ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags31j19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK102574.1| Oryza sativa (japonica cultivar-group) cDNA clon... 442 e-121
2dbj|AK062103.1| Oryza sativa (japonica cultivar-group) cDNA clon... 442 e-121
3gb|AY103915.1| Zea mays PCO106165 mRNA sequence 440 e-120
4ref|NM_100709.3| Arabidopsis thaliana structural constituent of ... 258 2e-65
5gb|AY114542.1| Arabidopsis thaliana putative ribosomal protein L... 258 2e-65
6gb|AY065077.1| Arabidopsis thaliana putative ribosomal protein L... 258 2e-65
7emb|BX814727.1|CNS0ACAP Arabidopsis thaliana Full-length cDNA Co... 258 2e-65
8emb|BX816002.1|CNS0ABUG Arabidopsis thaliana Full-length cDNA Co... 258 2e-65
9emb|BX841788.1|CNS09Y5M Arabidopsis thaliana Full-length cDNA Co... 258 2e-65
10ref|XM_483755.1| Oryza sativa (japonica cultivar-group), mRNA 250 5e-63
11gb|AY389626.1| Hyacinthus orientalis 60S ribosomal protein L10A ... 250 5e-63
12dbj|AK061522.1| Oryza sativa (japonica cultivar-group) cDNA clon... 250 5e-63
13gb|BT016546.1| Zea mays clone Contig379 mRNA sequence 244 3e-61
14gb|AY109405.1| Zea mays CL4809_1 mRNA sequence 244 3e-61
15dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 234 3e-58
16dbj|AP003794.4| Oryza sativa (japonica cultivar-group) genomic D... 234 3e-58
17dbj|AP003287.3| Oryza sativa (japonica cultivar-group) genomic D... 234 3e-58
18ref|NM_190697.1| Oryza sativa (japonica cultivar-group), predic... 228 2e-56
19ref|NM_179773.1| Arabidopsis thaliana structural constituent of ... 226 7e-56
20ref|NM_128313.2| Arabidopsis thaliana structural constituent of ... 226 7e-56
21gb|AY056371.1| Arabidopsis thaliana putative 60S ribosomal prote... 226 7e-56
22gb|AF360146.1| Arabidopsis thaliana putative 60S ribosomal prote... 226 7e-56
23gb|AY081263.1| Arabidopsis thaliana 60S ribosomal protein L10A (... 226 7e-56
24gb|BT006262.1| Arabidopsis thaliana At2g27530 mRNA, complete cds 226 7e-56
25gb|AY846821.1| Triticum aestivum ribosomal protein L10A mRNA, co... 226 7e-56
26ref|XM_483761.1| Oryza sativa (japonica cultivar-group), mRNA 218 2e-53
27dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 218 2e-53
28emb|BX818761.1|CNS0A9SM Arabidopsis thaliana Full-length cDNA Co... 218 2e-53
29emb|BX820970.1|CNS0A84X Arabidopsis thaliana Full-length cDNA Co... 218 2e-53
30dbj|AP005612.3| Oryza sativa (japonica cultivar-group) genomic D... 218 2e-53
31dbj|AK122095.1| Oryza sativa (japonica cultivar-group) cDNA clon... 218 2e-53
32dbj|AK071249.1| Oryza sativa (japonica cultivar-group) cDNA clon... 218 2e-53
33gb|BT012985.1| Lycopersicon esculentum clone 114201R, mRNA sequence 212 1e-51
34gb|AY104248.1| Zea mays PCO114889 mRNA sequence 204 3e-49
35ref|NM_122149.3| Arabidopsis thaliana structural constituent of ... 192 1e-45
36gb|AY077657.1| Arabidopsis thaliana AT5g22440/MWD9_24 mRNA, comp... 192 1e-45
37gb|AY037253.1| Arabidopsis thaliana AT5g22440/MWD9_24 mRNA, comp... 192 1e-45
38emb|BX829886.1|CNS0A1EM Arabidopsis thaliana Full-length cDNA Co... 192 1e-45
39emb|BX832559.1|CNS0A14N Arabidopsis thaliana Full-length cDNA Co... 178 1e-41
40gb|DQ226619.1| Boechera divaricarpa isolate SLW-4-A06 mRNA sequence 153 8e-34
41gb|AC006932.8|AC006932 Genomic sequence for Arabidopsis thaliana... 143 8e-31
42dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
43dbj|AP005524.3| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
44dbj|AP003928.3| Oryza sativa (japonica cultivar-group) genomic D... 131 3e-27
45gb|AC006232.4| Arabidopsis thaliana chromosome 2 clone F10A12 ma... 127 5e-26
46gb|AC005824.3| Arabidopsis thaliana chromosome 2 clone F15K20 ma... 127 5e-26
47gb|DQ160125.1| Taraxacum officinale TO97-3 (To97-3) mRNA, partia... 119 1e-23
48dbj|AB007651.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 119 1e-23
49gb|AY392166.1| Scyliorhinus canicula ribosomal protein L10a-like... 105 2e-19
50gb|AY149444.1| Euprymna scolopes 60S ribosomal protein L10 mRNA,... 105 2e-19
51gb|DQ233195.1| Pinus yunnanensis isolate PtIFG200918 putative 60... 105 2e-19
52gb|DQ233130.1| Pinus tabuliformis isolate PtIFG200928 putative 6... 105 2e-19
53gb|DQ233004.1| Pinus densata isolate PtIFG200926 putative 60S ri... 105 2e-19
54gb|DQ232993.1| Pinus densata isolate PtIFG200915 putative 60S ri... 105 2e-19
55gb|DQ232984.1| Pinus densata isolate PtIFG200906 putative 60S ri... 105 2e-19
56gb|DQ232982.1| Pinus densata isolate PtIFG200904 putative 60S ri... 105 2e-19
57gb|DQ233194.1| Pinus yunnanensis isolate PtIFG200917 putative 60... 98 4e-17
58gb|DQ233193.1| Pinus yunnanensis isolate PtIFG200916 putative 60... 98 4e-17
59gb|DQ233192.1| Pinus yunnanensis isolate PtIFG200915 putative 60... 98 4e-17
60gb|DQ233191.1| Pinus yunnanensis isolate PtIFG200914 putative 60... 98 4e-17
61gb|DQ233190.1| Pinus yunnanensis isolate PtIFG200913 putative 60... 98 4e-17
62gb|DQ233189.1| Pinus yunnanensis isolate PtIFG200912 putative 60... 98 4e-17
63gb|DQ233188.1| Pinus yunnanensis isolate PtIFG200911 putative 60... 98 4e-17
64gb|DQ233186.1| Pinus yunnanensis isolate PtIFG200909 putative 60... 98 4e-17
65gb|DQ233185.1| Pinus yunnanensis isolate PtIFG200908 putative 60... 98 4e-17
66gb|DQ233184.1| Pinus yunnanensis isolate PtIFG200907 putative 60... 98 4e-17
67gb|DQ233183.1| Pinus yunnanensis isolate PtIFG200906 putative 60... 98 4e-17
68gb|DQ233181.1| Pinus yunnanensis isolate PtIFG200904 putative 60... 98 4e-17
69gb|DQ233180.1| Pinus yunnanensis isolate PtIFG200903 putative 60... 98 4e-17
70gb|DQ233179.1| Pinus yunnanensis isolate PtIFG200902 putative 60... 98 4e-17
71gb|DQ233178.1| Pinus yunnanensis isolate PtIFG200901 putative 60... 98 4e-17
72gb|DQ233131.1| Pinus tabuliformis isolate PtIFG200929 putative 6... 98 4e-17
73gb|DQ233129.1| Pinus tabuliformis isolate PtIFG200927 putative 6... 98 4e-17
74gb|DQ233125.1| Pinus tabuliformis isolate PtIFG200923 putative 6... 98 4e-17
75gb|DQ233122.1| Pinus tabuliformis isolate PtIFG200920 putative 6... 98 4e-17
76gb|DQ233118.1| Pinus tabuliformis isolate PtIFG200916 putative 6... 98 4e-17
77gb|DQ233117.1| Pinus tabuliformis isolate PtIFG200915 putative 6... 98 4e-17
78gb|DQ233115.1| Pinus tabuliformis isolate PtIFG200913 putative 6... 98 4e-17
79gb|DQ233112.1| Pinus tabuliformis isolate PtIFG200910 putative 6... 98 4e-17
80gb|DQ233111.1| Pinus tabuliformis isolate PtIFG200909 putative 6... 98 4e-17
81gb|DQ233110.1| Pinus tabuliformis isolate PtIFG200908 putative 6... 98 4e-17
82gb|DQ233109.1| Pinus tabuliformis isolate PtIFG200907 putative 6... 98 4e-17
83gb|DQ233108.1| Pinus tabuliformis isolate PtIFG200906 putative 6... 98 4e-17
84gb|DQ233107.1| Pinus tabuliformis isolate PtIFG200905 putative 6... 98 4e-17
85gb|DQ233106.1| Pinus tabuliformis isolate PtIFG200904 putative 6... 98 4e-17
86gb|DQ233105.1| Pinus tabuliformis isolate PtIFG200903 putative 6... 98 4e-17
87gb|DQ233103.1| Pinus tabuliformis isolate PtIFG200901 putative 6... 98 4e-17
88gb|DQ233045.1| Pinus koraiensis isolate PtIFG200902 putative 60S... 98 4e-17
89gb|DQ233044.1| Pinus koraiensis isolate PtIFG200901 putative 60S... 98 4e-17
90gb|DQ233008.1| Pinus densata isolate PtIFG200930 putative 60S ri... 98 4e-17
91gb|DQ233007.1| Pinus densata isolate PtIFG200929 putative 60S ri... 98 4e-17
92gb|DQ233006.1| Pinus densata isolate PtIFG200928 putative 60S ri... 98 4e-17
93gb|DQ233003.1| Pinus densata isolate PtIFG200925 putative 60S ri... 98 4e-17
94gb|DQ233002.1| Pinus densata isolate PtIFG200924 putative 60S ri... 98 4e-17
95gb|DQ233001.1| Pinus densata isolate PtIFG200923 putative 60S ri... 98 4e-17
96gb|DQ233000.1| Pinus densata isolate PtIFG200922 putative 60S ri... 98 4e-17
97gb|DQ232999.1| Pinus densata isolate PtIFG200921 putative 60S ri... 98 4e-17
98gb|DQ232998.1| Pinus densata isolate PtIFG200920 putative 60S ri... 98 4e-17
99gb|DQ232997.1| Pinus densata isolate PtIFG200919 putative 60S ri... 98 4e-17
100gb|DQ232996.1| Pinus densata isolate PtIFG200918 putative 60S ri... 98 4e-17
101gb|DQ232995.1| Pinus densata isolate PtIFG200917 putative 60S ri... 98 4e-17
102gb|DQ232994.1| Pinus densata isolate PtIFG200916 putative 60S ri... 98 4e-17
103gb|DQ232992.1| Pinus densata isolate PtIFG200914 putative 60S ri... 98 4e-17
104gb|DQ232991.1| Pinus densata isolate PtIFG200913 putative 60S ri... 98 4e-17
105gb|DQ232990.1| Pinus densata isolate PtIFG200912 putative 60S ri... 98 4e-17
106gb|DQ232989.1| Pinus densata isolate PtIFG200911 putative 60S ri... 98 4e-17
107gb|DQ232988.1| Pinus densata isolate PtIFG200910 putative 60S ri... 98 4e-17
108gb|DQ232987.1| Pinus densata isolate PtIFG200909 putative 60S ri... 98 4e-17
109gb|DQ232983.1| Pinus densata isolate PtIFG200905 putative 60S ri... 98 4e-17
110gb|DQ232980.1| Pinus densata isolate PtIFG200902 putative 60S ri... 98 4e-17
111gb|DQ232979.1| Pinus densata isolate PtIFG200901 putative 60S ri... 98 4e-17
112gb|DQ232916.1| Pinus armandii isolate PtIFG200902 putative 60S r... 98 4e-17
113gb|BC059454.1| Danio rerio ribosomal protein L10a, mRNA (cDNA cl... 94 7e-16
114ref|XM_691265.1| PREDICTED: Danio rerio similar to Ribosomal pro... 94 7e-16
115ref|NM_199636.1| Danio rerio ribosomal protein L10a (rpl10a), mRNA 94 7e-16
116dbj|AP006415.1| Lotus japonicus genomic DNA, chromosome 6, clone... 94 7e-16
117gb|DQ233182.1| Pinus yunnanensis isolate PtIFG200905 putative 60... 92 3e-15
118gb|DQ233128.1| Pinus tabuliformis isolate PtIFG200926 putative 6... 92 3e-15
119gb|DQ233127.1| Pinus tabuliformis isolate PtIFG200925 putative 6... 92 3e-15
120gb|DQ233126.1| Pinus tabuliformis isolate PtIFG200924 putative 6... 92 3e-15
121gb|DQ233124.1| Pinus tabuliformis isolate PtIFG200922 putative 6... 92 3e-15
122gb|DQ233123.1| Pinus tabuliformis isolate PtIFG200921 putative 6... 92 3e-15
123gb|DQ233121.1| Pinus tabuliformis isolate PtIFG200919 putative 6... 92 3e-15
124gb|DQ233120.1| Pinus tabuliformis isolate PtIFG200918 putative 6... 92 3e-15
125gb|DQ233119.1| Pinus tabuliformis isolate PtIFG200917 putative 6... 92 3e-15
126gb|DQ233116.1| Pinus tabuliformis isolate PtIFG200914 putative 6... 92 3e-15
127gb|DQ233114.1| Pinus tabuliformis isolate PtIFG200912 putative 6... 92 3e-15
128gb|DQ233113.1| Pinus tabuliformis isolate PtIFG200911 putative 6... 92 3e-15
129gb|DQ233104.1| Pinus tabuliformis isolate PtIFG200902 putative 6... 92 3e-15
130gb|DQ233010.1| Pinus densata isolate PtIFG200932 putative 60S ri... 92 3e-15
131gb|DQ233009.1| Pinus densata isolate PtIFG200931 putative 60S ri... 92 3e-15
132gb|DQ233005.1| Pinus densata isolate PtIFG200927 putative 60S ri... 92 3e-15
133gb|DQ232985.1| Pinus densata isolate PtIFG200907 putative 60S ri... 92 3e-15
134gb|DQ232915.1| Pinus armandii isolate PtIFG200901 putative 60S r... 92 3e-15
135gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 90 1e-14
136ref|XM_571019.1| Cryptococcus neoformans var. neoformans JEC21 6... 90 1e-14
137gb|DQ233187.1| Pinus yunnanensis isolate PtIFG200910 putative 60... 90 1e-14
138gb|AC142498.21| Medicago truncatula clone mth2-24a18, complete s... 86 2e-13
139gb|DQ232986.1| Pinus densata isolate PtIFG200908 putative 60S ri... 86 2e-13
140gb|DQ232981.1| Pinus densata isolate PtIFG200903 putative 60S ri... 86 2e-13
141dbj|AK108883.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 2e-13
142gb|BC071510.1| Danio rerio ribosomal protein L10a, mRNA (cDNA cl... 86 2e-13
143emb|CT573029.5| M.truncatula DNA sequence from clone MTH2-67H11 ... 86 2e-13
144gb|AY620995.1| Branchiostoma belcheri tsingtaunese ribosomal pro... 80 1e-11
145ref|XM_756085.1| Ustilago maydis 521 hypothetical protein (UM050... 78 4e-11
146gb|AY826152.1| Aedes albopictus clone AL_390 60S ribosomal prote... 76 2e-10
147gb|AY847949.1| Pectinaria gouldii ribosomal protein L10 mRNA, co... 68 4e-08
148gb|AF391092.1| Spodoptera frugiperda ribosomal protein L10A mRNA... 68 4e-08
149gb|AY440221.1| Armigeres subalbatus ASAP ID: 39087 cytosolic lar... 64 6e-07
150emb|AJ718244.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT4-13-14... 64 6e-07
151gb|AY389923.1| Latimeria chalumnae ribosomal protein L10a mRNA, ... 62 2e-06
152ref|XM_504660.1| Yarrowia lipolytica CLIB122, YALI0E31911g predi... 62 2e-06
153emb|BX053438.1|CNS09DEA Single read from an extremity of a full-... 62 2e-06
154emb|BX072047.1|CNS09RR7 Single read from an extremity of a full-... 62 2e-06
155emb|BX071756.1|CNS09RJ4 Single read from an extremity of a full-... 62 2e-06
156emb|BX071755.1|CNS09RJ3 Single read from an extremity of a full-... 62 2e-06
157emb|BX070707.1|CNS09QPZ Single read from an extremity of a full-... 62 2e-06
158emb|BX060982.1|CNS09J7U Single read from an extremity of a full-... 62 2e-06
159emb|BX060981.1|CNS09J7T Single read from an extremity of a full-... 62 2e-06
160emb|BX069581.1|CNS09PUP Single read from an extremity of a full-... 62 2e-06
161emb|BX069580.1|CNS09PUO Single read from an extremity of a full-... 62 2e-06
162emb|BX069267.1|CNS09PLZ Single read from an extremity of a full-... 62 2e-06
163emb|BX068765.1|CNS09P81 Single read from an extremity of a full-... 62 2e-06
164emb|BX068764.1|CNS09P80 Single read from an extremity of a full-... 62 2e-06
165emb|BX067034.1|CNS09NVY Single read from an extremity of a full-... 62 2e-06
166emb|BX067033.1|CNS09NVX Single read from an extremity of a full-... 62 2e-06
167emb|BX066666.1|CNS09NLQ Single read from an extremity of a full-... 62 2e-06
168emb|BX066665.1|CNS09NLP Single read from an extremity of a full-... 62 2e-06
169emb|BX065462.1|CNS09MOA Single read from an extremity of a full-... 62 2e-06
170emb|BX065461.1|CNS09MO9 Single read from an extremity of a full-... 62 2e-06
171emb|BX065428.1|CNS09MNC Single read from an extremity of a full-... 62 2e-06
172emb|BX064407.1|CNS09LUZ Single read from an extremity of a full-... 62 2e-06
173emb|BX064406.1|CNS09LUY Single read from an extremity of a full-... 62 2e-06
174emb|BX064040.1|CNS09LKS Single read from an extremity of a full-... 62 2e-06
175emb|BX064039.1|CNS09LKR Single read from an extremity of a full-... 62 2e-06
176emb|BX063711.1|CNS09LBN Single read from an extremity of a full-... 62 2e-06
177emb|BX062611.1|CNS09KH3 Single read from an extremity of a full-... 62 2e-06
178emb|BX062610.1|CNS09KH2 Single read from an extremity of a full-... 62 2e-06
179emb|BX062333.1|CNS09K9D Single read from an extremity of a full-... 62 2e-06
180emb|BX062332.1|CNS09K9C Single read from an extremity of a full-... 62 2e-06
181emb|BX061889.1|CNS09JX1 Single read from an extremity of a full-... 62 2e-06
182emb|BX061888.1|CNS09JX0 Single read from an extremity of a full-... 62 2e-06
183emb|BX059682.1|CNS09I7Q Single read from an extremity of a full-... 62 2e-06
184emb|BX059681.1|CNS09I7P Single read from an extremity of a full-... 62 2e-06
185emb|BX059289.1|CNS09HWT Single read from an extremity of a full-... 62 2e-06
186emb|BX059288.1|CNS09HWS Single read from an extremity of a full-... 62 2e-06
187emb|BX059023.1|CNS09HPF Single read from an extremity of a full-... 62 2e-06
188emb|BX059022.1|CNS09HPE Single read from an extremity of a full-... 62 2e-06
189emb|BX058910.1|CNS09HMA Single read from an extremity of a full-... 62 2e-06
190emb|BX056669.1|CNS09FW1 Single read from an extremity of a full-... 62 2e-06
191emb|BX057965.1|CNS09GW1 Single read from an extremity of a full-... 62 2e-06
192emb|BX057964.1|CNS09GW0 Single read from an extremity of a full-... 62 2e-06
193emb|BX057413.1|CNS09GGP Single read from an extremity of a full-... 62 2e-06
194emb|BX057412.1|CNS09GGO Single read from an extremity of a full-... 62 2e-06
195emb|BX056303.1|CNS09FLV Single read from an extremity of a full-... 62 2e-06
196emb|BX055435.1|CNS09EXR Single read from an extremity of a full-... 62 2e-06
197emb|BX055434.1|CNS09EXQ Single read from an extremity of a full-... 62 2e-06
198emb|BX053004.1|CNS09D28 Single read from an extremity of a full-... 62 2e-06
199emb|BX053954.1|CNS09DSM Single read from an extremity of a full-... 62 2e-06
200emb|BX053562.1|CNS09DHQ Single read from an extremity of a full-... 62 2e-06
201emb|BX053561.1|CNS09DHP Single read from an extremity of a full-... 62 2e-06
202emb|BX052455.1|CNS09CMZ Single read from an extremity of a full-... 62 2e-06
203emb|BX051666.1|CNS09C12 Single read from an extremity of a full-... 62 2e-06
204emb|BX051022.1|CNS09BJ6 Single read from an extremity of a full-... 62 2e-06
205emb|BX051021.1|CNS09BJ5 Single read from an extremity of a full-... 62 2e-06
206emb|BX050571.1|CNS09B6N Single read from an extremity of a full-... 62 2e-06
207emb|BX050570.1|CNS09B6M Single read from an extremity of a full-... 62 2e-06
208emb|BX050435.1|CNS09B2V Single read from an extremity of a full-... 62 2e-06
209emb|BX050016.1|CNS09AR8 Single read from an extremity of a full-... 62 2e-06
210emb|BX048883.1|CNS099VR Single read from an extremity of a full-... 62 2e-06
211emb|BX048882.1|CNS099VQ Single read from an extremity of a full-... 62 2e-06
212emb|BX047422.1|CNS098R6 Single read from an extremity of a full-... 62 2e-06
213emb|BX047411.1|CNS098QV Single read from an extremity of a full-... 62 2e-06
214emb|BX047410.1|CNS098QU Single read from an extremity of a full-... 62 2e-06
215emb|BX046235.1|CNS097U7 Single read from an extremity of a full-... 62 2e-06
216emb|BX046234.1|CNS097U6 Single read from an extremity of a full-... 62 2e-06
217emb|BX045468.1|CNS0978W Single read from an extremity of a full-... 62 2e-06
218emb|BX045438.1|CNS09782 Single read from an extremity of a full-... 62 2e-06
219emb|BX045382.1|CNS0976I Single read from an extremity of a full-... 62 2e-06
220emb|BX042925.1|CNS095A9 Single read from an extremity of a full-... 62 2e-06
221emb|BX042924.1|CNS095A8 Single read from an extremity of a full-... 62 2e-06
222emb|BX042921.1|CNS095A5 Single read from an extremity of a full-... 62 2e-06
223emb|BX042920.1|CNS095A4 Single read from an extremity of a full-... 62 2e-06
224emb|BX044463.1|CNS096GZ Single read from an extremity of a full-... 62 2e-06
225emb|BX044077.1|CNS09669 Single read from an extremity of a full-... 62 2e-06
226emb|BX044076.1|CNS09668 Single read from an extremity of a full-... 62 2e-06
227emb|BX043941.1|CNS0962H Single read from an extremity of a full-... 62 2e-06
228emb|BX043475.1|CNS095PJ Single read from an extremity of a full-... 62 2e-06
229emb|BX043474.1|CNS095PI Single read from an extremity of a full-... 62 2e-06
230emb|BX043383.1|CNS095MZ Single read from an extremity of a full-... 62 2e-06
231emb|BX043382.1|CNS095MY Single read from an extremity of a full-... 62 2e-06
232emb|BX043302.1|CNS095KQ Single read from an extremity of a full-... 62 2e-06
233emb|BX042626.1|CNS0951Y Single read from an extremity of a full-... 62 2e-06
234emb|BX042625.1|CNS0951X Single read from an extremity of a full-... 62 2e-06
235emb|BX042537.1|CNS094ZH Single read from an extremity of a full-... 62 2e-06
236emb|BX042361.1|CNS094UL Single read from an extremity of a full-... 62 2e-06
237emb|BX042360.1|CNS094UK Single read from an extremity of a full-... 62 2e-06
238emb|BX041956.1|CNS094JC Single read from an extremity of a full-... 62 2e-06
239emb|BX039561.1|CNS092OT Single read from an extremity of a full-... 62 2e-06
240emb|BX039004.1|CNS0929C Single read from an extremity of a full-... 62 2e-06
241emb|BX039003.1|CNS0929B Single read from an extremity of a full-... 62 2e-06
242emb|BX038956.1|CNS09280 Single read from an extremity of a full-... 62 2e-06
243emb|BX038848.1|CNS09250 Single read from an extremity of a full-... 62 2e-06
244emb|BX038847.1|CNS0924Z Single read from an extremity of a full-... 62 2e-06
245emb|BX038776.1|CNS09230 Single read from an extremity of a full-... 62 2e-06
246emb|BX038775.1|CNS0922Z Single read from an extremity of a full-... 62 2e-06
247emb|BX038464.1|CNS091UC Single read from an extremity of a full-... 62 2e-06
248emb|BX038463.1|CNS091UB Single read from an extremity of a full-... 62 2e-06
249emb|BX038343.1|CNS091QZ Single read from an extremity of a full-... 62 2e-06
