        
Query: 166  agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
            |||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||||||||
Sbjct: 1426 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcatagaccacgtccatgg 1367

                                                                        
Query: 226  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
            | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 1366 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 1307

                                                                        
Query: 286  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
            | ||||| | |||||| || ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 1306 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 1247

                                                                        
Query: 346  cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
            ||||||| | ||  ||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 1246 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 1187

                                                                        
Query: 406  gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
            |||||||||| |||||||||||||||||||||||||| || ||||| || ||||||||||
Sbjct: 1186 gcagcaccttgcggtggcgcttggcgccgcccttgcctagtcccttcccgcccttgccgc 1127

                      
Query: 466  gcccggacat 475
            | || |||||
Sbjct: 1126 gaccagacat 1117



to top

>gb|BT017112.1| Zea mays clone EL01N0363G04.c mRNA sequence
          Length = 666

 Score =  351 bits (177), Expect = 1e-93
 Identities = 270/301 (89%)
 Strand = Plus / Minus

                                                                       
Query: 163 cctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcca 222
           ||||||||||||| || || || ||||| |||||||| ||||| ||||| ||||||||||
Sbjct: 387 cctagccgccgaagccataaagagtgcggccctggcgtttgagggcgtacacgacgtcca 328

                                                                       
Query: 223 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 282
           | ||||||||||| ||||| ||||||||||| |||||||| || |||||||||||||| |
Sbjct: 327 tagcggtgacggttttgcgacgggcgtgctccgtgtaggtcacagcgtcgcggatgacat 268

                                                                       
Query: 283 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgct 342
           ||||||| ||||||||||| ||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 267 tctcgagaaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgct 208

                                                                       
Query: 343 tcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgt 402
           ||||||| |||||||||||||| |  ||||| |||||||| ||||| |||||||||||||
Sbjct: 207 tcacgccacccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 148

                                                                       
Query: 403 cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgc 462
           ||||||||||||||||||| ||||| ||||||||||| ||||| |||||||| |||||||
Sbjct: 147 cgcgcagcaccttccggtgacgcttcgcgccgcccttcccgagccccttgccgcccttgc 88

            
Query: 463 c 463
           |
Sbjct: 87  c 87



to top

>ref|XM_848834.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611192), mRNA
          Length = 405

 Score =  347 bits (175), Expect = 2e-92
 Identities = 256/283 (90%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 403 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 344

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 343 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 284

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | |||||| || ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 283 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 224

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||| | ||  ||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 223 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 164

                                                      
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacc 448
           |||||||||| ||||||||||||||||||||||||||| ||||
Sbjct: 163 gcagcaccttgcggtggcgcttggcgccgcccttgccgcgacc 121



to top

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  341 bits (172), Expect = 1e-90
 Identities = 277/312 (88%)
 Strand = Plus / Plus

                                                                        
Query: 165  tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 1030 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1089

                                                                        
Query: 225  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
            |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 1090 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 1149

                                                                        
Query: 285  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
            || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 1150 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 1209

                                                                        
Query: 345  acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
            || || || | ||  |||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 1210 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 1269

                                                                        
Query: 405  cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
            || || ||||| ||||||||||| |||||||| ||||| || || || ||||||||||||
Sbjct: 1270 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 1329

                        
Query: 465  cgcccggacatg 476
            || || ||||||
Sbjct: 1330 cgacccgacatg 1341



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  341 bits (172), Expect = 1e-90
 Identities = 277/312 (88%)
 Strand = Plus / Minus

                                                                          
Query: 165    tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
              |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 127531 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 127472

                                                                          
Query: 225    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
              |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 127471 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 127412

                                                                          
Query: 285    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
              || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 127411 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 127352

                                                                          
Query: 345    acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
              || || || | ||  |||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 127351 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 127292

                                                                          
Query: 405    cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
              || || ||||| ||||||||||| |||||||| ||||| || || || ||||||||||||
Sbjct: 127291 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 127232

                          
Query: 465    cgcccggacatg 476
              || || ||||||
Sbjct: 127231 cgacccgacatg 127220



 Score =  327 bits (165), Expect = 2e-86
 Identities = 270/305 (88%)
 Strand = Plus / Plus

                                                                          
Query: 171    ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
              |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 131053 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 131112

                                                                          
Query: 231    acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
              |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 131113 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 131172

                                                                          
Query: 291    aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
              || | ||| || || ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 131173 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 131232

                                                                          
Query: 351    cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
              || | ||  |||||||| |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 131233 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 131292

                                                                          
Query: 411    accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
              || || || |||||||| ||||| || ||||| || || || |||||||||||||| || 
Sbjct: 131293 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 131352

                   
Query: 471    gacat 475
              |||||
Sbjct: 131353 gacat 131357



to top

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
            complete cds
          Length = 2321

 Score =  341 bits (172), Expect = 1e-90
 Identities = 277/312 (88%)
 Strand = Plus / Minus

                                                                        
Query: 165  tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 1858 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1799

                                                                        
Query: 225  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
            |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 1798 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 1739

                                                                        
Query: 285  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
            || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 1738 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 1679

                                                                        
Query: 345  acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
            || || || | ||  |||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 1678 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 1619

                                                                        
Query: 405  cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
            || || ||||| ||||||||||| |||||||| ||||| || || || ||||||||||||
Sbjct: 1618 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 1559

                        
Query: 465  cgcccggacatg 476
            || || ||||||
Sbjct: 1558 cgacccgacatg 1547



to top

>gb|AY158965.1| Mus musculus histone protein Hist1h4a gene, complete cds
          Length = 1246

 Score =  341 bits (172), Expect = 1e-90
 Identities = 277/312 (88%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 748 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 689

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 688 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 629

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 628 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 569

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 568 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 509

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           || || ||||| ||||||||||| |||||||| ||||| || || || ||||||||||||
Sbjct: 508 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 449

                       
Query: 465 cgcccggacatg 476
           || || ||||||
Sbjct: 448 cgacccgacatg 437



to top

>ref|NM_178192.1| Mus musculus histone 1, H4a (Hist1h4a), mRNA
          Length = 312

 Score =  339 bits (171), Expect = 5e-90
 Identities = 276/311 (88%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 131 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 72

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           || || ||||| ||||||||||| |||||||| ||||| || || || ||||||||||||
Sbjct: 71  cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 12

                      
Query: 465 cgcccggacat 475
           || || |||||
Sbjct: 11  cgacccgacat 1



to top

>ref|XM_849000.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611344), mRNA
          Length = 456

 Score =  339 bits (171), Expect = 5e-90
 Identities = 258/287 (89%)
 Strand = Plus / Minus

                                                                       
Query: 177 ccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtc 236
           |||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||| |||
Sbjct: 443 ccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggccgtgaccgtc 384

                                                                       
Query: 237 ttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatc 296
           |||||   ||||||||| ||||||||||||||||| ||||| |||||||| ||||| | |
Sbjct: 383 ttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttctccaggaacacc 324

                                                                       
Query: 297 ttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctc 356
           ||||| || ||||||||||||||||||||||| |||||||||||||| |||||||| | |
Sbjct: 323 ttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccgccgcgc 264

                                                                       
Query: 357 ctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttc 416
           |  ||||| || |||||||| |||||||||||||||||||||||||||||||||||||| 
Sbjct: 263 cgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgcgcagcaccttg 204

                                                          
Query: 417 cggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           |||||||||||||||||||||||||| || ||||| || ||||||||
Sbjct: 203 cggtggcgcttggcgccgcccttgcccagccccttcccgcccttgcc 157



to top

>ref|NM_153173.1| Mus musculus histone 1, H4h (Hist1h4h), mRNA
          Length = 472

 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 375 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 316

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 315 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 256

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 255 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 196

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 195 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 136

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || |||||||||||||||||||| ||||| ||||| || || |||||||| || 
Sbjct: 135 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 76

                     
Query: 468 ccggacatgg 477
           || |||||||
Sbjct: 75  ccagacatgg 66



to top

>gb|BC058529.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:6817839),
           partial cds
          Length = 457

 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 316 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 257

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 256 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 197

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 196 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 137

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 136 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 77

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || |||||||||||||||||||| ||||| ||||| || || |||||||| || 
Sbjct: 76  agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 17

                     
Query: 468 ccggacatgg 477
           || |||||||
Sbjct: 16  ccagacatgg 7



to top

>gb|BC028550.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:1398106),
           partial cds
          Length = 439

 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 320 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 261

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 260 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 201

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 200 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 141

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 140 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 81

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || |||||||||||||||||||| ||||| ||||| || || |||||||| || 
Sbjct: 80  agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 21

                     
Query: 468 ccggacatgg 477
           || |||||||
Sbjct: 20  ccagacatgg 11



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Plus

                                                                          
Query: 168    ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
              ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 103956 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 104015

                                                                          
Query: 228    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
              ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 104016 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 104075

                                                                          
Query: 288    aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
              ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 104076 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 104135

                                                                          
Query: 348    ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
              || || | ||  |||||||| |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 104136 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 104195

                                                                          
Query: 408    agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
              ||||| || |||||||||||||||||||| ||||| ||||| || || |||||||| || 
Sbjct: 104196 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 104255

                        
Query: 468    ccggacatgg 477
              || |||||||
Sbjct: 104256 ccagacatgg 104265



 Score =  325 bits (164), Expect = 8e-86
 Identities = 275/312 (88%)
 Strand = Plus / Plus

                                                                         
Query: 165   tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
             |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 53466 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 53525

                                                                         
Query: 225   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
             |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 53526 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 53585

                                                                         
Query: 285   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
             || ||||| | ||| || || || |||||||||||||||||||| || ||||||||||||
Sbjct: 53586 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 53645

                                                                         
Query: 345   acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
             || || || | ||  |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 53646 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 53705

                                                                         
Query: 405   cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
             ||||| || || ||||||||||| || || ||||| || ||||||||||| || || |||
Sbjct: 53706 cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 53765

                         
Query: 465   cgcccggacatg 476
             || || ||||||
Sbjct: 53766 cgtccagacatg 53777



 Score =  317 bits (160), Expect = 2e-83
 Identities = 274/312 (87%)
 Strand = Plus / Minus

                                                                         
Query: 168   ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
             ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 84042 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 83983

                                                                         
Query: 228   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 83982 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 83923

                                                                         
Query: 288   aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
             ||||| | ||| || || |||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 83922 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 83863

                                                                         
Query: 348   ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
             || || | ||  |||||||| |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 83862 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 83803

                                                                         
Query: 408   agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
             || ||||| ||||||||||| |||||||| ||||| || || || |||||||| || || 
Sbjct: 83802 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 83743

                         
Query: 468   ccggacatggct 479
             || |||||||||
Sbjct: 83742 ccagacatggct 83731



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                         
Query: 168   ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
             ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 12024 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 11965

                                                                         
Query: 228   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 11964 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 11905

                                                                         
Query: 288   aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
             ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 11904 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 11845

                                                                         
Query: 348   ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
             || || | ||  |||||||| |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 11844 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 11785

                                                                         
Query: 408   agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
             ||||| || |||||||||||||||||||| ||||| ||||| || || |||||||| || 
Sbjct: 11784 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 11725

                       
Query: 468   ccggacatgg 477
             || |||||||
Sbjct: 11724 ccagacatgg 11715



 Score =  325 bits (164), Expect = 8e-86
 Identities = 275/312 (88%)
 Strand = Plus / Minus

                                                                         
Query: 165   tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
             |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 62327 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 62268

                                                                         
Query: 225   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
             |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 62267 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 62208

                                                                         
Query: 285   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
             || ||||| | ||| || || || |||||||||||||||||||| || ||||||||||||
Sbjct: 62207 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 62148

                                                                         
Query: 345   acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
             || || || | ||  |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 62147 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 62088

                                                                         
Query: 405   cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
             ||||| || || ||||||||||| || || ||||| || ||||||||||| || || |||
Sbjct: 62087 cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 62028

                         
Query: 465   cgcccggacatg 476
             || || ||||||
Sbjct: 62027 cgtccagacatg 62016



 Score =  317 bits (160), Expect = 2e-83
 Identities = 274/312 (87%)
 Strand = Plus / Plus

                                                                         
Query: 168   ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
             ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 31942 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 32001

                                                                         
Query: 228   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 32002 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 32061

                                                                         
Query: 288   aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
             ||||| | ||| || || |||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 32062 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 32121

                                                                         
Query: 348   ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
             || || | ||  |||||||| |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 32122 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 32181

                                                                         
Query: 408   agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
             || ||||| ||||||||||| |||||||| ||||| || || || |||||||| || || 
Sbjct: 32182 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 32241

                         
Query: 468   ccggacatggct 479
             || |||||||||
Sbjct: 32242 ccagacatggct 32253



 Score =  287 bits (145), Expect = 2e-74
 Identities = 238/269 (88%)
 Strand = Plus / Plus

                                                                          
Query: 168    ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
              ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 178557 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 178616

                                                                          
Query: 228    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
              ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 178617 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 178676

                                                                          
Query: 288    aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
              ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 178677 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 178736

                                                                          
Query: 348    ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
              || || | ||  |||||||| |||||||| |||||||| |||||||||||||| || || 
Sbjct: 178737 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 178796

                                           
Query: 408    agcaccttccggtggcgcttggcgccgcc 436
              || ||||| ||||||||||| ||||||||
Sbjct: 178797 agaaccttacggtggcgcttagcgccgcc 178825



to top

>gb|BC087952.1| Mus musculus histone 1, H4h, mRNA (cDNA clone MGC:107599
           IMAGE:6787571), complete cds
          Length = 472

 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 368 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 309

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 308 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 249

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 248 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 189

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 188 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 129

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || |||||||||||||||||||| ||||| ||||| || || |||||||| || 
Sbjct: 128 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 69

                     
Query: 468 ccggacatgg 477
           || |||||||
Sbjct: 68  ccagacatgg 59



to top

>dbj|AK007642.1| Mus musculus 10 day old male pancreas cDNA, RIKEN full-length
           enriched library, clone:1810029H14 product:histone 4
           protein, full insert sequence
          Length = 472

 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 375 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 316

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 315 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 256

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 255 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 196

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 195 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 136

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || |||||||||||||||||||| ||||| ||||| || || |||||||| || 
Sbjct: 135 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 76

                     
Query: 468 ccggacatgg 477
           || |||||||
Sbjct: 75  ccagacatgg 66



to top

>gb|AY158960.1| Mus musculus histone protein Hist1h4h gene, complete cds
          Length = 1470

 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 873 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 814

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 813 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 754

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 753 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 694

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 693 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 634

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || |||||||||||||||||||| ||||| ||||| || || |||||||| || 
Sbjct: 633 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 574

                     
Query: 468 ccggacatgg 477
           || |||||||
Sbjct: 573 ccagacatgg 564



to top

>ref|NM_178193.1| Mus musculus histone 1, H4b (Hist1h4b), mRNA
          Length = 312

 Score =  327 bits (165), Expect = 2e-86
 Identities = 270/305 (88%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 305 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 246

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 245 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 186

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 185 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 126

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || | ||  |||||||| |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 125 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 66

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || || |||||||| ||||| || ||||| || || || |||||||||||||| || 
Sbjct: 65  actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 6

                
Query: 471 gacat 475
           |||||
Sbjct: 5   gacat 1



to top

>dbj|AK016310.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930578O05 product:histone 4 protein,
           full insert sequence
          Length = 541

 Score =  327 bits (165), Expect = 2e-86
 Identities = 277/313 (88%), Gaps = 1/313 (0%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 385 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 326

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 325 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 266

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 265 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 206

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 205 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 146

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgc-ccttgccgagacccttgcctcccttgcc 463
           || || ||||| ||||||||||| ||||||| | ||||| || || || |||||||||||
Sbjct: 145 cggagaaccttacggtggcgcttagcgccgcgctttgcccaggccttttcctcccttgcc 86

                        
Query: 464 gcgcccggacatg 476
           ||| || ||||||
Sbjct: 85  gcgacccgacatg 73



to top

>gb|AY158964.1| Mus musculus histone protein Hist1h4b gene, complete cds
          Length = 1186

 Score =  327 bits (165), Expect = 2e-86
 Identities = 270/305 (88%)
 Strand = Plus / Plus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 505 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 564

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 565 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 624

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 625 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 684

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || | ||  |||||||| |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 685 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 744

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || || |||||||| ||||| || ||||| || || || |||||||||||||| || 
Sbjct: 745 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 804

                
Query: 471 gacat 475
           |||||
Sbjct: 805 gacat 809



to top

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score =  325 bits (164), Expect = 8e-86
 Identities = 275/312 (88%)
 Strand = Plus / Plus

                                                                         
Query: 165   tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
             |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 32015 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 32074

                                                                         
Query: 225   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
             |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 32075 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 32134

                                                                         
Query: 285   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
             || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 32135 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 32194

                                                                         
Query: 345   acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
             || || || | ||  |||||||| |||||||| ||||| ||||||||||||||||| |||
Sbjct: 32195 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 32254

                                                                         
Query: 405   cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
             |||||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| 
Sbjct: 32255 cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcca 32314

                         
Query: 465   cgcccggacatg 476
             || || ||||||
Sbjct: 32315 cgaccagacatg 32326



 Score =  325 bits (164), Expect = 8e-86
 Identities = 275/312 (88%)
 Strand = Plus / Minus

                                                                         
Query: 165   tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
             |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 12261 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 12202

                                                                         
Query: 225   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
             |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 12201 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 12142

                                                                         
Query: 285   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
             || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 12141 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 12082

                                                                         
Query: 345   acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
             || || || | ||  |||||||| |||||||| ||||| ||||||||||||||||| |||
Sbjct: 12081 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 12022

                                                                         
Query: 405   cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
             |||||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| 
Sbjct: 12021 cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcca 11962

                         
Query: 465   cgcccggacatg 476
             || || ||||||
Sbjct: 11961 cgaccagacatg 11950



to top

>gb|AY158962.1| Mus musculus histone protein Hist1h4d gene, complete cds
          Length = 1309

 Score =  325 bits (164), Expect = 8e-86
 Identities = 275/312 (88%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 811 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 752

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 751 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 692

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || || |||||||||||||||||||| || ||||||||||||
Sbjct: 691 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 632

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 631 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 572

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||| || || ||||||||||| || || ||||| || ||||||||||| || || |||
Sbjct: 571 cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 512

                       
Query: 465 cgcccggacatg 476
           || || ||||||
Sbjct: 511 cgtccagacatg 500



to top

>gb|AY158958.1| Mus musculus histone protein Hist1h4m gene, complete cds
          Length = 1309

 Score =  325 bits (164), Expect = 8e-86
 Identities = 275/312 (88%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 811 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 752

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 751 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 692

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 691 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 632

