ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags31j17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF307145.1| Hordeum vulgare subsp. vulgare glutamine-dependen... 1185 0.0
2gb|BT009245.1| Triticum aestivum clone wlk1.pk0018.d4:fis, full ... 1027 0.0
3gb|AY621539.1| Triticum aestivum glutamine-dependent asparagine ... 997 0.0
4gb|BT009049.1| Triticum aestivum clone wdk9n1.pk001.f6:fis, full... 504 e-139
5gb|AY193714.1| Hordeum vulgare asparagine synthetase 2 (AS2) mRN... 488 e-134
6gb|AY108716.1| Zea mays PCO093600 mRNA sequence 323 4e-85
7gb|U77678.1|GMU77678 Glycine max asparagine synthetase 2 (AS2) m... 119 1e-23
8emb|AJ009952.1|PVU9952 Phaseolus vulgaris mRNA for asparagine sy... 113 7e-22
9gb|AY240926.1| Lycopersicon esculentum asparagine synthetase (AS... 111 3e-21
10ref|NM_121062.2| Arabidopsis thaliana ASN3 (ASPARAGINE SYNTHETAS... 109 1e-20
11ref|NM_001036787.1| Arabidopsis thaliana ASN3 (ASPARAGINE SYNTHE... 109 1e-20
12emb|X82849.1|ZMASPSY Z.mays mRNA for aspargine synthetase 109 1e-20
13gb|AF095452.1|AF095452 Arabidopsis thaliana asparagine synthetas... 109 1e-20
14emb|BX830209.1|CNS09YW6 Arabidopsis thaliana Full-length cDNA Co... 109 1e-20
15gb|BT005014.1| Arabidopsis thaliana clone U20709 putative aspara... 109 1e-20
16gb|BT003929.1| Arabidopsis thaliana clone RAFL15-17-K18 (R20709)... 109 1e-20
17emb|X84448.1|BOASPSYN B.oleracea mRNA for asparagine synthetase 103 7e-19
18gb|AF530460.1| Striga hermonthica asparagine synthetase (AS) mRN... 103 7e-19
19dbj|AB035247.1| Astragalus sinicus AsAS1 mRNA for asparagine syn... 101 3e-18
20gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 98 4e-17
21emb|X89409.1|LJAS1GENE L.japonicus mRNA for asparagine synthetas... 98 4e-17
22gb|AC137634.3| Oryza sativa (japonica cultivar-group) chromosome... 98 4e-17
23dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 98 4e-17
24dbj|AK100247.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 4e-17
25gb|U55873.1|OSU55873 Oryza sativa asparagine synthetase mRNA, co... 98 4e-17
26dbj|D83378.1|RICAS Oryza sativa (japonica cultivar-group) mRNA f... 98 4e-17
27emb|X52180.1|PSAS2 Pea AS2 root mRNA for asparagine synthase (EC... 96 2e-16
28emb|X67958.1|AOASPSYNM A.officinalis mRNA for asparagine synthetase 94 6e-16
29gb|BT013473.1| Lycopersicon esculentum clone 132134R, mRNA sequence 92 3e-15
30emb|AL360334.1|ATF18D22 Arabidopsis thaliana DNA chromosome 5, B... 92 3e-15
31gb|AY103777.1| Zea mays PCO113531 mRNA sequence 92 3e-15
32emb|AL356332.1|ATT31P16 Arabidopsis thaliana DNA chromosome 5, B... 92 3e-15
33dbj|AB050900.1| Raphanus sativus Asn1 mRNA for asparagine synthe... 92 3e-15
34ref|NM_180941.1| Arabidopsis thaliana ASN2 (ASPARAGINE SYNTHETAS... 90 1e-14
35ref|NM_125900.2| Arabidopsis thaliana ASN2 (ASPARAGINE SYNTHETAS... 90 1e-14
36ref|NM_114602.2| Arabidopsis thaliana ASN1 (DARK INDUCIBLE 6) AT... 90 1e-14
37ref|NM_180332.1| Arabidopsis thaliana ASN1 (DARK INDUCIBLE 6) AT... 90 1e-14
38ref|NM_180333.1| Arabidopsis thaliana ASN1 (DARK INDUCIBLE 6) AT... 90 1e-14
39gb|AY096592.1| Arabidopsis thaliana putative glutamine-dependent... 90 1e-14
40gb|AY072214.1| Arabidopsis thaliana putative glutamine-dependent... 90 1e-14
41emb|AL096860.1|ATT21L8 Arabidopsis thaliana DNA chromosome 3, BA... 90 1e-14
42gb|AY124866.1| Arabidopsis thaliana AT5g65010/MXK3_25 mRNA, comp... 90 1e-14
43gb|AF367340.1| Arabidopsis thaliana AT5g65010/MXK3_25 mRNA, comp... 90 1e-14
44gb|AF419557.1|AF419557 Arabidopsis thaliana AT3g47340/T21L8_90 m... 90 1e-14
45gb|AF095453.1|AF095453 Arabidopsis thaliana asparagine synthetas... 90 1e-14
46emb|BX824817.1|CNS0A4VX Arabidopsis thaliana Full-length cDNA Co... 90 1e-14
47gb|L29083.1|ATHMTGDAS Arabidopsis thaliana (clone At-ASN1) gluta... 90 1e-14
48emb|X89410.1|LJAS2GENE L.japonicus mRNA for asparagine synthetas... 88 4e-14
49dbj|AB035248.1| Astragalus sinicus AsAS2 mRNA for asparagine syn... 88 4e-14
50gb|AY081945.1| Securigera parviflora asparagine synthetase (As1)... 84 6e-13
51emb|AJ496567.2|PSY496567 Pinus sylvestris mRNA for putative aspa... 84 6e-13
52gb|AF005724.1| Sandersonia aurantiaca asparagine synthetase (SAN... 84 6e-13
53gb|DQ455293.1| Medicago truncatula cDNA-AFLP fragment BT11M44_22... 80 1e-11
54dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 80 1e-11
55dbj|AP005382.3| Oryza sativa (japonica cultivar-group) genomic D... 80 1e-11
56gb|DQ227307.1| Glycine max asparagine synthetase mRNA, complete cds 78 4e-11
57gb|U55874.1|GMU55874 Glycine max asparagine synthetase mRNA, com... 78 4e-11
58gb|AY061820.1| Nicotiana tabacum asparagine synthetase (din6) mR... 76 1e-10
59emb|AJ133522.1|PVU133522 Phaseolus vulgaris mRNA for asparagine ... 72 2e-09
60gb|AF488726.1| Securigera parviflora asparagine synthetase (As2)... 72 2e-09
61emb|CT573508.2| Medicago truncatula chromosome 5 clone mth2-29p1... 70 9e-09
62gb|U77679.1|GMU77679 Glycine max asparagine synthetase 1 (AS1) m... 70 9e-09
63gb|U89923.1|MSU89923 Medicago sativa asparagine synthetase mRNA,... 68 4e-08
64emb|Z72354.1|VFAS1 V.faba mRNA for asparagine synthetase 66 1e-07
65emb|X99552.1|AOASPS A.officinalis gene encoding asparagine synth... 66 1e-07
66emb|X52179.1|PSAS1 Pea AS1 nodule mRNA for asparagine synthase (... 66 1e-07
67dbj|AB019236.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 66 1e-07
68ref|XM_656913.1| Aspergillus nidulans FGSC A4 hypothetical prote... 64 6e-07
69gb|L40327.1|ALFASPSYN Medicago sativa asparagine synthetase gene... 64 6e-07
70gb|AF061740.1| Elaeagnus umbellata asparagine synthetase (AS) mR... 62 2e-06
71gb|AY208747.1| Securigera parviflora asparagine synthetase (AS2)... 62 2e-06
72gb|AF014055.1| Triphysaria versicolor asparagine synthetase (AS)... 62 2e-06
73gb|AF190729.1| Helianthus annuus asparagine synthetase (HAS2) mR... 58 4e-05
74gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome 58 4e-05
75gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome 58 4e-05
76ref|XM_747043.1| Aspergillus fumigatus Af293 asparagine syntheta... 54 5e-04
77gb|AF014057.1| Triphysaria versicolor asparagine synthetase (AS)... 54 5e-04
78gb|AF014056.1| Triphysaria versicolor asparagine synthetase (AS)... 54 5e-04
79emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 50 0.009
80emb|AL627267.1| Salmonella enterica serovar Typhi (Salmonella ty... 50 0.009
81emb|AJ549919.1|LJA549919 Lotus japonicus mRNA for asparagine syn... 50 0.009
82gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 50 0.009
83gb|AE017131.1| Yersinia pestis biovar Medievalis str. 91001 sect... 48 0.034
84gb|AE009952.1| Yersinia pestis KIM, complete genome 48 0.034
85emb|CR378666.1| Photobacterium profundum SS9; segment 4/12 48 0.034
86emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 48 0.034
87emb|AJ414153.1| Yersinia pestis strain CO92 complete genome; seg... 48 0.034
88gb|AF263432.1| Helianthus annuus asparagine synthetase (HAS1.1) ... 46 0.13
89gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g... 46 0.13
90emb|BX823779.1|CNS0A6KC Arabidopsis thaliana Full-length cDNA Co... 44 0.53
91ref|XM_561050.1| Anopheles gambiae str. PEST ENSANGP00000025823 ... 44 0.53
92gb|AC116394.22| Mus musculus chromosome 8, clone RP23-100C12, co... 42 2.1
93ref|XM_453910.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D19118g ... 42 2.1
94gb|AC163997.3| Mus musculus chromosome 8, clone RP24-273M3, comp... 42 2.1
95gb|AY275111.1| Abrothrix olivaceus cytochrome b gene, partial cd... 42 2.1
96emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 42 2.1
97emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 42 2.1
98gb|CP000133.1| Rhizobium etli CFN 42, complete genome 42 2.1
99gb|AF297902.1|AF297902 Abrothrix xanthorhinus canescens number F... 42 2.1
100gb|AF297901.1|AF297901 Abrothrix xanthorhinus canescens number F... 42 2.1
101gb|AF297900.1|AF297900 Abrothrix xanthorhinus canescens number F... 42 2.1
102gb|AF297899.1|AF297899 Abrothrix xanthorhinus canescens number F... 42 2.1
103gb|AF297898.1|AF297898 Abrothrix xanthorhinus canescens number F... 42 2.1
104gb|AF297897.1|AF297897 Abrothrix xanthorhinus canescens number F... 42 2.1
105gb|AF297896.1|AF297896 Abrothrix xanthorhinus canescens number F... 42 2.1
106gb|AF297895.1|AF297895 Abrothrix sp. FMNH129874 number FMNH 1298... 42 2.1
107gb|AF297894.1|AF297894 Abrothrix sp. FMNH129874 number FMNH 1298... 42 2.1
108gb|AF297893.1|AF297893 Abrothrix sp. FMNH129874 number FMNH 1298... 42 2.1
109gb|AF297892.1|AF297892 Abrothrix olivaceus brachiotis number FMN... 42 2.1
110gb|AF297891.1|AF297891 Abrothrix olivaceus brachiotis number FMN... 42 2.1
111gb|AF297890.1|AF297890 Abrothrix olivaceus brachiotis number FMN... 42 2.1
112gb|AF297889.1|AF297889 Abrothrix olivaceus brachiotis number FMN... 42 2.1
113gb|AF297888.1|AF297888 Abrothrix olivaceus brachiotis number FMN... 42 2.1
114gb|AF297887.1|AF297887 Abrothrix olivaceus brachiotis number FMN... 42 2.1
115gb|AF297886.1|AF297886 Abrothrix olivaceus brachiotis number FMN... 42 2.1
116gb|AF297885.1|AF297885 Abrothrix olivaceus brachiotis number FMN... 42 2.1
117gb|AF297884.1|AF297884 Abrothrix olivaceus brachiotis number FMN... 42 2.1
118gb|AF297883.1|AF297883 Abrothrix olivaceus brachiotis number FMN... 42 2.1
119gb|AF297882.1|AF297882 Abrothrix olivaceus brachiotis number FMN... 42 2.1
120gb|AF297881.1|AF297881 Abrothrix olivaceus pencanus number FMNH ... 42 2.1
121gb|AF297880.1|AF297880 Abrothrix olivaceus pencanus number FMNH ... 42 2.1
122gb|AF297878.1|AF297878 Abrothrix olivaceus olivaceus number FMNH... 42 2.1
123gb|AF027329.1| Akodon olivaceus canescens museum catalog number ... 42 2.1
124gb|AF027328.1| Akodon olivaceus canescens museum catalog number ... 42 2.1
125gb|AF027327.1| Akodon olivaceus canescens museum catalog number ... 42 2.1
126gb|AF027325.1| Akodon olivaceus canescens museum catalog number ... 42 2.1
127gb|AF027324.1| Akodon olivaceus canescens museum catalog number ... 42 2.1
128gb|AF027323.1| Akodon olivaceus canescens museum catalog number ... 42 2.1
129gb|AF027322.1| Akodon olivaceus beatus museum catalog number MVZ... 42 2.1
130gb|AF027321.1| Akodon olivaceus beatus museum catalog number MVZ... 42 2.1
131gb|AF027320.1| Akodon olivaceus beatus museum catalog number MVZ... 42 2.1
132gb|AF027319.1| Akodon olivaceus beatus museum catalog number MVZ... 42 2.1
133gb|AF027318.1| Akodon olivaceus beatus museum catalog number MVZ... 42 2.1
134gb|AF027316.1| Akodon olivaceus beatus museum catalog number MVZ... 42 2.1
135gb|AF027315.1| Akodon olivaceus beatus museum catalog number MVZ... 42 2.1
136gb|AF027314.1| Akodon olivaceus beatus museum catalog number MVZ... 42 2.1
137gb|AF027313.1| Akodon olivaceus beatus museum catalog number MVZ... 42 2.1
138gb|AF027312.1| Akodon olivaceus beatus museum catalog number MVZ... 42 2.1
139gb|AF027311.1| Akodon olivaceus brachiotis museum catalog number... 42 2.1
140gb|AF027310.1| Akodon olivaceus brachiotis museum catalog number... 42 2.1
141gb|AF027309.1| Akodon olivaceus brachiotis museum catalog number... 42 2.1
142gb|AF027308.1| Akodon olivaceus brachiotis museum catalog number... 42 2.1
143gb|AF027307.1| Akodon olivaceus brachiotis museum catalog number... 42 2.1
144gb|AF027305.1| Akodon olivaceus olivaceus museum catalog number ... 42 2.1
145gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 42 2.1
146gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 42 2.1
147emb|CT009733.13| Mouse DNA sequence from clone RP23-157D19 on ch... 42 2.1
148gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 8.2
149gb|AC140841.2| Mus musculus BAC clone RP24-470M20 from chromosom... 40 8.2
150gb|AC125357.4| Mus musculus BAC clone RP23-235J18 from chromosom... 40 8.2
151ref|XM_382770.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 40 8.2
152emb|AL139385.12| Human DNA sequence from clone RP11-90L1 on chro... 40 8.2
153emb|AL162756.2|NMA5Z2491 Neisseria meningitidis serogroup A stra... 40 8.2
154gb|AC087692.7| Homo sapiens chromosome 8, clone RP11-67D13, comp... 40 8.2
155gb|AC021523.8| Homo sapiens chromosome 8, clone RP11-336N16, com... 40 8.2
156emb|BX571800.8| Zebrafish DNA sequence from clone DKEY-29B15 in ... 40 8.2
157gb|AE002098.2| Neisseria meningitidis MC58, complete genome 40 8.2
158gb|AC132436.3| Mus musculus BAC clone RP23-226J18 from 1, comple... 40 8.2
159gb|AC137516.3| Mus musculus BAC clone RP23-259P18 from 1, comple... 40 8.2