250emb|BX038342.1|CNS091QY Single read from an extremity of a full-... 62 2e-06
251emb|BX038198.1|CNS091MY Single read from an extremity of a full-... 62 2e-06
252emb|BX038197.1|CNS091MX Single read from an extremity of a full-... 62 2e-06
253emb|BX037611.1|CNS0916N Single read from an extremity of a full-... 62 2e-06
254emb|BX037610.1|CNS0916M Single read from an extremity of a full-... 62 2e-06
255emb|BX036037.1|CNS08ZYX Single read from an extremity of a full-... 62 2e-06
256emb|BX036036.1|CNS08ZYW Single read from an extremity of a full-... 62 2e-06
257emb|BX035851.1|CNS08ZTR Single read from an extremity of a full-... 62 2e-06
258emb|BX035850.1|CNS08ZTQ Single read from an extremity of a full-... 62 2e-06
259emb|BX035713.1|CNS08ZPX Single read from an extremity of a full-... 62 2e-06
260emb|BX035712.1|CNS08ZPW Single read from an extremity of a full-... 62 2e-06
261emb|BX034822.1|CNS08Z16 Single read from an extremity of a full-... 62 2e-06
262emb|BX033511.1|CNS08Y0R Single read from an extremity of a full-... 62 2e-06
263emb|BX033510.1|CNS08Y0Q Single read from an extremity of a full-... 62 2e-06
264emb|BX033186.1|CNS08XRQ Single read from an extremity of a full-... 62 2e-06
265emb|BX033185.1|CNS08XRP Single read from an extremity of a full-... 62 2e-06
266emb|BX032601.1|CNS08XBH Single read from an extremity of a full-... 62 2e-06
267emb|BX032600.1|CNS08XBG Single read from an extremity of a full-... 62 2e-06
268emb|BX032184.1|CNS08WZW Single read from an extremity of a full-... 62 2e-06
269emb|BX031651.1|CNS08WL3 Single read from an extremity of a full-... 62 2e-06
270emb|BX031650.1|CNS08WL2 Single read from an extremity of a full-... 62 2e-06
271emb|BX030458.1|CNS08VNY Single read from an extremity of a full-... 62 2e-06
272emb|BX030213.1|CNS08VH5 Single read from an extremity of a full-... 62 2e-06
273emb|BX030212.1|CNS08VH4 Single read from an extremity of a full-... 62 2e-06
274emb|BX029766.1|CNS08V4Q Single read from an extremity of a full-... 62 2e-06
275emb|BX029425.1|CNS08UV9 Single read from an extremity of a full-... 62 2e-06
276emb|BX029640.1|CNS08V18 Single read from an extremity of a full-... 62 2e-06
277emb|BX029639.1|CNS08V17 Single read from an extremity of a full-... 62 2e-06
278emb|BX028678.1|CNS08UAI Single read from an extremity of a full-... 62 2e-06
279emb|BX028677.1|CNS08UAH Single read from an extremity of a full-... 62 2e-06
280emb|BX028645.1|CNS08U9L Single read from an extremity of a full-... 62 2e-06
281emb|BX028644.1|CNS08U9K Single read from an extremity of a full-... 62 2e-06
282emb|BX028137.1|CNS08TVH Single read from an extremity of a full-... 62 2e-06
283emb|BX028136.1|CNS08TVG Single read from an extremity of a full-... 62 2e-06
284emb|BX027589.1|CNS08TG9 Single read from an extremity of a full-... 62 2e-06
285emb|BX027588.1|CNS08TG8 Single read from an extremity of a full-... 62 2e-06
286emb|BX027296.1|CNS08T84 Single read from an extremity of a full-... 62 2e-06
287emb|BX027295.1|CNS08T83 Single read from an extremity of a full-... 62 2e-06
288emb|BX027261.1|CNS08T75 Single read from an extremity of a full-... 62 2e-06
289emb|BX026799.1|CNS08SUB Single read from an extremity of a full-... 62 2e-06
290emb|BX026798.1|CNS08SUA Single read from an extremity of a full-... 62 2e-06
291emb|BX026525.1|CNS08SMP Single read from an extremity of a full-... 62 2e-06
292emb|BX026139.1|CNS08SBZ Single read from an extremity of a full-... 62 2e-06
293emb|BX024800.1|CNS08RAS Single read from an extremity of a full-... 62 2e-06
294emb|BX024799.1|CNS08RAR Single read from an extremity of a full-... 62 2e-06
295emb|BX024449.1|CNS08R11 Single read from an extremity of a full-... 62 2e-06
296emb|BX024290.1|CNS08QWM Single read from an extremity of a full-... 62 2e-06
297emb|BX024289.1|CNS08QWL Single read from an extremity of a full-... 62 2e-06
298emb|BX023969.1|CNS08QNP Single read from an extremity of a full-... 62 2e-06
299emb|BX023968.1|CNS08QNO Single read from an extremity of a full-... 62 2e-06
300emb|BX023519.1|CNS08QB7 Single read from an extremity of a full-... 62 2e-06
301emb|BX023518.1|CNS08QB6 Single read from an extremity of a full-... 62 2e-06
302emb|BX023067.1|CNS08PYN Single read from an extremity of a full-... 62 2e-06
303emb|BX023066.1|CNS08PYM Single read from an extremity of a full-... 62 2e-06
304emb|BX021978.1|CNS08P4E Single read from an extremity of a full-... 62 2e-06
305emb|BX021977.1|CNS08P4D Single read from an extremity of a full-... 62 2e-06
306emb|BX021944.1|CNS08P3G Single read from an extremity of a full-... 62 2e-06
307emb|BX020784.1|CNS08O78 Single read from an extremity of a full-... 62 2e-06
308emb|BX020783.1|CNS08O77 Single read from an extremity of a full-... 62 2e-06
309emb|BX019213.1|CNS08MZL Single read from an extremity of a full-... 62 2e-06
310emb|BX019212.1|CNS08MZK Single read from an extremity of a full-... 62 2e-06
311emb|BX018565.1|CNS08MHL Single read from an extremity of a full-... 62 2e-06
312emb|BX018504.1|CNS08MFW Single read from an extremity of a full-... 62 2e-06
313emb|BX018331.1|CNS08MB3 Single read from an extremity of a full-... 62 2e-06
314emb|BX018330.1|CNS08MB2 Single read from an extremity of a full-... 62 2e-06
315emb|BX018282.1|CNS08M9Q Single read from an extremity of a full-... 62 2e-06
316emb|BX017049.1|CNS08LBH Single read from an extremity of a full-... 62 2e-06
317emb|BX017048.1|CNS08LBG Single read from an extremity of a full-... 62 2e-06
318emb|BX016888.1|CNS08L70 Single read from an extremity of a full-... 62 2e-06
319emb|BX016880.1|CNS08L6S Single read from an extremity of a full-... 62 2e-06
320emb|BX016564.1|CNS08KY0 Single read from an extremity of a full-... 62 2e-06
321emb|BX016563.1|CNS08KXZ Single read from an extremity of a full-... 62 2e-06
322emb|BX016168.1|CNS08KN0 Single read from an extremity of a full-... 62 2e-06
323emb|BX015663.1|CNS08K8Z Single read from an extremity of a full-... 62 2e-06
324emb|BX015662.1|CNS08K8Y Single read from an extremity of a full-... 62 2e-06
325emb|BX014527.1|CNS08JDF Single read from an extremity of a full-... 62 2e-06
326emb|BX014526.1|CNS08JDE Single read from an extremity of a full-... 62 2e-06
327emb|BX013842.1|CNS08IUE Single read from an extremity of a full-... 62 2e-06
328emb|BX013841.1|CNS08IUD Single read from an extremity of a full-... 62 2e-06
329emb|BX013672.1|CNS08IPO Single read from an extremity of a full-... 62 2e-06
330emb|BX013671.1|CNS08IPN Single read from an extremity of a full-... 62 2e-06
331emb|BX012550.1|CNS08HUI Single read from an extremity of a full-... 62 2e-06
332emb|BX012549.1|CNS08HUH Single read from an extremity of a full-... 62 2e-06
333emb|BX012430.1|CNS08HR6 Single read from an extremity of a full-... 62 2e-06
334emb|BX012429.1|CNS08HR5 Single read from an extremity of a full-... 62 2e-06
335emb|BX012014.1|CNS08HFM Single read from an extremity of a full-... 62 2e-06
336emb|BX012013.1|CNS08HFL Single read from an extremity of a full-... 62 2e-06
337emb|BX011638.1|CNS08H56 Single read from an extremity of a full-... 62 2e-06
338emb|BX011349.1|CNS08GX5 Single read from an extremity of a full-... 62 2e-06
339emb|BX010508.1|CNS08G9S Single read from an extremity of a full-... 62 2e-06
340emb|BX010075.1|CNS08FXR Single read from an extremity of a full-... 62 2e-06
341emb|BX009419.1|CNS08FFJ Single read from an extremity of a full-... 62 2e-06
342emb|BX009418.1|CNS08FFI Single read from an extremity of a full-... 62 2e-06
343emb|BX009131.1|CNS08F7J Single read from an extremity of a full-... 62 2e-06
344emb|BX009130.1|CNS08F7I Single read from an extremity of a full-... 62 2e-06
345emb|BX008970.1|CNS08F32 Single read from an extremity of a full-... 62 2e-06
346emb|BX008969.1|CNS08F31 Single read from an extremity of a full-... 62 2e-06
347emb|BX008303.1|CNS08EKJ Single read from an extremity of a full-... 62 2e-06
348emb|BX007609.1|CNS08E19 Single read from an extremity of a full-... 62 2e-06
349emb|BX006993.1|CNS08DK5 Single read from an extremity of a full-... 62 2e-06
350emb|BX006479.1|CNS08D5V Single read from an extremity of a full-... 62 2e-06
351emb|BX006478.1|CNS08D5U Single read from an extremity of a full-... 62 2e-06
352emb|BX006434.1|CNS08D4M Single read from an extremity of a full-... 62 2e-06
353emb|BX006433.1|CNS08D4L Single read from an extremity of a full-... 62 2e-06
354emb|BX005994.1|CNS08CSE Single read from an extremity of a full-... 62 2e-06
355emb|BX005993.1|CNS08CSD Single read from an extremity of a full-... 62 2e-06
356emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 62 2e-06
357emb|AL929282.5| Zebrafish DNA sequence from clone CH211-163L21, ... 62 2e-06
358gb|AY431736.1| Aedes aegypti ASAP ID: 33987 cytosolic large ribo... 60 9e-06
359emb|AL031740.1|SPCC1183 S.pombe chromosome III cosmid c1183 60 9e-06
360ref|NM_001022883.1| Schizosaccharomyces pombe 972h- hypothetical... 60 9e-06
361emb|CR636387.2|CNS0EQ09 Tetraodon nigroviridis full-length cDNA 58 4e-05
362emb|BX070614.1|CNS09QNE Single read from an extremity of a full-... 58 4e-05
363emb|BX070613.1|CNS09QND Single read from an extremity of a full-... 58 4e-05
364emb|BX023271.1|CNS08Q4B Single read from an extremity of a full-... 58 4e-05
365gb|AF175385.1|AF175385 Chlamydomonas reinhardtii 60S ribosomal p... 58 4e-05
366emb|AJ439529.1|PSP439529 Polytomella sp. 'Pringsheim 198.80' mRN... 58 4e-05
367gb|DQ440101.1| Aedes aegypti clone AE-430 60S ribosomal protein ... 56 1e-04
368emb|BX050785.1|CNS09BCL Single read from an extremity of a full-... 56 1e-04
369emb|BX048699.1|CNS099QN Single read from an extremity of a full-... 56 1e-04
370emb|BX040428.1|CNS093CW Single read from an extremity of a full-... 56 1e-04
371emb|BX037774.1|CNS091B6 Single read from an extremity of a full-... 56 1e-04
372emb|BX037773.1|CNS091B5 Single read from an extremity of a full-... 56 1e-04
373emb|BX031104.1|CNS08W5W Single read from an extremity of a full-... 56 1e-04
374emb|BX031103.1|CNS08W5V Single read from an extremity of a full-... 56 1e-04
375emb|BX029210.1|CNS08UPA Single read from an extremity of a full-... 56 1e-04
376emb|BX029209.1|CNS08UP9 Single read from an extremity of a full-... 56 1e-04
377emb|BX028822.1|CNS08UEI Single read from an extremity of a full-... 56 1e-04
378emb|BX027540.1|CNS08TEW Single read from an extremity of a full-... 56 1e-04
379emb|BX027539.1|CNS08TEV Single read from an extremity of a full-... 56 1e-04
380emb|BX025489.1|CNS08RTX Single read from an extremity of a full-... 56 1e-04
381emb|BX025488.1|CNS08RTW Single read from an extremity of a full-... 56 1e-04
382emb|BX021509.1|CNS08ORD Single read from an extremity of a full-... 56 1e-04
383emb|BX021508.1|CNS08ORC Single read from an extremity of a full-... 56 1e-04
384emb|BX020542.1|CNS08O0I Single read from an extremity of a full-... 56 1e-04
385emb|BX020541.1|CNS08O0H Single read from an extremity of a full-... 56 1e-04
386emb|BX013966.1|CNS08IXU Single read from an extremity of a full-... 56 1e-04
387emb|BX013965.1|CNS08IXT Single read from an extremity of a full-... 56 1e-04
388emb|BX009271.1|CNS08FBF Single read from an extremity of a full-... 56 1e-04
389emb|BX009270.1|CNS08FBE Single read from an extremity of a full-... 56 1e-04
390emb|BX008490.1|CNS08EPQ Single read from an extremity of a full-... 56 1e-04
391emb|BX008488.1|CNS08EPO Single read from an extremity of a full-... 56 1e-04
392emb|CR938654.1| Single read from an extremity of a full-length c... 56 1e-04
393emb|CR938414.1| Single read from an extremity of a full-length c... 56 1e-04
394emb|CR938383.1| Single read from an extremity of a full-length c... 56 1e-04
395emb|CR937988.1| Single read from an extremity of a full-length c... 56 1e-04
396gb|AY857423.1| Suberites domuncula L10a mRNA, complete cds 56 1e-04
397dbj|AK119934.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
398ref|XM_564193.1| Anopheles gambiae str. PEST ENSANGP00000026134 ... 56 1e-04
399ref|XM_309349.2| Anopheles gambiae str. PEST ENSANGP00000015019 ... 56 1e-04
400gb|BC083346.1| Mus musculus ribosomal protein L10A, mRNA (cDNA c... 54 6e-04
401gb|AC158958.4| Mus musculus chromosome 1, clone RP23-31E12, comp... 54 6e-04
402ref|NM_011287.1| Mus musculus ribosomal protein L10A (Rpl10a), mRNA 54 6e-04
403gb|AY829772.1| Lonomia obliqua ribosomal protein L1 mRNA, comple... 54 6e-04
404emb|BX065429.1|CNS09MND Single read from an extremity of a full-... 54 6e-04
405emb|BX051665.1|CNS09C11 Single read from an extremity of a full-... 54 6e-04
406emb|BX047486.1|CNS098SY Single read from an extremity of a full-... 54 6e-04
407emb|BX047485.1|CNS098SX Single read from an extremity of a full-... 54 6e-04
408emb|BX034639.1|CNS08YW3 Single read from an extremity of a full-... 54 6e-04
409emb|BX034638.1|CNS08YW2 Single read from an extremity of a full-... 54 6e-04
410emb|BX029558.1|CNS08UYY Single read from an extremity of a full-... 54 6e-04
411emb|BX021943.1|CNS08P3F Single read from an extremity of a full-... 54 6e-04
412emb|BX011639.1|CNS08H57 Single read from an extremity of a full-... 54 6e-04
413emb|BX006994.1|CNS08DK6 Single read from an extremity of a full-... 54 6e-04
414dbj|AK150743.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
415dbj|AK153863.1| Mus musculus 2 days neonate thymus thymic cells ... 54 6e-04
416dbj|AK151172.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 6e-04
417dbj|AK215262.1| Mus musculus cDNA, clone:Y2G0134H14, strand:minu... 54 6e-04
418dbj|AK200448.1| Mus musculus cDNA, clone:Y1G0134J12, strand:plus... 54 6e-04
419dbj|AK193763.1| Mus musculus cDNA, clone:Y1G0113E17, strand:plus... 54 6e-04
420emb|CT573502.2| Medicago truncatula chromosome 5 clone mte1-69f2... 54 6e-04
421gb|U12403.1|MMU12403 Mus musculus Csa-19 mRNA, complete cds 54 6e-04
422gb|AC101869.13| Mus musculus chromosome 1, clone RP23-348D4, com... 54 6e-04
423gb|AY190729.1| Pagrus major ribosomal protein L10a mRNA, partial... 52 0.002
424ref|XM_418020.1| PREDICTED: Gallus gallus similar to Rpl10a-prov... 50 0.009
425gb|AY389961.1| Gallus gallus ribosomal protein L10a mRNA, partia... 50 0.009
426gb|BT014654.1| Drosophila melanogaster RE06042 full insert cDNA 50 0.009
427ref|XM_653634.1| Aspergillus nidulans FGSC A4 hypothetical prote... 50 0.009
428ref|XM_981855.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.009
429ref|XM_909950.2| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.009
430ref|XM_356642.5| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.009
431ref|XM_662904.1| Cryptosporidium hominis TU502 ribosomal protein... 50 0.009
432gb|AC124732.5| Mus musculus BAC clone RP23-300J20 from chromosom... 50 0.009
433ref|XM_777696.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.009
434ref|NM_168480.1| Drosophila melanogaster Ribosomal protein L10Ab... 50 0.009
435ref|NM_140257.1| Drosophila melanogaster Ribosomal protein L10Ab... 50 0.009
436gb|AC105263.2| Drosophila melanogaster 3L BAC RP98-48G3 (Roswell... 50 0.009
437ref|XM_627187.1| Cryptosporidium parvum Iowa II 60S ribosomal pr... 50 0.009
438emb|CR390341.1| Gallus gallus finished cDNA, clone ChEST153g18 50 0.009
439emb|CR388620.1| Gallus gallus finished cDNA, clone ChEST88o22 50 0.009
440emb|BX935842.2| Gallus gallus finished cDNA, clone ChEST162g11 50 0.009
441emb|BX936248.1| Gallus gallus finished cDNA, clone ChEST960d7 50 0.009
442emb|BX935923.1| Gallus gallus finished cDNA, clone ChEST104i19 50 0.009
443emb|BX935807.1| Gallus gallus finished cDNA, clone ChEST165g19 50 0.009
444emb|BX934879.1| Gallus gallus finished cDNA, clone ChEST152p9 50 0.009
445emb|BX935031.1| Gallus gallus finished cDNA, clone ChEST301b20 50 0.009
446dbj|AK177057.1| Mus musculus cDNA, clone:Y0G0101H02, strand:minu... 50 0.009
447gb|AF132158.1|AF132158 Drosophila melanogaster clone GH13356 unk... 50 0.009
448gb|AE003543.4| Drosophila melanogaster chromosome 3L, section 42... 50 0.009
449gb|BT001825.1| Drosophila melanogaster RH43519 full insert cDNA 50 0.009
450emb|CT033109.1| Platynereis dumerilii EST IB0AAA26CC06EM1 50 0.009
451emb|CT033108.1| Platynereis dumerilii EST IB0AAA26CC06FM1 50 0.009
452emb|CT032991.1| Platynereis dumerilii EST IB0AAA28BD08EM1 50 0.009
453emb|CT032990.1| Platynereis dumerilii EST IB0AAA28BD08FM1 50 0.009
454dbj|D10916.1|MUSNEDD6 Mus musculus NEDD-6 mRNA, 3'terminal sequence 50 0.009
455ref|XM_362251.1| Magnaporthe grisea 70-15 hypothetical protein (... 48 0.036
456emb|BX006372.1|CNS08D2W Single read from an extremity of a full-... 48 0.036
457dbj|AB225948.1| Aspergillus oryzae cDNA, contig sequence: AoEST2804 48 0.036
458dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038 48 0.036
459gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 48 0.036
460ref|NM_210788.1| Eremothecium gossypii AFL116Wp (AFL116W), mRNA 48 0.036
461ref|XR_003552.1| PREDICTED: Mus musculus similar to ribosomal pr... 46 0.14
462ref|XR_001751.1| PREDICTED: Mus musculus similar to ribosomal pr... 46 0.14
463ref|XR_003989.1| PREDICTED: Mus musculus similar to ribosomal pr... 46 0.14
464emb|CT025652.7| Mouse DNA sequence from clone RP24-68J3 on chrom... 46 0.14
465ref|XM_822741.1| Trypanosoma brucei TREU927 60S ribosomal protei... 46 0.14
466ref|XM_823942.1| Trypanosoma brucei TREU927 60S ribosomal protei... 46 0.14
467emb|CT010441.11| Mouse DNA sequence from clone CH29-521N19 on ch... 46 0.14
468emb|CT009717.9| Mouse DNA sequence from clone RP23-216H9 on chro... 46 0.14
469emb|AM049022.1| Curculio glandium partial mRNA for ribosomal pro... 46 0.14
470gb|BC006039.1| Mus musculus ribosomal protein L10A, mRNA (cDNA c... 46 0.14
471emb|AL357632.11| Human DNA sequence from clone RP11-432D22 on ch... 46 0.14
472emb|BX026524.1|CNS08SMO Single read from an extremity of a full-... 46 0.14
473emb|BX016889.1|CNS08L71 Single read from an extremity of a full-... 46 0.14
474emb|BX010509.1|CNS08G9T Single read from an extremity of a full-... 46 0.14
475gb|AC093154.2| Homo sapiens chromosome 1 clone RP3-445O10, compl... 46 0.14
476dbj|AK002613.1| Mus musculus adult male kidney cDNA, RIKEN full-... 46 0.14
477gb|AC154912.3| Mus musculus BAC clone RP23-23B10 from 17, comple... 46 0.14
478gb|BT001758.1| Drosophila melanogaster RH06366 full insert cDNA 46 0.14
479emb|AL935326.13| Mouse DNA sequence from clone RP23-10L17 on chr... 46 0.14
480gb|AC154248.2| Mus musculus BAC clone RP24-182I14 from chromosom... 46 0.14
481gb|U34620.1|TBU34620 Trypanosoma brucei rhodesiense NEDD-6 like ... 46 0.14
482gb|U53342.1| Caenorhabditis elegans cosmid F01G12, complete sequ... 44 0.55
483gb|AY389969.1| Xenopus laevis ribosomal protein L10a mRNA, parti... 44 0.55
484gb|AC024200.2| Caenorhabditis elegans cosmid Y71F9AL, complete s... 44 0.55
485ref|XM_816791.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 44 0.55
486ref|XM_810733.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 44 0.55
487gb|BC041308.1| Xenopus laevis ribosomal protein L10a, mRNA (cDNA... 44 0.55
488emb|AL078603.4|HSJ364H10 Human DNA sequence from clone RP3-364H1... 44 0.55
489emb|BX023272.1|CNS08Q4C Single read from an extremity of a full-... 44 0.55
490emb|X92670.1|SCXII S.cerevisiae 14.6kb fragment from chromosome VII 44 0.55
491gb|AC079015.8| Homo sapiens chromosome 8, clone RP11-489O18, com... 44 0.55
492ref|NM_058661.3| Caenorhabditis elegans Ribosomal Protein, Large... 44 0.55
493ref|NM_058660.3| Caenorhabditis elegans Ribosomal Protein, Large... 44 0.55
494ref|NR_002354.1| Caenorhabditis elegans strain Bristol N2 chromo... 44 0.55
495ref|NR_002353.1| Caenorhabditis elegans strain Bristol N2 chromo... 44 0.55
496ref|XM_212679.3| PREDICTED: Rattus norvegicus similar to ribosom... 44 0.55
497emb|BX005154.6| Zebrafish DNA sequence from clone CH211-288G17 i... 44 0.55
498gb|AC024851.1|AC024851 Caenorhabditis elegans clone Y71F9AL, com... 44 0.55
499dbj|AK058256.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.55
500emb|Z73576.1|SCYPL220W S.cerevisiae chromosome XVI reading frame... 44 0.55