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| ||||| ||||||||||||||||| |||
Sbjct: 631 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 572

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           |||||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| 
Sbjct: 571 cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcca 512

                       
Query: 465 cgcccggacatg 476
           || || ||||||
Sbjct: 511 cgaccagacatg 500



to top

>ref|NM_175657.1| Mus musculus histone 1, H4m (Hist1h4m), mRNA
          Length = 312

 Score =  323 bits (163), Expect = 3e-85
 Identities = 265/299 (88%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| ||||| ||||||||||||||||| |||
Sbjct: 131 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 72

                                                                      
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           |||||||| || |||||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 71  cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcc 13



to top

>ref|NM_175654.1| Mus musculus histone 1, H4d (Hist1h4d), mRNA
          Length = 312

 Score =  323 bits (163), Expect = 3e-85
 Identities = 274/311 (88%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || || |||||||||||||||||||| || ||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 131 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 72

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||| || || ||||||||||| || || ||||| || ||||||||||| || || |||
Sbjct: 71  cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 12

                      
Query: 465 cgcccggacat 475
           || || |||||
Sbjct: 11  cgtccagacat 1



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  319 bits (161), Expect = 5e-84
 Identities = 242/269 (89%)
 Strand = Plus / Plus

                                                                          
Query: 165    tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
              ||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 171185 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 171244

                                                                          
Query: 225    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
              |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 171245 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 171304

                                                                          
Query: 285    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
              || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 171305 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 171364

                                                                          
Query: 345    acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
              || || || | ||  |||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 171365 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 171424

                                           
Query: 405    cgcagcaccttccggtggcgcttggcgcc 433
              |||||||| || |||||||||||||||||
Sbjct: 171425 cgcagcactttgcggtggcgcttggcgcc 171453



 Score =  311 bits (157), Expect = 1e-81
 Identities = 241/269 (89%)
 Strand = Plus / Minus

                                                                          
Query: 165    tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
              ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 156396 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 156337

                                                                          
Query: 225    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
              |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 156336 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 156277

                                                                          
Query: 285    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
              || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 156276 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 156217

                                                                          
Query: 345    acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
              || || || | ||  |||||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 156216 actcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcg 156157

                                           
Query: 405    cgcagcaccttccggtggcgcttggcgcc 433
              |||||||| || ||||||||||| |||||
Sbjct: 156156 cgcagcactttgcggtggcgcttagcgcc 156128



to top

>dbj|AK139521.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
           clone:B020002O07 product:histone 1, H4j, full insert
           sequence
          Length = 594

 Score =  319 bits (161), Expect = 5e-84
 Identities = 242/269 (89%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 346 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 287

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 286 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 227

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 226 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 167

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 166 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 107

                                        
Query: 405 cgcagcaccttccggtggcgcttggcgcc 433
           |||||||| || |||||||||||||||||
Sbjct: 106 cgcagcactttgcggtggcgcttggcgcc 78



to top

>gb|BC096767.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:30094179)
          Length = 3447

 Score =  319 bits (161), Expect = 5e-84
 Identities = 242/269 (89%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 326 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 267

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 266 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 207

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 206 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 147

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 146 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 87

                                        
Query: 405 cgcagcaccttccggtggcgcttggcgcc 433
           |||||||| || |||||||||||||||||
Sbjct: 86  cgcagcactttgcggtggcgcttggcgcc 58



to top

>gb|AY158957.1| Mus musculus histone protein Hist1h4k gene, complete cds
          Length = 1309

 Score =  319 bits (161), Expect = 5e-84
 Identities = 242/269 (89%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 811 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 752

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 751 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 692

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 691 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 632

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 631 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 572

                                        
Query: 405 cgcagcaccttccggtggcgcttggcgcc 433
           |||||||| || |||||||||||||||||
Sbjct: 571 cgcagcactttgcggtggcgcttggcgcc 543



to top

>ref|NM_178211.1| Mus musculus histone 1, H4k (Hist1h4k), mRNA
          Length = 312

 Score =  319 bits (161), Expect = 5e-84
 Identities = 242/269 (89%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 131 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 72

                                        
Query: 405 cgcagcaccttccggtggcgcttggcgcc 433
           |||||||| || |||||||||||||||||
Sbjct: 71  cgcagcactttgcggtggcgcttggcgcc 43



to top

>ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (predicted)
            (Hist1h2bm_predicted), mRNA
          Length = 1023

 Score =  317 bits (160), Expect = 2e-83
 Identities = 274/312 (87%)
 Strand = Plus / Minus

                                                                        
Query: 165  tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
            ||||| ||||| || |||||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 1013 tagccaccgaagccatagagggtacggccctggcgcttgagcgcgtagaccacgtccatg 954

                                                                        
Query: 225  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
            |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 953  gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttt 894

                                                                        
Query: 285  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
            || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 893  tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 834

                                                                        
Query: 345  acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
            || || |||| ||  |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 833  actcctccccgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 774

                                                                        
Query: 405  cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
            ||||| || || ||||||||||| |||||||| ||||| |||||||| || |||||||| 
Sbjct: 773  cgcaggactttgcggtggcgcttagcgccgcctttgcccagacccttcccgcccttgcct 714

                        
Query: 465  cgcccggacatg 476
            || || ||||||
Sbjct: 713  cggccagacatg 702



to top

>gb|AY158961.1| Mus musculus histone protein Hist1h4f gene, complete cds
          Length = 1309

 Score =  317 bits (160), Expect = 2e-83
 Identities = 274/312 (87%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || |||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 629

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 628 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 569

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           || ||||| ||||||||||| |||||||| ||||| || || || |||||||| || || 
Sbjct: 568 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 509

                       
Query: 468 ccggacatggct 479
           || |||||||||
Sbjct: 508 ccagacatggct 497



to top

>ref|NM_175655.1| Mus musculus histone 1, H4f (Hist1h4f), mRNA
          Length = 312

 Score =  311 bits (157), Expect = 1e-81
 Identities = 259/293 (88%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 308 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 249

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 248 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 189

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || |||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 188 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 129

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 128 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 69

                                                                
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
           || ||||| ||||||||||| |||||||| ||||| || || || ||||||||
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctccctt 16



to top

>ref|NM_178210.1| Mus musculus histone 1, H4j (Hist1h4j), mRNA
          Length = 312

 Score =  311 bits (157), Expect = 1e-81
 Identities = 241/269 (89%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 131 actcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcg 72

                                        
Query: 405 cgcagcaccttccggtggcgcttggcgcc 433
           |||||||| || ||||||||||| |||||
Sbjct: 71  cgcagcactttgcggtggcgcttagcgcc 43



to top

>gb|AY158956.1| Mus musculus histone protein Hist1h4j gene, complete cds
          Length = 1776

 Score =  311 bits (157), Expect = 1e-81
 Identities = 241/269 (89%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 845 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 786

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 785 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 726

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 725 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 666

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||||| ||||| |||||||||||||||||||||
Sbjct: 665 actcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcg 606

                                        
Query: 405 cgcagcaccttccggtggcgcttggcgcc 433
           |||||||| || ||||||||||| |||||
Sbjct: 605 cgcagcactttgcggtggcgcttagcgcc 577



to top

>gb|AF140034.1|AF140034 Phreatamoeba balamuthi histone H4 mRNA, complete cds
          Length = 394

 Score =  311 bits (157), Expect = 1e-81
 Identities = 241/269 (89%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||| ||||| ||||||||||||||||||||||| |||||||||
Sbjct: 326 tagccgccgaagccgtagagcgtgcggccctggcgcttgagcgcgtagacaacgtccatg 267

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| |||||||| | ||||||||| ||||| ||||| | ||||||||||||||||
Sbjct: 266 gccgtgaccgtcttgcgcctggcgtgctccgtgtacgtgaccgagtcgcggatgacgttc 207

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           |||||||||| |||||| |||||||| ||||||||||||||||||||   ||||||||| 
Sbjct: 206 tcgaggaagaccttgagcacgccgcgcgtctcctcgtagatgagcccgctgatgcgcttg 147

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           ||||| || |  | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 146 acgcccccgcggcgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 87

                                        
Query: 405 cgcagcaccttccggtggcgcttggcgcc 433
           ||||||||||| ||||| | |||||||||
Sbjct: 86  cgcagcaccttgcggtgcctcttggcgcc 58



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 448 ccttgcctcccttgccgcgcccgg 471
           ||||||||||||||||||| ||||
Sbjct: 28  ccttgcctcccttgccgcgtccgg 5



to top

>ref|XM_543797.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC486670), mRNA
          Length = 561

 Score =  305 bits (154), Expect = 8e-80
 Identities = 271/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| ||||| |||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 559 agccgccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 500

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||| ||||||||   ||||||||| |||||||| || ||||||||||| |||||||
Sbjct: 499 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcaccgcgtcgcggatcacgttct 440

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | |||||| || |||||||||||||||||||||||||| || ||||||||||
Sbjct: 439 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgagcccagaaatgcgcttca 380

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           | ||||| |  |  || || || |||||||| ||||| |||||||||||||||||||| |
Sbjct: 379 ccccgcctcggcgggcaagccggcggatggcgggcttcgtgatgccctggatgttgtccc 320

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||| ||||||||||||||||||||||| |||||||| || || ||||| || || ||||
Sbjct: 319 gcaggaccttccggtggcgcttggcgcctcccttgcccagccctttgccgcctttcccgc 260

                     
Query: 466 gcccggacat 475
           ||||||||||
Sbjct: 259 gcccggacat 250



to top

>emb|CR719166.2|CNS0GHUS Tetraodon nigroviridis full-length cDNA
          Length = 522

 Score =  305 bits (154), Expect = 8e-80
 Identities = 265/302 (87%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||| ||||| ||||| |||||||||||||| |||||||||||||| || || ||||||
Sbjct: 344 tagcctccgaagccgtacagggtgcgtccctgccgcttgagcgcgtacaccacatccatg 285

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||| |    |||||||||||||||||||||||| || ||||| ||||||
Sbjct: 284 gcggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgttc 225

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | |||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 224 tccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgcttg 165

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| |  |  |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 164 acgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 105

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           || |||||||| ||||||||||||||||| || ||||| || || |||||||| ||||||
Sbjct: 104 cggagcaccttgcggtggcgcttggcgcctcctttgcccaggcctttgcctcctttgccg 45

             
Query: 465 cg 466
           ||
Sbjct: 44  cg 43



to top

>emb|CR707537.2|CNS0G8VX Tetraodon nigroviridis full-length cDNA
          Length = 625

 Score =  305 bits (154), Expect = 8e-80
 Identities = 265/302 (87%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||| ||||| ||||| |||||||||||||| |||||||||||||| || || ||||||
Sbjct: 444 tagcctccgaagccgtacagggtgcgtccctgccgcttgagcgcgtacaccacatccatg 385

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||| |    |||||||||||||||||||||||| || ||||| ||||||
Sbjct: 384 gcggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgttc 325

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | |||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 324 tccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgcttg 265

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| |  |  |||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 264 acgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 205

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           || |||||||| ||||||||||||||||| || ||||| || || |||||||| ||||||
Sbjct: 204 cggagcaccttgcggtggcgcttggcgcctcctttgcccaggcctttgcctcctttgccg 145

             
Query: 465 cg 466
           ||
Sbjct: 144 cg 143



to top

>emb|X13235.1|MMHIS412 Mouse histone H4 gene (clone 12)
          Length = 637

 Score =  305 bits (154), Expect = 8e-80
 Identities = 271/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 541 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 482

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 481 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 422

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 421 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 362

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 361 cccccgcgccgggccaggcggcggatggcaggcttggtgatgccctggatgttatcgcgg 302

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           || ||||| ||||||||||| |||||||| || || || || || || |||||||| || 
Sbjct: 301 agaaccttacggtggcgcttagcgccgcctttcccaaggcctttaccacccttgccacgt 242

                     
Query: 468 ccggacatgg 477
           || |||||||
Sbjct: 241 ccagacatgg 232



to top

>dbj|AK010085.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310067E17 product:histone 4 protein,
           full insert sequence
          Length = 778

 Score =  303 bits (153), Expect = 3e-79
 Identities = 240/269 (89%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 347 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 288

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 287 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 228

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 227 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 168

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| |||||| | ||||| |||||||||||||||||||||
Sbjct: 167 actcccccgcgccgggccaggcggcggatgacgggcttcgtgatgccctggatgttgtcg 108

                                        
Query: 405 cgcagcaccttccggtggcgcttggcgcc 433
           |||||||| || ||||||||||| |||||
Sbjct: 107 cgcagcactttgcggtggcgcttagcgcc 79



to top

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
            genes, complete cds
          Length = 1338

 Score =  301 bits (152), Expect = 1e-78
 Identities = 272/312 (87%)
 Strand = Plus / Minus

                                                                        
Query: 165  tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
            ||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 1204 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1145

                                                                        
Query: 225  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
            ||||| |||||||| ||||| |||||||||||||||||||| | ||||||||||||||||
Sbjct: 1144 gcggtcacggtctttcggcgagcgtgctcggtgtaggtgaccgagtcgcggatgacgttc 1085

                                                                        
Query: 285  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
            || |||||| ||||||| ||   |||||||||||||||||| || ||   ||| ||||||
Sbjct: 1084 tccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccgctgatacgcttc 1025

                                                                        
Query: 345  acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
            || ||||| |  |  ||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 1024 acaccgccacgacgagccagacggcggatagcgggcttggtgatgccctggatgttgtcg 965

                                                                        
Query: 405  cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
            || |||||||| || ||||||||||||||||||||||| || |||||||| |||||||| 
Sbjct: 964  cggagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgcca 905

                        
Query: 465  cgcccggacatg 476
            || |||||||||
Sbjct: 904  cgtccggacatg 893



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III),
            histone H2B (ch2b-III) and histone H2A (ch2a-III) genes,
            complete cds
          Length = 4582

 Score =  301 bits (152), Expect = 1e-78
 Identities = 272/312 (87%)
 Strand = Plus / Minus

                                                                        
Query: 165  tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
            ||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 1466 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1407

                                                                        
Query: 225  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
            ||||| |||||||||||||| |||||||||||||||||||| | ||||||||||||||||
Sbjct: 1406 gcggtcacggtcttgcggcgagcgtgctcggtgtaggtgaccgagtcgcggatgacgttc 1347

                                                                        
Query: 285  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
            || |||||| |||| || ||   ||||||||||||||||||||| ||   ||| ||||||
Sbjct: 1346 tccaggaaggtcttcagcaccgtgcgggtctcctcgtagatgaggccgctgatacgcttc 1287

                                                                        
Query: 345  acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
            || ||||| |  |  ||||| || ||||| || ||||| |||||||||||||||||||||
Sbjct: 1286 acaccgccacggcgagccagacggcggatagcgggcttcgtgatgccctggatgttgtcg 1227

                                                                        
Query: 405  cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
            || |||||||| || ||||||||||||||||||||||| || |||||||| |||||||| 
Sbjct: 1226 cggagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgcca 1167

                        
Query: 465  cgcccggacatg 476
            || |||||||||
Sbjct: 1166 cgtccggacatg 1155



to top

>emb|X13236.1|MMHIS453 Mouse histone H4 gene
          Length = 1678

 Score =  299 bits (151), Expect = 5e-78
 Identities = 266/305 (87%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||||||||| |||||||| ||||||  |||||| |||||||||||||||
Sbjct: 964 ccgaatccgtagagggtgcggccctggcgyttgagccggtagaccacgtccatggcggtg 905

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 904 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 845

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 844 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 785

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || | ||  |||||||| |||||||| ||||| |||||||||||||||||||||||||||
Sbjct: 784 ccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcgcgcagc 725

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || || |||||||| ||||| || ||||| || || || |||||||||||||| || 
Sbjct: 724 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 665

                
Query: 471 gacat 475
           |||||
Sbjct: 664 gacat 660



to top

>gb|BC052219.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC:60536
           IMAGE:30017176), complete cds
          Length = 724

 Score =  295 bits (149), Expect = 7e-77
 Identities = 269/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| ||||| || || || ||||||||||||||||||||||| ||||||||||||
Sbjct: 320 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 261

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 260 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 201

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 200 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 141

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| |||||||||||||||||||||||||| || 
Sbjct: 140 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 81

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 80  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 21

                    
Query: 468 ccggacatg 476
           || ||||||
Sbjct: 20  ccagacatg 12



to top

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score =  295 bits (149), Expect = 7e-77
 Identities = 269/309 (87%)
 Strand = Plus / Plus

                                                                         
Query: 168   ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
             |||||||| ||||| || || || ||||||||||||||||||||||| ||||||||||||
Sbjct: 58372 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 58431

                                                                         
Query: 228   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 58432 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 58491

                                                                         
Query: 288   aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
             ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 58492 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 58551

                                                                         
Query: 348   ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
             || || | ||  |||||||| |||||||| |||||||||||||||||||||||||| || 
Sbjct: 58552 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 58611

                                                                         
Query: 408   agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
             ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 58612 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 58671

                      
Query: 468   ccggacatg 476
             || ||||||
Sbjct: 58672 ccagacatg 58680



to top

>gb|BC092144.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC:106611
           IMAGE:30612926), complete cds
          Length = 562

 Score =  295 bits (149), Expect = 7e-77
 Identities = 269/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| ||||| || || || ||||||||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 97  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                    
Query: 468 ccggacatg 476
           || ||||||
Sbjct: 37  ccagacatg 29



to top

>ref|NM_175656.2| Mus musculus histone 1, H4i (Hist1h4i), mRNA
          Length = 562

 Score =  295 bits (149), Expect = 7e-77
 Identities = 269/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| ||||| || || || ||||||||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 97  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                    
Query: 468 ccggacatg 476
           || ||||||
Sbjct: 37  ccagacatg 29



to top

>gb|AY158959.1| Mus musculus histone protein Hist1h4i gene, complete cds
          Length = 1309

 Score =  295 bits (149), Expect = 7e-77
 Identities = 269/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| ||||| || || || ||||||||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 629

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| |||||||||||||||||||||||||| || 
Sbjct: 628 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 569

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 568 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 509

                    
Query: 468 ccggacatg 476
           || ||||||
Sbjct: 508 ccagacatg 500



to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score =  293 bits (148), Expect = 3e-76
 Identities = 271/312 (86%)
 Strand = Plus / Minus

                                                                        
Query: 165  tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
            ||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 1271 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1212

                                                                        
Query: 225  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
            ||||| |||||||||||||| |||||||||||||| ||||| | ||||||||||||||||
Sbjct: 1211 gcggtcacggtcttgcggcgagcgtgctcggtgtatgtgaccgagtcgcggatgacgttc 1152