>gb|AF307145.1| Hordeum vulgare subsp. vulgare glutamine-dependent asparagine
            synthetase 1 mRNA, complete cds
          Length = 1973

 Score = 1185 bits (598), Expect = 0.0
 Identities = 605/606 (99%), Gaps = 1/606 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    acatcttatttcttat-agaaacggcaagcaggacaggacaccatcaactctcaattgcg 59
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1873 acatcttatttcttatcagaaacggcaagcaggacaggacaccatcaactctcaattgcg 1814

                                                                        
Query: 60   acaccaggtgccgcaaccttgatcatcctcggcttcttgctggttcctgccatgatggtt 119
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1813 acaccaggtgccgcaaccttgatcatcctcggcttcttgctggttcctgccatgatggtt 1754

                                                                        
Query: 120  gctgggagatgctcctgctcataggccgagagatggactccaagtgctgctctccctgag 179
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1753 gctgggagatgctcctgctcataggccgagagatggactccaagtgctgctctccctgag 1694

                                                                        
Query: 180  ggatccaggttccccgaccaccgagcatcccactctactgccttcgccgtgctgcatgcg 239
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1693 ggatccaggttccccgaccaccgagcatcccactctactgccttcgccgtgctgcatgcg 1634

                                                                        
Query: 240  acgcttggcccgcctggcactgtcaggattgccgagttctgggggaagaacctctcaaat 299
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1633 acgcttggcccgcctggcactgtcaggattgccgagttctgggggaagaacctctcaaat 1574

                                                                        
Query: 300  atcatcctgtaacagtaggcctcttttgtagtcggggtgttgtgtgggtaaatgaacttc 359
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1573 atcatcctgtaacagtaggcctcttttgtagtcggggtgttgtgtgggtaaatgaacttc 1514

                                                                        
Query: 360  gcatttgacatcatcttatcggtcacatttgattctgtgtgggcctttaggccatcaatc 419
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1513 gcatttgacatcatcttatcggtcacatttgattctgtgtgggcctttaggccatcaatc 1454

                                                                        
Query: 420  cagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatgtgcttcggc 479
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1453 cagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatgtgcttcggc 1394

                                                                        
Query: 480  aggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctcaattcttcca 539
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1393 aggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctcaattcttcca 1334

                                                                        
Query: 540  agatcaggccggatcatcttccactcaggatcaatgctcattgcctcattgataaactcc 599
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1333 agatcaggccggatcatcttccactcaggatcaatgctcattgcctcattgataaactcc 1274

                  
Query: 600  ttgtcc 605
            ||||||
Sbjct: 1273 ttgtcc 1268



to top

>gb|BT009245.1| Triticum aestivum clone wlk1.pk0018.d4:fis, full insert mRNA sequence
          Length = 2064

 Score = 1027 bits (518), Expect = 0.0
 Identities = 585/606 (96%), Gaps = 1/606 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    acatcttatttcttat-agaaacggcaagcaggacaggacaccatcaactctcaattgcg 59
            |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1857 acatcttatttcttatcagaaacggcaagcaggacaggacaccatcaactctcaattgcg 1798

                                                                        
Query: 60   acaccaggtgccgcaaccttgatcatcctcggcttcttgctggttcctgccatgatggtt 119
            |||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1797 acaccaggcgccgcaacctcgatcatccttggcttcttgctggttcctgccatgatggtt 1738

                                                                        
Query: 120  gctgggagatgctcctgctcataggccgagagatggactccaagtgctgctctccctgag 179
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1737 gctgggagatgctcctgttcataggccgagagatggactccaagtgctgctctccctgag 1678

                                                                        
Query: 180  ggatccaggttccccgaccaccgagcatcccactctactgccttcgccgtgctgcatgcg 239
            |||||||||||||| |||||| | |||||||||||||| |||||||||||||||||||| 
Sbjct: 1677 ggatccaggttccctgaccactgggcatcccactctaccgccttcgccgtgctgcatgca 1618

                                                                        
Query: 240  acgcttggcccgcctggcactgtcaggattgccgagttctgggggaagaacctctcaaat 299
            ||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 1617 acgcttggcccacctggcaccgtcaggatcgccgagttctgggggaagaacctctcaaat 1558

                                                                        
Query: 300  atcatcctgtaacagtaggcctcttttgtagtcggggtgttgtgtgggtaaatgaacttc 359
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 1557 atcatcctgtaacagtaggcctcttttgtagtcggggtgttgtgtgggtagatgaacttt 1498