>dbj|AK102574.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033097O05, full
           insert sequence
          Length = 917

 Score =  442 bits (223), Expect = e-121
 Identities = 370/419 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagaacaaccggtacacctttcccattgtgctcttcaggtacaggcaccgcacgttttgc 276
           |||||||  ||||||||||||||||| |||||||||||||||| |||||  ||||| |||
Sbjct: 723 tagaacactcggtacacctttcccatggtgctcttcaggtacaagcacctaacgttctgc 664

                                                                       
Query: 277 caattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctggaagatc 336
           |||||||||||||| || || |||||||||||||||||||||||||| || |||||||||
Sbjct: 663 caattcttcttcaaaagggaaacaaggaagttcacgctcatctgcacattttggaagatc 604

                                                                       
Query: 337 tgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacctttttcaac 396
           ||||||||||||||| |   || |||||| |||||||||||||| || ||||| |||| |
Sbjct: 603 tgcttctcctccatagcacagttgccaacagcaacacccatgcagagaaccttcttcagc 544

                                                                       
Query: 397 tggaacttgacagtggccttggtctcattaaccttggactcaagggactcctggtgagac 456
           ||||| || || || ||||| ||||||||||||||||||||||| || ||||| || | |
Sbjct: 543 tggaatttcactgtagccttagtctcattaaccttggactcaagtgattcctgatgcgtc 484

                                                                       
Query: 457 accaaagttggaaactttcctgccttgttaagaccaggtccaagaagtcggggaatctgc 516
           |||| |||||| || || ||||| |||||||||||||| ||||||||||| |||||||||
Sbjct: 483 accagagttgggaatttgcctgctttgttaagaccaggaccaagaagtcgaggaatctgc 424

                                                                       
Query: 517 ttaatgatagcctcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagc 576
           || |||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 423 ttgatgatagcctcagaagcaaggaaagcatgatatttctttgcaagcttcttaactagc 364

                                                                      
Query: 577 ttcttgtttttgttcatcttcttcagcgattccacatccatacagtcaaggcccatttt 635
           ||||||||||||||||| ||||| || | ||||||||||||| |||| |||||||||||
Sbjct: 363 ttcttgtttttgttcattttcttgagggcttccacatccatatagtctaggcccatttt 305



to top

>dbj|AK062103.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-A11, full
           insert sequence
          Length = 915

 Score =  442 bits (223), Expect = e-121
 Identities = 370/419 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagaacaaccggtacacctttcccattgtgctcttcaggtacaggcaccgcacgttttgc 276
           |||||||  ||||||||||||||||| |||||||||||||||| |||||  ||||| |||
Sbjct: 722 tagaacactcggtacacctttcccatggtgctcttcaggtacaagcacctaacgttctgc 663

                                                                       
Query: 277 caattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctggaagatc 336
           |||||||||||||| || || |||||||||||||||||||||||||| || |||||||||
Sbjct: 662 caattcttcttcaaaagggaaacaaggaagttcacgctcatctgcacattttggaagatc 603

                                                                       
Query: 337 tgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacctttttcaac 396
           ||||||||||||||| |   || |||||| |||||||||||||| || ||||| |||| |
Sbjct: 602 tgcttctcctccatagcacagttgccaacagcaacacccatgcagagaaccttcttcagc 543

                                                                       
Query: 397 tggaacttgacagtggccttggtctcattaaccttggactcaagggactcctggtgagac 456
           ||||| || || || ||||| ||||||||||||||||||||||| || ||||| || | |
Sbjct: 542 tggaatttcactgtagccttagtctcattaaccttggactcaagtgattcctgatgcgtc 483

                                                                       
Query: 457 accaaagttggaaactttcctgccttgttaagaccaggtccaagaagtcggggaatctgc 516
           |||| |||||| || || ||||| |||||||||||||| ||||||||||| |||||||||
Sbjct: 482 accagagttgggaatttgcctgctttgttaagaccaggaccaagaagtcgaggaatctgc 423

                                                                       
Query: 517 ttaatgatagcctcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagc 576
           || |||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 422 ttgatgatagcctcagaagcaaggaaagcatgatatttctttgcaagcttcttaactagc 363

                                                                      
Query: 577 ttcttgtttttgttcatcttcttcagcgattccacatccatacagtcaaggcccatttt 635
           ||||||||||||||||| ||||| || | ||||||||||||| |||| |||||||||||
Sbjct: 362 ttcttgtttttgttcattttcttgagggcttccacatccatatagtctaggcccatttt 304



to top

>gb|AY103915.1| Zea mays PCO106165 mRNA sequence
          Length = 978

 Score =  440 bits (222), Expect = e-120
 Identities = 357/402 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagaacaaccggtacacctttcccattgtgctcttcaggtacaggcaccgcacgttttgc 276
           ||||||| |||||||||||||||||| |||||||||||||||| ||| | ||| || |||
Sbjct: 766 tagaacagccggtacacctttcccatagtgctcttcaggtacaagcatctcacattctgc 707

                                                                       
Query: 277 caattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctggaagatc 336
           |||||||| ||||| || || || |||||||| || ||||| ||||||||||||||||||
Sbjct: 706 caattctttttcaagagcgacacgaggaagttgacactcatttgcacgttctggaagatc 647

                                                                       
Query: 337 tgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacctttttcaac 396
           |||||||| ||||| ||   || |||||| ||||||||||||||||||||||| |||| |
Sbjct: 646 tgcttctcatccatgccgcagttgccaacagcaacacccatgcaaagcaccttcttcagc 587

                                                                       
Query: 397 tggaacttgacagtggccttggtctcattaaccttggactcaagggactcctggtgagac 456
           |||||||| || || ||||| |||||||||||||||||||||||||| |||||||| | |
Sbjct: 586 tggaacttaactgtagcctttgtctcattaaccttggactcaagggattcctggtgtgtc 527

                                                                       
Query: 457 accaaagttggaaactttcctgccttgttaagaccaggtccaagaagtcggggaatctgc 516
           ||||| || || || ||||||||||||||||||||||| |||||||| || ||||| |||
Sbjct: 526 accaaggtagggaattttcctgccttgttaagaccaggaccaagaagacgaggaatttgc 467

                                                                       
Query: 517 ttaatgatagcctcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagc 576
           |||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 466 ttaatgatagcctcagatgcaaggaaagcatggtacttctttgccagcttcttcactagc 407

                                                     
Query: 577 ttcttgtttttgttcatcttcttcagcgattccacatccata 618
           ||||||||||||||||||||||| || | |||||||||||||
Sbjct: 406 ttcttgtttttgttcatcttcttgagggcttccacatccata 365



to top

>ref|NM_100709.3| Arabidopsis thaliana structural constituent of ribosome AT1G08360
           mRNA, complete cds
          Length = 930

 Score =  258 bits (130), Expect = 2e-65
 Identities = 298/354 (84%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           ||||||||||||||| |||||||  ||||  || |||||||| ||||||||||| || ||
Sbjct: 688 tcccattgtgctcttgaggtacaaacacctgacattttgccagttcttcttcaatagcga 629

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| |||||||||||||| ||||| |||||||||||||| |||||    ||
Sbjct: 628 gacgaggaagttgacgctcatctgcacattctgaaagatctgcttctcttccattgaaag 569

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||| |||||||| || ||||| |||| ||||||||| || || |||||
Sbjct: 568 gttaccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctt 509

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
            || ||||| ||||| ||||| | ||| ||||||||   ||| | |||||| || |||||
Sbjct: 508 tgtttcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcc 449

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 448 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaggc 389

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 388 caagaaagcatggtatttctttgcaagcttcttgacgagtttcttgttcttgtt 335



to top

>gb|AY114542.1| Arabidopsis thaliana putative ribosomal protein L10 (At1g08360)
           mRNA, complete cds
          Length = 714

 Score =  258 bits (130), Expect = 2e-65
 Identities = 298/354 (84%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           ||||||||||||||| |||||||  ||||  || |||||||| ||||||||||| || ||
Sbjct: 630 tcccattgtgctcttgaggtacaaacacctgacattttgccagttcttcttcaatagcga 571

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| |||||||||||||| ||||| |||||||||||||| |||||    ||
Sbjct: 570 gacgaggaagttgacgctcatctgcacattctgaaagatctgcttctcttccattgaaag 511

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||| |||||||| || ||||| |||| ||||||||| || || |||||
Sbjct: 510 gttaccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctt 451

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
            || ||||| ||||| ||||| | ||| ||||||||   ||| | |||||| || |||||
Sbjct: 450 tgtttcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcc 391

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 390 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaggc 331

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 330 caagaaagcatggtatttctttgcaagcttcttgacgagtttcttgttcttgtt 277



to top

>gb|AY065077.1| Arabidopsis thaliana putative ribosomal protein L10 (At1g08360;
           T27G7.6) mRNA, complete cds
          Length = 883

 Score =  258 bits (130), Expect = 2e-65
 Identities = 298/354 (84%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           ||||||||||||||| |||||||  ||||  || |||||||| ||||||||||| || ||
Sbjct: 684 tcccattgtgctcttgaggtacaaacacctgacattttgccagttcttcttcaatagcga 625

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| |||||||||||||| ||||| |||||||||||||| |||||    ||
Sbjct: 624 gacgaggaagttgacgctcatctgcacattctgaaagatctgcttctcttccattgaaag 565

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||| |||||||| || ||||| |||| ||||||||| || || |||||
Sbjct: 564 gttaccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctt 505

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
            || ||||| ||||| ||||| | ||| ||||||||   ||| | |||||| || |||||
Sbjct: 504 tgtttcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcc 445

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 444 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaggc 385

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 384 caagaaagcatggtatttctttgcaagcttcttgacgagtttcttgttcttgtt 331



to top

>emb|BX814727.1|CNS0ACAP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 870

 Score =  258 bits (130), Expect = 2e-65
 Identities = 298/354 (84%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           ||||||||||||||| |||||||  ||||  || |||||||| ||||||||||| || ||
Sbjct: 688 tcccattgtgctcttgaggtacaaacacctgacattttgccagttcttcttcaatagcga 629

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| |||||||||||||| ||||| |||||||||||||| |||||    ||
Sbjct: 628 gacgaggaagttgacgctcatctgcacattctgaaagatctgcttctcttccattgaaag 569

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||| |||||||| || ||||| |||| ||||||||| || || |||||
Sbjct: 568 gttaccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctt 509

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
            || ||||| ||||| ||||| | ||| ||||||||   ||| | |||||| || |||||
Sbjct: 508 tgtttcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcc 449

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 448 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaggc 389

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 388 caagaaagcatggtatttctttgcaagcttcttgacgagtttcttgttcttgtt 335



to top

>emb|BX816002.1|CNS0ABUG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH22ZB09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 840

 Score =  258 bits (130), Expect = 2e-65
 Identities = 298/354 (84%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           ||||||||||||||| |||||||  ||||  || |||||||| ||||||||||| || ||
Sbjct: 660 tcccattgtgctcttgaggtacaaacacctgacattttgccagttcttcttcaatagcga 601

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| |||||||||||||| ||||| |||||||||||||| |||||    ||
Sbjct: 600 gacgaggaagttgacgctcatctgcacattctgaaagatctgcttctcttccattgaaag 541

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||| |||||||| || ||||| |||| ||||||||| || || |||||
Sbjct: 540 gttaccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctt 481

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
            || ||||| ||||| ||||| | ||| ||||||||   ||| | |||||| || |||||
Sbjct: 480 tgtttcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcc 421

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 420 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaggc 361

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 360 caagaaagcatggtatttctttgcaagcttcttgacgagtttcttgttcttgtt 307



to top

>emb|BX841788.1|CNS09Y5M Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB6ZC05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 847

 Score =  258 bits (130), Expect = 2e-65
 Identities = 298/354 (84%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           ||||||||||||||| |||||||  ||||  || |||||||| ||||||||||| || ||
Sbjct: 667 tcccattgtgctcttgaggtacaaacacctgacattttgccagttcttcttcaatagcga 608

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| |||||||||||||| ||||| |||||||||||||| |||||    ||
Sbjct: 607 gacgaggaagttgacgctcatctgcacattctgaaagatctgcttctcttccattgaaag 548

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||| |||||||| || ||||| |||| ||||||||| || || |||||
Sbjct: 547 gttaccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctt 488

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
            || ||||| ||||| ||||| | ||| ||||||||   ||| | |||||| || |||||
Sbjct: 487 tgtttcattcacctttgactccaaggattcctggtggctcacaagagttgggaattttcc 428

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 427 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaggc 368

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| || |||||||||||||||||||| || |||||||| |||||
Sbjct: 367 caagaaagcatggtatttctttgcaagcttcttgacgagtttcttgttcttgtt 314



to top

>ref|XM_483755.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 936

 Score =  250 bits (126), Expect = 5e-63
 Identities = 303/362 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           ||||||||||| || | ||||||||||| ||| || ||||| ||||||||||| || || 
Sbjct: 703 cccattgtgcttttgatgtacaggcacctcacattctgccagttcttcttcaaaagggac 644

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           || |||||||| |||||||| || | ||| ||   ||||||||||||||||||   || |
Sbjct: 643 acgaggaagttgacgctcatttggatgttttgctggatctgcttctcctccatcgacaag 584

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           |  || || |||||||||||||| || ||||| |||| |||||||||||| || || || 
Sbjct: 583 ttacccacagcaacacccatgcacagaaccttcttcagctggaacttgactgtagctttc 524