                                                                        
Query: 285  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
            || |||||| ||||||| ||   |||||||||||||||||| || ||   ||| ||||||
Sbjct: 1151 tccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccgctgatacgcttc 1092

                                                                        
Query: 345  acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
            || ||||| |  |  ||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 1091 acaccgccacgacgagccagacggcggatagcgggcttggtgatgccctggatgttgtcg 1032

                                                                        
Query: 405  cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
            || |||||||| || ||||||||||| ||||||||||| || |||||||| |||||||| 
Sbjct: 1031 cgaagcaccttgcgatggcgcttggcaccgcccttgcccaggcccttgccgcccttgcca 972

                        
Query: 465  cgcccggacatg 476
            || |||||||||
Sbjct: 971  cgtccggacatg 960



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score =  293 bits (148), Expect = 3e-76
 Identities = 271/312 (86%)
 Strand = Plus / Minus

                                                                        
Query: 165  tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
            ||||| ||||| ||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 1279 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1220

                                                                        
Query: 225  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
            || || |||||||||||||| |||||||||||||||||||||| ||||||||||||||||
Sbjct: 1219 gcagtcacggtcttgcggcgagcgtgctcggtgtaggtgacggagtcgcggatgacgttc 1160

                                                                        
Query: 285  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
            || |||||| ||||||| ||   |||||||||||||||||| || ||   ||| ||||||
Sbjct: 1159 tccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccactgatacgcttc 1100

                                                                        
Query: 345  acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
            || ||||| |  |  ||||| || ||||| || ||||||||||| ||||||||||| |||
Sbjct: 1099 acaccgccacggcgagccagacggcggatagcgggcttggtgatcccctggatgttatcg 1040

                                                                        
Query: 405  cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
            || |||||||| || ||||||||||||||||||||||| || |||||||| |||||||| 
Sbjct: 1039 cgaagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgcca 980

                        
Query: 465  cgcccggacatg 476
            || |||||||||
Sbjct: 979  cgtccggacatg 968



to top

>ref|NM_178208.1| Mus musculus histone 1, H4c (Hist1h4c), mRNA
          Length = 312

 Score =  287 bits (145), Expect = 2e-74
 Identities = 238/269 (88%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 308 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 249

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 248 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 189

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 188 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 129

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| |||||||| |||||||||||||| || || 
Sbjct: 128 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 69

                                        
Query: 408 agcaccttccggtggcgcttggcgccgcc 436
           || ||||| ||||||||||| ||||||||
Sbjct: 68  agaaccttacggtggcgcttagcgccgcc 40



to top

>emb|AJ249813.1|MAL249813 Mortierella alpina histone H3.2 and H4.2 genes for histone H3 and for
            histone H4
          Length = 1860

 Score =  287 bits (145), Expect = 2e-74
 Identities = 268/309 (86%)
 Strand = Plus / Minus

                                                                        
Query: 168  ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
            |||||||| ||||||||||||||||||||||||||||| ||||||||||| || |  | |
Sbjct: 1596 ccgccgaaaccgtagagggtgcgtccctggcgcttgagggcgtagacgacatcgagcgag 1537

                                                                        
Query: 228  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
            ||||||||||||||   ||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 1536 gtgacggtcttgcgcttggcgtgctcagtgtaggtgacggcgtcacggatgacgttctcg 1477

                                                                        
Query: 288  aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
            ||||||| ||||||||||  ||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 1476 aggaagaccttgaggacggagcgggtctcctcgtagatgaggccggagatacgcttgaca 1417

                                                                        
Query: 348  ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
            || || |  |  || || ||||||||||| ||||||||||| |||||||||||||| || 
Sbjct: 1416 ccaccacgacgggcgagacgacggatggcgggcttggtgattccctggatgttgtcacga 1357

                                                                        
Query: 408  agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
            || | ||| ||||| |||||||| |||||||| ||||||||||| |||||||||||||| 
Sbjct: 1356 agaatcttgcggtgacgcttggcaccgccctttccgagaccctttcctcccttgccgcgg 1297

                     
Query: 468  ccggacatg 476
            || ||||||
Sbjct: 1296 ccagacatg 1288



to top

>gb|BC019757.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:4205460),
           partial cds
          Length = 733

 Score =  287 bits (145), Expect = 2e-74
 Identities = 268/309 (86%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| ||||| || || || ||||||||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || ||||| |||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 97  agcactttgcggtgacgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                    
Query: 468 ccggacatg 476
           || ||||||
Sbjct: 37  ccagacatg 29



to top

>dbj|AB179406.1| Macaca fascicularis testis cDNA clone: QtsA-19327, similar to human
           histone 1, H4j (HIST1H4J), mRNA, RefSeq: NM_021968.3
          Length = 2002

 Score =  287 bits (145), Expect = 2e-74
 Identities = 268/309 (86%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| |||||||||||||| ||||||||||| |||||||| || || |||||||||
Sbjct: 393 ccgccgaaaccgtagagggtgcgaccctggcgcttcagcgcgtaaaccacatccatggcg 334

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||| ||||||||   ||||||||| |||||||| || ||||| ||||| |||||||| 
Sbjct: 333 gtgaccgtcttgcgcttggcgtgctccgtgtaggtcacagcgtcccggatcacgttctcc 274

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           |||||||  || || || || |||||||||||||||||||| || |||||||||||||||
Sbjct: 273 aggaagactttcagcaccccacgggtctcctcgtagatgagaccagagatgcgcttcacg 214

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           ||||| |  |  || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 213 ccgccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatgttgtcacgc 154

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           |||||||| ||||||||||| |||||||| ||||| |||||||| || || |||||||| 
Sbjct: 153 agcaccttgcggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcgg 94

                    
Query: 468 ccggacatg 476
           || ||||||
Sbjct: 93  ccagacatg 85



to top

>dbj|AK011560.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610027B07 product:histone 4
           protein, full insert sequence
          Length = 720

 Score =  287 bits (145), Expect = 2e-74
 Identities = 268/309 (86%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| ||||| || || || ||||||||||||||||||||||| ||||||||||||
Sbjct: 348 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 289

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           |||||||||| |||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 288 gtgacggtctcgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 229

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 228 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 169

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| |||||||||||||||||||||||||| || 
Sbjct: 168 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 109

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 108 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 49

                    
Query: 468 ccggacatg 476
           || ||||||
Sbjct: 48  ccagacatg 40



to top

>gb|AY158963.1| Mus musculus histone protein Hist1h4c gene, complete cds
          Length = 1309

 Score =  287 bits (145), Expect = 2e-74
 Identities = 238/269 (88%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||| || || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 629

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || | ||  |||||||| |||||||| |||||||| |||||||||||||| || || 
Sbjct: 628 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 569

                                        
Query: 408 agcaccttccggtggcgcttggcgccgcc 436
           || ||||| ||||||||||| ||||||||
Sbjct: 568 agaaccttacggtggcgcttagcgccgcc 540



to top

>gb|BC062345.1| Homo sapiens cDNA clone IMAGE:6597408
          Length = 392

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 324 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 265

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 264 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 205

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 204 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 145

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 144 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 85

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 84  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 25

                 
Query: 471 gacatg 476
           ||||||
Sbjct: 24  gacatg 19



to top

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Plus

                                                                         
Query: 171   ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
             ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 70023 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 70082

                                                                         
Query: 231   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 70083 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 70142

                                                                         
Query: 291   aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
             || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 70143 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 70202

                                                                         
Query: 351   cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
             || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 70203 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 70262

                                                                         
Query: 411   accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
             || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 70263 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 70322

                   
Query: 471   gacatg 476
             ||||||
Sbjct: 70323 gacatg 70328



 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                         
Query: 171   ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
             ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 63229 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 63170

                                                                         
Query: 231   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 63169 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 63110

                                                                         
Query: 291   aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
             || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 63109 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 63050

                                                                         
Query: 351   cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
             || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 63049 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 62990

                                                                         
Query: 411   accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
             || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 62989 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 62930

                   
Query: 471   gacatg 476
             ||||||
Sbjct: 62929 gacatg 62924



 Score =  204 bits (103), Expect = 2e-49
 Identities = 259/311 (83%)
 Strand = Plus / Minus

                                                                         
Query: 166   agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
             ||||||| || || || |||||||| |||||||||||||||||||| || ||||||||||
Sbjct: 21251 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 21192

                                                                         
Query: 226   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
             | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 21191 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 21132

                                                                         
Query: 286   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
             | |  || |  || || || ||||| ||||||||||| || || || ||||||||||| |
Sbjct: 21131 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 21072

                                                                         
Query: 346   cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
             |||| || | ||  |||||||| |||||||| ||||||||||||||||| ||||||||||
Sbjct: 21071 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 21012

                                                                         
Query: 406   gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
             |||| || || ||||||||||| ||||| || ||||| |||||||| || || |||||||
Sbjct: 21011 gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 20952

                        
Query: 466   gcccggacatg 476
             |||| ||||||
Sbjct: 20951 gcccagacatg 20941



to top

>gb|BC100619.1| Rattus norvegicus germinal histone H4 gene, mRNA (cDNA clone
           MGC:124607 IMAGE:7938313), complete cds
          Length = 1326

 Score =  281 bits (142), Expect = 1e-72
 Identities = 244/278 (87%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || |||||||| || |||||||| ||||| |||||||| |||||||||
Sbjct: 334 tagccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatg 275

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 274 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 215

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 214 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 155

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 154 actcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcg 95

                                                 
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgcc 442
           ||||| || || ||||||||||| |||||||| |||||
Sbjct: 94  cgcaggactttgcggtggcgcttagcgccgcctttgcc 57



to top

>gb|AY128664.1| Homo sapiens clone HIST1H4K histone H4 gene, complete cds
          Length = 930

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 615 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 556

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 555 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 496

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 495 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 436

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 435 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 376

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 375 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 316

                 
Query: 471 gacatg 476
           ||||||
Sbjct: 315 gacatg 310



to top

>gb|AY128663.1| Homo sapiens clone HIST1H4J histone H4 gene, complete cds
          Length = 930

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 616 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 557

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 556 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 497

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 496 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 437

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 436 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 377

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 376 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 317

                 
Query: 471 gacatg 476
           ||||||
Sbjct: 316 gacatg 311



to top

>ref|NM_022686.2| Rattus norvegicus germinal histone H4 gene (Hist1h4b), mRNA
          Length = 1296

 Score =  281 bits (142), Expect = 1e-72
 Identities = 244/278 (87%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || |||||||| || |||||||| ||||| |||||||| |||||||||
Sbjct: 330 tagccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatg 271

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 270 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 211

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 210 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 151

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 150 actcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcg 91

                                                 
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgcc 442
           ||||| || || ||||||||||| |||||||| |||||
Sbjct: 90  cgcaggactttgcggtggcgcttagcgccgcctttgcc 53



to top

>emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A22 on chromosome 6p21.2-22.2
             Contains histone genes H2AFE, H2BFE, H4FE and H4FD, ESTs,
             STSs, GSSs and three CpG islands, complete sequence
          Length = 24706

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Plus

                                                                         
Query: 171   ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
             ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 19570 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 19629

                                                                         
Query: 231   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 19630 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 19689

                                                                         
Query: 291   aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
             || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 19690 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 19749

                                                                         
Query: 351   cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
             || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 19750 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 19809

                                                                         
Query: 411   accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
             || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 19810 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 19869

                   
Query: 471   gacatg 476
             ||||||
Sbjct: 19870 gacatg 19875



 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                         
Query: 171   ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
             ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 12776 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 12717

                                                                         
Query: 231   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 12716 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 12657

                                                                         
Query: 291   aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
             || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 12656 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 12597

                                                                         
Query: 351   cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
             || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 12596 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 12537

                                                                         
Query: 411   accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
             || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 12536 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 12477

                   
Query: 471   gacatg 476
             ||||||
Sbjct: 12476 gacatg 12471



to top

>emb|X60484.1|HSH4EHIS H.sapiens H4/e gene for H4 histone
          Length = 859

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 615 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 556

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 555 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 496

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 495 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 436

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 435 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 376

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 375 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 316

                 
Query: 471 gacatg 476
           ||||||
Sbjct: 315 gacatg 310



to top

>emb|X60483.1|HSH4DHIS H.sapiens H4/d gene for H4 histone
          Length = 1528

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 916 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 857

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 856 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 797

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 796 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 737

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 736 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 677

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 676 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 617

                 
Query: 471 gacatg 476
           ||||||
Sbjct: 616 gacatg 611



to top

>gb|BC017361.2| Homo sapiens cDNA clone MGC:29783 IMAGE:4647914, complete cds
          Length = 416

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 324 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 265

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 264 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 205

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 204 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 145

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 144 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 85

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 84  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 25

                 
Query: 471 gacatg 476
           ||||||
Sbjct: 24  gacatg 19



to top

>gb|AY936209.1| Rattus norvegicus histone H4 variant H4-v.1 mRNA, complete cds
          Length = 1296

 Score =  281 bits (142), Expect = 1e-72
 Identities = 244/278 (87%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || |||||||| || |||||||| ||||| |||||||| |||||||||
Sbjct: 330 tagccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatg 271

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 270 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 211

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| || || ||||||||||||||||||||||| || ||||||||||||
Sbjct: 210 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 151

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || | ||  |||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 150 actcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcg 91

                                                 
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgcc 442
           ||||| || || ||||||||||| |||||||| |||||
Sbjct: 90  cgcaggactttgcggtggcgcttagcgccgcctttgcc 53



to top

>gb|AF086564.1|HUMZE16D01 Homo sapiens full length insert cDNA clone ZE16D01
          Length = 382

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 322 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 263

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 262 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 203

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 202 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 143

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 142 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 83

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 82  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 23

                 
Query: 471 gacatg 476
           ||||||
Sbjct: 22  gacatg 17



to top

>ref|NM_021968.3| Homo sapiens histone 1, H4j (HIST1H4J), mRNA
          Length = 356

 Score =  280 bits (141), Expect = 4e-72
 Identities = 264/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 305 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 246

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 186

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 185 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 126

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 125 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 66

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 65  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 6

                
Query: 471 gacat 475
           |||||
Sbjct: 5   gacat 1



to top

>ref|NM_003541.2| Homo sapiens histone 1, H4k (HIST1H4K), mRNA
          Length = 354

 Score =  280 bits (141), Expect = 4e-72
 Identities = 264/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 305 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 246

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 186

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 185 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 126

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  || ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 125 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 66

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || ||||||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 65  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 6

                
Query: 471 gacat 475
           |||||
Sbjct: 5   gacat 1



to top

>emb|CR657174.2|CNS0F61O Tetraodon nigroviridis full-length cDNA
          Length = 517

 Score =  280 bits (141), Expect = 4e-72
 Identities = 262/301 (87%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 341 agcctccgaagccgtacagggtgcgcccctgccgcttgagcgcgtacaccacatccatgg 282

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||||||||| |    |||||||||||||||||||||||| || ||||| |||||||
Sbjct: 281 cggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgttct 222

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | |||||| ||||||||||||||||||||||| || |||||||||||||| |
Sbjct: 221 ccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgcttga 162

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||| |  |  |||||||| |||||||| ||||||||||||||||||||||||||||
Sbjct: 161 cgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 102

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | | |||||| ||||||||||||||||| || ||||| || || |||||||| |||||||
Sbjct: 101 gga-caccttgcggtggcgcttggcgccccctttgcccaggcctttgcctcctttgccgc 43

            
Query: 466 g 466
           |
Sbjct: 42  g 42



to top

>emb|CR657322.2|CNS0F65S Tetraodon nigroviridis full-length cDNA
          Length = 586

 Score =  280 bits (141), Expect = 4e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||||||||| ||||| |||||||| ||||| | ||| || ||||| || ||||||||
Sbjct: 319 ctagccgccgaagccgtacagggtgcggccctgcctcttcagggcgtacaccacgtccat 260

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
           ||| || || ||||| |    ||||||||| ||||||||||||||||||||||| |||||
Sbjct: 259 ggccgtcaccgtcttcctcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgtt 200

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           ||| ||||| | ||| || || |||||||||||||||||||| || || |||||||||||
Sbjct: 199 ctccaggaacaccttcagcaccccgcgggtctcctcgtagatcaggccggagatgcgctt 140

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
           ||||||||| | || ||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 139 cacgccgccgcgccgcgccaggcggcggatggcgggcttggtgatgccctggatgttgtc 80

                                                                    
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
           ||| || ||||| |||||||||||||||||||| ||||| ||||| |||||||||||
Sbjct: 79  gcggaggaccttgcggtggcgcttggcgccgcctttgcccagacctttgcctccctt 23



to top

>gb|AY263810.1| Eucalyptus globulus histone H4 mRNA, complete cds
          Length = 451

 Score =  274 bits (138), Expect = 3e-70
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| || || ||||| |  ||||| | |||||||||||| |||||||||||||
Sbjct: 310 agccgccgaagccatacagggtcctgccctgcctcttgagcgcgtacacgacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           |||| || ||||| ||||| |||||||| |||||||| |||||||||||||| |||||||
Sbjct: 250 cggtcaccgtcttccggcgcgcgtgctccgtgtaggtcacggcgtcgcggatcacgttct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||||||||| || ||||||||||||||||||||||| |||||   ||| |||||||
Sbjct: 190 ccaggaagatcttcagcacgccgcgggtctcctcgtagatcagcccgctgatccgcttca 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           | ||||| |  |  ||||| || ||||| |||||||| ||||||||||||||||||||||
Sbjct: 130 ccccgccacggcgggccagccgccggatcgccggcttcgtgatgccctggatgttgtcgc 71

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||| ||||| | ||| ||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 70  gcaggacctttctgtgccgcttcgcgccgcccttgccaagccccttgcctcccttgccgc 11

                     
Query: 466 gcccggacat 475
           | || |||||
Sbjct: 10  ggcccgacat 1



to top

>gb|DQ400915.1| Elaeis guineensis histone 4 mRNA, complete cds
          Length = 561

 Score =  272 bits (137), Expect = 1e-69
 Identities = 254/293 (86%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| |||||||||||||| |||||||| |||||||||||||||
Sbjct: 358 ccgaagccgtagagggtgcggccctggcgcttgagagcgtagacaacgtccatggcggtg 299

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           |||||||| ||||| |||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 298 acggtcttccggcgagcgtgctccgtgtaggtgacggcgtcgcggataacgttctccagg 239

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           ||||||||||| ||||| |  ||||||||||||||||| ||   ||| ||||||||||| 
Sbjct: 238 aagatcttgagcacgcctcttgtctcctcgtagatgagaccgctgatacgcttcacgcca 179

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || | ||  || || || |||||||| |||||||||||||||||||||||||| || || 
Sbjct: 178 ccacgccgtgcgagacgccggatggcgggcttggtgatgccctggatgttgtcccggagg 119