                                                                        
Query: 360  gcatttgacatcatcttatcggtcacatttgattctgtgtgggcctttaggccatcaatc 419
            |||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||
Sbjct: 1497 gcatttgacatcatcttatctgtcacatttgattctgcgtgagcctttaggccatcaatc 1438

                                                                        
Query: 420  cagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatgtgcttcggc 479
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1437 cagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatgtgcttcggc 1378

                                                                        
Query: 480  aggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctcaattcttcca 539
            |||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||
Sbjct: 1377 aggaatggttgctcctcgtcatcaaatgctttcctcagcatccatttctcaattcttcca 1318

                                                                        
Query: 540  agatcaggccggatcatcttccactcaggatcaatgctcattgcctcattgataaactcc 599
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1317 agatcaggccggatcatcttccactcaggatcaatgctcattgcctcattgataaactcc 1258

                  
Query: 600  ttgtcc 605
            ||||||
Sbjct: 1257 ttgtcc 1252



to top

>gb|AY621539.1| Triticum aestivum glutamine-dependent asparagine synthetase (ASN1)
            mRNA, complete cds
          Length = 1815

 Score =  997 bits (503), Expect = 0.0
 Identities = 563/583 (96%)
 Strand = Plus / Minus

                                                                        
Query: 23   ggcaagcaggacaggacaccatcaactctcaattgcgacaccaggtgccgcaaccttgat 82
            ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||
Sbjct: 1800 ggcaagcaggacaggacaccatcaactctcaattgcgacaccaggcgccgcaacctcgat 1741

                                                                        
Query: 83   catcctcggcttcttgctggttcctgccatgatggttgctgggagatgctcctgctcata 142
            |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1740 catcctcggcttcttgctggttcctgccatgatggttgctgggagatgctcctgttcata 1681

                                                                        
Query: 143  ggccgagagatggactccaagtgctgctctccctgagggatccaggttccccgaccaccg 202
            ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
Sbjct: 1680 ggccgagagatggactccaagtgctgctctccctgagggatccaggttccctgaccactg 1621

                                                                        
Query: 203  agcatcccactctactgccttcgccgtgctgcatgcgacgcttggcccgcctggcactgt 262
             |||||||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 1620 ggcatcccactctaccgccttcgccgtgctgcatgcaacgcttggcccacctggcaccgt 1561

                                                                        
Query: 263  caggattgccgagttctgggggaagaacctctcaaatatcatcctgtaacagtaggcctc 322
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1560 caggatcgccgagttctgggggaagaacctctcaaatatcatcctgtaacagtaggcctc 1501

                                                                        
Query: 323  ttttgtagtcggggtgttgtgtgggtaaatgaacttcgcatttgacatcatcttatcggt 382
            ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||
Sbjct: 1500 ttttgtagtcggggtgttgtgtgggtagatgaactttgcatttgacatcatcttatctgt 1441

                                                                        
Query: 383  cacatttgattctgtgtgggcctttaggccatcaatccagctgtagccaacaccatcact 442
            |||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1440 cacattcgattctgcgtgagcctttaggccatcaatccagctgtagccaacaccatcact 1381

                                                                        
Query: 443  gaactgctctttctgcctgtacagaatgtgcttcggcaggaatggttgctcctcgtcatc 502
            ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1380 gaactgctctttctgcctgtacagaatatgcttcggcaggaatggttgctcctcgtcatc 1321

                                                                        
Query: 503  aaatgctttcctcagaacccacttctcaattcttccaagatcaggccggatcatcttcca 562
            ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1320 aaatgctttcctcagcacccatttctcaattcttccaagatcaggccggatcatcttcca 1261

                                                       
Query: 563  ctcaggatcaatgctcattgcctcattgataaactccttgtcc 605
            |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1260 ctcaggatcaatgctcattgcctcattgataaactccttgtcc 1218



to top

>gb|BT009049.1| Triticum aestivum clone wdk9n1.pk001.f6:fis, full insert mRNA
            sequence
          Length = 2119

 Score =  504 bits (254), Expect = e-139
 Identities = 419/474 (88%)
 Strand = Plus / Minus

                                                                        
Query: 132  tcctgctcataggccgagagatggactccaagtgctgctctccctgagggatccaggttc 191
            |||||||| ||||| ||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 1739 tcctgctcgtaggctgagagatggactccaagcgctgctctcccagaggggtccaggttc 1680

                                                                        
Query: 192  cccgaccaccgagcatcccactctactgccttcgccgtgctgcatgcgacgcttggcccg 251
            || |||||  | |||||||||||||  ||||| || |||||||| || ||||||||||||
Sbjct: 1679 ccagaccattgggcatcccactctatagccttggctgtgctgcacgccacgcttggcccg 1620

                                                                        
Query: 252  cctggcactgtcaggattgccgagttctgggggaagaacctctcaaatatcatcctgtaa 311
            |||||||| || ||||| |||||| ||||||||||| |||||||||| ||||||||||||
Sbjct: 1619 cctggcaccgtgaggatcgccgagctctgggggaagtacctctcaaagatcatcctgtaa 1560

                                                                        
Query: 312  cagtaggcctcttttgtagtcggggtgttgtgtgggtaaatgaacttcgcatttgacatc 371
             ||||||||||||| || || ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 1559 tagtaggcctctttagttgttggggtgttgtgtgggtagatgaactttgcattggacatc 1500

                                                                        
Query: 372  atcttatcggtcacatttgattctgtgtgggcctttaggccatcaatccagctgtagcca 431
            ||||||||  ||||||||||  |||  ||  |||| ||||||||||||||||| || |||
Sbjct: 1499 atcttatcactcacatttgaggctgcatgatccttcaggccatcaatccagctataccca 1440

                                                                        
Query: 432  acaccatcactgaactgctctttctgcctgtacagaatgtgcttcggcaggaatggttgc 491
            ||||||||||| |||||||| ||||||||||||||||| |||||||||||||| ||| ||
Sbjct: 1439 acaccatcactaaactgctccttctgcctgtacagaatatgcttcggcaggaagggtcgc 1380

                                                                        
Query: 492  tcctcgtcatcaaatgctttcctcagaacccacttctcaattcttccaagatcaggccgg 551
            ||||| ||||| || ||||||||||| | ||| |||||||||||||||||||||||||||
Sbjct: 1379 tcctcatcatcgaacgctttcctcagtatccatttctcaattcttccaagatcaggccgg 1320

                                                                  
Query: 552  atcatcttccactcaggatcaatgctcattgcctcattgataaactccttgtcc 605
            ||||||||||| || ||||| |||||||| ||||||||||| ||||||||||||
Sbjct: 1319 atcatcttccattcgggatctatgctcatagcctcattgatgaactccttgtcc 1266



to top

>gb|AY193714.1| Hordeum vulgare asparagine synthetase 2 (AS2) mRNA, complete cds
          Length = 1867

