ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags31l04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC098883.3| Mus musculus BAC clone RP23-122F3 from 16, comple... 44 0.36
2emb|AL390866.14| Human DNA sequence from clone RP11-218D6 on chr... 44 0.36
3gb|AC130844.3| Mus musculus BAC clone RP24-529I3 from 16, comple... 44 0.36
4gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 5.6
5emb|CR731443.2|CNS0GRBS Tetraodon nigroviridis full-length cDNA 40 5.6
6emb|CR729918.2|CNS0GQ5G Tetraodon nigroviridis full-length cDNA 40 5.6
7emb|CR728736.2|CNS0GP8M Tetraodon nigroviridis full-length cDNA 40 5.6
8emb|CR724775.2|CNS0GM6L Tetraodon nigroviridis full-length cDNA 40 5.6
9emb|CR723541.2|CNS0GL8B Tetraodon nigroviridis full-length cDNA 40 5.6
10emb|CR656152.2|CNS0F59A Tetraodon nigroviridis full-length cDNA 40 5.6
11emb|CR648106.2|CNS0EZ1S Tetraodon nigroviridis full-length cDNA 40 5.6
12emb|AL391358.14| Human DNA sequence from clone RP11-197B12 on ch... 40 5.6
13emb|AL772271.11| Mouse DNA sequence from clone RP23-17P12 on chr... 40 5.6

>gb|AC098883.3| Mus musculus BAC clone RP23-122F3 from 16, complete sequence
          Length = 211348

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 189   ctctccaaagttttgctggtgg 210
             ||||||||||||||||||||||
Sbjct: 22456 ctctccaaagttttgctggtgg 22477



to top

>emb|AL390866.14| Human DNA sequence from clone RP11-218D6 on chromosome 10 Contains
            the 5' end of the gene for a novel protein
            (FLJ10817)(DKFZP434P1735), a ribosomal protein L36a-like
            (RPL36AL)(RPL36A) pseudogene, a mitochondrial ribosomal
            protein S21 (MRPS21)(MDS016, RPMS21, MRP-S21) pseudogene,
            a novel gene, the 3' end of the gene for a novel protein
            (FLJ32798) and a CpG island, complete sequence
          Length = 206198

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 82   gcagtctccctgaagttttcct 103
            ||||||||||||||||||||||
Sbjct: 8908 gcagtctccctgaagttttcct 8887



to top

>gb|AC130844.3| Mus musculus BAC clone RP24-529I3 from 16, complete sequence
          Length = 168387

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 189    ctctccaaagttttgctggtgg 210
              ||||||||||||||||||||||
Sbjct: 165800 ctctccaaagttttgctggtgg 165821



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 104     ggcggcgcgagcttggggcagcgg 127
               |||||||||||||| |||||||||
Sbjct: 3159325 ggcggcgcgagcttcgggcagcgg 3159348



to top

>emb|CR731443.2|CNS0GRBS Tetraodon nigroviridis full-length cDNA
          Length = 1093

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 389 cggtctctccgaagttttcc 408
           ||||||||||||||||||||
Sbjct: 524 cggtctctccgaagttttcc 505



to top

>emb|CR729918.2|CNS0GQ5G Tetraodon nigroviridis full-length cDNA
          Length = 1098

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 389 cggtctctccgaagttttcc 408
           ||||||||||||||||||||
Sbjct: 527 cggtctctccgaagttttcc 508



to top

>emb|CR728736.2|CNS0GP8M Tetraodon nigroviridis full-length cDNA
          Length = 1076

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 389 cggtctctccgaagttttcc 408
           ||||||||||||||||||||
Sbjct: 524 cggtctctccgaagttttcc 505



to top

>emb|CR724775.2|CNS0GM6L Tetraodon nigroviridis full-length cDNA
          Length = 1076

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 389 cggtctctccgaagttttcc 408
           ||||||||||||||||||||
Sbjct: 513 cggtctctccgaagttttcc 494



to top

>emb|CR723541.2|CNS0GL8B Tetraodon nigroviridis full-length cDNA
          Length = 1070

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 389 cggtctctccgaagttttcc 408
           ||||||||||||||||||||
Sbjct: 510 cggtctctccgaagttttcc 491



to top

>emb|CR656152.2|CNS0F59A Tetraodon nigroviridis full-length cDNA
          Length = 1169

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 389 cggtctctccgaagttttcc 408
           ||||||||||||||||||||
Sbjct: 510 cggtctctccgaagttttcc 491



to top

>emb|CR648106.2|CNS0EZ1S Tetraodon nigroviridis full-length cDNA
          Length = 1018

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 389 cggtctctccgaagttttcc 408
           ||||||||||||||||||||
Sbjct: 452 cggtctctccgaagttttcc 433



to top

>emb|AL391358.14| Human DNA sequence from clone RP11-197B12 on chromosome Xq23-24,
             complete sequence
          Length = 104309

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 204   ctggtggtgcgagcctggggaggc 227
             ||||||||||| ||||||||||||
Sbjct: 21687 ctggtggtgcgtgcctggggaggc 21664



to top

>emb|AL772271.11| Mouse DNA sequence from clone RP23-17P12 on chromosome 2, complete
              sequence
          Length = 204136

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 322    ggggcggaggagaaggcggt 341
              ||||||||||||||||||||
Sbjct: 164928 ggggcggaggagaaggcggt 164909


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,854,692
Number of Sequences: 3902068
Number of extensions: 2854692
Number of successful extensions: 62017
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61968
Number of HSP's gapped (non-prelim): 49
length of query: 417
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 395
effective length of database: 17,147,199,772
effective search space: 6773143909940
effective search space used: 6773143909940
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top