                                                                
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||| ||| ||||||| || || ||||| || | |||||| |||||||||||
Sbjct: 118 accttgcgggggcgctttgcacctccctttcccaaacccttacctcccttgcc 66



to top

>gb|AF457966.1| Zea mays clone cho1c.pk003.e4, mRNA sequence
          Length = 248

 Score =  272 bits (137), Expect = 1e-69
 Identities = 158/165 (95%)
 Strand = Plus / Minus

                                                                       
Query: 161 ggcctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtc 220
           ||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 165 ggcctagccgccgaagccgtagagggtgcggccctggcgcttaagcgcgtagacgacgtc 106

                                                                       
Query: 221 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 280
           |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 105 catggcggtgacggtcttacggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgac 46

                                                        
Query: 281 gttctcgaggaagatcttgaggacgccgcgggtctcctcgtagat 325
           |||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 45  gttctccaggaagatcttgagcacgccgcgggtctcctcgtagat 1



to top

>gb|BC016336.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:24014
           IMAGE:4101102), complete cds
          Length = 1260

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 342 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 283

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 282 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 223

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| |  || |||||||||||||| |||||||| || || |||||||||
Sbjct: 222 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 163

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| |  |  || ||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 162 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 103

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 102 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 43

                      
Query: 465 cgcccggacat 475
           || || |||||
Sbjct: 42  cgtcctgacat 32



to top

>gb|AY128662.1| Homo sapiens clone HIST1H4I histone H4 gene, complete cds
          Length = 930

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 622 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 563

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 562 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 503

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| |  || |||||||||||||| |||||||| || || |||||||||
Sbjct: 502 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 443

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| |  |  || ||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 442 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 383

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 382 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 323

                      
Query: 465 cgcccggacat 475
           || || |||||
Sbjct: 322 cgtcctgacat 312



to top

>gb|BC075806.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:87855
           IMAGE:5225467), complete cds
          Length = 1418

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 323 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 264

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 263 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 204

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| |  || |||||||||||||| |||||||| || || |||||||||
Sbjct: 203 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 144

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| |  |  || ||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 143 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 84

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 83  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 24

                      
Query: 465 cgcccggacat 475
           || || |||||
Sbjct: 23  cgtcctgacat 13



to top

>gb|BC066250.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79353
           IMAGE:7002105), complete cds
          Length = 365

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| |  || |||||||||||||| |||||||| || || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| |  |  || ||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 465 cgcccggacat 475
           || || |||||
Sbjct: 11  cggccagacat 1



to top

>emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 on chromosome 6p21.31-22.1
             Contains a vomeronasal olfactory 1 receptor chromosome 6-2
             (VN1R6-2P) pseudogene, histone genes H2BFN and H2AFA, the
             gene for a novel protein identical to H2B histone family
             member A (H2BFA), the gene for a novel protein identical
             to H2A histone family member I (H2AFI), a novel histone
             gene similar to H4F2 and three CpG islands, complete
             sequence
          Length = 89016

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                         
Query: 165   tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
             ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 62924 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 62865

                                                                         
Query: 225   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
             |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 62864 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 62805

                                                                         
Query: 285   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
             || ||||| | ||| |  || |||||||||||||| |||||||| || || |||||||||
Sbjct: 62804 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 62745

                                                                         
Query: 345   acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
             |||||||| |  |  || ||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 62744 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 62685

                                                                         
Query: 405   cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
             ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 62684 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 62625

                        
Query: 465   cgcccggacat 475
             || || |||||
Sbjct: 62624 cgtcctgacat 62614



to top

>emb|CR599017.1| full-length cDNA clone CS0DC001YE12 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1321

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 326 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 267

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 266 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 207

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| |  || |||||||||||||| |||||||| || || |||||||||
Sbjct: 206 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 147

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| |  |  || ||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 146 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 87

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 86  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 27

                      
Query: 465 cgcccggacat 475
           || || |||||
Sbjct: 26  cgtcctgacat 16



to top

>gb|BC067497.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79354
           IMAGE:7002106), complete cds
          Length = 365

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| |  || |||||||||||||| |||||||| || || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| |  |  || ||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 465 cgcccggacat 475
           || || |||||
Sbjct: 11  cggccagacat 1



to top

>ref|NG_000827.2| Homo sapiens genomic histone family microcluster (HFM@) on chromosome 6
          Length = 20621

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                         
Query: 165   tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
             ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 12125 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 12066

                                                                         
Query: 225   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
             |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 12065 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 12006

                                                                         
Query: 285   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
             || ||||| | ||| |  || |||||||||||||| |||||||| || || |||||||||
Sbjct: 12005 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 11946

                                                                         
Query: 345   acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
             |||||||| |  |  || ||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 11945 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 11886

                                                                         
Query: 405   cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
             ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 11885 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 11826

                        
Query: 465   cgcccggacat 475
             || || |||||
Sbjct: 11825 cgtcctgacat 11815



to top

>ref|NM_003495.2| Homo sapiens histone 1, H4i (HIST1H4I), mRNA
          Length = 370

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| |  || |||||||||||||| |||||||| || || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| |  |  || ||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 465 cgcccggacat 475
           || || |||||
Sbjct: 11  cgtcctgacat 1



to top

>dbj|AB000905.1| Homo sapiens DNA for H4 histone, complete cds
          Length = 1293

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                        
Query: 165  tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
            ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 1031 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 972

                                                                        
Query: 225  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
            |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 971  gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 912

                                                                        
Query: 285  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
            || ||||| | ||| |  || |||||||||||||| |||||||| || || |||||||||
Sbjct: 911  tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 852

                                                                        
Query: 345  acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
            |||||||| |  |  || ||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 851  acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 792

                                                                        
Query: 405  cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
            ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 791  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 732

                       
Query: 465  cgcccggacat 475
            || || |||||
Sbjct: 731  cgtcctgacat 721



to top

>gb|AY389612.1| Hyacinthus orientalis unknown mRNA
          Length = 436

 Score =  266 bits (134), Expect = 7e-68
 Identities = 234/266 (87%), Gaps = 1/266 (0%)
 Strand = Plus / Minus

                                                                       
Query: 163 cctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtcca 222
           ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 266 cctagccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagacgacgtcca 207

                                                                       
Query: 223 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 282
           | || || || ||||| ||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 206 tcgccgtcaccgtcttccggcgcgcgtgctcggtgtaggtgacggcgtcacggatgacgt 147

                                                                       
Query: 283 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgct 342
           |||||||||||||||||||||| ||||| ||||||||||||||||||||    || | ||
Sbjct: 146 tctcgaggaagatcttgaggaccccgcgcgtctcctcgtagatgagcccgcttatcctct 87

                                                                       
Query: 343 tcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgt 402
           |||| || || |  |  |||||||| ||||| |||||||| |||||||||||||||||||
Sbjct: 86  tcactcctccacggcgagccaggcggcggatcgccggcttcgtgatgccctggatgttgt 27

                                     
Query: 403 -cgcgcagcaccttccggtggcgctt 427
            | || || |||| ||||||||||||
Sbjct: 26  ccccggagtacctgccggtggcgctt 1



to top

>ref|XM_976380.1| PREDICTED: Mus musculus similar to germinal histone H4 gene
           (LOC674678), mRNA
          Length = 2984

 Score =  266 bits (134), Expect = 7e-68
 Identities = 251/290 (86%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| ||||| || ||||| |||||||||||||||||||| || |||||||| 
Sbjct: 476 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 417

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| ||||||||   ||||||||||||||| ||||||||||||||||| || |||
Sbjct: 416 gccgtgaccgtcttgcgcttggcgtgctcggtgtatgtgacggcgtcgcggatcacattc 357

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||||||||| ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 356 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 297

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | ||  ||||  || ||||| || |||||||| ||||||||||||||||||
Sbjct: 296 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 237

                                                             
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcc 454
           || || ||||| ||||| ||||||||||| || || || |||||||||||
Sbjct: 236 cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 187



to top

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score =  266 bits (134), Expect = 7e-68
 Identities = 251/290 (86%)
 Strand = Plus / Minus

                                                                          
Query: 165    tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
              ||||||||||| ||||| || ||||| |||||||||||||||||||| || |||||||| 
Sbjct: 113214 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 113155

                                                                          
Query: 225    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
              || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 113154 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 113095

                                                                          
Query: 285    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
              || ||||| | ||||||||| ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 113094 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 113035

                                                                          
Query: 345    acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
              |||||||| | ||  ||||  || ||||| || |||||||| ||||||||||||||||||
Sbjct: 113034 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 112975

                                                                
Query: 405    cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcc 454
              || || ||||| ||||| ||||||||||| || || || |||||||||||
Sbjct: 112974 cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 112925



to top

>ref|XM_225382.1| PREDICTED: Rattus norvegicus histone 1, H4m (predicted)
           (Hist1h4m_predicted), mRNA
          Length = 312

 Score =  266 bits (134), Expect = 7e-68
 Identities = 251/290 (86%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||| ||||| ||||||||||| ||||| ||||| || |||||||| |||
Sbjct: 305 ccgaagccgtagagagtgcggccctggcgcttaagcgcatagacaacatccatggcagtg 246

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 245 acagtcttgcgcttggcgtgctctgtgtaggtgacggcgtcgcggatcacgttctccagg 186

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 185 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 126

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           |||| ||  |||| ||| |||||||| ||||| |||||||||||||||||||||||||| 
Sbjct: 125 ccccgccgagccaagcggcggatggcgggcttagtgatgccctggatgttgtcgcgcagg 66

                                                             
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
           || || ||||||||||| |||||||| ||||| |||||||| || |||||
Sbjct: 65  actttgcggtggcgcttagcgccgcctttgcccagacccttcccgccctt 16



to top

>gb|AY158967.1| Mus musculus histone protein Hist4h4 gene, complete cds
          Length = 1200

 Score =  266 bits (134), Expect = 7e-68
 Identities = 251/290 (86%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| ||||| || ||||| |||||||||||||||||||| || |||||||| 
Sbjct: 702 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 643

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 642 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 583

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||||||||| ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 582 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 523

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | ||  ||||  || ||||| || |||||||| ||||||||||||||||||
Sbjct: 522 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 463

                                                             
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcc 454
           || || ||||| ||||| ||||||||||| || || || |||||||||||
Sbjct: 462 cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 413



to top

>gb|BC111813.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:40040608),
           partial cds
          Length = 311

 Score =  266 bits (134), Expect = 7e-68
 Identities = 251/290 (86%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| ||||| || ||||| |||||||||||||||||||| || |||||||| 
Sbjct: 310 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 251

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || ||||| ||||||||   ||||||||||||||| ||||||||||||||||| || |||
Sbjct: 250 gccgtgaccgtcttgcgcttggcgtgctcggtgtatgtgacggcgtcgcggatcacattc 191

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||||||||| ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 190 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 131

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | ||  ||||  || ||||| || |||||||| ||||||||||||||||||
Sbjct: 130 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 71

                                                             
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcc 454
           || || ||||| ||||| ||||||||||| || || || |||||||||||
Sbjct: 70  cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 21



to top

>ref|NM_175652.1| Mus musculus histone 4, H4 (Hist4h4), mRNA
          Length = 312

 Score =  266 bits (134), Expect = 7e-68
 Identities = 251/290 (86%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| ||||| || ||||| |||||||||||||||||||| || |||||||| 
Sbjct: 311 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 251 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||||||||| ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 191 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| | ||  ||||  || ||||| || |||||||| ||||||||||||||||||
Sbjct: 131 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 72

                                                             
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcc 454
           || || ||||| ||||| ||||||||||| || || || |||||||||||
Sbjct: 71  cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 22



to top

>gb|BC057955.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:5359141), with
           apparent retained intron
          Length = 1631

 Score =  264 bits (133), Expect = 3e-67
 Identities = 256/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||| ||||| |||||||||||||| |||||||||||||| ||||| || || |||||
Sbjct: 319 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 260

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 259 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 200

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           ||| ||||| | ||| || || || |||||||||||||||||||| || |||||||||||
Sbjct: 199 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 140

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
            || || || | ||  |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 139 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 80

                                                                    
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
            ||||  || || || |||||||||||||| |||||||| |||||||| || |||||
Sbjct: 79  acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 23



to top

>emb|V00753.1|MMHI01 Mouse gene encoding the mouse histone H4
          Length = 968

 Score =  264 bits (133), Expect = 3e-67
 Identities = 256/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||| ||||| |||||||||||||| |||||||||||||| ||||| || || |||||
Sbjct: 569 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 510

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 509 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 450

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           ||| ||||| | ||| || || || |||||||||||||||||||| || |||||||||||
Sbjct: 449 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 390

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
            || || || | ||  |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 389 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 330

                                                                    
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
            ||||  || || || |||||||||||||| |||||||| |||||||| || |||||
Sbjct: 329 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 273



to top

>ref|NM_033596.1| Mus musculus histone 2, H4 (Hist2h4), mRNA
          Length = 400

 Score =  264 bits (133), Expect = 3e-67
 Identities = 256/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||| ||||| |||||||||||||| |||||||||||||| ||||| || || |||||
Sbjct: 341 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 282

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 281 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 222

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           ||| ||||| | ||| || || || |||||||||||||||||||| || |||||||||||
Sbjct: 221 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 162

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
            || || || | ||  |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 161 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 102

                                                                    
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
            ||||  || || || |||||||||||||| |||||||| |||||||| || |||||
Sbjct: 101 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 45



to top

>gb|AY158966.1| Mus musculus histone protein Hist2h4 gene, complete cds
          Length = 1309

 Score =  264 bits (133), Expect = 3e-67
 Identities = 256/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||| ||||| |||||||||||||| |||||||||||||| ||||| || || |||||
Sbjct: 812 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 753

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 752 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 693

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           ||| ||||| | ||| || || || |||||||||||||||||||| || |||||||||||
Sbjct: 692 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 633

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
            || || || | ||  |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 632 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 573

                                                                    
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
            ||||  || || || |||||||||||||| |||||||| |||||||| || |||||
Sbjct: 572 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 516



to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  264 bits (133), Expect = 3e-67
 Identities = 256/297 (86%)
 Strand = Plus / Plus

                                                                         
Query: 164   ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
             |||||| ||||| |||||||||||||| |||||||||||||| ||||| || || |||||
Sbjct: 87632 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 87691

                                                                         
Query: 224   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
              |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 87692 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 87751

                                                                         
Query: 284   ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
             ||| ||||| | ||| || || || |||||||||||||||||||| || |||||||||||
Sbjct: 87752 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 87811

                                                                         
Query: 344   cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
              || || || | ||  |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 87812 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 87871

                                                                      
Query: 404   gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
              ||||  || || || |||||||||||||| |||||||| |||||||| || |||||
Sbjct: 87872 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 87928



to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  264 bits (133), Expect = 3e-67
 Identities = 256/297 (86%)
 Strand = Plus / Minus

                                                                         
Query: 164   ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
             |||||| ||||| |||||||||||||| |||||||||||||| ||||| || || |||||
Sbjct: 13061 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 13002

                                                                         
Query: 224   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
              |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 13001 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 12942

                                                                         
Query: 284   ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
             ||| ||||| | ||| || || || |||||||||||||||||||| || |||||||||||
Sbjct: 12941 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 12882

                                                                         
Query: 344   cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
              || || || | ||  |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 12881 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 12822

                                                                      
Query: 404   gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
              ||||  || || || |||||||||||||| |||||||| |||||||| || |||||
Sbjct: 12821 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 12765



to top

>gb|BC051566.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:1446370)
          Length = 358

 Score =  264 bits (133), Expect = 3e-67
 Identities = 256/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||| ||||| |||||||||||||| |||||||||||||| ||||| || || |||||
Sbjct: 333 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 274

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 273 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 214

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           ||| ||||| | ||| || || || |||||||||||||||||||| || |||||||||||
Sbjct: 213 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 154

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
            || || || | ||  |||||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 153 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 94

                                                                    
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
            ||||  || || || |||||||||||||| |||||||| |||||||| || |||||
Sbjct: 93  acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 37



to top

>gb|BC114196.1| Bos taurus histone H4, mRNA (cDNA clone IMAGE:8186024)
          Length = 409

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||| ||||| ||||||||||| ||||||||||
Sbjct: 340 agccgccgaagccgtagagggtgcggccctgtcgcttcagcgcgtagaccacgtccatgg 281

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 280 cggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgttct 221

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | ||| || || |||||||||||||||||||||||||| |||||||||||||
Sbjct: 220 ccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgcttca 161

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           | || || |  |  |||||||| || || || |||||||| |||||||||||||| || |
Sbjct: 160 caccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatcac 101

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | || || || ||||||||||| ||||| || ||||| |||||||| || || |||||||
Sbjct: 100 gaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgccgc 41

                      
Query: 466 gcccggacatg 476
           | || ||||||
Sbjct: 40  gaccagacatg 30



to top

>gb|BC067496.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79352
           IMAGE:7002103), complete cds
          Length = 364

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           |||||||| ||||||||   ||||||||| ||||||||  ||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcgcggcgtcccggatcacgttc 192

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||| |  || |||||||||||||| |||||||| || || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           |||||||| |  |  || ||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 405 cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 465 cgcccggacat 475
           || || |||||
Sbjct: 11  cggccagacat 1



to top

>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507),
           mRNA
          Length = 846

 Score =  258 bits (130), Expect = 2e-65
 Identities = 262/306 (85%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 830 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 771

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 770 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 711

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 710 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 651

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  || ||||| ||||| ||||||||||||||||||||||| ||||||||||  
Sbjct: 650 ccgcggcgagcaaggcgccggatagccggcttggtgatgccctggatattgtcgcgcaat 591

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || || |||||||| |||||||| ||||| |||||||| || || |||||||| || 
Sbjct: 590 actttacgatggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 531

                 
Query: 471 gacatg 476
           ||||||
Sbjct: 530 gacatg 525



to top

>ref|XM_868981.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC527645), mRNA
          Length = 312

 Score =  258 bits (130), Expect = 2e-65
 Identities = 265/310 (85%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||||||||| ||||| ||||| ||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctgtcgcttcagcgcgtagaccacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 250 cggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgttct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | ||| || || |||||||||||||||||||||||||| |||||||||||||
Sbjct: 190 ccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           | || || |  |  |||||||| || || || |||||||| |||||||||||||| || |
Sbjct: 130 caccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatcac 71

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | || || || ||||||||||| ||||| || ||||| |||||||| || || |||||||
Sbjct: 70  gaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgccgc 11

                     
Query: 466 gcccggacat 475
           | || |||||
Sbjct: 10  gaccagacat 1



to top

>emb|AJ249812.1|MAL249812 Mortierella alpina H3.1 and H4.1 genes for histone H3 and histone H4
          Length = 1630