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           |||||||| |||||||| ||||| |||||||||||||  ||||| || || ||||| |||
Sbjct: 523 gtctcattgaccttggattcaagagactcctggtgagtaaccaatgtagggaacttgcct 464

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| ||||| || ||||| |||||||| ||||| ||||| ||||| 
Sbjct: 463 gccttgtttagaccaggaccaaggagacgggggatctgcttgatgatggcctctgatgct 404

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           | ||||||||| |||||||| ||||||||||| || ||||||||||| ||||||||||||
Sbjct: 403 aagaaagcatggtacttcttggcaagcttcttcacaagcttcttgttcttgttcatcttc 344

             
Query: 598 tt 599
           ||
Sbjct: 343 tt 342



to top

>gb|AY389626.1| Hyacinthus orientalis 60S ribosomal protein L10A (RPL10A) mRNA,
           partial cds
          Length = 756

 Score =  250 bits (126), Expect = 5e-63
 Identities = 309/370 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 tttcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacaga 294
           |||||||| ||||||||||||| || ||| || || ||||||||||||||||||| || |
Sbjct: 583 tttcccatggtgctcttcaggtgcaagcatcggacattttgccaattcttcttcagcaaa 524

                                                                       
Query: 295 gagacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccataccc 354
           || || |||||||| || || |  || || ||||| |||||||| || || ||||| || 
Sbjct: 523 gataccaggaagttgacactgagttgtacattctgaaagatctgtttttcttccatcccg 464

                                                                       
Query: 355 aggtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcc 414
             ||  ||||| ||||||||||||||||| || || || | ||| ||||| ||  | || 
Sbjct: 463 cagtttccaacagcaacacccatgcaaagaactttcttgagctgaaacttaaccattgct 404

                                                                       
Query: 415 ttggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaacttt 474
           ||||| |||||||| || | ||| | ||| ||||| |||| |||||| || |||||||||
Sbjct: 403 ttggtttcattaactttcgcctccaaggattcctgatgagtcaccaatgtaggaaacttt 344

                                                                       
Query: 475 cctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagat 534
           ||||||||||||||||| || || ||||| ||||| ||||||||||||| |||||| |||
Sbjct: 343 cctgccttgttaagaccgggacccagaagacgggggatctgcttaatgacagcctcggat 284

                                                                       
Query: 535 gcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatc 594
           || || |||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 283 gccagaaaagcatgatacttctttgcaagcttcttgacgagcttcttgttcttgttcatc 224

                     
Query: 595 ttcttcagcg 604
           ||||||||||
Sbjct: 223 ttcttcagcg 214



to top

>dbj|AK061522.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-B06, full
           insert sequence
          Length = 936

 Score =  250 bits (126), Expect = 5e-63
 Identities = 303/362 (83%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           ||||||||||| || | ||||||||||| ||| || ||||| ||||||||||| || || 
Sbjct: 703 cccattgtgcttttgatgtacaggcacctcacattctgccagttcttcttcaaaagggac 644

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           || |||||||| |||||||| || | ||| ||   ||||||||||||||||||   || |
Sbjct: 643 acgaggaagttgacgctcatttggatgttttgctggatctgcttctcctccatcgacaag 584

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           |  || || |||||||||||||| || ||||| |||| |||||||||||| || || || 
Sbjct: 583 ttacccacagcaacacccatgcacagaaccttcttcagctggaacttgactgtagctttc 524

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           |||||||| |||||||| ||||| |||||||||||||  ||||| || || ||||| |||
Sbjct: 523 gtctcattgaccttggattcaagagactcctggtgagtaaccaatgtagggaacttgcct 464

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| ||||| || ||||| |||||||| ||||| ||||| ||||| 
Sbjct: 463 gccttgtttagaccaggaccaaggagacgggggatctgcttgatgatggcctctgatgct 404

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           | ||||||||| |||||||| ||||||||||| || ||||||||||| ||||||||||||
Sbjct: 403 aagaaagcatggtacttcttggcaagcttcttcacaagcttcttgttcttgttcatcttc 344

             
Query: 598 tt 599
           ||
Sbjct: 343 tt 342



to top

>gb|BT016546.1| Zea mays clone Contig379 mRNA sequence
          Length = 937

 Score =  244 bits (123), Expect = 3e-61
 Identities = 327/395 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           ||||| |||||||| | ||| ||||| | ||| || ||||| ||||||||||  || || 
Sbjct: 688 cccatggtgctcttgacgtagaggcatctcacattctgccagttcttcttcagaagggaa 629

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           ||||||||||||||||||||||| | ||||||   ||||||||||||||||||  ||| |
Sbjct: 628 acaaggaagttcacgctcatctggatgttctgctggatctgcttctcctccatcgccaag 569

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           | ||| ||||| || ||||||||||| ||||| || | |||||||||||| || ||||| 
Sbjct: 568 ttgccgacggcgacgcccatgcaaaggaccttcttgagctggaacttgacggttgcctta 509

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           ||||| || |||||||| || ||||| ||||||||||  ||||  || || ||||| |||
Sbjct: 508 gtctcgttcaccttggattcgagggattcctggtgagtaaccagggtcgggaacttgcct 449

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| ||||| || |||||||||||||| ||||| ||||| ||||| 
Sbjct: 448 gccttgttgagaccaggaccaaggagacggggaatctgcttgatgatggcctctgatgcc 389

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           | ||||||||| |||||||| |||||| |||| || ||||||||||| |||||||| |||
Sbjct: 388 aagaaagcatggtacttcttggcaagcctcttaacaagcttcttgttcttgttcattttc 329

                                              
Query: 598 ttcagcgattccacatccatacagtcaaggcccat 632
           || || |  || ||||||||  ||||||| |||||
Sbjct: 328 ttgagagcctcaacatccatgtagtcaagtcccat 294



to top

>gb|AY109405.1| Zea mays CL4809_1 mRNA sequence
          Length = 1296

 Score =  244 bits (123), Expect = 3e-61
 Identities = 327/395 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           ||||| |||||||| | ||| ||||| | ||| || ||||| ||||||||||  || || 
Sbjct: 966 cccatggtgctcttgacgtagaggcatctcacattctgccagttcttcttcagaagggaa 907

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           ||||||||||||||||||||||| | ||||||   ||||||||||||||||||  ||| |
Sbjct: 906 acaaggaagttcacgctcatctggatgttctgctggatctgcttctcctccatcgccaag 847

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           | ||| ||||| || ||||||||||| ||||| || | |||||||||||| || ||||| 
Sbjct: 846 ttgccgacggcgacgcccatgcaaaggaccttcttgagctggaacttgacggttgcctta 787

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           ||||| || |||||||| || ||||| ||||||||||  ||||  || || ||||| |||
Sbjct: 786 gtctcgttcaccttggattcgagggattcctggtgagtaaccagggtcgggaacttgcct 727

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| ||||| || |||||||||||||| ||||| ||||| ||||| 
Sbjct: 726 gccttgttgagaccaggaccaaggagacggggaatctgcttgatgatggcctctgatgcc 667

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           | ||||||||| |||||||| |||||| |||| || ||||||||||| |||||||| |||
Sbjct: 666 aagaaagcatggtacttcttggcaagcctcttaacaagcttcttgttcttgttcattttc 607

                                              
Query: 598 ttcagcgattccacatccatacagtcaaggcccat 632
           || || |  || ||||||||  ||||||| |||||
Sbjct: 606 ttgagagcctcaacatccatgtagtcaagtcccat 572



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  234 bits (118), Expect = 3e-58
 Identities = 154/166 (92%)
 Strand = Plus / Minus

                                                                            
Query: 470      actttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcct 529
                |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 37226518 acttgcctgccttgttaagaccaggtccaagaagtcgaggaatctgcttaatgatggcct 37226459

                                                                            
Query: 530      cagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgt 589
                |||||||||||||||| ||||| ||||||||||||||||| || ||||||||||||||||
Sbjct: 37226458 cagatgcaaggaaagcgtgatatttctttgcaagcttcttaaccagcttcttgtttttgt 37226399

                                                              
Query: 590      tcatcttcttcagcgattccacatccatacagtcaaggcccatttt 635
                |||||||||| || | ||||||||||||| |||| |||||||||||
Sbjct: 37226398 tcatcttcttgagagcttccacatccatatagtctaggcccatttt 37226353



 Score =  190 bits (96), Expect = 4e-45
 Identities = 174/200 (87%)
 Strand = Plus / Minus

                                                                            
Query: 268      acgttttgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttc 327
                ||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||| || 
Sbjct: 37227209 acgttctgccaattcttcttcaaaagagagacaaggaagttcacgctcatttgcacattt 37227150

                                                                            
Query: 328      tggaagatctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacc 387
                ||||| || ||||||||||||||| |   || ||| || ||||||||||||||||| |||
Sbjct: 37227149 tggaaaatttgcttctcctccatagcacagttgcctacagcaacacccatgcaaagaacc 37227090

                                                                            
Query: 388      tttttcaactggaacttgacagtggccttggtctcattaaccttggactcaagggactcc 447
                |||||||  |||||||| || || ||||| ||||| ||||||||||||||||| || |||
Sbjct: 37227089 tttttcagttggaacttcactgtagccttagtctcgttaaccttggactcaagtgattcc 37227030

                                    
Query: 448      tggtgagacaccaaagttgg 467
                ||||||| |||||| |||||
Sbjct: 37227029 tggtgagtcaccaacgttgg 37227010



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                           
Query: 217      tagaacaaccggtacacctttcccattgtgctcttcaggtaca 259
                ||||||| ||||  ||| |||||||| ||||||||||||||||
Sbjct: 37227633 tagaacacccggatcacttttcccatagtgctcttcaggtaca 37227591



to top

>dbj|AP003794.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0489B03
          Length = 150381

 Score =  234 bits (118), Expect = 3e-58
 Identities = 154/166 (92%)
 Strand = Plus / Minus

                                                                          
Query: 470    actttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcct 529
              |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 101174 acttgcctgccttgttaagaccaggtccaagaagtcgaggaatctgcttaatgatggcct 101115

                                                                          
Query: 530    cagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgt 589
              |||||||||||||||| ||||| ||||||||||||||||| || ||||||||||||||||
Sbjct: 101114 cagatgcaaggaaagcgtgatatttctttgcaagcttcttaaccagcttcttgtttttgt 101055

                                                            
Query: 590    tcatcttcttcagcgattccacatccatacagtcaaggcccatttt 635
              |||||||||| || | ||||||||||||| |||| |||||||||||
Sbjct: 101054 tcatcttcttgagagcttccacatccatatagtctaggcccatttt 101009



 Score =  190 bits (96), Expect = 4e-45
 Identities = 174/200 (87%)
 Strand = Plus / Minus

                                                                          
Query: 268    acgttttgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttc 327
              ||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||| || 
Sbjct: 101865 acgttctgccaattcttcttcaaaagagagacaaggaagttcacgctcatttgcacattt 101806

                                                                          
Query: 328    tggaagatctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacc 387
              ||||| || ||||||||||||||| |   || ||| || ||||||||||||||||| |||
Sbjct: 101805 tggaaaatttgcttctcctccatagcacagttgcctacagcaacacccatgcaaagaacc 101746

                                                                          
Query: 388    tttttcaactggaacttgacagtggccttggtctcattaaccttggactcaagggactcc 447
              |||||||  |||||||| || || ||||| ||||| ||||||||||||||||| || |||
Sbjct: 101745 tttttcagttggaacttcactgtagccttagtctcgttaaccttggactcaagtgattcc 101686

                                  
Query: 448    tggtgagacaccaaagttgg 467
              ||||||| |||||| |||||
Sbjct: 101685 tggtgagtcaccaacgttgg 101666



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                         
Query: 217    tagaacaaccggtacacctttcccattgtgctcttcaggtaca 259
              ||||||| ||||  ||| |||||||| ||||||||||||||||
Sbjct: 102289 tagaacacccggatcacttttcccatagtgctcttcaggtaca 102247



to top

>dbj|AP003287.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0679C12
          Length = 153666

 Score =  234 bits (118), Expect = 3e-58
 Identities = 154/166 (92%)
 Strand = Plus / Minus

                                                                         
Query: 470   actttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcct 529
             |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 63507 acttgcctgccttgttaagaccaggtccaagaagtcgaggaatctgcttaatgatggcct 63448

                                                                         
Query: 530   cagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgt 589
             |||||||||||||||| ||||| ||||||||||||||||| || ||||||||||||||||
Sbjct: 63447 cagatgcaaggaaagcgtgatatttctttgcaagcttcttaaccagcttcttgtttttgt 63388

                                                           
Query: 590   tcatcttcttcagcgattccacatccatacagtcaaggcccatttt 635
             |||||||||| || | ||||||||||||| |||| |||||||||||
Sbjct: 63387 tcatcttcttgagagcttccacatccatatagtctaggcccatttt 63342



 Score =  190 bits (96), Expect = 4e-45
 Identities = 174/200 (87%)
 Strand = Plus / Minus

                                                                         
Query: 268   acgttttgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttc 327
             ||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||| || 
Sbjct: 64198 acgttctgccaattcttcttcaaaagagagacaaggaagttcacgctcatttgcacattt 64139

                                                                         
Query: 328   tggaagatctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacc 387
             ||||| || ||||||||||||||| |   || ||| || ||||||||||||||||| |||
Sbjct: 64138 tggaaaatttgcttctcctccatagcacagttgcctacagcaacacccatgcaaagaacc 64079

                                                                         
Query: 388   tttttcaactggaacttgacagtggccttggtctcattaaccttggactcaagggactcc 447
             |||||||  |||||||| || || ||||| ||||| ||||||||||||||||| || |||
Sbjct: 64078 tttttcagttggaacttcactgtagccttagtctcgttaaccttggactcaagtgattcc 64019

                                 
Query: 448   tggtgagacaccaaagttgg 467
             ||||||| |||||| |||||
Sbjct: 64018 tggtgagtcaccaacgttgg 63999



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                        
Query: 217   tagaacaaccggtacacctttcccattgtgctcttcaggtaca 259
             ||||||| ||||  ||| |||||||| ||||||||||||||||
Sbjct: 64622 tagaacacccggatcacttttcccatagtgctcttcaggtaca 64580



to top

>ref|NM_190697.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 627

 Score =  228 bits (115), Expect = 2e-56
 Identities = 217/251 (86%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagaacaaccggtacacctttcccattgtgctcttcaggtacaggcaccgcacgttttgc 276
           ||||||| ||||  ||| |||||||| |||||||||||||||| ||| | |||||| |||
Sbjct: 626 tagaacacccggatcacttttcccatagtgctcttcaggtacaagcatctcacgttctgc 567

                                                                       
Query: 277 caattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctggaagatc 336
           |||||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || 
Sbjct: 566 caattcttcttcaaaagagagacaaggaagttcacgctcatttgcacattttggaaaatt 507

                                                                       
Query: 337 tgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacctttttcaac 396
           ||||||||||||||| |   || ||| || ||||||||||||||||| ||||||||||  
Sbjct: 506 tgcttctcctccatagcacagttgcctacagcaacacccatgcaaagaacctttttcagt 447

                                                                       
Query: 397 tggaacttgacagtggccttggtctcattaaccttggactcaagggactcctggtgagac 456
           |||||||| || || ||||| ||||| ||||||||||||||||| || |||||||||| |
Sbjct: 446 tggaacttcactgtagccttagtctcgttaaccttggactcaagtgattcctggtgagtc 387

                      
Query: 457 accaaagttgg 467
           ||||| |||||
Sbjct: 386 accaacgttgg 376



 Score =  202 bits (102), Expect = 1e-48
 Identities = 135/146 (92%)
 Strand = Plus / Minus

                                                                       
Query: 490 ccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatga 549
           ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||
Sbjct: 368 ccaggtccaagaagtcgaggaatctgcttaatgatggcctcagatgcaaggaaagcgtga 309

                                                                       
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcgattcc 609
           || ||||||||||||||||| || |||||||||||||||||||||||||| || | ||||
Sbjct: 308 tatttctttgcaagcttcttaaccagcttcttgtttttgttcatcttcttgagagcttcc 249

                                     
Query: 610 acatccatacagtcaaggcccatttt 635
           ||||||||| |||| |||||||||||
Sbjct: 248 acatccatatagtctaggcccatttt 223



to top

>ref|NM_179773.1| Arabidopsis thaliana structural constituent of ribosome AT2G27530
           transcript variant AT2G27530.2 mRNA, complete cds
          Length = 904

 Score =  226 bits (114), Expect = 7e-56
 Identities = 294/354 (83%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           |||||| |||||||||| |||||  ||||  ||||||||||||||||||||||| || ||
Sbjct: 695 tcccatggtgctcttcaagtacaaacaccttacgttttgccaattcttcttcaagagcga 636

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| || ||||||||||| |||||||||| ||||||||| |||||    ||
Sbjct: 635 gacgaggaagttaacactcatctgcacattctggaagagctgcttctcttccatggaaag 576

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||||||||| || || || || |||||||||||||| || || || ||
Sbjct: 575 gttaccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgcttt 516

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
           ||||||||| ||||| |  || |  ||||| ||||||  ||| |  ||||| ||||||||
Sbjct: 515 ggtctcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcc 456

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 455 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaagc 396

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| ||   ||| ||||||||||| || ||||||||||| |||||
Sbjct: 395 caagaaagcatggtaagacttagcaagcttcttaacaagcttcttgttcttgtt 342



to top

>ref|NM_128313.2| Arabidopsis thaliana structural constituent of ribosome AT2G27530
           transcript variant AT2G27530.1 mRNA, complete cds
          Length = 935

 Score =  226 bits (114), Expect = 7e-56
 Identities = 294/354 (83%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           |||||| |||||||||| |||||  ||||  ||||||||||||||||||||||| || ||
Sbjct: 726 tcccatggtgctcttcaagtacaaacaccttacgttttgccaattcttcttcaagagcga 667

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| || ||||||||||| |||||||||| ||||||||| |||||    ||
Sbjct: 666 gacgaggaagttaacactcatctgcacattctggaagagctgcttctcttccatggaaag 607

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||||||||| || || || || |||||||||||||| || || || ||
Sbjct: 606 gttaccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgcttt 547

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
           ||||||||| ||||| |  || |  ||||| ||||||  ||| |  ||||| ||||||||
Sbjct: 546 ggtctcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcc 487

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 486 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaagc 427

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| ||   ||| ||||||||||| || ||||||||||| |||||
Sbjct: 426 caagaaagcatggtaagacttagcaagcttcttaacaagcttcttgttcttgtt 373



to top

>gb|AY056371.1| Arabidopsis thaliana putative 60S ribosomal protein L10A
           (At2g27530) mRNA, complete cds
          Length = 682

 Score =  226 bits (114), Expect = 7e-56
 Identities = 294/354 (83%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           |||||| |||||||||| |||||  ||||  ||||||||||||||||||||||| || ||
Sbjct: 630 tcccatggtgctcttcaagtacaaacaccttacgttttgccaattcttcttcaagagcga 571

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| || ||||||||||| |||||||||| ||||||||| |||||    ||
Sbjct: 570 gacgaggaagttaacactcatctgcacattctggaagagctgcttctcttccatggaaag 511

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||||||||| || || || || |||||||||||||| || || || ||
Sbjct: 510 gttaccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgcttt 451

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
           ||||||||| ||||| |  || |  ||||| ||||||  ||| |  ||||| ||||||||
Sbjct: 450 ggtctcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcc 391

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 390 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaagc 331

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| ||   ||| ||||||||||| || ||||||||||| |||||
Sbjct: 330 caagaaagcatggtaagacttagcaagcttcttaacaagcttcttgttcttgtt 277



to top

>gb|AF360146.1| Arabidopsis thaliana putative 60S ribosomal protein L10A
           (At2g27530) mRNA, complete cds
          Length = 916

 Score =  226 bits (114), Expect = 7e-56
 Identities = 294/354 (83%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           |||||| |||||||||| |||||  ||||  ||||||||||||||||||||||| || ||
Sbjct: 691 tcccatggtgctcttcaagtacaaacaccttacgttttgccaattcttcttcaagagcga 632

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| || ||||||||||| |||||||||| ||||||||| |||||    ||
Sbjct: 631 gacgaggaagttaacactcatctgcacattctggaagagctgcttctcttccatggaaag 572

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||||||||| || || || || |||||||||||||| || || || ||
Sbjct: 571 gttaccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgcttt 512

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
           ||||||||| ||||| |  || |  ||||| ||||||  ||| |  ||||| ||||||||
Sbjct: 511 ggtctcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcc 452

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 451 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaagc 392

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| ||   ||| ||||||||||| || ||||||||||| |||||
Sbjct: 391 caagaaagcatggtaagacttagcaagcttcttaacaagcttcttgttcttgtt 338



to top

>gb|AY081263.1| Arabidopsis thaliana 60S ribosomal protein L10A (At2g27530) mRNA,
           complete cds
          Length = 891