 Score =  488 bits (246), Expect = e-134
 Identities = 417/474 (87%)
 Strand = Plus / Minus

                                                                        
Query: 132  tcctgctcataggccgagagatggactccaagtgctgctctccctgagggatccaggttc 191
            |||||||| ||||| ||||||||||||||||| ||||||||||| ||||| |||||||||
Sbjct: 1670 tcctgctcgtaggctgagagatggactccaagcgctgctctcccagaggggtccaggttc 1611

                                                                        
Query: 192  cccgaccaccgagcatcccactctactgccttcgccgtgctgcatgcgacgcttggcccg 251
            || |||||| | || |||||||||| |||||| || |||||||| || ||||||||||||
Sbjct: 1610 ccagaccactgcgcgtcccactctattgccttggctgtgctgcacgccacgcttggcccg 1551

                                                                        
Query: 252  cctggcactgtcaggattgccgagttctgggggaagaacctctcaaatatcatcctgtaa 311
            |||||||| || ||||| |||||| |||| |||||| ||||||| || ||||||||||||
Sbjct: 1550 cctggcaccgtgaggatcgccgagctctgagggaagtacctctcgaagatcatcctgtaa 1491

                                                                        
Query: 312  cagtaggcctcttttgtagtcggggtgttgtgtgggtaaatgaacttcgcatttgacatc 371
             ||||||||||||| || || ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 1490 tagtaggcctctttagttgttggggtgttgtgtgggtagatgaactttgcattggacatc 1431

                                                                        
Query: 372  atcttatcggtcacatttgattctgtgtgggcctttaggccatcaatccagctgtagcca 431
            ||||||||  ||||||||||| |||  ||  |||| ||||||||||||||||| || |||
Sbjct: 1430 atcttatcactcacatttgatgctgcatgatccttaaggccatcaatccagctataccca 1371

                                                                        
Query: 432  acaccatcactgaactgctctttctgcctgtacagaatgtgcttcggcaggaatggttgc 491
            ||||||||||| |||||||| |||||||||||||||||||||||||||| ||| |||| |
Sbjct: 1370 acaccatcactaaactgctccttctgcctgtacagaatgtgcttcggcaagaacggtttc 1311

                                                                        
Query: 492  tcctcgtcatcaaatgctttcctcagaacccacttctcaattcttccaagatcaggccgg 551
            ||||| || || || ||||||||||| | ||| || ||||||||||||||||||||||||
Sbjct: 1310 tcctcatcgtcgaacgctttcctcagtatccatttttcaattcttccaagatcaggccgg 1251

                                                                  
Query: 552  atcatcttccactcaggatcaatgctcattgcctcattgataaactccttgtcc 605
            ||||||||||| |||||||| |||||||| ||||||| ||| ||||||||||||
Sbjct: 1250 atcatcttccattcaggatctatgctcatagcctcatcgatgaactccttgtcc 1197



to top

>gb|AY108716.1| Zea mays PCO093600 mRNA sequence
          Length = 673

 Score =  323 bits (163), Expect = 4e-85
 Identities = 331/387 (85%)
 Strand = Plus / Minus

                                                                       
Query: 219 gccttcgccgtgctgcatgcgacgcttggcccgcctggcactgtcaggattgccgagttc 278
           ||||| || |||||||| || || |||||||| || || || |||||||| || || |||
Sbjct: 560 gccttggctgtgctgcacgccacacttggcccaccaggtaccgtcaggatagcagatttc 501

                                                                       
Query: 279 tgggggaagaacctctcaaatatcatcctgtaacagtaggcctcttttgtagtcggggtg 338
           || |||||||||||||| || | |||||||||  |||||||||| || || ||||| |||
Sbjct: 500 tgtgggaagaacctctcgaagaccatcctgtagtagtaggcctccttggtggtcggagtg 441

                                                                       
Query: 339 ttgtgtgggtaaatgaacttcgcatttgacatcatcttatcggtcacatttgattctgtg 398
           ||||||||| | |||||||| |||||||||| |||||| || ||||||||||||  ||  
Sbjct: 440 ttgtgtgggaagatgaactttgcatttgacagcatcttgtcagtcacatttgatgttgca 381

                                                                       
Query: 399 tgggcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgc 458
           || ||||| |||||||| ||||||||||| ||||| || |||||||||||||| ||||| 
Sbjct: 380 tgagccttcaggccatcgatccagctgtacccaacgccgtcactgaactgctccttctgt 321

                                                                       
Query: 459 ctgtacagaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcaga 518
           ||||| || || ||||| ||||||||||| ||||||||||| || ||||| |||||||| 
Sbjct: 320 ctgtagaggatatgcttgggcaggaatggctgctcctcgtcgtcgaatgccttcctcagc 261

                                                                       
Query: 519 acccacttctcaattcttccaagatcaggccggatcatcttccactcaggatcaatgctc 578
           |||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||||
Sbjct: 260 acccacttctcaatccttccaagatcaggctggaccatcttccactcaggatcgatgctc 201

                                      
Query: 579 attgcctcattgataaactccttgtcc 605
           || ||| ||||||| ||||||||||||
Sbjct: 200 atggccgcattgatgaactccttgtcc 174



to top

>gb|U77678.1|GMU77678 Glycine max asparagine synthetase 2 (AS2) mRNA, complete cds
          Length = 2143

 Score =  119 bits (60), Expect = 1e-23
 Identities = 117/136 (86%)
 Strand = Plus / Minus

                                                                        
Query: 399  tgggcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgc 458
            |||||||| ||| |||||||||| || |||||||| ||||||||||| || |||||||||
Sbjct: 1557 tgggccttaagggcatcaatccaactatagccaactccatcactgaattgttctttctgc 1498

                                                                        
Query: 459  ctgtacagaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcaga 518
            ||||| | ||||||||| |||||  | || ||||| || |||||||| ||| ||||||||
Sbjct: 1497 ctgtataaaatgtgctttggcagataaggatgctcttcatcatcaaaggctctcctcaga 1438

                            
Query: 519  acccacttctcaattc 534
            | ||||||||||||||
Sbjct: 1437 atccacttctcaattc 1422



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                  
Query: 552  atcatcttccactcaggatcaatgctcattgcctcattgataaactccttgtcc 605
            ||||||||||||||||| ||||| ||||||||  ||||||||||| ||||||||
Sbjct: 1404 atcatcttccactcagggtcaatactcattgcagcattgataaacgccttgtcc 1351



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 273  gagttctgggggaagaacctctcaaatatcatcctgta 310
            |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1683 gagttctgagggaagaacctctcaaagatcattctgta 1646



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 156  actccaagtgctgctctccctgagggatccaggtt 190
            ||||||||||||||||| || |||||||| |||||
Sbjct: 1800 actccaagtgctgctctaccagagggatcaaggtt 1766



to top

>emb|AJ009952.1|PVU9952 Phaseolus vulgaris mRNA for asparagine synthetase type II
          Length = 2044