 Score =  258 bits (130), Expect = 2e-65
 Identities = 262/306 (85%)
 Strand = Plus / Minus

                                                                        
Query: 171  ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
            ||||| ||||||||||||||||||||||||||||| ||||||||||| || |  | ||||
Sbjct: 1394 ccgaaaccgtagagggtgcgtccctggcgcttgagggcgtagacgacatcgagcgaggtg 1335

                                                                        
Query: 231  acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
            |||||||||||   ||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 1334 acggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcacggatgacgttctcgagg 1275

                                                                        
Query: 291  aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
            |||| ||||||||||  ||||||||||||||||||||| || ||||| ||||| || || 
Sbjct: 1274 aagaccttgaggacggagcgggtctcctcgtagatgaggccggagatacgcttgacacca 1215

                                                                        
Query: 351  cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
            || |  |  || || || ||||| || ||||||||||| |||||||||||||| || || 
Sbjct: 1214 ccacgacgggcgagacggcggatagcgggcttggtgattccctggatgttgtcacgaaga 1155

                                                                        
Query: 411  accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
            | ||| |||||||||||||| || ||||| ||||||||||| ||||| || ||||| || 
Sbjct: 1154 atcttgcggtggcgcttggcaccaccctttccgagaccctttcctcctttaccgcggcca 1095

                  
Query: 471  gacatg 476
            ||||||
Sbjct: 1094 gacatg 1089



to top

>gb|AY104535.1| Zea mays PCO094675 mRNA sequence
          Length = 995

 Score =  254 bits (128), Expect = 2e-64
 Identities = 177/192 (92%), Gaps = 1/192 (0%)
 Strand = Plus / Plus

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           |||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||
Sbjct: 756 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccagaaatgcgctt 815

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
            |||||||||||||| ||||| | |||||| |||||||| ||||||||||||||||||||
Sbjct: 816 gacgccgcccctcctggccagcctacggatcgccggcttcgtgatgccctggatgttgtc 875

                                                                       
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||||| |||| |||||||||||||||||||||||||| || |||||||| ||||||||
Sbjct: 876 gcgcagc-ccttgcggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 934

                       
Query: 464 gcgcccggacat 475
           |||||| |||||
Sbjct: 935 gcgccccgacat 946



to top

>dbj|AK045187.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length
           enriched library, clone:B130044J01 product:H4 HISTONE
           homolog [Homo sapiens], full insert sequence
          Length = 2875

 Score =  252 bits (127), Expect = 1e-63
 Identities = 251/291 (86%), Gaps = 1/291 (0%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| ||||| || ||||| |||||||||||||||||||| || |||||||| 
Sbjct: 358 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 299

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 298 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 239

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || ||||| | ||||||||| ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 238 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 179

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgat-gccctggatgttgtc 403
           |||||||| | ||  ||||  || ||||| || |||||||| || |||||||||||||||
Sbjct: 178 acgccgccacgccgagccaaccgccggatagcgggcttggtaatggccctggatgttgtc 119

                                                              
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcc 454
           ||| || ||||| ||||| ||||||||||| || || || |||||||||||
Sbjct: 118 gcggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 68



to top

>ref|XM_606749.2| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC528329), mRNA
          Length = 312

 Score =  250 bits (126), Expect = 4e-63
 Identities = 264/310 (85%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| |||||||| ||||| ||||| ||||| ||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagcgtgcggccctgtcgcttcagcgcgtagaccacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 250 cggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgttct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | ||| || || |||||||||||||||||||||||||| |||||||||||||
Sbjct: 190 ccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           | || || |  |  |||||||| || || || |||||||| |||||||||||||| || |
Sbjct: 130 caccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatcac 71

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           | || || || ||||||||||| ||||| || ||||| |||||||| || || |||||||
Sbjct: 70  gaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgccgc 11

                     
Query: 466 gcccggacat 475
           | || |||||
Sbjct: 10  gaccagacat 1



to top

>emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes
          Length = 2930

 Score =  244 bits (123), Expect = 2e-61
 Identities = 246/287 (85%)
 Strand = Plus / Minus

                                                                        
Query: 168  ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
            |||||||| ||||| ||||||||||||||||| || || |||||||| ||||||||||| 
Sbjct: 1145 ccgccgaaaccgtacagggtgcgtccctggcgtttcagagcgtagaccacgtccatggcc 1086

                                                                        
Query: 228  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
            || |||||||| |    ||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 1085 gtaacggtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttctca 1026

                                                                        
Query: 288  aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
            ||||| | ||| ||||| |||||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 1025 aggaacaccttcaggacaccgcgggtctcctcgtagatcagcccggagatacgcttcacg 966

                                                                        
Query: 348  ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
            ||||| |  |  ||||| || || ||||| ||||||||||| ||||||||||| ||||| 
Sbjct: 965  ccgccacggcgagccagacggcgaatggcgggcttggtgattccctggatgttatcgcgg 906

                                                           
Query: 408  agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcc 454
            || ||||| ||||| ||||||||||| || || ||||| ||||||||
Sbjct: 905  agaaccttacggtgacgcttggcgcctccttttccgagtcccttgcc 859



to top

>dbj|AB197150.1| Fragaria x ananassa mRNA for histone H4, partial cds
          Length = 308

 Score =  240 bits (121), Expect = 4e-60
 Identities = 250/293 (85%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| |||||||| || | |||||| | |||||| || |||||||| |||||||||
Sbjct: 308 ccgccgaagccgtagagtgtccttccctgcctcttgagagcatagacgacatccatggcg 249

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||| ||||| |  ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 248 gtgacagtcttcctccgggcgtgctcggtgtaggtgacggcgtcacggatgacgttctcg 189

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           |||||||||||||||||||| | |||||| || |||||||| || ||||| ||||| |||
Sbjct: 188 aggaagatcttgaggacgcctctggtctcttcatagatgagaccggagatacgcttgacg 129

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || || |  ||||  || |||||||| ||||||||||||||||||||||| || |  
Sbjct: 128 ccacctctgcgagccaaacggcggatggcgggcttggtgatgccctggatgttatccctg 69

                                                                
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
           || ||||||| ||| |||||||| || ||||| || | |||||||||||||||
Sbjct: 68  aggaccttcctgtgacgcttggctcctccctttcccaaacccttgcctccctt 16



to top

>ref|NM_001016869.2| Xenopus tropicalis hypothetical protein LOC549623 (LOC549623), mRNA
          Length = 440

 Score =  238 bits (120), Expect = 1e-59
 Identities = 231/268 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||| ||||| |||||||| ||||| |||||||||||||| ||||| || || |||||||
Sbjct: 326 agcccccgaagccgtagagagtgcggccctggcgcttgagagcgtacaccacatccatgg 267

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           |||| |||||||| |    ||||||||||||||||||||||||||| |||||||| ||||
Sbjct: 266 cggtaacggtcttcctcttggcgtgctcggtgtaggtgacggcgtcccggatgacattct 207

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | ||||||||| || || |||||||| |||||||| || ||||||||||| |
Sbjct: 206 ccaggaaaaccttgaggaccccccgagtctcctcatagatgaggccagagatgcgcttga 147

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           | || || ||||  |||||||| |||||||| ||||||||||||||||||||||| || |
Sbjct: 146 ctccccctctccgtgccaggcggcggatggcgggcttggtgatgccctggatgttatccc 87

                                       
Query: 406 gcagcaccttccggtggcgcttggcgcc 433
           |||||||||||| ||| |||||||||||
Sbjct: 86  gcagcaccttcctgtgccgcttggcgcc 59



to top

>emb|CR848633.2| Xenopus tropicalis finished cDNA, clone TGas006m08
          Length = 440

 Score =  238 bits (120), Expect = 1e-59
 Identities = 231/268 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||| ||||| |||||||| ||||| |||||||||||||| ||||| || || |||||||
Sbjct: 326 agcccccgaagccgtagagagtgcggccctggcgcttgagagcgtacaccacatccatgg 267

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           |||| |||||||| |    ||||||||||||||||||||||||||| |||||||| ||||
Sbjct: 266 cggtaacggtcttcctcttggcgtgctcggtgtaggtgacggcgtcccggatgacattct 207

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | ||||||||| || || |||||||| |||||||| || ||||||||||| |
Sbjct: 206 ccaggaaaaccttgaggaccccccgagtctcctcatagatgaggccagagatgcgcttga 147

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           | || || ||||  |||||||| |||||||| ||||||||||||||||||||||| || |
Sbjct: 146 ctccccctctccgtgccaggcggcggatggcgggcttggtgatgccctggatgttatccc 87

                                       
Query: 406 gcagcaccttccggtggcgcttggcgcc 433
           |||||||||||| ||| |||||||||||
Sbjct: 86  gcagcaccttcctgtgccgcttggcgcc 59



to top

>gb|M27433.1|RATHIS4G Rattus norvegicus histone H4 gene, complete cds
          Length = 594

 Score =  236 bits (119), Expect = 6e-59
 Identities = 209/239 (87%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||| ||||| |||||||| || ||||||||||| ||||||||||| |||
Sbjct: 494 ccgaagccgtagagtgtgcggccctggcgtttaagcgcgtagaccacgtccatggcagtg 435

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 434 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 375

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 374 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 315

                                                                      
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcag 409
           || | ||  |||||||| |||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 314 ccgcgccgggccaggcggcggatggcgggctttgtgatgccctggatgttgtcgcgcag 256



to top

>gb|M28409.1|RATH1TH4T Rat testis-specific histone H1t and histone H4t, complete cds
          Length = 6861

 Score =  236 bits (119), Expect = 6e-59
 Identities = 209/239 (87%)
 Strand = Plus / Plus

                                                                        
Query: 171  ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
            ||||| |||||||| ||||| |||||||| || ||||||||||| ||||||||||| |||
Sbjct: 4742 ccgaagccgtagagtgtgcggccctggcgtttaagcgcgtagaccacgtccatggcagtg 4801

                                                                        
Query: 231  acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
            || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 4802 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 4861

                                                                        
Query: 291  aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
            || | ||| || || ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 4862 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 4921

                                                                       
Query: 351  cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcag 409
            || | ||  |||||||| |||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 4922 ccgcgccgggccaggcggcggatggcgggctttgtgatgccctggatgttgtcgcgcag 4980



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score =  228 bits (115), Expect = 1e-56
 Identities = 250/295 (84%)
 Strand = Plus / Plus

                                                                          
Query: 166    agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
              |||||||||| ||||| | |||||| |||||||||||||||||||| |||||||| |  |
Sbjct: 656515 agccgccgaagccgtacaaggtgcggccctggcgcttgagcgcgtacacgacgtcgagcg 656574

                                                                          
Query: 226    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
               |||||||||||||||   |||||||||||||||||||||||||||||||||||||  ||
Sbjct: 656575 aggtgacggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatgacggact 656634

                                                                          
Query: 286    cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
              | ||||    |||||| ||  ||||    |||||||| ||||| || ||||||||||| |
Sbjct: 656635 ccaggaccgacttgagcaccgcgcgcacgtcctcgtaaatgaggccggagatgcgcttga 656694

                                                                          
Query: 346    cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
              ||||||| |  |  ||||||||  ||||||| ||||||||||||||||||||||||||||
Sbjct: 656695 cgccgccacgacgggccaggcgcaggatggcgggcttggtgatgccctggatgttgtcgc 656754

                                                                     
Query: 406    gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
              | || | ||| ||||||||||| ||||||||||||||||| |||||||| |||||
Sbjct: 656755 ggaggatcttgcggtggcgcttcgcgccgcccttgccgaggcccttgcccccctt 656809



to top

>ref|XM_227462.3| PREDICTED: Rattus norvegicus histone 2, H4 (predicted)
           (Hist2h4_predicted), mRNA
          Length = 312

 Score =  228 bits (115), Expect = 1e-56
 Identities = 238/279 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||| ||||| ||||| ||||| || |||||||||||||| ||||| || || |||||
Sbjct: 312 ctagcctccgaagccgtacagggttcggccctggcgcttgagagcgtacaccacatccat 253

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
           ||||||||||||||||||   ||||||||| ||||||||||| ||||||||||| |||||
Sbjct: 252 ggcggtgacggtcttgcgcttggcgtgctcagtgtaggtgactgcgtcgcggatcacgtt 193

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           ||| ||||| | ||| || || || ||||||||||| |||||||| || |||||||||||
Sbjct: 192 ctccaggaacaccttcagtacaccacgggtctcctcatagatgaggccggagatgcgctt 133

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
            || ||||| | ||  || |||||||||||||| ||||||||||| ||||||||||| ||
Sbjct: 132 gacaccgccacgccgagctaggcgacggatggcgggcttggtgatcccctggatgttatc 73

                                                  
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgcc 442
            ||||  ||||| ||||| ||||||||||| ||||||||
Sbjct: 72  ccgcaagaccttgcggtgacgcttggcgccacccttgcc 34



to top

>ref|NM_210226.1| Eremothecium gossypii AER012Cp (AER012C), mRNA
          Length = 312

 Score =  228 bits (115), Expect = 1e-56
 Identities = 250/295 (84%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| ||||| | |||||| |||||||||||||||||||| |||||||| |  |
Sbjct: 310 agccgccgaagccgtacaaggtgcggccctggcgcttgagcgcgtacacgacgtcgagcg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
            |||||||||||||||   |||||||||||||||||||||||||||||||||||||  ||
Sbjct: 250 aggtgacggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatgacggact 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||    |||||| ||  ||||    |||||||| ||||| || ||||||||||| |
Sbjct: 190 ccaggaccgacttgagcaccgcgcgcacgtcctcgtaaatgaggccggagatgcgcttga 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           ||||||| |  |  ||||||||  ||||||| ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccacgacgggccaggcgcaggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                  
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctccctt 460
           | || | ||| ||||||||||| ||||||||||||||||| |||||||| |||||
Sbjct: 70  ggaggatcttgcggtggcgcttcgcgccgcccttgccgaggcccttgcccccctt 16



to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on
            chromosome 6
          Length = 269712

 Score =  226 bits (114), Expect = 6e-56
 Identities = 237/278 (85%)
 Strand = Plus / Minus

                                                                        
Query: 183  agggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 242
            |||||||||||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 5913 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 5854

                                                                        
Query: 243  cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagg 302
              ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||| 
Sbjct: 5853 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 5794

                                                                        
Query: 303  acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctcgcc 362
            || ||||| |||||||||||||| || || ||||| |||||||| ||||| | ||  |||
Sbjct: 5793 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 5734

                                                                        
Query: 363  aggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 422
            || || ||||||||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 5733 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 5674

                                                  
Query: 423  cgcttggcgccgcccttgccgagacccttgcctccctt 460
            |||||||| || ||||| || | |||||| || |||||
Sbjct: 5673 cgcttggcaccccccttacccaaacccttcccgccctt 5636



 Score =  188 bits (95), Expect = 1e-44
 Identities = 221/263 (84%)
 Strand = Plus / Minus

                                                                          
Query: 177    ccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtc 236
              ||||| || ||||||||||||||||||||||||||||| || ||||| || ||||| |||
Sbjct: 224724 ccgtacagagtgcgtccctggcgcttgagcgcgtagacaacatccattgcagtgactgtc 224665

                                                                          
Query: 237    ttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatc 296
              || ||   ||||||||| |||||||| |||||||| || || || ||||| ||||| | |
Sbjct: 224664 ttacgcttggcgtgctccgtgtaggttacggcgtcccgtatcacattctccaggaacacc 224605

                                                                          
Query: 297    ttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctc 356
              || || || |||||||||||||| || ||||| ||||| ||||| ||||||||||| |  
Sbjct: 224604 ttaagaacaccgcgggtctcctcataaatgaggcccgaaatgcgtttcacgccgccgcgt 224545

                                                                          
Query: 357    ctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttc 416
              |  |||| |||||||||||| ||||| ||||||||||| |||||||| |||||||| || 
Sbjct: 224544 cgggccaagcgacggatggcgggcttcgtgatgccctgtatgttgtcacgcagcactttg 224485

                                     
Query: 417    cggtggcgcttggcgccgccctt 439
              || |||||||||||||| |||||
Sbjct: 224484 cgatggcgcttggcgcctccctt 224462



 Score =  155 bits (78), Expect = 2e-34
 Identities = 252/310 (81%)
 Strand = Plus / Plus

                                                                          
Query: 166    agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
              |||||||||| || || || |||||||||||||||||||||||||| || ||||||||||
Sbjct: 172767 agccgccgaagccataaagagtgcgtccctggcgcttgagcgcgtacaccacgtccatgg 172826

                                                                          
Query: 226    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
              | ||||| ||||||||   |||||| || ||||||||||| || |||||||| || || |
Sbjct: 172827 ctgtgactgtcttgcgtttggcgtgttccgtgtaggtgacagcatcgcggattacatttt 172886

                                                                          
Query: 286    cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
              | ||||| |  || || || ||||| || ||||| || ||||| || || || ||||| |
Sbjct: 172887 ccaggaaaactttcagcactccgcgagtttcctcataaatgaggccagaaatacgcttga 172946

                                                                          
Query: 346    cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
              ||||||| |  |  |||||||| ||||| || ||||||||||| || ||||| ||||| |
Sbjct: 172947 cgccgccgcggcgagccaggcggcggatagcgggcttggtgattccttggatattgtcac 173006

                                                                          
Query: 406    gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
              |||  ||||| ||||| ||||||||||| ||||| || |||||||| || ||||| ||||
Sbjct: 173007 gcaataccttacggtgacgcttggcgccacccttacctagaccctttccgcccttaccgc 173066

                        
Query: 466    gcccggacat 475
              | || |||||
Sbjct: 173067 ggccagacat 173076



 Score =  145 bits (73), Expect = 2e-31
 Identities = 250/309 (80%)
 Strand = Plus / Plus

                                                                         
Query: 168   ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
             |||||||| ||||| || |||||||| || |||||||||||||| || || |||||||| 
Sbjct: 10887 ccgccgaagccgtacagagtgcgtccttgacgcttgagcgcgtaaaccacatccatggca 10946

                                                                         
Query: 228   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
             ||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||| 
Sbjct: 10947 gtgacagtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttctcc 11006

                                                                         
Query: 288   aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
             || || | |||||| ||||| || |||||||| || || |  || || || ||||| || 
Sbjct: 11007 agaaacaccttgagaacgccacgagtctcctcataaatcaaaccggaaattcgcttaacc 11066

                                                                         
Query: 348   ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
             || || | ||| || ||||| || |||||||| ||||||||||| |||||||| || |||
Sbjct: 11067 ccaccacgcctagcaaggcgccgaatggccggtttggtgatgccttggatgttatcccgc 11126