 Score =  226 bits (114), Expect = 7e-56
 Identities = 294/354 (83%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           |||||| |||||||||| |||||  ||||  ||||||||||||||||||||||| || ||
Sbjct: 726 tcccatggtgctcttcaagtacaaacaccttacgttttgccaattcttcttcaagagcga 667

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| || ||||||||||| |||||||||| ||||||||| |||||    ||
Sbjct: 666 gacgaggaagttaacactcatctgcacattctggaagagctgcttctcttccatggaaag 607

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||||||||| || || || || |||||||||||||| || || || ||
Sbjct: 606 gttaccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgcttt 547

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
           ||||||||| ||||| |  || |  ||||| ||||||  ||| |  ||||| ||||||||
Sbjct: 546 ggtctcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcc 487

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 486 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaagc 427

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| ||   ||| ||||||||||| || ||||||||||| |||||
Sbjct: 426 caagaaagcatggtaagacttagcaagcttcttaacaagcttcttgttcttgtt 373



to top

>gb|BT006262.1| Arabidopsis thaliana At2g27530 mRNA, complete cds
          Length = 651

 Score =  226 bits (114), Expect = 7e-56
 Identities = 294/354 (83%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           |||||| |||||||||| |||||  ||||  ||||||||||||||||||||||| || ||
Sbjct: 630 tcccatggtgctcttcaagtacaaacaccttacgttttgccaattcttcttcaagagcga 571

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| || ||||||||||| |||||||||| ||||||||| |||||    ||
Sbjct: 570 gacgaggaagttaacactcatctgcacattctggaagagctgcttctcttccatggaaag 511

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||||||||| || || || || |||||||||||||| || || || ||
Sbjct: 510 gttaccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgcttt 451

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
           ||||||||| ||||| |  || |  ||||| ||||||  ||| |  ||||| ||||||||
Sbjct: 450 ggtctcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcc 391

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 390 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaagc 331

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| ||   ||| ||||||||||| || ||||||||||| |||||
Sbjct: 330 caagaaagcatggtaagacttagcaagcttcttaacaagcttcttgttcttgtt 277



to top

>gb|AY846821.1| Triticum aestivum ribosomal protein L10A mRNA, complete cds
          Length = 788

 Score =  226 bits (114), Expect = 7e-56
 Identities = 327/398 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           ||||| |||||||||| ||||||||||| ||| || ||||||||||||||||  || || 
Sbjct: 700 cccatggtgctcttcacgtacaggcacctcacattctgccaattcttcttcaggagggac 641

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           ||||||||||| || ||||| || | ||| ||   |||||||||||| |||||   || |
Sbjct: 640 acaaggaagttgacactcatttggatgttttgttggatctgcttctcgtccatcgacaag 581

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           | ||| || ||||||||||||||||| ||||| || | |||||||||||| || || || 
Sbjct: 580 ttgcccacagcaacacccatgcaaagaaccttctttagctggaacttgactgtagctttt 521

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           ||||| || |||||||  ||||| || |||||||||   |||| ||| |||||||| |||
Sbjct: 520 gtctcgttgaccttggcttcaagagattcctggtgactaaccagagtgggaaacttgcct 461

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           ||||||||||||||||| ||||| || || || |||||||| || || ||||| ||||| 
Sbjct: 460 gccttgttaagaccagggccaaggagacgagggatctgcttgattatggcctctgatgcc 401

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           | ||||||||| |||||||| || |||||||| || ||||||||||| ||||||||||||
Sbjct: 400 aagaaagcatggtacttcttggctagcttcttaacaagcttcttgttcttgttcatcttc 341

                                                 
Query: 598 ttcagcgattccacatccatacagtcaaggcccatttt 635
           || ||   ||| ||||||||  ||||||| ||||||||
Sbjct: 340 ttgagactttcaacatccatgtagtcaagtcccatttt 303



to top

>ref|XM_483761.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 937

 Score =  218 bits (110), Expect = 2e-53
 Identities = 299/362 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           ||||| |||||||| | ||| ||||||| ||| || ||||| ||||| ||||| || || 
Sbjct: 699 cccatggtgctcttgatgtaaaggcacctcacattctgccagttctttttcaaaagggac 640

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           || |||||||| |||||||| || | ||| ||   ||||||||||||||||||   || |
Sbjct: 639 acgaggaagttgacgctcatttggatgttttgctggatctgcttctcctccattgacaag 580

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           |  || || |||||||||||||| || ||||| |||| |||||||||||| || || || 
Sbjct: 579 ttacccacagcaacacccatgcacagaaccttcttcagctggaacttgactgtagctttc 520

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           ||||| || |||||||| ||||| |||||||||||||  ||||| || || ||||| |||
Sbjct: 519 gtctcgttgaccttggattcaagagactcctggtgagtaaccaatgtagggaacttgcct 460

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| ||||| || || ||||||||||| ||||| ||||| ||||| 
Sbjct: 459 gccttgttgagaccaggaccaaggagacgaggaatctgcttgatgatggcctctgatgct 400

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           | ||||||||| |||||||| ||||||||||| || ||||||||||| |||||||| |||
Sbjct: 399 aagaaagcatggtacttcttggcaagcttcttaaccagcttcttgttcttgttcattttc 340

             
Query: 598 tt 599
           ||
Sbjct: 339 tt 338



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  218 bits (110), Expect = 2e-53
 Identities = 152/166 (91%)
 Strand = Plus / Minus

                                                                            
Query: 470      actttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcct 529
                |||| ||||| |||||||||||||| ||||||||||| ||||||||||| ||||||||||
Sbjct: 12870451 acttgcctgctttgttaagaccaggaccaagaagtcgaggaatctgcttgatgatagcct 12870392

                                                                            
Query: 530      cagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgt 589
                |||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||
Sbjct: 12870391 cagaagcaaggaaagcatgatatttctttgcaagcttcttaactagcttcttgtttttgt 12870332

                                                              
Query: 590      tcatcttcttcagcgattccacatccatacagtcaaggcccatttt 635
                |||| ||||| || | ||||||||||||| |||| |||||||||||
Sbjct: 12870331 tcattttcttgagggcttccacatccatatagtctaggcccatttt 12870286



 Score =  182 bits (92), Expect = 9e-43
 Identities = 173/200 (86%)
 Strand = Plus / Minus

                                                                            
Query: 268      acgttttgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttc 327
                ||||| ||||||||||||||||| || || |||||||||||||||||||||||||| || 
Sbjct: 12871060 acgttctgccaattcttcttcaaaagggaaacaaggaagttcacgctcatctgcacattt 12871001

                                                                            
Query: 328      tggaagatctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacc 387
                |||||||||||||||||||||||| |   || |||||| |||||||||||||| || |||
Sbjct: 12871000 tggaagatctgcttctcctccatagcacagttgccaacagcaacacccatgcagagaacc 12870941

                                                                            
Query: 388      tttttcaactggaacttgacagtggccttggtctcattaaccttggactcaagggactcc 447
                || |||| |||||| || || || ||||| ||||||||||||||||||||||| || |||
Sbjct: 12870940 ttcttcagctggaatttcactgtagccttagtctcattaaccttggactcaagtgattcc 12870881

                                    
Query: 448      tggtgagacaccaaagttgg 467
                || || | ||||| ||||||
Sbjct: 12870880 tgatgcgtcaccagagttgg 12870861



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                 
Query: 217      tagaacaaccggtacacctttcccattgtgctcttcaggtacaggcacc 265
                |||||||  ||||||||||||||||| |||||||||||||||| |||||
Sbjct: 12871218 tagaacactcggtacacctttcccatggtgctcttcaggtacaagcacc 12871170



to top

>emb|BX818761.1|CNS0A9SM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZC01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 850

 Score =  218 bits (110), Expect = 2e-53
 Identities = 293/354 (82%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           |||||| |||||||||| |||||  ||||  ||||||||||||||||||||||| || ||
Sbjct: 669 tcccatggtgctcttcaagtacaaacaccttacgttttgccaattcttcttcaagagcga 610

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| |  ||||||||||| |||||||||| ||||||||| |||||    ||
Sbjct: 609 gacgaggaagttaaaactcatctgcacattctggaagagctgcttctcttccatggaaag 550

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||||||||| || || || || |||||||||||||| || || || ||
Sbjct: 549 gttaccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgcttt 490

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
           ||||||||| ||||| |  || |  ||||| ||||||  ||| |  ||||| ||||||||
Sbjct: 489 ggtctcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcc 430

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           |||||||||||||||||| |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 429 tgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaagc 370

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| ||   ||| ||||||||||| || ||||||||||| |||||
Sbjct: 369 caagaaagcatggtaagacttagcaagcttcttaacaagcttcttgttcttgtt 316



to top

>emb|BX820970.1|CNS0A84X Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZC06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 840

 Score =  218 bits (110), Expect = 2e-53
 Identities = 293/354 (82%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
           |||||| |||||||||| |||||  ||||  ||||||||||||||||||||||| || ||
Sbjct: 669 tcccatggtgctcttcaagtacaaacaccttacgttttgccaattcttcttcaagagcga 610

                                                                       
Query: 297 gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
           ||| |||||||| || ||||||||||| |||||||||| ||||||||| |||||    ||
Sbjct: 609 gacgaggaagttaacactcatctgcacattctggaagagctgcttctcttccatggaaag 550

                                                                       
Query: 357 gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
           ||  ||||| ||||||||||| || || || || |||||||||||||| || || || ||
Sbjct: 549 gttaccaacagcaacacccatacacagaactttcttcaactggaacttcactgttgcttt 490

                                                                       
Query: 417 ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
           ||||||||| ||||| |  || |  ||||| ||||||  ||| |  ||||| ||||||||
Sbjct: 489 ggtctcattcacctttgcttccaatgactcttggtgactcacaagtgttgggaactttcc 430

                                                                       
Query: 477 tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
           ||||||||||||||| || |||||||| || |||||||||||||||| || |||||| ||
Sbjct: 429 tgccttgttaagaccgggaccaagaagacgaggaatctgcttaatgacagactcagaagc 370

                                                                 
Query: 537 aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
            | ||||||||| ||   ||| ||||||||||| || ||||||||||| |||||
Sbjct: 369 caagaaagcatggtaagacttagcaagcttcttaacaagcttcttgttcttgtt 316



to top

>dbj|AP005612.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0073A18
          Length = 176755

 Score =  218 bits (110), Expect = 2e-53
 Identities = 152/166 (91%)
 Strand = Plus / Minus

                                                                         
Query: 470   actttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcct 529
             |||| ||||| |||||||||||||| ||||||||||| ||||||||||| ||||||||||
Sbjct: 89933 acttgcctgctttgttaagaccaggaccaagaagtcgaggaatctgcttgatgatagcct 89874

                                                                         
Query: 530   cagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgt 589
             |||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||
Sbjct: 89873 cagaagcaaggaaagcatgatatttctttgcaagcttcttaactagcttcttgtttttgt 89814

                                                           
Query: 590   tcatcttcttcagcgattccacatccatacagtcaaggcccatttt 635
             |||| ||||| || | ||||||||||||| |||| |||||||||||
Sbjct: 89813 tcattttcttgagggcttccacatccatatagtctaggcccatttt 89768



 Score =  182 bits (92), Expect = 9e-43
 Identities = 173/200 (86%)
 Strand = Plus / Minus

                                                                         
Query: 268   acgttttgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttc 327
             ||||| ||||||||||||||||| || || |||||||||||||||||||||||||| || 
Sbjct: 90542 acgttctgccaattcttcttcaaaagggaaacaaggaagttcacgctcatctgcacattt 90483

                                                                         
Query: 328   tggaagatctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacc 387
             |||||||||||||||||||||||| |   || |||||| |||||||||||||| || |||
Sbjct: 90482 tggaagatctgcttctcctccatagcacagttgccaacagcaacacccatgcagagaacc 90423

                                                                         
Query: 388   tttttcaactggaacttgacagtggccttggtctcattaaccttggactcaagggactcc 447
             || |||| |||||| || || || ||||| ||||||||||||||||||||||| || |||
Sbjct: 90422 ttcttcagctggaatttcactgtagccttagtctcattaaccttggactcaagtgattcc 90363

                                 
Query: 448   tggtgagacaccaaagttgg 467
             || || | ||||| ||||||
Sbjct: 90362 tgatgcgtcaccagagttgg 90343



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                              
Query: 217   tagaacaaccggtacacctttcccattgtgctcttcaggtacaggcacc 265
             |||||||  ||||||||||||||||| |||||||||||||||| |||||
Sbjct: 90700 tagaacactcggtacacctttcccatggtgctcttcaggtacaagcacc 90652



to top

>dbj|AK122095.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033125C22, full
           insert sequence
          Length = 937

 Score =  218 bits (110), Expect = 2e-53
 Identities = 299/362 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           ||||| |||||||| | ||| ||||||| ||| || ||||| ||||| ||||| || || 
Sbjct: 699 cccatggtgctcttgatgtaaaggcacctcacattctgccagttctttttcaaaagggac 640

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           || |||||||| |||||||| || | ||| ||   ||||||||||||||||||   || |
Sbjct: 639 acgaggaagttgacgctcatttggatgttttgctggatctgcttctcctccattgacaag 580

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           |  || || |||||||||||||| || ||||| |||| |||||||||||| || || || 
Sbjct: 579 ttacccacagcaacacccatgcacagaaccttcttcagctggaacttgactgtagctttc 520

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           ||||| || |||||||| ||||| |||||||||||||  ||||| || || ||||| |||
Sbjct: 519 gtctcgttgaccttggattcaagagactcctggtgagtaaccaatgtagggaacttgcct 460

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| ||||| || || ||||||||||| ||||| ||||| ||||| 
Sbjct: 459 gccttgttgagaccaggaccaaggagacgaggaatctgcttgatgatggcctctgatgct 400

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           | ||||||||| |||||||| ||||||||||| || ||||||||||| |||||||| |||
Sbjct: 399 aagaaagcatggtacttcttggcaagcttcttaaccagcttcttgttcttgttcattttc 340

             
Query: 598 tt 599
           ||
Sbjct: 339 tt 338



to top

>dbj|AK071249.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088C14, full
           insert sequence
          Length = 982

 Score =  218 bits (110), Expect = 2e-53
 Identities = 299/362 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           ||||| |||||||| | ||| ||||||| ||| || ||||| ||||| ||||| || || 
Sbjct: 771 cccatggtgctcttgatgtaaaggcacctcacattctgccagttctttttcaaaagggac 712

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           || |||||||| |||||||| || | ||| ||   ||||||||||||||||||   || |
Sbjct: 711 acgaggaagttgacgctcatttggatgttttgctggatctgcttctcctccattgacaag 652

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           |  || || |||||||||||||| || ||||| |||| |||||||||||| || || || 
Sbjct: 651 ttacccacagcaacacccatgcacagaaccttcttcagctggaacttgactgtagctttc 592

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           ||||| || |||||||| ||||| |||||||||||||  ||||| || || ||||| |||
Sbjct: 591 gtctcgttgaccttggattcaagagactcctggtgagtaaccaatgtagggaacttgcct 532

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| ||||| || || ||||||||||| ||||| ||||| ||||| 
Sbjct: 531 gccttgttgagaccaggaccaaggagacgaggaatctgcttgatgatggcctctgatgct 472

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           | ||||||||| |||||||| ||||||||||| || ||||||||||| |||||||| |||
Sbjct: 471 aagaaagcatggtacttcttggcaagcttcttaaccagcttcttgttcttgttcattttc 412

             
Query: 598 tt 599
           ||
Sbjct: 411 tt 410



to top

>gb|BT012985.1| Lycopersicon esculentum clone 114201R, mRNA sequence
          Length = 895

 Score =  212 bits (107), Expect = 1e-51
 Identities = 287/347 (82%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           ||||| |||||||||| ||||| |||||  ||||| |||||||||||||| |  ||||| 
Sbjct: 712 cccatggtgctcttcaagtacaagcaccttacgttctgccaattcttctttagaagagaa 653

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           || | ||||||||||||||| ||||| ||||||||||| || ||||| |||||| |    
Sbjct: 652 actaagaagttcacgctcatttgcacattctggaagatttgtttctcttccatatcacaa 593

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           |  ||||| ||||||||||||||||||||||| ||||||||||||||||  || ||||||
Sbjct: 592 ttaccaacagcaacacccatgcaaagcaccttcttcaactggaacttgatggtagccttg 533

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           || ||||||||||| ||||| || ||||| ||||| || || |  ||||||||||| |||
Sbjct: 532 gtttcattaaccttagactcgagtgactcttggtgggaaacaagggttggaaacttacct 473

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| || |  || || ||||||||||| ||||  |  || || || 
Sbjct: 472 gccttgttcagaccaggacccaagagacgaggaatctgcttgatgacggattctgaagcc 413

                                                          
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtt 584
           | ||||||||| || ||||||||||||||||| |||| |||||||||
Sbjct: 412 aagaaagcatggtatttctttgcaagcttcttaactaacttcttgtt 366



to top

>gb|AY104248.1| Zea mays PCO114889 mRNA sequence
          Length = 1019

 Score =  204 bits (103), Expect = 3e-49
 Identities = 295/359 (82%)
 Strand = Plus / Minus

                                                                       
Query: 274 tgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctggaag 333
           ||||| ||||||||||  ||||| || |||||||| | ||||||||| | ||||||   |
Sbjct: 663 tgccagttcttcttcagaagagacacgaggaagttgatgctcatctggatgttctgttgg 604

                                                                       
Query: 334 atctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacctttttc 393
           ||||||||||||||||||  |||||  || || || |||||||||||||| || || |||
Sbjct: 603 atctgcttctcctccatagacaggttaccgaccgcgacacccatgcaaaggactttcttc 544

                                                                       
Query: 394 aactggaacttgacagtggccttggtctcattaaccttggactcaagggactcctggtga 453
           |  || |||||||| || ||||| |||||||| |||||||| || ||||| |||||||||
Sbjct: 543 agttgaaacttgactgtagccttcgtctcattcaccttggattccagggattcctggtga 484

                                                                       
Query: 454 gacaccaaagttggaaactttcctgccttgttaagaccaggtccaagaagtcggggaatc 513
           |  |||| ||| || ||||| ||||||||||| |||||||| ||||| || |||||||| 
Sbjct: 483 gtgaccagagtggggaacttgcctgccttgttgagaccaggaccaaggagacggggaatt 424

                                                                       
Query: 514 tgcttaatgatagcctcagatgcaaggaaagcatgatacttctttgcaagcttcttgact 573
           ||||| ||||| | ||| ||||| |  |||||||| |||||||| ||||||||||| || 
Sbjct: 423 tgcttgatgatggtctctgatgccaaaaaagcatggtacttcttggcaagcttcttaaca 364

                                                                      
Query: 574 agcttcttgtttttgttcatcttcttcagcgattccacatccatacagtcaaggcccat 632
           ||||||||||| |||||||| ||||| || |  || ||||||||  ||||||| |||||
Sbjct: 363 agcttcttgttcttgttcattttcttgagggcctcaacatccatgtagtcaagtcccat 305



to top

>ref|NM_122149.3| Arabidopsis thaliana structural constituent of ribosome AT5G22440
           mRNA, complete cds
          Length = 900

 Score =  192 bits (97), Expect = 1e-45
 Identities = 310/381 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           |||||||||||||||| ||||| ||||| ||| |||||||| || |||||||| ||||| 
Sbjct: 675 cccattgtgctcttcaagtacaagcacctcacattttgccagtttttcttcaagagagaa 616

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           || |||||||| || |||||||| || || || ||||||||||||||||||||    || 
Sbjct: 615 acgaggaagttaacactcatctgaacattttgaaagatctgcttctcctccatggaaaga 556

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           |  || || ||||| ||||| || || ||||| || | ||||||||| || || ||||| 
Sbjct: 555 ttaccgacagcaactcccatacatagaaccttcttgagctggaacttcactgttgccttt 496

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           |||||||| || ||||| || |  ||||| |||||    || | |||||| || ||||||
Sbjct: 495 gtctcattcactttggattccaaagactcttggtggctaacaagagttgggaattttcct 436

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || |||||||||||||||| ||  ||||| |||
Sbjct: 435 gccttgttgagaccaggaccaagaagacgaggaatctgcttaatgacagattcagaagca 376

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           |||||||||||  | ||||| ||||||||||| || || |||||||| ||||||| ||||
Sbjct: 375 aggaaagcatggaatttcttagcaagcttcttaacaagtttcttgttcttgttcaacttc 316

                                
Query: 598 ttcagcgattccacatccata 618
           || || | ||| |||||||||
Sbjct: 315 ttaagagcttcaacatccata 295



to top

>gb|AY077657.1| Arabidopsis thaliana AT5g22440/MWD9_24 mRNA, complete cds
          Length = 654