 Score =  113 bits (57), Expect = 7e-22
 Identities = 114/133 (85%)
 Strand = Plus / Minus

                                                                        
Query: 402  gcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctg 461
            ||||| |||||||||||||| || |||||||| ||||||||||| || ||||||||||||
Sbjct: 1419 gccttaaggccatcaatccaactatagccaactccatcactgaattgttctttctgcctg 1360

                                                                        
Query: 462  tacagaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacc 521
            || | ||||||||| |||||  | || || || || |||||||| ||| ||||||||| |
Sbjct: 1359 tataaaatgtgctttggcagataaggctggtcttcatcatcaaaggctctcctcagaatc 1300

                         
Query: 522  cacttctcaattc 534
            |||||||||||||
Sbjct: 1299 cacttctcaattc 1287



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 273  gagttctgggggaagaacctctcaaatatcat 304
            |||||||| ||||||||||||||||| |||||
Sbjct: 1548 gagttctgagggaagaacctctcaaagatcat 1517



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 570  tcaatgctcattgcctcattgataaactccttgtcc 605
            |||||| |||||||  ||||||||||||||||||||
Sbjct: 1251 tcaatgttcattgcagcattgataaactccttgtcc 1216



to top

>gb|AY240926.1| Lycopersicon esculentum asparagine synthetase (AS1) mRNA, partial
           cds
          Length = 730

 Score =  111 bits (56), Expect = 3e-21
 Identities = 152/184 (82%)
 Strand = Plus / Minus

                                                                       
Query: 415 caatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatgtgct 474
           ||||||| ||||| ||||| ||||| ||||| || |||||||||||||||||||| ||||
Sbjct: 730 caatccaactgtatccaacgccatcgctgaattgttctttctgcctgtacagaatatgct 671

                                                                       
Query: 475 tcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctcaattc 534
           | || ||  | ||||||||||| |||||||| || ||||| |||||||||||||| || |
Sbjct: 670 ttggaagatacggttgctcctcatcatcaaacgccttcctaagaacccacttctcgatcc 611

                                                                       
Query: 535 ttccaagatcaggccggatcatcttccactcaggatcaatgctcattgcctcattgataa 594
           ||||  ||||| |    |||||||||||||| ||||| || ||||| ||  ||||||| |
Sbjct: 610 ttccttgatcatgtttaatcatcttccactcgggatcgatactcatggcaacattgatga 551

               
Query: 595 actc 598
           ||||
Sbjct: 550 actc 547



to top

>ref|NM_121062.2| Arabidopsis thaliana ASN3 (ASPARAGINE SYNTHETASE 3); asparagine
            synthase (glutamine-hydrolyzing) AT5G10240 (ASN3)
            transcript variant AT5G10240.1 mRNA, complete cds
          Length = 2018

 Score =  109 bits (55), Expect = 1e-20
 Identities = 148/179 (82%)
 Strand = Plus / Minus

                                                                        
Query: 405  tttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtac 464
            ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||| || 
Sbjct: 1443 tttagaccatcaatccagctgtatccaactccatcactgaactgttctttctgcctatat 1384

                                                                        
Query: 465  agaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccac 524
            ||||||||||| || ||| | || |  | ||| |||||||| || || |  |  ||||| 
Sbjct: 1383 agaatgtgctttggtaggtaaggatttttctcatcatcaaaggcattgcgtaacacccat 1324

                                                                       
Query: 525  ttctcaattcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
            ||||| || ||||| | ||||||||  |||||||||||||| ||||| |||||||||||
Sbjct: 1323 ttctcgatccttcccaaatcaggcctaatcatcttccactctggatcgatgctcattgc 1265



to top

>ref|NM_001036787.1| Arabidopsis thaliana ASN3 (ASPARAGINE SYNTHETASE 3); asparagine
            synthase (glutamine-hydrolyzing) AT5G10240 (ASN3)
            transcript variant AT5G10240.2 mRNA, complete cds
          Length = 2028

 Score =  109 bits (55), Expect = 1e-20
 Identities = 148/179 (82%)
 Strand = Plus / Minus

                                                                        
Query: 405  tttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtac 464
            ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||| || 
Sbjct: 1442 tttagaccatcaatccagctgtatccaactccatcactgaactgttctttctgcctatat 1383

                                                                        
Query: 465  agaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccac 524
            ||||||||||| || ||| | || |  | ||| |||||||| || || |  |  ||||| 
Sbjct: 1382 agaatgtgctttggtaggtaaggatttttctcatcatcaaaggcattgcgtaacacccat 1323

                                                                       
Query: 525  ttctcaattcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
            ||||| || ||||| | ||||||||  |||||||||||||| ||||| |||||||||||
Sbjct: 1322 ttctcgatccttcccaaatcaggcctaatcatcttccactctggatcgatgctcattgc 1264



to top

>emb|X82849.1|ZMASPSY Z.mays mRNA for aspargine synthetase
          Length = 2135

 Score =  109 bits (55), Expect = 1e-20
 Identities = 109/127 (85%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||| |||||| |||||||||| || ||||||||||| |||||||||||||| |||
Sbjct: 1394 aggccatcgatccagttgtagccaacgccgtcactgaactgttctttctgcctgtagaga 1335

                                                                        
Query: 468  atgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttc 527
            || ||||| |||||| | || ||||| ||||| || || || |||||||  |||||||||
Sbjct: 1334 atatgcttgggcaggtaagggtgctcgtcgtcgtcgaacgccttcctcatgacccacttc 1275

                   
Query: 528  tcaattc 534
            |||||||
Sbjct: 1274 tcaattc 1268



to top

>gb|AF095452.1|AF095452 Arabidopsis thaliana asparagine synthetase (ASN3) mRNA, complete cds
          Length = 1986

 Score =  109 bits (55), Expect = 1e-20
 Identities = 148/179 (82%)
 Strand = Plus / Minus

                                                                        
Query: 405  tttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtac 464
            ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||| || 
Sbjct: 1397 tttagaccatcaatccagctgtatccaactccatcactgaactgttctttctgcctatat 1338

                                                                        
Query: 465  agaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccac 524
            ||||||||||| || ||| | || |  | ||| |||||||| || || |  |  ||||| 
Sbjct: 1337 agaatgtgctttggtaggtaaggatttttctcatcatcaaaggcattgcgtaacacccat 1278

                                                                       
Query: 525  ttctcaattcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
            ||||| || ||||| | ||||||||  |||||||||||||| ||||| |||||||||||
Sbjct: 1277 ttctcgatccttcccaaatcaggcctaatcatcttccactctggatcgatgctcattgc 1219



to top

>emb|BX830209.1|CNS09YW6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB66ZB09 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1954