                                                                         
Query: 408   agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
             ||||| || ||||| |||||||| || ||||| || | ||| || || || |||||||| 
Sbjct: 11127 agcacttttcggtgacgcttggcacctcccttacccaaacctttaccgcctttgccgcga 11186

                      
Query: 468   ccggacatg 476
             || ||||||
Sbjct: 11187 ccagacatg 11195



 Score =  119 bits (60), Expect = 9e-24
 Identities = 249/312 (79%)
 Strand = Plus / Minus

                                                                          
Query: 165    tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
              ||||||||||| ||||| || ||||||||||| | ||| ||||||||||| || ||||| 
Sbjct: 188955 tagccgccgaagccgtaaagagtgcgtccctgtctcttcagcgcgtagaccacatccatc 188896

                                                                          
Query: 225    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
              || || || ||||||||   ||||||||| ||||| || || || || || || ||||| 
Sbjct: 188895 gctgtcactgtcttgcgtttggcgtgctccgtgtaagtcacagcatcacgaatcacgttt 188836

                                                                          
Query: 285    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
              || || || | ||| || || ||||| ||||||||||||||||| || || |||||||| 
Sbjct: 188835 tccagaaacaccttcagaaccccgcgagtctcctcgtagatgagaccagaaatgcgcttg 188776

                                                                          
Query: 345    acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
              || || || |  |  || ||||| |||||||| |||||||| |||||||||||||| || 
Sbjct: 188775 acacccccgcgacgagcaaggcgccggatggcaggcttggtaatgccctggatgttatct 188716

                                                                          
Query: 405    cgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccg 464
              ||||| ||||| ||||| ||||| ||||| || || || || ||||| || || ||||||
Sbjct: 188715 cgcaggaccttacggtgacgcttagcgcctcctttacccagtccctttccgcctttgccg 188656

                          
Query: 465    cgcccggacatg 476
              || || ||||||
Sbjct: 188655 cgaccagacatg 188644



 Score =  111 bits (56), Expect = 2e-21
 Identities = 197/244 (80%)
 Strand = Plus / Plus

                                                                          
Query: 165    tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
              ||||| ||||| ||||| || ||||||||||| ||||| ||||||||||| || ||||| 
Sbjct: 269189 tagccaccgaagccgtaaagagtgcgtccctgtcgcttcagcgcgtagaccacatccatt 269248

                                                                          
Query: 225    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
              || || |||||||||||   ||||||||| ||||| ||||| ||||| || || ||||||
Sbjct: 269249 gctgtcacggtcttgcgtttggcgtgctctgtgtaagtgacagcgtcacgaatcacgttc 269308

                                                                          
Query: 285    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
              || ||||| | ||| || || || || |||||||| ||||| || || || || ||||| 
Sbjct: 269309 tccaggaacaccttcagaacaccacgagtctcctcatagataaggccagaaattcgcttg 269368

                                                                          
Query: 345    acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
              || ||||| |  |  || ||||| ||||| || ||||| ||||||||||||||||| |||
Sbjct: 269369 acaccgccgcgacgagcaaggcgccggatagctggcttagtgatgccctggatgttatcg 269428

                  
Query: 405    cgca 408
              ||||
Sbjct: 269429 cgca 269432



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 132/162 (81%)
 Strand = Plus / Plus

                                                                          
Query: 191    tccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcggcgggcgtg 250
              ||||||||| |||||| ||||||| ||| ||||||||||||| ||||||||   ||||||
Sbjct: 230693 tccctggcgtttgagcacgtagaccacggccatggcggtgaccgtcttgcgcttggcgtg 230752

                                                                          
Query: 251    ctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgaggacgccgcg 310
              ||| |||| ||| |||||||  | ||| || || || ||||| | |||||  || | |||
Sbjct: 230753 ctccgtgttggtcacggcgtaccagatcacattttccaggaacaccttgaacacccggcg 230812

                                                        
Query: 311    ggtctcctcgtagatgagccccgagatgcgcttcacgccgcc 352
              ||||||||| || ||||| ||| |||||||||| || |||||
Sbjct: 230813 ggtctcctcataaatgaggcccaagatgcgcttgacaccgcc 230854



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 205/262 (78%)
 Strand = Plus / Minus

                                                                         
Query: 166   agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
             |||||||||| || || || ||||| ||||| || || || || || || || |||||||
Sbjct: 88199 agccgccgaagccatacagagtgcgcccctgacgttttagggcatatactacatccatgg 88140

                                                                         
Query: 226   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
             | ||||| || |||||   ||||||||| || |||||||||||||| || || |||||||
Sbjct: 88139 ctgtgacagttttgcgcttggcgtgctccgtataggtgacggcgtctcgaataacgttct 88080

                                                                         
Query: 286   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
             | | ||| | ||| || || || || |||||||| ||||| || || || |||||||| |
Sbjct: 88079 ctaagaaaaccttaagcacacctcgagtctcctcatagataagaccggaaatgcgcttga 88020

                                                                         
Query: 346   cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
             |||| || | ||  ||||  || || || ||||| || || |||||||||||||| || |
Sbjct: 88019 cgccaccgcgccgagccaaacggcgaatagccggttttgtaatgccctggatgttatccc 87960

                                   
Query: 406   gcagcaccttccggtggcgctt 427
             | |||||||| || ||||||||
Sbjct: 87959 ggagcaccttacgatggcgctt 87938



to top

>ref|NM_003538.3| Homo sapiens histone 1, H4a (HIST1H4A), mRNA
          Length = 372

 Score =  226 bits (114), Expect = 6e-56
 Identities = 237/278 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 agggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 242
           |||||||||||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 243 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagg 302
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||| 
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 303 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctcgcc 362
           || ||||| |||||||||||||| || || ||||| |||||||| ||||| | ||  |||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 363 aggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 422
           || || ||||||||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                                                 
Query: 423 cgcttggcgccgcccttgccgagacccttgcctccctt 460
           |||||||| || ||||| || | |||||| || |||||
Sbjct: 53  cgcttggcaccccccttacccaaacccttcccgccctt 16



to top

>gb|AY128654.1| Homo sapiens clone HIST1H4A histone H4 gene, complete cds
          Length = 930

 Score =  226 bits (114), Expect = 6e-56
 Identities = 237/278 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 agggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 242
           |||||||||||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 604 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 545

                                                                       
Query: 243 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagg 302
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||| 
Sbjct: 544 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 485

                                                                       
Query: 303 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctcgcc 362
           || ||||| |||||||||||||| || || ||||| |||||||| ||||| | ||  |||
Sbjct: 484 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 425

                                                                       
Query: 363 aggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 422
           || || ||||||||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 424 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 365

                                                 
Query: 423 cgcttggcgccgcccttgccgagacccttgcctccctt 460
           |||||||| || ||||| || | |||||| || |||||
Sbjct: 364 cgcttggcaccccccttacccaaacccttcccgccctt 327



to top

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
              hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
              sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score =  226 bits (114), Expect = 6e-56
 Identities = 237/278 (85%)
 Strand = Plus / Plus

                                                                          
Query: 183    agggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 242
              |||||||||||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 119088 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 119147

                                                                          
Query: 243    cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagg 302
                ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||| 
Sbjct: 119148 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 119207

                                                                          
Query: 303    acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctcgcc 362
              || ||||| |||||||||||||| || || ||||| |||||||| ||||| | ||  |||
Sbjct: 119208 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 119267

                                                                          
Query: 363    aggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 422
              || || ||||||||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 119268 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 119327

                                                    
Query: 423    cgcttggcgccgcccttgccgagacccttgcctccctt 460
              |||||||| || ||||| || | |||||| || |||||
Sbjct: 119328 cgcttggcaccccccttacccaaacccttcccgccctt 119365



 Score =  145 bits (73), Expect = 2e-31
 Identities = 250/309 (80%)
 Strand = Plus / Minus

                                                                          
Query: 168    ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
              |||||||| ||||| || |||||||| || |||||||||||||| || || |||||||| 
Sbjct: 114114 ccgccgaagccgtacagagtgcgtccttgacgcttgagcgcgtaaaccacatccatggca 114055

                                                                          
Query: 228    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
              ||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||| 
Sbjct: 114054 gtgacagtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttctcc 113995

                                                                          
Query: 288    aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
              || || | |||||| ||||| || |||||||| || || |  || || || ||||| || 
Sbjct: 113994 agaaacaccttgagaacgccacgagtctcctcataaatcaaaccggaaattcgcttaacc 113935

                                                                          
Query: 348    ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
              || || | ||| || ||||| || |||||||| ||||||||||| |||||||| || |||
Sbjct: 113934 ccaccacgcctagcaaggcgccgaatggccggtttggtgatgccttggatgttatcccgc 113875

                                                                          
Query: 408    agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
              ||||| || ||||| |||||||| || ||||| || | ||| || || || |||||||| 
Sbjct: 113874 agcacttttcggtgacgcttggcacctcccttacccaaacctttaccgcctttgccgcga 113815

                       
Query: 468    ccggacatg 476
              || ||||||
Sbjct: 113814 ccagacatg 113806



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 205/262 (78%)
 Strand = Plus / Plus

                                                                         
Query: 166   agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
             |||||||||| || || || ||||| ||||| || || || || || || || |||||||
Sbjct: 36802 agccgccgaagccatacagagtgcgcccctgacgttttagggcatatactacatccatgg 36861

                                                                         
Query: 226   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
             | ||||| || |||||   ||||||||| || |||||||||||||| || || |||||||
Sbjct: 36862 ctgtgacagttttgcgcttggcgtgctccgtataggtgacggcgtctcgaataacgttct 36921

                                                                         
Query: 286   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
             | | ||| | ||| || || || || |||||||| ||||| || || || |||||||| |
Sbjct: 36922 ctaagaaaaccttaagcacacctcgagtctcctcatagataagaccggaaatgcgcttga 36981

                                                                         
Query: 346   cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
             |||| || | ||  ||||  || || || ||||| || || |||||||||||||| || |
Sbjct: 36982 cgccaccgcgccgagccaaacggcgaatagccggttttgtaatgccctggatgttatccc 37041

                                   
Query: 406   gcagcaccttccggtggcgctt 427
             | |||||||| || ||||||||
Sbjct: 37042 ggagcaccttacgatggcgctt 37063



to top

>gb|BC069654.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:97476
           IMAGE:7262752), complete cds
          Length = 365

 Score =  226 bits (114), Expect = 6e-56
 Identities = 237/278 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 agggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 242
           |||||||||||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 243 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagg 302
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||| 
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 303 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctcgcc 362
           || ||||| |||||||||||||| || || ||||| |||||||| ||||| | ||  |||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 363 aggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 422
           || || ||||||||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                                                 
Query: 423 cgcttggcgccgcccttgccgagacccttgcctccctt 460
           |||||||| || ||||| || | |||||| || |||||
Sbjct: 53  cgcttggcaccccccttacccaaacccttcccgccctt 16



to top

>gb|BC067495.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79351
           IMAGE:7002090), complete cds
          Length = 349

 Score =  226 bits (114), Expect = 6e-56
 Identities = 237/278 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 agggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 242
           |||||||||||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 243 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagg 302
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||| 
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 303 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctcgcc 362
           || ||||| |||||||||||||| || || ||||| |||||||| ||||| | ||  |||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 363 aggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 422
           || || ||||||||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                                                 
Query: 423 cgcttggcgccgcccttgccgagacccttgcctccctt 460
           |||||||| || ||||| || | |||||| || |||||
Sbjct: 53  cgcttggcaccccccttacccaaacccttcccgccctt 16



to top

>emb|X00091.1|HSHISH4 Human histone H4 gene
          Length = 709

 Score =  226 bits (114), Expect = 6e-56
 Identities = 259/306 (84%), Gaps = 1/306 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 424 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 365

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| | |
Sbjct: 364 accgtcttgcgcttggcgtgctctgtataggttacggcgtcccggattacgttctccaag 305

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 304 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 245

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  || ||||| || ||||| || ||||||||||| ||||| ||||||||||| 
Sbjct: 244 ccgcggc-ggcaaggcgtcgaatggctggtttggtgatgccatggatattgtcgcgcagt 186

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 185 actttacggtggcgcttagcgccgcctttgccaaggcccttcccgcctttgccgcggcca 126

                 
Query: 471 gacatg 476
           ||||||
Sbjct: 125 gacatg 120



to top

>gb|BC066248.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79349
           IMAGE:7002088), complete cds
          Length = 349

 Score =  226 bits (114), Expect = 6e-56
 Identities = 237/278 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 agggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 242
           |||||||||||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 243 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagg 302
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||| 
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 303 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctcgcc 362
           || ||||| |||||||||||||| || || ||||| |||||||| ||||| | ||  |||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 363 aggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 422
           || || ||||||||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                                                 
Query: 423 cgcttggcgccgcccttgccgagacccttgcctccctt 460
           |||||||| || ||||| || | |||||| || |||||
Sbjct: 53  cgcttggcaccccccttacccaaacccttcccgccctt 16



to top

>gb|BC066249.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79350
           IMAGE:7002089), complete cds
          Length = 349

 Score =  226 bits (114), Expect = 6e-56
 Identities = 237/278 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 agggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 242
           |||||||||||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 243 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagg 302
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||| 
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 303 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctcgcc 362
           || ||||| |||||||||||||| || || ||||| |||||||| ||||| | ||  |||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 363 aggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 422
           || || ||||||||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                                                 
Query: 423 cgcttggcgccgcccttgccgagacccttgcctccctt 460
           |||||||| || ||||| || | |||||| || |||||
Sbjct: 53  cgcttggcaccccccttacccaaacccttcccgccctt 16



to top

>emb|BX061454.1|CNS09JKY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score =  224 bits (113), Expect = 2e-55
 Identities = 254/301 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 402 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 343

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 342 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 283

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 282 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 223

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 222 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 163

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 162 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 103

            
Query: 471 g 471
           |
Sbjct: 102 g 102



to top

>emb|BX057867.1|CNS09GTB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score =  224 bits (113), Expect = 2e-55
 Identities = 254/301 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 413 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 354

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 353 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 294

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 293 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 234

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 233 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 174

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 173 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 114

            
Query: 471 g 471
           |
Sbjct: 113 g 113



to top

>emb|BX053174.1|CNS09D6Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 626

 Score =  224 bits (113), Expect = 2e-55
 Identities = 254/301 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 402 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 343

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 342 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 283

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 282 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 223

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 222 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 163

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 162 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 103

            
Query: 471 g 471
           |
Sbjct: 102 g 102



to top

>emb|BX048034.1|CNS09986 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score =  224 bits (113), Expect = 2e-55
 Identities = 254/301 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 382 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 323

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 322 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 263

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 262 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 203

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 202 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 143

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 142 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 83

            
Query: 471 g 471
           |
Sbjct: 82  g 82



to top

>emb|BX037780.1|CNS091BC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 622

 Score =  224 bits (113), Expect = 2e-55
 Identities = 254/301 (84%)
 Strand = Plus / Plus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 237 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 296

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 297 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 356

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 357 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 416

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 417 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 476

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 477 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 536

            
Query: 471 g 471
           |
Sbjct: 537 g 537



to top

>emb|BX037779.1|CNS091BB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 604

 Score =  224 bits (113), Expect = 2e-55
 Identities = 254/301 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 421 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 362

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 361 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 302

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 301 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 242

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 241 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 182

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 181 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 122

            
Query: 471 g 471
           |
Sbjct: 121 g 121



to top

>emb|BX020583.1|CNS08O1N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 394

 Score =  224 bits (113), Expect = 2e-55
 Identities = 254/301 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 323 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 264

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 263 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 204

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 203 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 144

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 143 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 84

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 83  accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 24

            
Query: 471 g 471
           |
Sbjct: 23  g 23



to top

>emb|BX009114.1|CNS08F72 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score =  224 bits (113), Expect = 2e-55
 Identities = 254/301 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 384 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 325

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 324 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 265

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 264 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 205

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 204 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 145

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 144 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 85

            
Query: 471 g 471
           |
Sbjct: 84  g 84



to top

>ref|XM_306825.2| Anopheles gambiae str. PEST ENSANGP00000000125
           (ENSANGG00000000123), partial mRNA
          Length = 312

 Score =  224 bits (113), Expect = 2e-55
 Identities = 254/301 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 305 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 246

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 186

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 185 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 126

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 125 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 66

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 65  accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 6

            
Query: 471 g 471
           |
Sbjct: 5   g 5



to top

>gb|BC078038.1| Xenopus laevis histone 1, H4l, mRNA (cDNA clone MGC:82777
           IMAGE:5161621), complete cds
          Length = 1057

 Score =  222 bits (112), Expect = 9e-55
 Identities = 259/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| |||||||| ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 319 ccgccgaagccgtagagagtgcggccctggcgcttgagagcgtacaccacatccatggcg 260

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           || |||||||| |    |||||| || ||||||||||||||||| |||||||| ||||| 
Sbjct: 259 gtaacggtcttcctcttggcgtgttctgtgtaggtgacggcgtcccggatgacattctcc 200

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||||||||| || || |||||||| |||||||| || ||||||||||| || 
Sbjct: 199 aggaaaaccttgaggaccccacgagtctcctcatagatgaggccagagatgcgcttgact 140

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || ||||  |||||||| |||||||| ||||||||||||||||||||||| || |  
Sbjct: 139 ccccctctccgtgccaggcggcggatggcgggcttggtgatgccctggatgttatccctg 80

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           |||||||||| ||| ||||||||||| || || || || || || ||||| |||||||| 
Sbjct: 79  agcaccttcctgtgccgcttggcgcctcctttccccagtccttttcctcctttgccgcgg 20

                   
Query: 468 ccggacat 475
           ||||||||
Sbjct: 19  ccggacat 12



to top

>ref|XM_595302.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC517138), mRNA
          Length = 312

 Score =  222 bits (112), Expect = 9e-55
 Identities = 259/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||| || |||||||| || || |||||||||||||| |||||||| |||||||| |||
Sbjct: 308 ccgccaaagccgtagagagtacggccctggcgcttgagagcgtagaccacgtccatagcg 249

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||| ||||| ||   ||| ||||||||||||||||| ||||| ||||| |||||||| 
Sbjct: 248 gtgaccgtcttccgcttggcatgctcggtgtaggtgaccgcgtcccggatcacgttctcc 189

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           || || |  || ||||| ||||||||||| |||||||||||||| |||||||||||||| 
Sbjct: 188 agaaacactttcaggaccccgcgggtctcttcgtagatgagcccagagatgcgcttcaca 129

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || |  |  |||||||| ||||| || || || ||||||||||||||||||||||||
Sbjct: 128 ccaccacgacgagccaggcggcggatagcaggtttagtgatgccctggatgttgtcgcgc 69

