| Clone Name | rbags31l04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC098883.3| Mus musculus BAC clone RP23-122F3 from 16, complete sequence Length = 211348 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 189 ctctccaaagttttgctggtgg 210 |||||||||||||||||||||| Sbjct: 22456 ctctccaaagttttgctggtgg 22477
>emb|AL390866.14| Human DNA sequence from clone RP11-218D6 on chromosome 10 Contains the 5' end of the gene for a novel protein (FLJ10817)(DKFZP434P1735), a ribosomal protein L36a-like (RPL36AL)(RPL36A) pseudogene, a mitochondrial ribosomal protein S21 (MRPS21)(MDS016, RPMS21, MRP-S21) pseudogene, a novel gene, the 3' end of the gene for a novel protein (FLJ32798) and a CpG island, complete sequence Length = 206198 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 82 gcagtctccctgaagttttcct 103 |||||||||||||||||||||| Sbjct: 8908 gcagtctccctgaagttttcct 8887
>gb|AC130844.3| Mus musculus BAC clone RP24-529I3 from 16, complete sequence Length = 168387 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 189 ctctccaaagttttgctggtgg 210 |||||||||||||||||||||| Sbjct: 165800 ctctccaaagttttgctggtgg 165821
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome Length = 6438405 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 104 ggcggcgcgagcttggggcagcgg 127 |||||||||||||| ||||||||| Sbjct: 3159325 ggcggcgcgagcttcgggcagcgg 3159348
>emb|CR731443.2|CNS0GRBS Tetraodon nigroviridis full-length cDNA Length = 1093 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 389 cggtctctccgaagttttcc 408 |||||||||||||||||||| Sbjct: 524 cggtctctccgaagttttcc 505
>emb|CR729918.2|CNS0GQ5G Tetraodon nigroviridis full-length cDNA Length = 1098 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 389 cggtctctccgaagttttcc 408 |||||||||||||||||||| Sbjct: 527 cggtctctccgaagttttcc 508
>emb|CR728736.2|CNS0GP8M Tetraodon nigroviridis full-length cDNA Length = 1076 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 389 cggtctctccgaagttttcc 408 |||||||||||||||||||| Sbjct: 524 cggtctctccgaagttttcc 505
>emb|CR724775.2|CNS0GM6L Tetraodon nigroviridis full-length cDNA Length = 1076 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 389 cggtctctccgaagttttcc 408 |||||||||||||||||||| Sbjct: 513 cggtctctccgaagttttcc 494
>emb|CR723541.2|CNS0GL8B Tetraodon nigroviridis full-length cDNA Length = 1070 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 389 cggtctctccgaagttttcc 408 |||||||||||||||||||| Sbjct: 510 cggtctctccgaagttttcc 491
>emb|CR656152.2|CNS0F59A Tetraodon nigroviridis full-length cDNA Length = 1169 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 389 cggtctctccgaagttttcc 408 |||||||||||||||||||| Sbjct: 510 cggtctctccgaagttttcc 491
>emb|CR648106.2|CNS0EZ1S Tetraodon nigroviridis full-length cDNA Length = 1018 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 389 cggtctctccgaagttttcc 408 |||||||||||||||||||| Sbjct: 452 cggtctctccgaagttttcc 433
>emb|AL391358.14| Human DNA sequence from clone RP11-197B12 on chromosome Xq23-24, complete sequence Length = 104309 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 204 ctggtggtgcgagcctggggaggc 227 ||||||||||| |||||||||||| Sbjct: 21687 ctggtggtgcgtgcctggggaggc 21664
>emb|AL772271.11| Mouse DNA sequence from clone RP23-17P12 on chromosome 2, complete sequence Length = 204136 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 322 ggggcggaggagaaggcggt 341 |||||||||||||||||||| Sbjct: 164928 ggggcggaggagaaggcggt 164909 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,854,692 Number of Sequences: 3902068 Number of extensions: 2854692 Number of successful extensions: 62017 Number of sequences better than 10.0: 13 Number of HSP's better than 10.0 without gapping: 13 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 61968 Number of HSP's gapped (non-prelim): 49 length of query: 417 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 395 effective length of database: 17,147,199,772 effective search space: 6773143909940 effective search space used: 6773143909940 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)