 Score =  109 bits (55), Expect = 1e-20
 Identities = 148/179 (82%)
 Strand = Plus / Minus

                                                                        
Query: 405  tttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtac 464
            ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||| || 
Sbjct: 1403 tttagaccatcaatccagctgtatccaactccatcactgaactgttctttctgcctatat 1344

                                                                        
Query: 465  agaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccac 524
            ||||||||||| || ||| | || |  | ||| |||||||| || || |  |  ||||| 
Sbjct: 1343 agaatgtgctttggtaggtaaggatttttctcatcatcaaaggcattgcgtaacacccat 1284

                                                                       
Query: 525  ttctcaattcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
            ||||| || ||||| | ||||||||  |||||||||||||| ||||| |||||||||||
Sbjct: 1283 ttctcgatccttcccaaatcaggcctaatcatcttccactctggatcgatgctcattgc 1225



to top

>gb|BT005014.1| Arabidopsis thaliana clone U20709 putative asparagine synthetase ASN3
            (At5g10240) mRNA, complete cds
          Length = 1768

 Score =  109 bits (55), Expect = 1e-20
 Identities = 148/179 (82%)
 Strand = Plus / Minus

                                                                        
Query: 405  tttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtac 464
            ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||| || 
Sbjct: 1397 tttagaccatcaatccagctgtatccaactccatcactgaactgttctttctgcctatat 1338

                                                                        
Query: 465  agaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccac 524
            ||||||||||| || ||| | || |  | ||| |||||||| || || |  |  ||||| 
Sbjct: 1337 agaatgtgctttggtaggtaaggatttttctcatcatcaaaggcattgcgtaacacccat 1278

                                                                       
Query: 525  ttctcaattcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
            ||||| || ||||| | ||||||||  |||||||||||||| ||||| |||||||||||
Sbjct: 1277 ttctcgatccttcccaaatcaggcctaatcatcttccactctggatcgatgctcattgc 1219



to top

>gb|BT003929.1| Arabidopsis thaliana clone RAFL15-17-K18 (R20709) putative asparagine
            synthetase ASN3 (At5g10240) mRNA, complete cds
          Length = 2026

 Score =  109 bits (55), Expect = 1e-20
 Identities = 148/179 (82%)
 Strand = Plus / Minus

                                                                        
Query: 405  tttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtac 464
            ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||| || 
Sbjct: 1443 tttagaccatcaatccagctgtatccaactccatcactgaactgttctttctgcctatat 1384

                                                                        
Query: 465  agaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccac 524
            ||||||||||| || ||| | || |  | ||| |||||||| || || |  |  ||||| 
Sbjct: 1383 agaatgtgctttggtaggtaaggatttttctcatcatcaaaggcattgcgtaacacccat 1324

                                                                       
Query: 525  ttctcaattcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
            ||||| || ||||| | ||||||||  |||||||||||||| ||||| |||||||||||
Sbjct: 1323 ttctcgatccttcccaaatcaggcctaatcatcttccactctggatcgatgctcattgc 1265



to top

>emb|X84448.1|BOASPSYN B.oleracea mRNA for asparagine synthetase
          Length = 2085

 Score =  103 bits (52), Expect = 7e-19
 Identities = 112/132 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398  gtgggcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctg 457
            |||||| || |||||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1439 gtgggctttgaggccatcgatccagctgtagccaacaccatcactaaactgctctttctg 1380

                                                                        
Query: 458  cctgtacagaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcag 517
             ||||| |||||||| || ||||   | ||  | || || |||||||| ||| |||| ||
Sbjct: 1379 tctgtagagaatgtgttttggcaaataaggacgttcttcatcatcaaaggctctccttag 1320

                        
Query: 518  aacccacttctc 529
            ||||||||||||
Sbjct: 1319 aacccacttctc 1308



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 268  ttgccgagttctgggggaagaacctctcaaatatcatcctgtaacagtaggcctcttt 325
            ||||||||||||| ||||||||||||||||| ||||| |||||| |||| || |||||
Sbjct: 1569 ttgccgagttctgtgggaagaacctctcaaagatcattctgtaatagtatgcttcttt 1512



to top

>gb|AF530460.1| Striga hermonthica asparagine synthetase (AS) mRNA, complete cds
          Length = 2278

 Score =  103 bits (52), Expect = 7e-19
 Identities = 160/196 (81%)
 Strand = Plus / Minus

                                                                        
Query: 410  gccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaat 469
            |||||||||||| ||||| ||||| ||||| || ||||| |||||||| ||||| |  ||
Sbjct: 1635 gccatcaatccaactgtatccaactccatcgctaaactgttctttctgtctgtataatat 1576

                                                                        
Query: 470  gtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctc 529
            |||||| ||||   | |||| |||||| |||||||| || || | ||||| |||||||||
Sbjct: 1575 gtgctttggcaaataaggtttctcctcatcatcaaacgcgttgcgcagaatccacttctc 1516

                                                                        
Query: 530  aattcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgcctcatt 589
            ||||| |||||||||||| |  ||||| ||||| || |||||||| | ||| ||  ||| 
Sbjct: 1515 aattcgtccaagatcaggtcttatcattttccattccggatcaatacccatcgcaacatc 1456

                            
Query: 590  gataaactccttgtcc 605
            |||||| |||||||||
Sbjct: 1455 gataaattccttgtcc 1440



to top

>dbj|AB035247.1| Astragalus sinicus AsAS1 mRNA for asparagine synthetase, complete cds
          Length = 1931

 Score =  101 bits (51), Expect = 3e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            ||||||||||||||||| ||||||||||||||||||||||| |||||||||||  | | |
Sbjct: 1402 aggccatcaatccagctatagccaacaccatcactgaactgttctttctgcctaaataaa 1343

                                                                        
Query: 468  atgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttc 527
            || ||||| |||||  | || ||||| || |||||||| || ||||||||||   | |||
Sbjct: 1342 atatgctttggcagataaggatgctcttcatcatcaaaggccttcctcagaatatatttc 1283

                       
Query: 528  tcaattcttcc 538
            |||||||||||
Sbjct: 1282 tcaattcttcc 1272



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 268  ttgccgagttctgggggaagaacctctcaaatatcatcctgta 310
            |||| |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1542 ttgctgagttctgagggaagaacctctcaaagatcattctgta 1500



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 565  caggatcaatgctcattgcctcattgataaactccttgtcc 605
            ||||||||||  |||||||  ||||||||||||||||||||
Sbjct: 1245 caggatcaatattcattgcaacattgataaactccttgtcc 1205



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 67/73 (91%)
 Strand = Plus / Plus

                                                                            
Query: 402      gcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctg 461
                ||||| |||||||| |||||| ||||||| || |||||||||||||||||||||||||||
Sbjct: 10093209 gccttcaggccatcgatccagttgtagccgacgccatcactgaactgctctttctgcctg 10093268