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           || ||||| ||||||||||| |||||||| || || ||||| ||||| || |||||||| 
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttccccagacctttgccgcctttgccgcgt 9

                   
Query: 468 ccggacat 475
           || |||||
Sbjct: 8   ccagacat 1



to top

>gb|AC150544.3| Bos taurus  BAC CH240-75C8 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 190186

 Score =  218 bits (110), Expect = 1e-53
 Identities = 260/310 (83%)
 Strand = Plus / Plus

                                                                          
Query: 168    ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
              ||||| || |||||||| || || |||||||||||||| |||||||| |||||||| |||
Sbjct: 184923 ccgccaaagccgtagagagtacggccctggcgcttgagagcgtagaccacgtccatagcg 184982

                                                                          
Query: 228    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
              ||||| ||||| ||   ||| |||||||||||||||||  |||| ||||| |||||||| 
Sbjct: 184983 gtgactgtcttccgcttggcatgctcggtgtaggtgaccacgtcccggatcacgttctcc 185042

                                                                          
Query: 288    aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
              || || |  || ||||| ||||||||||| |||||||||||||| |||||||||||||| 
Sbjct: 185043 agaaacacttttaggaccccgcgggtctcttcgtagatgagcccagagatgcgcttcaca 185102

                                                                          
Query: 348    ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
              || || |  |  |||||||| ||||| || || || ||||||||||||||||||||||||
Sbjct: 185103 ccaccacgacgagccaggcggcggatagcaggtttagtgatgccctggatgttgtcgcgc 185162

                                                                          
Query: 408    agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
              || ||||| ||||||||||| |||||||| || || ||||| ||||| || |||||||| 
Sbjct: 185163 agaaccttacggtggcgcttagcgccgcctttccccagacctttgccgcctttgccgcgt 185222

                        
Query: 468    ccggacatgg 477
              || |||||||
Sbjct: 185223 ccagacatgg 185232



to top

>emb|X60481.1|HSH4AHIS H.sapiens H4/a gene for H4 histone
          Length = 672

 Score =  218 bits (110), Expect = 1e-53
 Identities = 236/278 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 agggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 242
           |||||||||||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 473 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 414

                                                                       
Query: 243 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagg 302
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||| 
Sbjct: 413 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 354

                                                                       
Query: 303 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctcgcc 362
           || ||||| |||||||||||||| || || ||||| |||||||| ||||| | ||  |||
Sbjct: 353 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 294

                                                                       
Query: 363 aggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 422
           || || |||||||| |||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 293 agacgccggatggctggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 234

                                                 
Query: 423 cgcttggcgccgcccttgccgagacccttgcctccctt 460
           |||||||| || ||||| || | |||||| || |||||
Sbjct: 233 cgcttggcaccccccttacccaaacccttcccgccctt 196



to top

>emb|BX039313.1|CNS092HX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score =  216 bits (109), Expect = 5e-53
 Identities = 254/301 (84%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 408 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 349

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 348 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 290

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 289 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 230

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 229 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 170

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 169 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 110

            
Query: 471 g 471
           |
Sbjct: 109 g 109



to top

>emb|BX032921.1|CNS08XKD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score =  216 bits (109), Expect = 5e-53
 Identities = 253/301 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||| | || ||||| || || ||||| || |||
Sbjct: 404 ccgaatccgtagagcgtacggccctggcgcctcagagcgtacaccacatccatcgccgtg 345

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 344 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 285

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 284 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 225

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 224 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 165

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 164 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 105

            
Query: 471 g 471
           |
Sbjct: 104 g 104



to top

>ref|XM_311439.2| Anopheles gambiae str. PEST ENSANGP00000018626
           (ENSANGG00000016137), partial mRNA
          Length = 312

 Score =  216 bits (109), Expect = 5e-53
 Identities = 253/301 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 305 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 246

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||| ||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 245 accgtcttacgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 186

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 185 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 126

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 125 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 66

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 65  accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 6

            
Query: 471 g 471
           |
Sbjct: 5   g 5



to top

>gb|J00986.1|XELHIS4L xenopus laevis h4 histone mrna
          Length = 372

 Score =  216 bits (109), Expect = 5e-53
 Identities = 247/293 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           ||||||||||| || |||||||| |||||||| || || || || || ||||| ||||||
Sbjct: 298 ccgaatccgtacagagtgcgtccttggcgcttcagagcatacaccacatccatagcggtg 239

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           |||||||| |    ||||||||||||||||||||| ||||| ||||| |||||||| |||
Sbjct: 238 acggtcttcctcttggcgtgctcggtgtaggtgaccgcgtcccggataacgttctccagg 179

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || |  || || || ||||| ||||||||||||||||| || ||||||||||| || || 
Sbjct: 178 aacactttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttgactccc 119

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || || |  |||||||| |||||||| ||||||||||||||||||||||| || ||||||
Sbjct: 118 cctctgcgtgccaggcggcggatggcgggcttggtgatgccctggatgttatcccgcagc 59

                                                                
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||||| ||||||||| ||||| || ||||| |||||||| || ||||||||
Sbjct: 58  accttcctgtggcgcttagcgcctcctttgcccagaccctttccgcccttgcc 6



to top

>ref|XM_604220.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC525863), mRNA
          Length = 312

 Score =  214 bits (108), Expect = 2e-52
 Identities = 258/308 (83%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||| || |||||||| || || |||||||||||||| |||||||| |||||||| |||
Sbjct: 308 ccgccaaagccgtagagagtacggccctggcgcttgagagcgtagaccacgtccatagcg 249

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||| ||||| ||   ||| |||||||||||||||||  |||| ||||| |||||||| 
Sbjct: 248 gtgactgtcttccgcttggcatgctcggtgtaggtgaccacgtcccggatcacgttctcc 189

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           || || |  || ||||| ||||||||||| |||||||||||||| |||||||||||||| 
Sbjct: 188 agaaacacttttaggaccccgcgggtctcttcgtagatgagcccagagatgcgcttcaca 129

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || |  |  |||||||| ||||| || || || ||||||||||||||||||||||||
Sbjct: 128 ccaccacgacgagccaggcggcggatagcaggtttagtgatgccctggatgttgtcgcgc 69

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           || ||||| ||||||||||| |||||||| || || ||||| ||||| || |||||||| 
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttccccagacctttgccgcctttgccgcgt 9

                   
Query: 468 ccggacat 475
           || |||||
Sbjct: 8   ccagacat 1



to top

>gb|AY450353.1| Bos grunniens histone H4.1 mRNA, partial cds
          Length = 313

 Score =  214 bits (108), Expect = 2e-52
 Identities = 225/264 (85%)
 Strand = Plus / Minus

                                                                       
Query: 170 gccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggt 229
           |||||| || || |||||||| |||||||| ||||||||||| || ||||||||||||||
Sbjct: 306 gccgaaaccataaagggtgcgaccctggcgtttgagcgcgtaaaccacgtccatggcggt 247

                                                                       
Query: 230 gacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgag 289
           ||| ||||||||   ||||||||| ||||||||||| ||||| ||||| || || || ||
Sbjct: 246 gacagtcttgcgtttggcgtgctccgtgtaggtgaccgcgtctcggatcacattttccag 187

                                                                       
Query: 290 gaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgcc 349
            || | ||| || || || ||||||||||||||||||||||| |||||||||||||| ||
Sbjct: 186 aaacaccttcagcaccccacgggtctcctcgtagatgagcccggagatgcgcttcacacc 127

                                                                       
Query: 350 gcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcag 409
            || |  |  ||||||||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 126 accacgacgagccaggcgacggatggcgggcttggtgataccctggatattgtcgcgcag 67

                                   
Query: 410 caccttccggtggcgcttggcgcc 433
            ||||| ||||||||||| |||||
Sbjct: 66  aaccttgcggtggcgcttagcgcc 43



to top

>emb|BX061529.1|CNS09JN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score =  214 bits (108), Expect = 2e-52
 Identities = 250/296 (84%), Gaps = 1/296 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 357 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 298

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 297 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 239

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 238 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 179

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 178 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 119

                                                                   
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcg 466
           ||||| || || |||||||| || ||||| || || ||||||||||||||||||||
Sbjct: 118 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 63



to top

>emb|BX060419.1|CNS09IS7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score =  214 bits (108), Expect = 2e-52
 Identities = 250/296 (84%), Gaps = 1/296 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 388 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 329

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 328 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 270

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 269 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 210

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 209 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 150

                                                                   
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcg 466
           ||||| || || |||||||| || ||||| || || ||||||||||||||||||||
Sbjct: 149 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 94



to top

>emb|X00224.1|XLHIS4 Xenopus laevis H4 histone gene and flanking regions
          Length = 815

 Score =  214 bits (108), Expect = 2e-52
 Identities = 258/308 (83%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| |||||||| ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 715 ccgccgaagccgtagagagtgcggccctggcgcttgagagcgtacaccacatccatggcg 656

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           || |||||||| |    ||||||||||||||||||||| ||||| |||||||| ||||| 
Sbjct: 655 gtaacggtcttcctcttggcgtgctcggtgtaggtgacagcgtcccggatgacattctcc 596

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||||||||| || || || ||||| || ||||| || ||||||||||| || 
Sbjct: 595 aggaaaaccttgaggaccccacgagtttcctcataaatgaggccagagatgcgcttgact 536

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || ||||  |||||||| |||||||| |||||||||||||||||||||||||| |  
Sbjct: 535 ccccctctccgtgccaggcggcggatggcaggcttggtgatgccctggatgttgtccctg 476

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           |||||||||| ||| ||||||||||| || || || || || || ||||| |||||||| 
Sbjct: 475 agcaccttcctgtgccgcttggcgcctcctttccccagtccttttcctcctttgccgcgt 416

                   
Query: 468 ccggacat 475
           || |||||
Sbjct: 415 ccagacat 408



to top

>ref|XM_601250.2| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC522961), mRNA
          Length = 312

 Score =  210 bits (106), Expect = 3e-51
 Identities = 232/274 (84%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| || |||||||||||||| ||||| |||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccatagagggtgcgtccttggcgtttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           ||||||| ||||||||   ||||||||||||||||||||| || || ||||| || ||||
Sbjct: 250 cggtgacagtcttgcgcttggcgtgctcggtgtaggtgactgcatcccggatcacattct 191

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | ||||| | ||| || || ||||||||||||||||||||||| || |||||||| || |
Sbjct: 190 ccaggaacaccttcagcaccccgcgggtctcctcgtagatgaggccggagatgcgtttga 131

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           | || || | ||  || ||||| ||||| || ||||| |||||||||||||||||||| |
Sbjct: 130 ctcctccacgccgagctaggcggcggatagcgggcttagtgatgccctggatgttgtctc 71

                                             
Query: 406 gcagcaccttccggtggcgcttggcgccgccctt 439
           |||  || || ||||| ||||||||||| |||||
Sbjct: 70  gcaaaactttgcggtgacgcttggcgcccccctt 37



to top

>emb|BX053210.1|CNS09D7Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score =  210 bits (106), Expect = 3e-51
 Identities = 254/302 (84%), Gaps = 1/302 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 395 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 336

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 335 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 276

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 275 aacaccttcagtacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 216

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 215 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 156

                                                                       
Query: 411 accttccggtggcgcttggc-gccgcccttgccgagacccttgcctcccttgccgcgccc 469
           ||||| || || ||||||||  || ||||| || || |||||||||||||||||||| ||
Sbjct: 155 accttgcgatgacgcttggctccctccctttcccagtcccttgcctcccttgccgcgacc 96

             
Query: 470 gg 471
           ||
Sbjct: 95  gg 94



to top

>emb|BX052400.1|CNS09CLG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score =  210 bits (106), Expect = 3e-51
 Identities = 254/302 (84%), Gaps = 1/302 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 398 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 339

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 338 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 279

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 278 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 219

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 218 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 159

                                                                       
Query: 411 accttccggtggcgcttggcgccgcc-cttgccgagacccttgcctcccttgccgcgccc 469
           ||||| || || |||||||| || || ||| || || |||||||||||||||||||| ||
Sbjct: 158 accttgcgatgacgcttggctcctccgctttcccagtcccttgcctcccttgccgcgacc 99

             
Query: 470 gg 471
           ||
Sbjct: 98  gg 97



to top

>ref|XM_545396.2| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488274), mRNA
          Length = 366

 Score =  208 bits (105), Expect = 1e-50
 Identities = 147/161 (91%)
 Strand = Plus / Minus

                                                                       
Query: 306 ccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctcgccagg 365
           ||||||||||||||||||||||| |||||||||||||| |||||||| | ||  ||||| 
Sbjct: 233 ccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccgccgcgccgggccagc 174

                                                                       
Query: 366 cgacggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtggcgc 425
           || |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 173 cgccggatggcgggcttggtgatgccctggatgttgtcgcgcagcaccttgcggtggcgc 114

                                                    
Query: 426 ttggcgccgcccttgccgagacccttgcctcccttgccgcg 466
           ||||||||||||||||| || ||||| || |||||||||||
Sbjct: 113 ttggcgccgcccttgcccagccccttcccgcccttgccgcg 73



to top

>emb|BX066856.1|CNS09NR0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score =  208 bits (105), Expect = 1e-50
 Identities = 253/301 (84%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 407 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 348

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||| ||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 347 accgtcttacgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 289

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 288 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 229

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 228 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 169

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 168 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 109

            
Query: 471 g 471
           |
Sbjct: 108 g 108



to top

>emb|BX053099.1|CNS09D4V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 434

 Score =  208 bits (105), Expect = 1e-50
 Identities = 252/301 (83%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 347 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 288

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || || || ||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 287 accgttttacgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 228

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 227 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 168

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 167 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 108

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 107 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 48

            
Query: 471 g 471
           |
Sbjct: 47  g 47



to top

>emb|BX047092.1|CNS098I0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score =  208 bits (105), Expect = 1e-50
 Identities = 253/301 (84%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 392 ccgaatccgtagagcgtacggccctgccgcttcagagcgtacaccacatccatcgccgtg 333

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 332 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 274

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 273 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 214

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 213 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 154

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 153 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 94

            
Query: 471 g 471
           |
Sbjct: 93  g 93



to top

>emb|BX043671.1|CNS095UZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16BG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 645

 Score =  208 bits (105), Expect = 1e-50
 Identities = 247/293 (84%), Gaps = 1/293 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 379 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 320

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 319 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 261

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 260 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 201

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 200 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 141

                                                                
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
           ||||| || || |||||||| || ||||| || || |||||||||||||||||
Sbjct: 140 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgcc 88



to top

>emb|BX036322.1|CNS0906U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score =  208 bits (105), Expect = 1e-50
 Identities = 253/301 (84%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 401 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 342

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||| ||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 341 accgtcttacgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 283

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 282 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 223

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 222 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 163

                                                                       
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgcccg 470
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 162 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 103

            
Query: 471 g 471
           |
Sbjct: 102 g 102



to top

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  208 bits (105), Expect = 1e-50
 Identities = 246/293 (83%)
 Strand = Plus / Minus

                                                                        
Query: 171  ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
            ||||||||||| || |||||||| |||||||| || || || || || ||||| ||||| 
Sbjct: 7253 ccgaatccgtacagagtgcgtccttggcgcttcagagcatacaccacatccatagcggta 7194

                                                                        
Query: 231  acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
            |||||||| |    ||||||||||||||||||||||||||| ||||| |||||||| |||
Sbjct: 7193 acggtcttcctcttggcgtgctcggtgtaggtgacggcgtcccggataacgttctccagg 7134

                                                                        
Query: 291  aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
            || |  ||||| || ||||| ||||||||||||||||| || ||||||||||| || || 
Sbjct: 7133 aaaactttgagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttgactccc 7074

                                                                        
Query: 351  cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
            || || |  || ||||| |||||||| ||||||||||||||||||||||| || ||||||
Sbjct: 7073 cctctgcgtgcgaggcggcggatggcgggcttggtgatgccctggatgttatcccgcagc 7014

                                                                 
Query: 411  accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
            ||||||| ||| || |||||||| || ||||| |||||||| || ||||||||
Sbjct: 7013 accttcctgtgacgtttggcgcctcctttgcccagaccctttccgcccttgcc 6961



to top

>ref|NM_173880.2| Bos taurus histone H4 (H4), mRNA
          Length = 1517

 Score =  208 bits (105), Expect = 1e-50
 Identities = 228/269 (84%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || ||||| ||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 351 tagccgccgaaaccatagagagtgcggccctggcgtttgagcgcgtaaaccacgtccata 292

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           ||||| || ||||||||   ||||||||| ||||||||||| ||||| ||||| || || 
Sbjct: 291 gcggttacagtcttgcgtttggcgtgctccgtgtaggtgaccgcgtcccggatcacattt 232

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || || || | ||| || || || ||||||||||||||||||||||| ||||||||||||
Sbjct: 231 tccagaaacaccttcagcaccccacgggtctcctcgtagatgagcccggagatgcgcttc 172

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || |  |  ||||||||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 171 acaccaccacgacgagccaggcgacggatggcgggcttggtgataccctggatattgtcg 112

                                        
Query: 405 cgcagcaccttccggtggcgcttggcgcc 433
           ||||| ||||| ||||||||||| |||||
Sbjct: 111 cgcagaaccttgcggtggcgcttagcgcc 83



to top

>gb|AF001288.1|AF001288 Bos taurus histone H4.1 mRNA, complete cds
          Length = 1517

 Score =  208 bits (105), Expect = 1e-50
 Identities = 228/269 (84%)
 Strand = Plus / Minus

                                                                       
Query: 165 tagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatg 224
           ||||||||||| || ||||| ||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 351 tagccgccgaaaccatagagagtgcggccctggcgtttgagcgcgtaaaccacgtccata 292

                                                                       
Query: 225 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 284
           ||||| || ||||||||   ||||||||| ||||||||||| ||||| ||||| || || 
Sbjct: 291 gcggttacagtcttgcgtttggcgtgctccgtgtaggtgaccgcgtcccggatcacattt 232

                                                                       
Query: 285 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 344
           || || || | ||| || || || ||||||||||||||||||||||| ||||||||||||
Sbjct: 231 tccagaaacaccttcagcaccccacgggtctcctcgtagatgagcccggagatgcgcttc 172

                                                                       
Query: 345 acgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcg 404
           || || || |  |  ||||||||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 171 acaccaccacgacgagccaggcgacggatggcgggcttggtgataccctggatattgtcg 112

                                        
Query: 405 cgcagcaccttccggtggcgcttggcgcc 433
           ||||| ||||| ||||||||||| |||||
Sbjct: 111 cgcagaaccttgcggtggcgcttagcgcc 83



to top

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score =  208 bits (105), Expect = 1e-50
 Identities = 246/293 (83%)
 Strand = Plus / Minus