 Score =  192 bits (97), Expect = 1e-45
 Identities = 310/381 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           |||||||||||||||| ||||| ||||| ||| |||||||| || |||||||| ||||| 
Sbjct: 632 cccattgtgctcttcaagtacaagcacctcacattttgccagtttttcttcaagagagaa 573

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           || |||||||| || |||||||| || || || ||||||||||||||||||||    || 
Sbjct: 572 acgaggaagttaacactcatctgaacattttgaaagatctgcttctcctccatggaaaga 513

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           |  || || ||||| ||||| || || ||||| || | ||||||||| || || ||||| 
Sbjct: 512 ttaccgacagcaactcccatacatagaaccttcttgagctggaacttcactgttgccttt 453

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           |||||||| || ||||| || |  ||||| |||||    || | |||||| || ||||||
Sbjct: 452 gtctcattcactttggattccaaagactcttggtggctaacaagagttgggaattttcct 393

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || |||||||||||||||| ||  ||||| |||
Sbjct: 392 gccttgttgagaccaggaccaagaagacgaggaatctgcttaatgacagattcagaagca 333

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           |||||||||||  | ||||| ||||||||||| || || |||||||| ||||||| ||||
Sbjct: 332 aggaaagcatggaatttcttagcaagcttcttaacaagtttcttgttcttgttcaacttc 273

                                
Query: 598 ttcagcgattccacatccata 618
           || || | ||| |||||||||
Sbjct: 272 ttaagagcttcaacatccata 252



to top

>gb|AY037253.1| Arabidopsis thaliana AT5g22440/MWD9_24 mRNA, complete cds
          Length = 864

 Score =  192 bits (97), Expect = 1e-45
 Identities = 310/381 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           |||||||||||||||| ||||| ||||| ||| |||||||| || |||||||| ||||| 
Sbjct: 673 cccattgtgctcttcaagtacaagcacctcacattttgccagtttttcttcaagagagaa 614

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           || |||||||| || |||||||| || || || ||||||||||||||||||||    || 
Sbjct: 613 acgaggaagttaacactcatctgaacattttgaaagatctgcttctcctccatggaaaga 554

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           |  || || ||||| ||||| || || ||||| || | ||||||||| || || ||||| 
Sbjct: 553 ttaccgacagcaactcccatacatagaaccttcttgagctggaacttcactgttgccttt 494

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           |||||||| || ||||| || |  ||||| |||||    || | |||||| || ||||||
Sbjct: 493 gtctcattcactttggattccaaagactcttggtggctaacaagagttgggaattttcct 434

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || |||||||||||||||| ||  ||||| |||
Sbjct: 433 gccttgttgagaccaggaccaagaagacgaggaatctgcttaatgacagattcagaagca 374

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           |||||||||||  | ||||| ||||||||||| || || |||||||| ||||||| ||||
Sbjct: 373 aggaaagcatggaatttcttagcaagcttcttaacaagtttcttgttcttgttcaacttc 314

                                
Query: 598 ttcagcgattccacatccata 618
           || || | ||| |||||||||
Sbjct: 313 ttaagagcttcaacatccata 293



to top

>emb|BX829886.1|CNS0A1EM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB43ZE02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 883

 Score =  192 bits (97), Expect = 1e-45
 Identities = 310/381 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 cccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagagag 297
           |||||||||||||||| ||||| ||||| ||| |||||||| || |||||||| ||||| 
Sbjct: 658 cccattgtgctcttcaagtacaagcacctcacattttgccagtttttcttcaagagagaa 599

                                                                       
Query: 298 acaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccagg 357
           || |||||||| || |||||||| || || || ||||||||||||||||||||    || 
Sbjct: 598 acgaggaagttaacactcatctgaacattttgaaagatctgcttctcctccatggaaaga 539

                                                                       
Query: 358 tggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggccttg 417
           |  || || ||||| ||||| || || ||||| || | ||||||||| || || ||||| 
Sbjct: 538 ttaccgacagcaactcccatacatagaaccttcttgagctggaacttcactgttgccttt 479

                                                                       
Query: 418 gtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcct 477
           |||||||| || ||||| || |  ||||| |||||    || | |||||| || ||||||
Sbjct: 478 gtctcattcactttggattccaaagactcttggtggctaacaagagttgggaattttcct 419

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || |||||||||||||||| ||  ||||| |||
Sbjct: 418 gccttgttgagaccaggaccaagaagacgaggaatctgcttaatgacagattcagaagca 359

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           |||||||||||  | ||||| ||||||||||| || || |||||||| ||||||| ||||
Sbjct: 358 aggaaagcatggaatttcttagcaagcttcttaacaagtttcttgttcttgttcaacttc 299

                                
Query: 598 ttcagcgattccacatccata 618
           || || | ||| |||||||||
Sbjct: 298 ttaagagcttcaacatccata 278



to top

>emb|BX832559.1|CNS0A14N Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH80ZB10 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1299

 Score =  178 bits (90), Expect = 1e-41
 Identities = 310/382 (81%), Gaps = 1/382 (0%)
 Strand = Plus / Minus

                                                                        
Query: 238  cccattgtgctcttcaggtacaggcaccg-cacgttttgccaattcttcttcaacagaga 296
            |||||||||||||||| ||||| |||||  ||| |||||||| || |||||||| |||||
Sbjct: 1006 cccattgtgctcttcaagtacaagcaccatcacattttgccagtttttcttcaagagaga 947

                                                                        
Query: 297  gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
             || |||||||| || |||||||| || || || ||||||||||||||||||||    ||
Sbjct: 946  aacgaggaagttaacactcatctgaacattttgaaagatctgcttctcctccatggaaag 887

                                                                        
Query: 357  gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
             |  || || ||||| ||||| || || ||||| || | ||||||||| || || |||||
Sbjct: 886  attaccgacagcaactcccatacatagaaccttcttgagctggaacttcactgttgcctt 827

                                                                        
Query: 417  ggtctcattaaccttggactcaagggactcctggtgagacaccaaagttggaaactttcc 476
             |||||||| || ||||| || |  ||||| |||||    || | |||||| || |||||
Sbjct: 826  tgtctcattcactttggattccaaagactcttggtggctaacaagagttgggaattttcc 767

                                                                        
Query: 477  tgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgc 536
            ||||||||| |||||||| |||||||| || |||||||||||||||| ||  ||||| ||
Sbjct: 766  tgccttgttgagaccaggaccaagaagacgaggaatctgcttaatgacagattcagaagc 707

                                                                        
Query: 537  aaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatctt 596
            ||||||||||||  | ||||| ||||||||||| || || |||||||| ||||||| |||
Sbjct: 706  aaggaaagcatggaatttcttagcaagcttcttaacaagtttcttgttcttgttcaactt 647

                                  
Query: 597  cttcagcgattccacatccata 618
            ||| || | ||| |||||||||
Sbjct: 646  cttaagagcttcaacatccata 625



to top

>gb|DQ226619.1| Boechera divaricarpa isolate SLW-4-A06 mRNA sequence
          Length = 634

 Score =  153 bits (77), Expect = 8e-34
 Identities = 266/329 (80%)
 Strand = Plus / Minus

                                                                       
Query: 271 ttttgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctgg 330
           |||||||| || |||||||| || || || |||||||| || |||||||| || ||||| 
Sbjct: 626 ttttgccagtttttcttcaagagtgaaacgaggaagttaacactcatctgaacattctga 567

                                                                       
Query: 331 aagatctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcaccttt 390
           |||||||||||||| |||||    || |  || || ||||| ||||| ||||| ||||| 
Sbjct: 566 aagatctgcttctcttccatggaaagattacccacagcaactcccatacaaagaaccttc 507

                                                                       
Query: 391 ttcaactggaacttgacagtggccttggtctcattaaccttggactcaagggactcctgg 450
           || | ||||||||| || || ||||| |||||||| || ||||  || |  ||||| |||
Sbjct: 506 ttgagctggaacttcactgttgcctttgtctcattcactttggcttccaacgactcttgg 447

                                                                       
Query: 451 tgagacaccaaagttggaaactttcctgccttgttaagaccaggtccaagaagtcgggga 510
           ||    || | |||||| ||||||||||||||||| ||||| || |||||||| || |||
Sbjct: 446 tggctaacaagagttgggaactttcctgccttgttgagaccgggaccaagaagacgagga 387

                                                                       
Query: 511 atctgcttaatgatagcctcagatgcaaggaaagcatgatacttctttgcaagcttcttg 570
           ||||||||||||| ||  ||||| ||||||||||||||  ||||||| ||||||||||| 
Sbjct: 386 atctgcttaatgacagattcagaagcaaggaaagcatggaacttcttagcaagcttctta 327

                                        
Query: 571 actagcttcttgtttttgttcatcttctt 599
           || || |||||||| ||||||| ||||||
Sbjct: 326 acaagtttcttgttcttgttcaacttctt 298



to top

>gb|AC006932.8|AC006932 Genomic sequence for Arabidopsis thaliana BAC T27G7 from chromosome I,
             complete sequence
          Length = 89479

 Score =  143 bits (72), Expect = 8e-31
 Identities = 180/216 (83%)
 Strand = Plus / Minus

                                                                         
Query: 237   tcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttcaacagaga 296
             ||||||||||||||| |||||||  ||||  || |||||||| ||||||||||| || ||
Sbjct: 18507 tcccattgtgctcttgaggtacaaacacctgacattttgccagttcttcttcaatagcga 18448

                                                                         
Query: 297   gacaaggaagttcacgctcatctgcacgttctggaagatctgcttctcctccatacccag 356
             ||| |||||||| |||||||||||||| ||||| |||||||||||||| |||||    ||
Sbjct: 18447 gacgaggaagttgacgctcatctgcacattctgaaagatctgcttctcttccattgaaag 18388

                                                                         
Query: 357   gtggccaacggcaacacccatgcaaagcacctttttcaactggaacttgacagtggcctt 416
             ||  ||||| ||||| |||||||| || ||||| |||| ||||||||| || || |||||
Sbjct: 18387 gttaccaactgcaactcccatgcacagaaccttcttcagctggaacttcactgttgcctt 18328

                                                 
Query: 417   ggtctcattaaccttggactcaagggactcctggtg 452
              || ||||| ||||| ||||| | ||| ||||||||
Sbjct: 18327 tgtttcattcacctttgactccaaggattcctggtg 18292



 Score =  131 bits (66), Expect = 3e-27
 Identities = 108/122 (88%)
 Strand = Plus / Minus

                                                                         
Query: 469   aactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcc 528
             ||||| |||||||||||||||||||| |||||||| || |||||||||||||||| || |
Sbjct: 18093 aacttgcctgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagac 18034

                                                                         
Query: 529   tcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttg 588
             ||||| || | ||||||||| || |||||||||||||||||||| || |||||||| |||
Sbjct: 18033 tcagaggccaagaaagcatggtatttctttgcaagcttcttgacgagtttcttgttcttg 17974

               
Query: 589   tt 590
             ||
Sbjct: 17973 tt 17972



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  131 bits (66), Expect = 3e-27
 Identities = 114/130 (87%)
 Strand = Plus / Minus

                                                                            
Query: 470      actttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcct 529
                |||| ||||||||||| |||||||| ||||| || ||||| |||||||| ||||| ||||
Sbjct: 27923540 acttgcctgccttgtttagaccaggaccaaggagacgggggatctgcttgatgatggcct 27923481

                                                                            
Query: 530      cagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgt 589
                | ||||| | ||||||||| |||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 27923480 ctgatgctaagaaagcatggtacttcttggcaagcttcttcacaagcttcttgttcttgt 27923421

                          
Query: 590      tcatcttctt 599
                ||||||||||
Sbjct: 27923420 tcatcttctt 27923411



 Score =  123 bits (62), Expect = 7e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                            
Query: 470      actttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcct 529
                |||| ||||||||||| |||||||| ||||| || || ||||||||||| ||||| ||||
Sbjct: 27957171 acttgcctgccttgttgagaccaggaccaaggagacgaggaatctgcttgatgatggcct 27957112

                                                                            
Query: 530      cagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgt 589
                | ||||| | ||||||||| |||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 27957111 ctgatgctaagaaagcatggtacttcttggcaagcttcttaaccagcttcttgttcttgt 27957052

                          
Query: 590      tcatcttctt 599
                |||| |||||
Sbjct: 27957051 tcattttctt 27957042



 Score =  107 bits (54), Expect = 4e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                            
Query: 274      tgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctggaag 333
                ||||| ||||||||||| || || || |||||||| |||||||| || | ||| ||   |
Sbjct: 27924075 tgccagttcttcttcaaaagggacacgaggaagttgacgctcatttggatgttttgctgg 27924016

                                                                            
Query: 334      atctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacctttttc 393
                |||||||||||||||||   || ||  || || |||||||||||||| || ||||| |||
Sbjct: 27924015 atctgcttctcctccatcgacaagttacccacagcaacacccatgcacagaaccttcttc 27923956

                                                                            
Query: 394      aactggaacttgacagtggccttggtctcattaaccttggactcaagggactcctggtga 453
                | |||||||||||| || || || |||||||| |||||||| ||||| ||||||||||||
Sbjct: 27923955 agctggaacttgactgtagctttcgtctcattgaccttggattcaagagactcctggtga 27923896

                                          
Query: 454      gacaccaaagttggaaactttcctgc 479
                |  ||||| || || ||||| |||||
Sbjct: 27923895 gtaaccaatgtagggaacttgcctgc 27923870



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 166/206 (80%)
 Strand = Plus / Minus

                                                                            
Query: 274      tgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctggaag 333
                ||||| ||||| ||||| || || || |||||||| |||||||| || | ||| ||   |
Sbjct: 27957803 tgccagttctttttcaaaagggacacgaggaagttgacgctcatttggatgttttgctgg 27957744

                                                                            
Query: 334      atctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacctttttc 393
                |||||||||||||||||   || ||  || || |||||||||||||| || ||||| |||
Sbjct: 27957743 atctgcttctcctccattgacaagttacccacagcaacacccatgcacagaaccttcttc 27957684

                                                                            
Query: 394      aactggaacttgacagtggccttggtctcattaaccttggactcaagggactcctggtga 453
                | |||||||||||| || || || ||||| || |||||||| ||||| ||||||||||||
Sbjct: 27957683 agctggaacttgactgtagctttcgtctcgttgaccttggattcaagagactcctggtga 27957624

                                          
Query: 454      gacaccaaagttggaaactttcctgc 479
                |  ||||| || || ||||| |||||
Sbjct: 27957623 gtaaccaatgtagggaacttgcctgc 27957598



to top

>dbj|AP005524.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
            clone:P0562A06
          Length = 154198

 Score =  131 bits (66), Expect = 3e-27
 Identities = 114/130 (87%)
 Strand = Plus / Minus

                                                                        
Query: 470  actttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcct 529
            |||| ||||||||||| |||||||| ||||| || ||||| |||||||| ||||| ||||
Sbjct: 1032 acttgcctgccttgtttagaccaggaccaaggagacgggggatctgcttgatgatggcct 973

                                                                        
Query: 530  cagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgt 589
            | ||||| | ||||||||| |||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 972  ctgatgctaagaaagcatggtacttcttggcaagcttcttcacaagcttcttgttcttgt 913

                      
Query: 590  tcatcttctt 599
            ||||||||||
Sbjct: 912  tcatcttctt 903



 Score =  123 bits (62), Expect = 7e-25
 Identities = 113/130 (86%)
 Strand = Plus / Minus

                                                                         
Query: 470   actttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcct 529
             |||| ||||||||||| |||||||| ||||| || || ||||||||||| ||||| ||||
Sbjct: 34663 acttgcctgccttgttgagaccaggaccaaggagacgaggaatctgcttgatgatggcct 34604

                                                                         
Query: 530   cagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgt 589
             | ||||| | ||||||||| |||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 34603 ctgatgctaagaaagcatggtacttcttggcaagcttcttaaccagcttcttgttcttgt 34544

                       
Query: 590   tcatcttctt 599
             |||| |||||
Sbjct: 34543 tcattttctt 34534



 Score =  107 bits (54), Expect = 4e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                        
Query: 274  tgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctggaag 333
            ||||| ||||||||||| || || || |||||||| |||||||| || | ||| ||   |
Sbjct: 1567 tgccagttcttcttcaaaagggacacgaggaagttgacgctcatttggatgttttgctgg 1508

                                                                        
Query: 334  atctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacctttttc 393
            |||||||||||||||||   || ||  || || |||||||||||||| || ||||| |||
Sbjct: 1507 atctgcttctcctccatcgacaagttacccacagcaacacccatgcacagaaccttcttc 1448

                                                                        
Query: 394  aactggaacttgacagtggccttggtctcattaaccttggactcaagggactcctggtga 453
            | |||||||||||| || || || |||||||| |||||||| ||||| ||||||||||||
Sbjct: 1447 agctggaacttgactgtagctttcgtctcattgaccttggattcaagagactcctggtga 1388

                                      
Query: 454  gacaccaaagttggaaactttcctgc 479
            |  ||||| || || ||||| |||||
Sbjct: 1387 gtaaccaatgtagggaacttgcctgc 1362



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 166/206 (80%)
 Strand = Plus / Minus

                                                                         
Query: 274   tgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctggaag 333
             ||||| ||||| ||||| || || || |||||||| |||||||| || | ||| ||   |
Sbjct: 35295 tgccagttctttttcaaaagggacacgaggaagttgacgctcatttggatgttttgctgg 35236

                                                                         
Query: 334   atctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacctttttc 393
             |||||||||||||||||   || ||  || || |||||||||||||| || ||||| |||
Sbjct: 35235 atctgcttctcctccattgacaagttacccacagcaacacccatgcacagaaccttcttc 35176

                                                                         
Query: 394   aactggaacttgacagtggccttggtctcattaaccttggactcaagggactcctggtga 453
             | |||||||||||| || || || ||||| || |||||||| ||||| ||||||||||||
Sbjct: 35175 agctggaacttgactgtagctttcgtctcgttgaccttggattcaagagactcctggtga 35116

                                       
Query: 454   gacaccaaagttggaaactttcctgc 479
             |  ||||| || || ||||| |||||
Sbjct: 35115 gtaaccaatgtagggaacttgcctgc 35090



to top

>dbj|AP003928.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1150_A11
          Length = 142010

 Score =  131 bits (66), Expect = 3e-27
 Identities = 114/130 (87%)
 Strand = Plus / Minus

                                                                          
Query: 470    actttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcct 529
              |||| ||||||||||| |||||||| ||||| || ||||| |||||||| ||||| ||||
Sbjct: 131618 acttgcctgccttgtttagaccaggaccaaggagacgggggatctgcttgatgatggcct 131559

                                                                          
Query: 530    cagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgt 589
              | ||||| | ||||||||| |||||||| ||||||||||| || ||||||||||| ||||
Sbjct: 131558 ctgatgctaagaaagcatggtacttcttggcaagcttcttcacaagcttcttgttcttgt 131499

                        
Query: 590    tcatcttctt 599
              ||||||||||
Sbjct: 131498 tcatcttctt 131489



 Score =  107 bits (54), Expect = 4e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                          
Query: 274    tgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctggaag 333
              ||||| ||||||||||| || || || |||||||| |||||||| || | ||| ||   |
Sbjct: 132153 tgccagttcttcttcaaaagggacacgaggaagttgacgctcatttggatgttttgctgg 132094

                                                                          
Query: 334    atctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacctttttc 393
              |||||||||||||||||   || ||  || || |||||||||||||| || ||||| |||
Sbjct: 132093 atctgcttctcctccatcgacaagttacccacagcaacacccatgcacagaaccttcttc 132034

                                                                          
Query: 394    aactggaacttgacagtggccttggtctcattaaccttggactcaagggactcctggtga 453
              | |||||||||||| || || || |||||||| |||||||| ||||| ||||||||||||
Sbjct: 132033 agctggaacttgactgtagctttcgtctcattgaccttggattcaagagactcctggtga 131974

                                        
Query: 454    gacaccaaagttggaaactttcctgc 479
              |  ||||| || || ||||| |||||
Sbjct: 131973 gtaaccaatgtagggaacttgcctgc 131948



to top

>gb|AC006232.4| Arabidopsis thaliana chromosome 2 clone F10A12 map B68, complete
             sequence
          Length = 90341

 Score =  127 bits (64), Expect = 5e-26
 Identities = 139/164 (84%)
 Strand = Plus / Plus

                                                                         
Query: 268   acgttttgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttc 327
             ||||||||||||||||||||||| || ||||| |||||||| || ||||||||||| |||
Sbjct: 68580 acgttttgccaattcttcttcaagagcgagacgaggaagttaacactcatctgcacattc 68639

                                                                         
Query: 328   tggaagatctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacc 387
             ||||||| ||||||||| |||||    ||||  ||||| ||||||||||| || || || 
Sbjct: 68640 tggaagagctgcttctcttccatggaaaggttaccaacagcaacacccatacacagaact 68699

                                                         
Query: 388   tttttcaactggaacttgacagtggccttggtctcattaacctt 431
             || |||||||||||||| || || || ||||||||||| |||||
Sbjct: 68700 ttcttcaactggaacttcactgttgctttggtctcattcacctt 68743