                                                                        
Query: 171  ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
            ||||||||||| || |||||||| |||||||| || || || || || ||||| ||||| 
Sbjct: 7269 ccgaatccgtacagagtgcgtccttggcgcttcagagcatacaccacatccatagcggta 7210

                                                                        
Query: 231  acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
            |||||||| |    ||||||||||||||||||||||||||| ||||| |||||||| |||
Sbjct: 7209 acggtcttcctcttggcgtgctcggtgtaggtgacggcgtcccggataacgttctccagg 7150

                                                                        
Query: 291  aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
            || |  ||||| || ||||| ||||||||||||||||| || ||||||||||| || || 
Sbjct: 7149 aaaactttgagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttgactccc 7090

                                                                        
Query: 351  cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
            || || |  || ||||| |||||||| ||||||||||||||||||||||| || ||||||
Sbjct: 7089 cctctgcgtgcgaggcggcggatggcgggcttggtgatgccctggatgttatcccgcagc 7030

                                                                 
Query: 411  accttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
            ||||||| ||| || |||||||| || ||||| |||||||| || ||||||||
Sbjct: 7029 accttcctgtgacgtttggcgcctcctttgcccagaccctttccgcccttgcc 6977



to top

>ref|XM_602616.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC524294), mRNA
          Length = 312

 Score =  206 bits (104), Expect = 5e-50
 Identities = 257/308 (83%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           ||||| || |||||||| || || |||||||||||||| |||||||| |||||||| |||
Sbjct: 308 ccgccaaagccgtagagagtacggccctggcgcttgagagcgtagaccacgtccatagcg 249

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           ||||| | ||| ||   ||| ||||||||||||||||| ||||| | ||| |||||||| 
Sbjct: 248 gtgaccgccttccgcttggcatgctcggtgtaggtgaccgcgtcccagatcacgttctcc 189

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           || || |  || ||||| ||||||||||| |||||||||||||| |||||||||||||| 
Sbjct: 188 agaaacactttcaggaccccgcgggtctcttcgtagatgagcccagagatgcgcttcaca 129

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || |  |  |||||||| ||||| || || || ||||||||||||||||||||||||
Sbjct: 128 ccaccacgacgagccaggcggcggatagcaggtttagtgatgccctggatgttgtcgcgc 69

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           || ||||| ||||||||||| |||||||| || || ||||| ||||| || |||||||| 
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttccccagacctttgccgcctttgccgcgt 9

                   
Query: 468 ccggacat 475
           || |||||
Sbjct: 8   ccagacat 1



to top

>emb|BX054530.1|CNS09E8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score =  206 bits (104), Expect = 5e-50
 Identities = 242/288 (84%)
 Strand = Plus / Minus

                                                                       
Query: 171 ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
           |||||||||||||| || || ||||||||||| || ||||| || || ||||| || |||
Sbjct: 398 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 339

                                                                       
Query: 231 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 338 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 279

                                                                       
Query: 291 aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 278 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 219

                                                                       
Query: 351 cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
           || |  |  ||||| || |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 218 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 159

                                                           
Query: 411 accttccggtggcgcttggcgccgcccttgccgagacccttgcctccc 458
           ||||| || || |||||||| || ||||| || || ||||||||||||
Sbjct: 158 accttgcgatgacgcttggctcctccctttcccagtcccttgcctccc 111



to top

>emb|BX047203.1|CNS098L3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 192 ccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcggcgggcgtgc 251
           ||||||||||| || ||||| || || ||||| || ||||| ||||||||   |||||||
Sbjct: 310 ccctggcgcttcagagcgtacaccacatccatcgccgtgaccgtcttgcgcttggcgtgc 251

                                                                       
Query: 252 tcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgaggacgccgcgg 311
           |||||||||||||| || |||||||| |||||||| ||||| | ||| || || ||||| 
Sbjct: 250 tcggtgtaggtgaccgcatcgcggatcacgttctccaggaacaccttcagcacaccgcgc 191

                                                                       
Query: 312 gtctcctcgtagatgagccccgagatgcgcttcacgccgcccctcctcgccaggcgacgg 371
           ||||| |||||||| || || ||||| |||||||||||||| |  |  ||||| || |||
Sbjct: 190 gtctcttcgtagatcaggccggagatacgcttcacgccgccacggcgagccagacggcgg 131

                                                                       
Query: 372 atggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtggcgcttggcg 431
           ||||| ||||||||||||||||||||||| |||||||||||||| || || |||||||| 
Sbjct: 130 atggcgggcttggtgatgccctggatgttatcgcgcagcaccttgcgatgacgcttggct 71

                                                   
Query: 432 ccgcccttgccgagacccttgcctcccttgccgcgcccgg 471
           || ||||| || || |||||||||||||||||||| ||||
Sbjct: 70  cctccctttcccagtcccttgcctcccttgccgcgaccgg 31



to top

>gb|DQ066258.1| Ixodes scapularis isolate ISN-L-157 hist1h4i protein mRNA, complete
           cds
          Length = 312

 Score =  206 bits (104), Expect = 5e-50
 Identities = 251/300 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||||||||| ||||| ||||| ||||| || | ||| ||||||||||||||||||||
Sbjct: 312 ctagccgccgaacccgtacagggtacgtccttgtctcttcagcgcgtagacgacgtccat 253

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
           ||||||||| || || |    |||||| || ||||||||||||||||||||||| |||||
Sbjct: 252 ggcggtgaccgtttttctcttggcgtgttccgtgtaggtgacggcgtcgcggatcacgtt 193

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           ||| |||||||  ||||| ||||| ||||||||||||||||| || || ||||| |||||
Sbjct: 192 ctccaggaagactttgagcacgcctcgggtctcctcgtagatcagaccggagatacgctt 133

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
            ||||| || |  |  ||||| ||||| ||||| ||||| ||||| ||||||||||||||
Sbjct: 132 gacgccaccacggcgagccagacgacgaatggcgggctttgtgatcccctggatgttgtc 73

                                                                       
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgcc 463
            || |||||||| || || ||||||||||| || || ||||| |||||||| || |||||
Sbjct: 72  tcggagcaccttgcgatgacgcttggcgcctccttttccgagccccttgccacctttgcc 13



to top

>gb|J00987.1|XELHIS4LB x.laevis histone gene h4 and flanks
          Length = 408

 Score =  206 bits (104), Expect = 5e-50
 Identities = 257/308 (83%)
 Strand = Plus / Minus

                                                                       
Query: 168 ccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcg 227
           |||||||| |||||||| ||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 308 ccgccgaagccgtagagagtgcggccctggcgcttgagagcgtacaccacatccatggcg 249

                                                                       
Query: 228 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 287
           || |||||||| |    ||||||||||||||||||||| ||||| |||||||| ||||| 
Sbjct: 248 gtaacggtcttcctcttggcgtgctcggtgtaggtgacagcgtcccggatgacattctct 189

                                                                       
Query: 288 aggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 347
           ||||| | ||||||||| || || || ||||| || ||||| || ||||||||||| || 
Sbjct: 188 aggaaaaccttgaggaccccacgagtttcctcataaatgaggccagagatgcgcttgact 129

                                                                       
Query: 348 ccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgc 407
           || || ||||  || ||||| |||||||| |||||||||||||||||||||||||| |  
Sbjct: 128 ccccctctccgtgctaggcggcggatggcaggcttggtgatgccctggatgttgtcccta 69

                                                                       
Query: 408 agcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgcgc 467
           |||||||||| ||| ||||||||||| || || || || || || ||||| |||||||| 
Sbjct: 68  agcaccttcctgtgccgcttggcgcctcctttccccagtccttttcctcctttgccgcgt 9

                   
Query: 468 ccggacat 475
           || |||||
Sbjct: 8   ccagacat 1



to top

>ref|NM_003546.2| Homo sapiens histone 1, H4l (HIST1H4L), mRNA
          Length = 364

 Score =  204 bits (103), Expect = 2e-49
 Identities = 259/311 (83%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           ||||||| || || || |||||||| |||||||||||||||||||| || ||||||||||
Sbjct: 311 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 252

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 251 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 192

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | |  || |  || || || ||||| ||||||||||| || || || ||||||||||| |
Sbjct: 191 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 132

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           |||| || | ||  |||||||| |||||||| ||||||||||||||||| ||||||||||
Sbjct: 131 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 72

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||| || || ||||||||||| ||||| || ||||| |||||||| || || |||||||
Sbjct: 71  gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 12

                      
Query: 466 gcccggacatg 476
           |||| ||||||
Sbjct: 11  gcccagacatg 1



to top

>gb|AY128665.1| Homo sapiens clone HIST1H4L histone H4 gene, complete cds
          Length = 930

 Score =  204 bits (103), Expect = 2e-49
 Identities = 259/311 (83%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           ||||||| || || || |||||||| |||||||||||||||||||| || ||||||||||
Sbjct: 620 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 561

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 560 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 501

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | |  || |  || || || ||||| ||||||||||| || || || ||||||||||| |
Sbjct: 500 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 441

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           |||| || | ||  |||||||| |||||||| ||||||||||||||||| ||||||||||
Sbjct: 440 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 381

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||| || || ||||||||||| ||||| || ||||| |||||||| || || |||||||
Sbjct: 380 gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 321

                      
Query: 466 gcccggacatg 476
           |||| ||||||
Sbjct: 320 gcccagacatg 310



to top

>emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones
          Length = 4942

 Score =  204 bits (103), Expect = 2e-49
 Identities = 241/287 (83%)
 Strand = Plus / Plus

                                                                        
Query: 171  ccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatggcggtg 230
            ||||| ||||| || || || |||||||| || || ||||||||||| ||||||||||||
Sbjct: 4237 ccgaagccgtacagagtacgaccctggcgtttcagagcgtagacgacatccatggcggtg 4296

                                                                        
Query: 231  acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 290
            |||||||| |    |||||||||||||||||||||||| || |||||||||||||| |||
Sbjct: 4297 acggtctttctcttggcgtgctcggtgtaggtgacggcatcacggatgacgttctcaagg 4356

                                                                        
Query: 291  aagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 350
            ||||  ||||| ||||| |||||||||||||||||||| || ||||| || ||||| || 
Sbjct: 4357 aagactttgagtacgccacgggtctcctcgtagatgagaccagagatacgtttcacacca 4416

                                                                        
Query: 351  cccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgcgcagc 410
            || || |  ||||| ||||||||||| ||||||||||| |||||||||||||| | ||  
Sbjct: 4417 cctctgcgggccagacgacggatggcgggcttggtgataccctggatgttgtctctcaat 4476

                                                           
Query: 411  accttccggtggcgcttggcgccgcccttgccgagacccttgcctcc 457
            ||||| || || ||||||||||| || || ||||| ||||| |||||
Sbjct: 4477 accttacgatgacgcttggcgcctccttttccgagtcccttacctcc 4523



to top

>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3
             Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ,
             H2AFN, and H2BFN histone genes, the OR2B2 gene for
             olfactory receptor 2B2, histone H2B family member I
             pseudogene H2BFIP, a hypothetical protein pseudogene,
             ESTs, STSs, GSSs and CpG islands, complete sequence
          Length = 100374

 Score =  204 bits (103), Expect = 2e-49
 Identities = 259/311 (83%)
 Strand = Plus / Plus

                                                                         
Query: 166   agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
             ||||||| || || || |||||||| |||||||||||||||||||| || ||||||||||
Sbjct: 36942 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 37001

                                                                         
Query: 226   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
             | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 37002 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 37061

                                                                         
Query: 286   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
             | |  || |  || || || ||||| ||||||||||| || || || ||||||||||| |
Sbjct: 37062 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 37121

                                                                         
Query: 346   cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
             |||| || | ||  |||||||| |||||||| ||||||||||||||||| ||||||||||
Sbjct: 37122 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 37181

                                                                         
Query: 406   gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
             |||| || || ||||||||||| ||||| || ||||| |||||||| || || |||||||
Sbjct: 37182 gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 37241

                        
Query: 466   gcccggacatg 476
             |||| ||||||
Sbjct: 37242 gcccagacatg 37252



to top

>emb|X83548.1|HSHISTN4 H.sapiens gene for histone H4
          Length = 870

 Score =  204 bits (103), Expect = 2e-49
 Identities = 259/311 (83%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           ||||||| || || || |||||||| |||||||||||||||||||| || ||||||||||
Sbjct: 667 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 608

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 607 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 548

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | |  || |  || || || ||||| ||||||||||| || || || ||||||||||| |
Sbjct: 547 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 488

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           |||| || | ||  |||||||| |||||||| ||||||||||||||||| ||||||||||
Sbjct: 487 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 428

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||| || || ||||||||||| ||||| || ||||| |||||||| || || |||||||
Sbjct: 427 gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 368

                      
Query: 466 gcccggacatg 476
           |||| ||||||
Sbjct: 367 gcccagacatg 357



to top

>emb|CR542172.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0824D for
           gene HIST2H4, histone 2, H4; complete cds, incl.
           stopcodon
          Length = 312

 Score =  204 bits (103), Expect = 2e-49
 Identities = 235/279 (84%)
 Strand = Plus / Minus

                                                                       
Query: 164 ctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccat 223
           |||||| ||||| |||||||||||||| |||||||||||||||||||| || || |||||
Sbjct: 312 ctagcctccgaagccgtagagggtgcgcccctggcgcttgagcgcgtacaccacatccat 253

                                                                       
Query: 224 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283
           ||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||
Sbjct: 252 ggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacatt 193

                                                                       
Query: 284 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgctt 343
           ||| ||||| | ||| || || ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 192 ctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgctt 133

                                                                       
Query: 344 cacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtc 403
            |||||||| | ||  || || || || ||||| ||||||||||||||||| ||||||||
Sbjct: 132 aacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtc 73

                                                  
Query: 404 gcgcagcaccttccggtggcgcttggcgccgcccttgcc 442
            | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 72  tctcaagaccttgcggtggcgcttagcgccccctttgcc 34



to top

>gb|BC069392.1| Homo sapiens histone 1, H4l, mRNA (cDNA clone MGC:97405
           IMAGE:7262681), complete cds
          Length = 363

 Score =  204 bits (103), Expect = 2e-49
 Identities = 259/311 (83%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           ||||||| || || || |||||||| |||||||||||||||||||| || ||||||||||
Sbjct: 311 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 252

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 251 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 192

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | |  || |  || || || ||||| ||||||||||| || || || ||||||||||| |
Sbjct: 191 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 132

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           |||| || | ||  |||||||| |||||||| ||||||||||||||||| ||||||||||
Sbjct: 131 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 72

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||| || || ||||||||||| ||||| || ||||| |||||||| || || |||||||
Sbjct: 71  gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 12

                      
Query: 466 gcccggacatg 476
           |||| ||||||
Sbjct: 11  gcccagacatg 1



to top

>gb|BC019846.1| Homo sapiens cDNA clone IMAGE:5113140
          Length = 946

 Score =  202 bits (102), Expect = 8e-49
 Identities = 237/282 (84%)
 Strand = Plus / Minus

                                                                       
Query: 161 ggcctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtc 220
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 322 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 263

                                                                       
Query: 221 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 280
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 262 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 203

                                                                       
Query: 281 gttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcg 340
            ||||| ||||| | ||| || || ||||||||||||||||| ||||| || ||||| ||
Sbjct: 202 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 143

                                                                       
Query: 341 cttcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgtt 400
           ||| |||||||| | ||  || || || || ||||| ||||||||||||||||| |||||
Sbjct: 142 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 83

                                                     
Query: 401 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 442
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 82  gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 41



to top

>ref|XM_520759.1| PREDICTED: Pan troglodytes similar to germinal histone H4 gene
           (LOC465305), mRNA
          Length = 1195

 Score =  202 bits (102), Expect = 8e-49
 Identities = 258/310 (83%)
 Strand = Plus / Minus

                                                                       
Query: 166 agccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtccatgg 225
           |||||||||| || ||||||||||| |||||||| || ||||| || || || |||||||
Sbjct: 457 agccgccgaaaccatagagggtgcgaccctggcgtttcagcgcatacaccacatccatgg 398

                                                                       
Query: 226 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 285
           | ||||||||||||||   ||||||||| ||||| || || ||||||||||| |||||||
Sbjct: 397 ccgtgacggtcttgcgcttggcgtgctccgtgtaagtcaccgcgtcgcggatcacgttct 338

                                                                       
Query: 286 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 345
           | |||||||  |||||||| || |||||||||||||||||||| || || |||||||| |
Sbjct: 337 ccaggaagactttgaggactccccgggtctcctcgtagatgagaccagaaatgcgcttaa 278

                                                                       
Query: 346 cgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgttgtcgc 405
           |||| || |  |  || || || || || |||||||| || ||||| ||||||||||| |
Sbjct: 277 cgcccccacgtcgggcgagacggcgaatcgccggctttgtaatgccttggatgttgtccc 218

                                                                       
Query: 406 gcagcaccttccggtggcgcttggcgccgcccttgccgagacccttgcctcccttgccgc 465
           |||||||||||||||||||||| ||||| ||||| || || |||||||| || || || |
Sbjct: 217 gcagcaccttccggtggcgcttagcgcctcccttacccagccccttgccacctttacctc 158

                     
Query: 466 gcccggacat 475
           |||| |||||
Sbjct: 157 gcccagacat 148



to top

>ref|NM_003548.2| Homo sapiens histone 2, H4 (HIST2H4), mRNA
          Length = 396

 Score =  202 bits (102), Expect = 8e-49
 Identities = 237/282 (84%)
 Strand = Plus / Minus

                                                                       
Query: 161 ggcctagccgccgaatccgtagagggtgcgtccctggcgcttgagcgcgtagacgacgtc 220
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 343 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 284

                                                                       
Query: 221 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 280
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 283 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 224

                                                                       
Query: 281 gttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgagccccgagatgcg 340
            ||||| ||||| | ||| || || ||||||||||||||||| ||||| || ||||| ||
Sbjct: 223 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 164

                                                                       
Query: 341 cttcacgccgcccctcctcgccaggcgacggatggccggcttggtgatgccctggatgtt 400
           ||| |||||||| | ||  || || || || ||||| ||||||||||||||||| |||||
Sbjct: 163 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 104

                                                     
Query: 401 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 442
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 103 gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 62


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,046,981
Number of Sequences: 3902068
Number of extensions: 3046981
Number of successful extensions: 65855
Number of sequences better than 10.0: 910
Number of HSP's better than 10.0 without gapping: 911
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 62363
Number of HSP's gapped (non-prelim): 2916
length of query: 519
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 496
effective length of database: 17,143,297,704
effective search space: 8503075661184
effective search space used: 8503075661184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top