 Score =  103 bits (52), Expect = 7e-19
 Identities = 100/116 (86%)
 Strand = Plus / Plus

                                                                         
Query: 475   cctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagat 534
             |||||||||||||||||||| |||||||| || |||||||||||||||| || |||||| 
Sbjct: 68893 cctgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaa 68952

                                                                     
Query: 535   gcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
             || | ||||||||| ||   ||| ||||||||||| || ||||||||||| |||||
Sbjct: 68953 gccaagaaagcatggtaagacttagcaagcttcttaacaagcttcttgttcttgtt 69008



to top

>gb|AC005824.3| Arabidopsis thaliana chromosome 2 clone F15K20 map B68, complete sequence
          Length = 118196

 Score =  127 bits (64), Expect = 5e-26
 Identities = 139/164 (84%)
 Strand = Plus / Minus

                                                                          
Query: 268    acgttttgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttc 327
              ||||||||||||||||||||||| || ||||| |||||||| || ||||||||||| |||
Sbjct: 116093 acgttttgccaattcttcttcaagagcgagacgaggaagttaacactcatctgcacattc 116034

                                                                          
Query: 328    tggaagatctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcacc 387
              ||||||| ||||||||| |||||    ||||  ||||| ||||||||||| || || || 
Sbjct: 116033 tggaagagctgcttctcttccatggaaaggttaccaacagcaacacccatacacagaact 115974

                                                          
Query: 388    tttttcaactggaacttgacagtggccttggtctcattaacctt 431
              || |||||||||||||| || || || ||||||||||| |||||
Sbjct: 115973 ttcttcaactggaacttcactgttgctttggtctcattcacctt 115930



 Score =  103 bits (52), Expect = 7e-19
 Identities = 100/116 (86%)
 Strand = Plus / Minus

                                                                          
Query: 475    cctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagat 534
              |||||||||||||||||||| |||||||| || |||||||||||||||| || |||||| 
Sbjct: 115780 cctgccttgttaagaccaggaccaagaagacgaggaatctgcttaatgacagactcagaa 115721

                                                                      
Query: 535    gcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgtt 590
              || | ||||||||| ||   ||| ||||||||||| || ||||||||||| |||||
Sbjct: 115720 gccaagaaagcatggtaagacttagcaagcttcttaacaagcttcttgttcttgtt 115665



to top

>gb|DQ160125.1| Taraxacum officinale TO97-3 (To97-3) mRNA, partial cds
          Length = 310

 Score =  119 bits (60), Expect = 1e-23
 Identities = 216/268 (80%)
 Strand = Plus / Minus

                                                                       
Query: 325 ttctggaagatctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagc 384
           |||||||||||||||||||| ||||| |    ||  ||||| ||||| ||||| ||||||
Sbjct: 293 ttctggaagatctgcttctcttccatgctgcagtttccaacagcaactcccatacaaagc 234

                                                                       
Query: 385 acctttttcaactggaacttgacagtggccttggtctcattaaccttggactcaagggac 444
           |||   ||||  |||||||||||||| || ||||||||||| ||||| | ||||||||| 
Sbjct: 233 acccccttcagttggaacttgacagttgctttggtctcattcacctttgcctcaagggat 174

                                                                       
Query: 445 tcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtccaagaagt 504
           |||||||| || || | ||| || ||||| || || ||||| | ||||||||| |  |  
Sbjct: 173 tcctggtgggaaacaagagtagggaacttaccggctttgttcaaaccaggtcccaacaaa 114

                                                                       
Query: 505 cggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttctttgcaagc 564
           |||||||||||||| |||| ||  ||||| || | |||||| ||||  ||||||||||||
Sbjct: 113 cggggaatctgcttgatgacagattcagaagccaagaaagcttgatgtttctttgcaagc 54

                                       
Query: 565 ttcttgactagcttcttgtttttgttca 592
           ||||| || | ||||||||| |||||||
Sbjct: 53  ttcttcaccaacttcttgttcttgttca 26



to top

>dbj|AB007651.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD9
          Length = 85421

 Score =  119 bits (60), Expect = 1e-23
 Identities = 123/144 (85%)
 Strand = Plus / Plus

                                                                         
Query: 475   cctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagat 534
             ||||||||||| |||||||| |||||||| || |||||||||||||||| ||  ||||| 
Sbjct: 74697 cctgccttgttgagaccaggaccaagaagacgaggaatctgcttaatgacagattcagaa 74756

                                                                         
Query: 535   gcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatc 594
             ||||||||||||||  | ||||| ||||||||||| || || |||||||| ||||||| |
Sbjct: 74757 gcaaggaaagcatggaatttcttagcaagcttcttaacaagtttcttgttcttgttcaac 74816

                                     
Query: 595   ttcttcagcgattccacatccata 618
             ||||| || | ||| |||||||||
Sbjct: 74817 ttcttaagagcttcaacatccata 74840



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                         
Query: 271   ttttgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctgg 330
             |||||||| || |||||||| ||||| || |||||||| || |||||||| || || || 
Sbjct: 74399 ttttgccagtttttcttcaagagagaaacgaggaagttaacactcatctgaacattttga 74458

                                 
Query: 331   aagatctgcttctcctccat 350
             ||||||||||||||||||||
Sbjct: 74459 aagatctgcttctcctccat 74478



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 238   cccattgtgctcttcaggtacaggcacc 265
             |||||||||||||||| ||||| |||||
Sbjct: 74280 cccattgtgctcttcaagtacaagcacc 74307



to top

>gb|AY392166.1| Scyliorhinus canicula ribosomal protein L10a-like mRNA, partial
           sequence
          Length = 553

 Score =  105 bits (53), Expect = 2e-19
 Identities = 107/125 (85%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| || ||||  || |||||||||||||| |  | ||| || |||
Sbjct: 363 gccttgttgagaccaggacccagaatacgaggaatctgcttaataagggactccgaagca 304

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || ||||||| ||| |||||||||||||||||||| | ||||||||||||||||| ||||
Sbjct: 303 agaaaagcatcatatttctttgcaagcttcttgaccatcttcttgtttttgttcaacttc 244

                
Query: 598 ttcag 602
           |||||
Sbjct: 243 ttcag 239



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 382 agcacctttttcaactggaacttga 406
           ||||||||||||| |||||||||||
Sbjct: 459 agcacctttttcatctggaacttga 435



to top

>gb|AY149444.1| Euprymna scolopes 60S ribosomal protein L10 mRNA, partial cds
          Length = 180

 Score =  105 bits (53), Expect = 2e-19
 Identities = 107/125 (85%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           ||||| || ||||| || ||||||| || ||||||||| ||||||| ||  |||||||||
Sbjct: 140 gccttatttagacctggaccaagaattctgggaatctgtttaatgagagaatcagatgca 81

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           |||||||||| ||| ||||| ||||| |||||||| |  |||||||||||||||| ||||
Sbjct: 80  aggaaagcatcatatttcttggcaagtttcttgaccaatttcttgtttttgttcaacttc 21

                
Query: 598 ttcag 602
           |||||
Sbjct: 20  ttcag 16



to top

>gb|DQ233195.1| Pinus yunnanensis isolate PtIFG200918 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score =  105 bits (53), Expect = 2e-19
 Identities = 134/161 (83%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  |||||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggttggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233130.1| Pinus tabuliformis isolate PtIFG200928 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score =  105 bits (53), Expect = 2e-19
 Identities = 134/161 (83%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  |||||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggttggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233004.1| Pinus densata isolate PtIFG200926 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score =  105 bits (53), Expect = 2e-19
 Identities = 134/161 (83%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| ||||| |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaattttccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232993.1| Pinus densata isolate PtIFG200915 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score =  105 bits (53), Expect = 2e-19
 Identities = 134/161 (83%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  |||||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggttggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232984.1| Pinus densata isolate PtIFG200906 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score =  105 bits (53), Expect = 2e-19
 Identities = 134/161 (83%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  |||||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggttggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232982.1| Pinus densata isolate PtIFG200904 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score =  105 bits (53), Expect = 2e-19
 Identities = 134/161 (83%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  |||||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggttggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233194.1| Pinus yunnanensis isolate PtIFG200917 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233193.1| Pinus yunnanensis isolate PtIFG200916 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233192.1| Pinus yunnanensis isolate PtIFG200915 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccagggcca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233191.1| Pinus yunnanensis isolate PtIFG200914 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233190.1| Pinus yunnanensis isolate PtIFG200913 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233189.1| Pinus yunnanensis isolate PtIFG200912 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 543

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 494 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 435

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 434 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 375

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 374 gcaagtttcttaaccaatttcttgtttttgttcattttctt 334



to top

>gb|DQ233188.1| Pinus yunnanensis isolate PtIFG200911 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233186.1| Pinus yunnanensis isolate PtIFG200909 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233185.1| Pinus yunnanensis isolate PtIFG200908 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 115/137 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 gttggaaactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatg 522
           |||||||| || || |||||||| |||||||| |||||||| || || ||||| ||||||
Sbjct: 472 gttggaaatttgccagccttgttgagaccaggcccaagaagccgaggtatctgtttaatg 413

                                                                       
Query: 523 atagcctcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttg 582
           || || || || ||||| || |||||||| ||||||||||| ||||| || |  ||||||
Sbjct: 412 attgcttctgaagcaagaaaggcatgatatttctttgcaagtttcttaaccaatttcttg 353

                            
Query: 583 tttttgttcatcttctt 599
           ||||||||||| |||||
Sbjct: 352 tttttgttcattttctt 336



to top

>gb|DQ233184.1| Pinus yunnanensis isolate PtIFG200907 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233183.1| Pinus yunnanensis isolate PtIFG200906 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233181.1| Pinus yunnanensis isolate PtIFG200904 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233180.1| Pinus yunnanensis isolate PtIFG200903 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233179.1| Pinus yunnanensis isolate PtIFG200902 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233178.1| Pinus yunnanensis isolate PtIFG200901 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233131.1| Pinus tabuliformis isolate PtIFG200929 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233129.1| Pinus tabuliformis isolate PtIFG200927 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233125.1| Pinus tabuliformis isolate PtIFG200923 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233122.1| Pinus tabuliformis isolate PtIFG200920 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233118.1| Pinus tabuliformis isolate PtIFG200916 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233117.1| Pinus tabuliformis isolate PtIFG200915 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 514

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 115/137 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 gttggaaactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatg 522
           |||||||| || || |||||||| |||||||| |||||||| || || ||||| ||||||
Sbjct: 441 gttggaaatttgccagccttgttgagaccaggcccaagaagccgaggtatctgtttaatg 382

                                                                       
Query: 523 atagcctcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttg 582
           || || || || ||||| || |||||||| ||||||||||| ||||| || |  ||||||
Sbjct: 381 attgcttctgaagcaagaaaggcatgatatttctttgcaagtttcttaaccaatttcttg 322

                            
Query: 583 tttttgttcatcttctt 599
           ||||||||||| |||||
Sbjct: 321 tttttgttcattttctt 305



to top

>gb|DQ233115.1| Pinus tabuliformis isolate PtIFG200913 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233112.1| Pinus tabuliformis isolate PtIFG200910 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233111.1| Pinus tabuliformis isolate PtIFG200909 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233110.1| Pinus tabuliformis isolate PtIFG200908 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233109.1| Pinus tabuliformis isolate PtIFG200907 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233108.1| Pinus tabuliformis isolate PtIFG200906 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233107.1| Pinus tabuliformis isolate PtIFG200905 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233106.1| Pinus tabuliformis isolate PtIFG200904 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233105.1| Pinus tabuliformis isolate PtIFG200903 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233103.1| Pinus tabuliformis isolate PtIFG200901 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233045.1| Pinus koraiensis isolate PtIFG200902 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || || ||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcgtgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||||||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagcttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233044.1| Pinus koraiensis isolate PtIFG200901 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacgagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||||||||| || |  ||||| ||||||||||| |||||
Sbjct: 376 gcaagcttcttaaccaatttcttatttttgttcattttctt 336



to top

>gb|DQ233008.1| Pinus densata isolate PtIFG200930 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 115/137 (83%)
 Strand = Plus / Minus

                                                                       
Query: 463 gttggaaactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatg 522
           |||||||| || || |||||||| |||||||| |||||||| || || ||||| ||||||
Sbjct: 472 gttggaaatttgccagccttgttgagaccaggcccaagaagccgaggtatctgtttaatg 413

                                                                       
Query: 523 atagcctcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttg 582
           || || || || ||||| || |||||||| ||||||||||| ||||| || |  ||||||
Sbjct: 412 attgcttctgaagcaagaaaggcatgatatttctttgcaagtttcttaaccaatttcttg 353

                            
Query: 583 tttttgttcatcttctt 599
           ||||||||||| |||||
Sbjct: 352 tttttgttcattttctt 336



to top

>gb|DQ233007.1| Pinus densata isolate PtIFG200929 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233006.1| Pinus densata isolate PtIFG200928 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233003.1| Pinus densata isolate PtIFG200925 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233002.1| Pinus densata isolate PtIFG200924 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233001.1| Pinus densata isolate PtIFG200923 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ233000.1| Pinus densata isolate PtIFG200922 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232999.1| Pinus densata isolate PtIFG200921 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232998.1| Pinus densata isolate PtIFG200920 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232997.1| Pinus densata isolate PtIFG200919 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232996.1| Pinus densata isolate PtIFG200918 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 536

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 487 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 428

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 427 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 368

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 367 gcaagtttcttaaccaatttcttgtttttgttcattttctt 327



to top

>gb|DQ232995.1| Pinus densata isolate PtIFG200917 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 540

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 491 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 432

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 431 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 372

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 371 gcaagtttcttaaccaatttcttgtttttgttcattttctt 331



to top

>gb|DQ232994.1| Pinus densata isolate PtIFG200916 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 543

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 494 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 435

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 434 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 375

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 374 gcaagtttcttaaccaatttcttgtttttgttcattttctt 334



to top

>gb|DQ232992.1| Pinus densata isolate PtIFG200914 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 543

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 494 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 435

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 434 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 375

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 374 gcaagtttcttaaccaatttcttgtttttgttcattttctt 334



to top

>gb|DQ232991.1| Pinus densata isolate PtIFG200913 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 543

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 494 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 435

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 434 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 375

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 374 gcaagtttcttaaccaatttcttgtttttgttcattttctt 334



to top

>gb|DQ232990.1| Pinus densata isolate PtIFG200912 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232989.1| Pinus densata isolate PtIFG200911 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232988.1| Pinus densata isolate PtIFG200910 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232987.1| Pinus densata isolate PtIFG200909 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232983.1| Pinus densata isolate PtIFG200905 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232980.1| Pinus densata isolate PtIFG200902 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232979.1| Pinus densata isolate PtIFG200901 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|DQ232916.1| Pinus armandii isolate PtIFG200902 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacgagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || || ||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcgtgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||||||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagcttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|BC059454.1| Danio rerio ribosomal protein L10a, mRNA (cDNA clone MGC:73082
           IMAGE:4199288), complete cds
          Length = 746

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 101/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 466 ggaaactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgata 525
           |||||||||||||||||||| || ||||| || || |  || ||||||||||| || | |
Sbjct: 426 ggaaactttcctgccttgttgaggccagggcccaggatacgaggaatctgcttgatcaga 367

                                                                      
Query: 526 gcctcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtt 584
           | |||||| || ||||||||||  ||||||||||| ||||||||||| |||||||||||
Sbjct: 366 gactcagaggccaggaaagcatcgtacttctttgccagcttcttgaccagcttcttgtt 308



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 268 acgttttgccaattcttcttcaacagagagacaaggaagtt 308
           ||||||||||| |||||||||| |||||| || ||||||||
Sbjct: 624 acgttttgccagttcttcttcagcagagacaccaggaagtt 584



to top

>ref|XM_691265.1| PREDICTED: Danio rerio similar to Ribosomal protein L10a
           (LOC567951), mRNA
          Length = 745

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 101/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 466 ggaaactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgata 525
           |||||||||||||||||||| || ||||| || || |  || ||||||||||| || | |
Sbjct: 449 ggaaactttcctgccttgttgaggccagggcccaggatacgaggaatctgcttgatcaga 390

                                                                      
Query: 526 gcctcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtt 584
           | |||||| || ||||||||||  ||||||||||| ||||||||||| |||||||||||
Sbjct: 389 gactcagaggccaggaaagcatcgtacttctttgccagcttcttgaccagcttcttgtt 331



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 268 acgttttgccaattcttcttcaacagagagacaaggaagtt 308
           ||||||||||| |||||||||| |||||| || ||||||||
Sbjct: 647 acgttttgccagttcttcttcagcagagacaccaggaagtt 607



to top

>ref|NM_199636.1| Danio rerio ribosomal protein L10a (rpl10a), mRNA
          Length = 746

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 101/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 466 ggaaactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgata 525
           |||||||||||||||||||| || ||||| || || |  || ||||||||||| || | |
Sbjct: 426 ggaaactttcctgccttgttgaggccagggcccaggatacgaggaatctgcttgatcaga 367

                                                                      
Query: 526 gcctcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtt 584
           | |||||| || ||||||||||  ||||||||||| ||||||||||| |||||||||||
Sbjct: 366 gactcagaggccaggaaagcatcgtacttctttgccagcttcttgaccagcttcttgtt 308



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 268 acgttttgccaattcttcttcaacagagagacaaggaagtt 308
           ||||||||||| |||||||||| |||||| || ||||||||
Sbjct: 624 acgttttgccagttcttcttcagcagagacaccaggaagtt 584



to top

>dbj|AP006415.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT37I11, TM0302a,
             complete sequence
          Length = 96704

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 128/155 (82%)
 Strand = Plus / Plus

                                                                         
Query: 469   aactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcc 528
             ||||| ||||||||||| |||||||| || | ||| || |||||||||||||||| ||||
Sbjct: 50071 aacttgcctgccttgttgagaccaggacccaaaagacgaggaatctgcttaatgacagcc 50130

                                                                         
Query: 529   tcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttg 588
             ||||| || |  || ||||| || ||||| || |||||||| || | |||||| ||||||
Sbjct: 50131 tcagaagctaaaaatgcatggtatttcttagctagcttcttcaccaacttcttatttttg 50190

                                                
Query: 589   ttcatcttcttcagcgattccacatccatacagtc 623
             |||| ||||||||  | ||| |||||||| |||||
Sbjct: 50191 ttcagcttcttcaatgcttcgacatccatccagtc 50225



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 148/184 (80%)
 Strand = Plus / Plus

                                                                         
Query: 271   ttttgccaattcttcttcaacagagagacaaggaagttcacgctcatctgcacgttctgg 330
             |||||||| ||||| ||||||| ||||||||||||||| || ||||  |||||||| || 
Sbjct: 49553 ttttgccagttctttttcaacaaagagacaaggaagttaacactcagttgcacgttttga 49612

                                                                         
Query: 331   aagatctgcttctcctccatacccaggtggccaacggcaacacccatgcaaagcaccttt 390
             |||||||| || || ||||| |  |  |  || ||||| || |||||||| |||||||||
Sbjct: 49613 aagatctgtttttcttccatgctaacattacccacggcgactcccatgcagagcaccttt 49672

                                                                         
Query: 391   ttcaactggaacttgacagtggccttggtctcattaaccttggactcaagggactcctgg 450
             || | ||| || |||||  | ||||| |||||||||||||| |  |||||||| || |||
Sbjct: 49673 ttgagctgaaatttgaccatagccttagtctcattaacctttgcttcaagggattcttgg 49732

                 
Query: 451   tgag 454
             ||||
Sbjct: 49733 tgag 49736



to top

>gb|DQ233182.1| Pinus yunnanensis isolate PtIFG200905 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233128.1| Pinus tabuliformis isolate PtIFG200926 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233127.1| Pinus tabuliformis isolate PtIFG200925 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 543

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 455 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 396

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 395 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 336

             
Query: 598 tt 599
           ||
Sbjct: 335 tt 334



to top

>gb|DQ233126.1| Pinus tabuliformis isolate PtIFG200924 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233124.1| Pinus tabuliformis isolate PtIFG200922 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233123.1| Pinus tabuliformis isolate PtIFG200921 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233121.1| Pinus tabuliformis isolate PtIFG200919 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233120.1| Pinus tabuliformis isolate PtIFG200918 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233119.1| Pinus tabuliformis isolate PtIFG200917 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233116.1| Pinus tabuliformis isolate PtIFG200914 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233114.1| Pinus tabuliformis isolate PtIFG200912 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233113.1| Pinus tabuliformis isolate PtIFG200911 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 536

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 448 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 389

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 388 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 329

             
Query: 598 tt 599
           ||
Sbjct: 328 tt 327



to top

>gb|DQ233104.1| Pinus tabuliformis isolate PtIFG200902 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233010.1| Pinus densata isolate PtIFG200932 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233009.1| Pinus densata isolate PtIFG200931 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ233005.1| Pinus densata isolate PtIFG200927 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ232985.1| Pinus densata isolate PtIFG200907 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || |||||||| ||||||||||| ||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcatgatatttctttgcaagtttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|DQ232915.1| Pinus armandii isolate PtIFG200901 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 gccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagatgca 537
           |||||||| |||||||| |||||||| || || ||||| |||||||| || || || |||
Sbjct: 457 gccttgttgagaccaggcccaagaagccgaggtatctgtttaatgattgcttctgaagca 398

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           || || || ||||| ||||||||||||||||| || |  ||||||||||||||||| |||
Sbjct: 397 agaaaggcgtgatatttctttgcaagcttcttaaccaatttcttgtttttgttcattttc 338

             
Query: 598 tt 599
           ||
Sbjct: 337 tt 336



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
               sequence
          Length = 1507550

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 84/97 (86%)
 Strand = Plus / Minus

                                                                           
Query: 505     cggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttctttgcaagc 564
               |||||||||||||| |||| ||||||||| ||||||||||| |  |||||||  || |||
Sbjct: 1112611 cggggaatctgcttgatgagagcctcagaggcaaggaaagcgtcgtacttctgagcgagc 1112552

                                                    
Query: 565     ttcttgactagcttcttgtttttgttcatcttcttca 601
               |||||||| ||||||||||| ||||| | ||||||||
Sbjct: 1112551 ttcttgacgagcttcttgttcttgttgagcttcttca 1112515



to top

>ref|XM_571019.1| Cryptococcus neoformans var. neoformans JEC21 60s ribosomal protein
           l1-a (l10a) (CNE03920) partial mRNA
          Length = 945

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 84/97 (86%)
 Strand = Plus / Minus

                                                                       
Query: 505 cggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttctttgcaagc 564
           |||||||||||||| |||| ||||||||| ||||||||||| |  |||||||  || |||
Sbjct: 427 cggggaatctgcttgatgagagcctcagaggcaaggaaagcgtcgtacttctgagcgagc 368

                                                
Query: 565 ttcttgactagcttcttgtttttgttcatcttcttca 601
           |||||||| ||||||||||| ||||| | ||||||||
Sbjct: 367 ttcttgacgagcttcttgttcttgttgagcttcttca 331



to top

>gb|DQ233187.1| Pinus yunnanensis isolate PtIFG200910 putative 60S ribosomal
           protein L10A gene, partial cds
          Length = 545

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 132/161 (81%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| ||||| || || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaattattgcttctgaagcaagaaaggcatgatatttcttt 377

                                                    
Query: 559 gcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| ||||| || |  ||||||||||||||||| |||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgttcattttctt 336



to top

>gb|AC142498.21| Medicago truncatula clone mth2-24a18, complete sequence
          Length = 114956

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                         
Query: 475   cctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagat 534
             ||||||||||| |||||||| || | ||| || ||||||||||||||||  |||||||| 
Sbjct: 45965 cctgccttgttgagaccaggacccaaaagacgaggaatctgcttaatgactgcctcagaa 45906

                                                                         
Query: 535   gcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatc 594
             || | ||||||||| |||||||| || ||||| || || | |||||| |||||||| | |
Sbjct: 45905 gctaagaaagcatggtacttcttggctagctttttcaccaacttcttatttttgttgagc 45846

                    
Query: 595   ttcttca 601
             |||||||
Sbjct: 45845 ttcttca 45839



to top

>gb|DQ232986.1| Pinus densata isolate PtIFG200908 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 124/151 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                          
Query: 559 gcaagcttcttgactagcttcttgtttttgt 589
           ||||| ||||| || |  |||||||||||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgt 346



to top

>gb|DQ232981.1| Pinus densata isolate PtIFG200903 putative 60S ribosomal protein
           L10A gene, partial cds
          Length = 545

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 124/151 (82%)
 Strand = Plus / Minus

                                                                       
Query: 439 agggactcctggtgagacaccaaagttggaaactttcctgccttgttaagaccaggtcca 498
           |||||||| |||||||| || |  || ||||| || || |||||||| |||||||| |||
Sbjct: 496 agggactcttggtgagatacaagggtaggaaatttgccagccttgttgagaccaggccca 437

                                                                       
Query: 499 agaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttcttt 558
           ||||| || || ||||| |||||||| || || || ||||| || |||||||| ||||||
Sbjct: 436 agaagccgaggtatctgtttaatgattgcttctgaagcaagaaaggcatgatatttcttt 377

                                          
Query: 559 gcaagcttcttgactagcttcttgtttttgt 589
           ||||| ||||| || |  |||||||||||||
Sbjct: 376 gcaagtttcttaaccaatttcttgtttttgt 346



to top

>dbj|AK108883.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-152-D09, full
           insert sequence
          Length = 1289

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 109/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 469 aactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcc 528
           ||||||||||||||||| || || ||||| || || ||||| |||||||| || | ||||
Sbjct: 451 aactttcctgccttgttgaggcctggtcccagcagacgggggatctgcttgatcacagcc 392

                                                                       
Query: 529 tcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttg 588
           ||||| |||||||| || || ||  |||| || ||||||||||| ||||||||||| |||
Sbjct: 391 tcagaggcaaggaaggcgtggtagctcttggccagcttcttgaccagcttcttgttcttg 332

                      
Query: 589 ttcatcttctt 599
           || | ||||||
Sbjct: 331 ttgagcttctt 321



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 370 acacccatgcaaagcacctttttcaactggaacttgacagtggccttggtctcatt 425
           ||||||||||| |||||||| |||| |||||||||||  |  ||||||||||||||
Sbjct: 550 acacccatgcacagcaccttcttcagctggaacttgatggacgccttggtctcatt 495



to top

>gb|BC071510.1| Danio rerio ribosomal protein L10a, mRNA (cDNA clone MGC:86881
           IMAGE:6904291), complete cds
          Length = 774

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 100/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 466 ggaaactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgata 525
           |||||||||||||||||||| || ||||| || || |  || ||||||||||| || | |
Sbjct: 443 ggaaactttcctgccttgttgaggccagggcccaggatacgaggaatctgcttgatcaga 384

                                                                      
Query: 526 gcctcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtt 584
           | |||||| || ||||||||||  ||||||||||| ||||||||||| || ||||||||
Sbjct: 383 gactcagaggccaggaaagcatcgtacttctttgccagcttcttgaccagtttcttgtt 325



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 268 acgttttgccaattcttcttcaacagagagacaaggaagtt 308
           ||||||||||| |||||||||| |||||| || ||||||||
Sbjct: 641 acgttttgccagttcttcttcagcagagacaccaggaagtt 601



to top

>emb|CT573029.5| M.truncatula DNA sequence from clone MTH2-67H11 on chromosome 3,
             complete sequence
          Length = 152399

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                         
Query: 475   cctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcctcagat 534
             ||||||||||| |||||||| || | ||| || ||||||||||||||||  |||||||| 
Sbjct: 64412 cctgccttgttgagaccaggacccaaaagacgaggaatctgcttaatgactgcctcagaa 64471

                                                                         
Query: 535   gcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatc 594
             || | ||||||||| |||||||| || ||||| || || | |||||| |||||||| | |
Sbjct: 64472 gctaagaaagcatggtacttcttggctagctttttcaccaacttcttatttttgttgagc 64531

                    
Query: 595   ttcttca 601
             |||||||
Sbjct: 64532 ttcttca 64538



to top

>gb|AY620995.1| Branchiostoma belcheri tsingtaunese ribosomal protein L10a mRNA,
           partial sequence
          Length = 531

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                       
Query: 538 aggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttcatcttc 597
           |||||||| | ||||||||| |||||||||||||| ||||||||||| ||||||| ||||
Sbjct: 364 aggaaagcgtcatacttcttggcaagcttcttgacaagcttcttgttcttgttcagcttc 305

               
Query: 598 ttca 601
           ||||
Sbjct: 304 ttca 301



to top

>ref|XM_756085.1| Ustilago maydis 521 hypothetical protein (UM05031.1) partial mRNA
          Length = 651

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 511 atctgcttaatgatagcctcagatgcaaggaaagcatgatacttctttgcaagcttcttg 570
           |||||||| || | ||||||||| ||||||||||| |  |||||||| || |||||||||
Sbjct: 356 atctgcttgatcagagcctcagaagcaaggaaagcgtcgtacttcttggcgagcttcttg 297

                                          
Query: 571 actagcttcttgtttttgttcatcttcttca 601
           || ||||||||||| ||||| | ||||||||
Sbjct: 296 acgagcttcttgttcttgttgagcttcttca 266



to top

>gb|AY826152.1| Aedes albopictus clone AL_390 60S ribosomal protein L10a mRNA,
           complete cds
          Length = 654

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 469 aactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcc 528
           ||||| || |||||||| ||||| ||||| || || |||||||||||||| ||||  | |
Sbjct: 401 aacttaccagccttgttcagaccgggtccgagcagacggggaatctgcttgatgagcgac 342

                                                                       
Query: 529 tcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttg 588
           || || || ||||| || |  |||||||| || ||||||||||| | ||||||||| |||
Sbjct: 341 tccgaggccaggaaggcgtcgtacttcttggctagcttcttgaccaacttcttgttcttg 282

                         
Query: 589 ttcatcttcttcag 602
           |||| |||||||||
Sbjct: 281 ttcagcttcttcag 268



to top

>gb|AY847949.1| Pectinaria gouldii ribosomal protein L10 mRNA, complete cds
          Length = 734

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 100/122 (81%)
 Strand = Plus / Minus

                                                                       
Query: 469 aactttcctgccttgttaagaccaggtccaagaagtcggggaatctgcttaatgatagcc 528
           ||||| || |||||||| || ||||| ||||| |  ||||| |||||||| || | || |
Sbjct: 425 aacttgccagccttgttcagtccaggaccaaggatacgggggatctgcttgatcagagac 366

                                                                       
Query: 529 tcagatgcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttg 588
           ||||| || ||||| |||| || |||||| ||||||||||| || ||||||||||| |||
Sbjct: 365 tcagaggccaggaaggcatcatgcttcttggcaagcttcttcaccagcttcttgttcttg 306

             
Query: 589 tt 590
           ||
Sbjct: 305 tt 304



to top

>gb|AF391092.1| Spodoptera frugiperda ribosomal protein L10A mRNA, complete cds
          Length = 719

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 535 gcaaggaaagcatgatacttctttgcaagcttcttgactagcttcttgtttttgttca 592
           |||||||| |||| |||||||||||| || |||||||| ||||||||||| |||||||
Sbjct: 381 gcaaggaaggcatcatacttctttgctagtttcttgacaagcttcttgttcttgttca 324



to top

>gb|AY440221.1| Armigeres subalbatus ASAP ID: 39087 cytosolic large ribosomal
           subunit L10a mRNA sequence
          Length = 771

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 505 cggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttctttgcaagc 564
           ||||| |||||||||||||  |  || || || |||||||| |  |||||||| || |||
Sbjct: 416 cgggggatctgcttaatgagcgattccgaagccaggaaagcgtcgtacttcttggctagc 357

                                                   
Query: 565 ttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| | ||| ||||||||||||| |||||||||||
Sbjct: 356 ttcttgaccaactttttgtttttgttcagcttcttcagcg 317



to top

>emb|AJ718244.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT4-13-142, cultivar Bright
           Yellow 2
          Length = 107

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 234 ctttcccattgtgctcttcaggtacaggcaccgcacgttttgccaattcttcttca 289
           ||||||||| |||||||||| |||||||||||  || |||||||||||||| ||||
Sbjct: 94  ctttcccatggtgctcttcaagtacaggcacctaacattttgccaattctttttca 39



to top

>gb|AY389923.1| Latimeria chalumnae ribosomal protein L10a mRNA, partial cds
          Length = 598

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                       
Query: 508 ggaatctgcttaatgatagcctcagatgcaaggaaagcatgatacttctttgcaagcttc 567
           |||||||||||||| |  | ||| ||||| ||||||||||  |||||||| || || |||
Sbjct: 333 ggaatctgcttaattagggactcggatgccaggaaagcatcgtacttcttagccagtttc 274

                                              
Query: 568 ttgactagcttcttgtttttgttcatcttcttcag 602
           || || ||||||||||| ||||||| ||| |||||
Sbjct: 273 ttaaccagcttcttgttcttgttcagctttttcag 239



to top

>ref|XM_504660.1| Yarrowia lipolytica CLIB122, YALI0E31911g predicted mRNA
          Length = 654

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 493 ggtccaagaagtcggggaatctgcttaatgatagcctcagatgcaaggaaagcatgatac 552
           ||||| ||||||||||||| |||||| || | |||||| || |||| ||| || |  |||
Sbjct: 377 ggtccgagaagtcggggaacctgcttgatcagagcctcggaggcaatgaaggcgttgtac 318

                                                          
Query: 553 ttctttgcaagcttcttgactagcttcttgtttttgttcatcttctt 599
           ||||| || ||||||||||  ||||||||||| ||||| | ||||||
Sbjct: 317 ttcttggcgagcttcttgatgagcttcttgttcttgttgagcttctt 271



to top

>emb|BX053438.1|CNS09DEA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 660

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 599 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 545



to top

>emb|BX072047.1|CNS09RR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 603 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 549



to top

>emb|BX071756.1|CNS09RJ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 438 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 492



to top

>emb|BX071755.1|CNS09RJ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 893

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 702 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 648



to top

>emb|BX070707.1|CNS09QPZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 682

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 325 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 271



to top

>emb|BX060982.1|CNS09J7U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 404 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 458



to top

>emb|BX060981.1|CNS09J7T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 575 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 521



to top

>emb|BX069581.1|CNS09PUP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 623

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 428 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 482



to top

>emb|BX069580.1|CNS09PUO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 348 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 294



to top

>emb|BX069267.1|CNS09PLZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 619 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 565



to top

>emb|BX068765.1|CNS09P81 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 431 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 485



to top

>emb|BX068764.1|CNS09P80 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 596 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 542



to top

>emb|BX067034.1|CNS09NVY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 415 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 469



to top

>emb|BX067033.1|CNS09NVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 431 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 377



to top

>emb|BX066666.1|CNS09NLQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 428 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 482



to top

>emb|BX066665.1|CNS09NLP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1078

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 608 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 554



to top

>emb|BX065462.1|CNS09MOA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 421 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 475



to top

>emb|BX065461.1|CNS09MO9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1065

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 596 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 542



to top

>emb|BX065428.1|CNS09MNC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 721 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 667



to top

>emb|BX064407.1|CNS09LUZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 449 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 503



to top

>emb|BX064406.1|CNS09LUY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 616 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 562



to top

>emb|BX064040.1|CNS09LKS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 452 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 506



to top

>emb|BX064039.1|CNS09LKR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 616 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 562



to top

>emb|BX063711.1|CNS09LBN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 425

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 154 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 100



to top

>emb|BX062611.1|CNS09KH3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 423 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 477



to top

>emb|BX062610.1|CNS09KH2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 587 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 533



to top

>emb|BX062333.1|CNS09K9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 439 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 493



to top

>emb|BX062332.1|CNS09K9C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1079

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 590 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 536



to top

>emb|BX061889.1|CNS09JX1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 434 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 488



to top

>emb|BX061888.1|CNS09JX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 356 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 302



to top

>emb|BX059682.1|CNS09I7Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 427 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 481



to top

>emb|BX059681.1|CNS09I7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 601 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 547



to top

>emb|BX059289.1|CNS09HWT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 438 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 492



to top

>emb|BX059288.1|CNS09HWS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 611 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 557



to top

>emb|BX059023.1|CNS09HPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 411 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 465



to top

>emb|BX059022.1|CNS09HPE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 823

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 340 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 286



to top

>emb|BX058910.1|CNS09HMA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 594 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 540



to top

>emb|BX056669.1|CNS09FW1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 779

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 351 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 297



to top

>emb|BX057965.1|CNS09GW1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 454 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 508



to top

>emb|BX057964.1|CNS09GW0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1043

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 807 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 753



to top

>emb|BX057413.1|CNS09GGP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 768

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 413 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 467



to top

>emb|BX057412.1|CNS09GGO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 792

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 584 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 530



to top

>emb|BX056303.1|CNS09FLV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 606 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 552



to top

>emb|BX055435.1|CNS09EXR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 417 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 471



to top

>emb|BX055434.1|CNS09EXQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 345 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 291



to top

>emb|BX053004.1|CNS09D28 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 574

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 445 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 499



to top

>emb|BX053954.1|CNS09DSM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 377 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 323



to top

>emb|BX053562.1|CNS09DHQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 427 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 481



to top

>emb|BX053561.1|CNS09DHP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 792

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 356 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 302



to top

>emb|BX052455.1|CNS09CMZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 433 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 487



to top

>emb|BX051666.1|CNS09C12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 638

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 428 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 482



to top

>emb|BX051022.1|CNS09BJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 411 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 465



to top

>emb|BX051021.1|CNS09BJ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 595 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 541



to top

>emb|BX050571.1|CNS09B6N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 417 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 471



to top

>emb|BX050570.1|CNS09B6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 351 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 297



to top

>emb|BX050435.1|CNS09B2V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26DG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 807

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 317 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 263



to top

>emb|BX050016.1|CNS09AR8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 426 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 480



to top

>emb|BX048883.1|CNS099VR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 407 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 461



to top

>emb|BX048882.1|CNS099VQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 581 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 527



to top

>emb|BX047422.1|CNS098R6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 211

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 200 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 146



to top

>emb|BX047411.1|CNS098QV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 438 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 492



to top

>emb|BX047410.1|CNS098QU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 609 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 555



to top

>emb|BX046235.1|CNS097U7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 436 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 490



to top

>emb|BX046234.1|CNS097U6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 721 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 667



to top

>emb|BX045468.1|CNS0978W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 782 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 728



to top

>emb|BX045438.1|CNS09782 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 597 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 543



to top

>emb|BX045382.1|CNS0976I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 697 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 643



to top

>emb|BX042925.1|CNS095A9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 440 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 494



to top

>emb|BX042924.1|CNS095A8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 614 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 560



to top

>emb|BX042921.1|CNS095A5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 388

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 254 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 308



to top

>emb|BX042920.1|CNS095A4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 597 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 543



to top

>emb|BX044463.1|CNS096GZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 561 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 507



to top

>emb|BX044077.1|CNS09669 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC17BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 428 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 482



to top

>emb|BX044076.1|CNS09668 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 696

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 602 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 548



to top

>emb|BX043941.1|CNS0962H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC17AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 529

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 442 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 496



to top

>emb|BX043475.1|CNS095PJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 389 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 443



to top

>emb|BX043474.1|CNS095PI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 701 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 647



to top

>emb|BX043383.1|CNS095MZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 445 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 499



to top

>emb|BX043382.1|CNS095MY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 812 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 758



to top

>emb|BX043302.1|CNS095KQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 762

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 377 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 323



to top

>emb|BX042626.1|CNS0951Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 426 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 480



to top

>emb|BX042625.1|CNS0951X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 704 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 650



to top

>emb|BX042537.1|CNS094ZH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 696

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 437 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 491



to top

>emb|BX042361.1|CNS094UL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 424 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 478



to top

>emb|BX042360.1|CNS094UK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 790 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 736



to top

>emb|BX041956.1|CNS094JC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 156

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 47  tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 101



to top

>emb|BX039561.1|CNS092OT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 615 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 561



to top

>emb|BX039004.1|CNS0929C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 670

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 461 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 515



to top

>emb|BX039003.1|CNS0929B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 377 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 323



to top

>emb|BX038956.1|CNS09280 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 637

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 477 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 531



to top

>emb|BX038848.1|CNS09250 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 714

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 422 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 476



to top

>emb|BX038847.1|CNS0924Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 379 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 325



to top

>emb|BX038776.1|CNS09230 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 646

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 458 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 512



to top

>emb|BX038775.1|CNS0922Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 377 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 323



to top

>emb|BX038464.1|CNS091UC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 753

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 451 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 505



to top

>emb|BX038463.1|CNS091UB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 744

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 381 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 327



to top

>emb|BX038343.1|CNS091QZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 456 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 510



to top

>emb|BX038342.1|CNS091QY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 762

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 550 tacttctttgcaagcttcttgactagcttcttgtttttgttcatcttcttcagcg 604
           |||||||| || |||||||| || ||||||||||| ||||||| |||||||||||
Sbjct: 381 tacttcttcgccagcttcttcaccagcttcttgttcttgttcagcttcttcagcg 327


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,585,870
Number of Sequences: 3902068
Number of extensions: 6585870
Number of successful extensions: 137836
Number of sequences better than 10.0: 597
Number of HSP's better than 10.0 without gapping: 596
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 136465
Number of HSP's gapped (non-prelim): 1328
length of query: 635
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 612
effective length of database: 17,143,297,704
effective search space: 10491698194848
effective search space used: 10491698194848
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top