                             
Query: 462      tacagaatgtgct 474
                ||||| |||||||
Sbjct: 10093269 tacagtatgtgct 10093281



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                            
Query: 473      cttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctcaat 532
                |||||||||| | || ||||||||||| || || || ||||||| |||||||||||| ||
Sbjct: 10093367 cttcggcaggtaaggatgctcctcgtcgtcgaacgccttcctcataacccacttctcgat 10093426

                              
Query: 533      tcttccaagatcag 546
                 |  ||||||||||
Sbjct: 10093427 gcgaccaagatcag 10093440



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                   
Query: 554      catcttccactcaggatcaatgctcattgcctcattgataaactccttgtc 604
                ||||||||||||||| || |||||||| ||  | ||||| |||||||||||
Sbjct: 10093548 catcttccactcagggtccatgctcatggcgacgttgatgaactccttgtc 10093598



to top

>emb|X89409.1|LJAS1GENE L.japonicus mRNA for asparagine synthetase (clone LJAS1)
          Length = 2053

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 106/125 (84%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||||||||| || |||||||| ||||||||||| || ||||||||||| ||||||
Sbjct: 1492 aggccatcaatccaactatagccaactccatcactgaattgttctttctgcctatacaga 1433

                                                                        
Query: 468  atgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttc 527
            |||||||| |||||  | |||| ||| || |||||||| ||  |||||||||   |||||
Sbjct: 1432 atgtgctttggcagataaggtttctcttcatcatcaaaggccctcctcagaatatacttc 1373

                 
Query: 528  tcaat 532
            |||||
Sbjct: 1372 tcaat 1368



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 128/161 (79%)
 Strand = Plus / Minus

                                                                        
Query: 150  agatggactccaagtgctgctctccctgagggatccaggttccccgaccaccgagcatcc 209
            ||||| ||||| ||||||||||| ||||| ||||| |||||    |||||   |||||||
Sbjct: 1750 agatgcactcctagtgctgctctacctgaaggatcaaggttattagaccaagcagcatcc 1691

                                                                        
Query: 210  cactctactgccttcgccgtgctgcatgcgacgcttggcccgcctggcactgtcaggatt 269
            ||||| |||||||| || ||||| ||||| ||  |||| || || || || || ||  | 
Sbjct: 1690 cactcaactgcctttgctgtgctacatgcaacagttggtcctccaggaacagttagccta 1631

                                                     
Query: 270  gccgagttctgggggaagaacctctcaaatatcatcctgta 310
            || |||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 1630 gctgagttctgtgggaagaacctttcaaagatcattctgta 1590



to top

>gb|AC137634.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0078C05, complete sequence
          Length = 122116

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 67/73 (91%)
 Strand = Plus / Plus

                                                                         
Query: 402   gcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctg 461
             ||||| |||||||| |||||| ||||||| || |||||||||||||||||||||||||||
Sbjct: 38830 gccttcaggccatcgatccagttgtagccgacgccatcactgaactgctctttctgcctg 38889

                          
Query: 462   tacagaatgtgct 474
             ||||| |||||||
Sbjct: 38890 tacagtatgtgct 38902



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                         
Query: 473   cttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctcaat 532
             |||||||||| | || ||||||||||| || || || ||||||| |||||||||||| ||
Sbjct: 38988 cttcggcaggtaaggatgctcctcgtcgtcgaacgccttcctcataacccacttctcgat 39047

                           
Query: 533   tcttccaagatcag 546
              |  ||||||||||
Sbjct: 39048 gcgaccaagatcag 39061



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                
Query: 554   catcttccactcaggatcaatgctcattgcctcattgataaactccttgtc 604
             ||||||||||||||| || |||||||| ||  | ||||| |||||||||||
Sbjct: 39169 catcttccactcagggtccatgctcatggcgacgttgatgaactccttgtc 39219



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 67/73 (91%)
 Strand = Plus / Plus

                                                                            
Query: 402      gcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctg 461
                ||||| |||||||| |||||| ||||||| || |||||||||||||||||||||||||||
Sbjct: 10091330 gccttcaggccatcgatccagttgtagccgacgccatcactgaactgctctttctgcctg 10091389

                             
Query: 462      tacagaatgtgct 474
                ||||| |||||||
Sbjct: 10091390 tacagtatgtgct 10091402



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                            
Query: 473      cttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctcaat 532
                |||||||||| | || ||||||||||| || || || ||||||| |||||||||||| ||
Sbjct: 10091488 cttcggcaggtaaggatgctcctcgtcgtcgaacgccttcctcataacccacttctcgat 10091547

                              
Query: 533      tcttccaagatcag 546
                 |  ||||||||||
Sbjct: 10091548 gcgaccaagatcag 10091561



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                   
Query: 554      catcttccactcaggatcaatgctcattgcctcattgataaactccttgtc 604
                ||||||||||||||| || |||||||| ||  | ||||| |||||||||||
Sbjct: 10091669 catcttccactcagggtccatgctcatggcgacgttgatgaactccttgtc 10091719



to top

>dbj|AK100247.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023058E10, full
            insert sequence
          Length = 2265

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/165 (82%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            ||||||||||| ||||| ||||||||||||||||| ||||| || |||||||| ||||||
Sbjct: 1513 ccatcaatccaactgtacccaacaccatcactgaattgctccttttgcctgtatagaatg 1454

                                                                        
Query: 471  tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
            ||||| || |   | || | |||||| ||||||||||| ||||  |||||||| ||||||
Sbjct: 1453 tgcttaggtaaatagggcttctcctcatcatcaaatgcattccggagaacccatttctca 1394

                                                         
Query: 531  attcttccaagatcaggccggatcatcttccactcaggatcaatg 575
            || |  ||||||||| |    ||||| ||||| ||||||||||||
Sbjct: 1393 atacggccaagatcacgttttatcattttccattcaggatcaatg 1349



to top

>gb|U55873.1|OSU55873 Oryza sativa asparagine synthetase mRNA, complete cds
          Length = 2172

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/165 (82%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            ||||||||||| ||||| ||||||||||||||||| ||||| || |||||||| ||||||
Sbjct: 1524 ccatcaatccaactgtacccaacaccatcactgaattgctccttttgcctgtatagaatg 1465

                                                                        
Query: 471  tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
            ||||| || |   | || | |||||| ||||||||||| ||||  |||||||| ||||||
Sbjct: 1464 tgcttaggtaaatagggcttctcctcatcatcaaatgcattccggagaacccatttctca 1405

                                                         
Query: 531  attcttccaagatcaggccggatcatcttccactcaggatcaatg 575
            || |  ||||||||| |    ||||| ||||| ||||||||||||
Sbjct: 1404 atacggccaagatcacgttttatcattttccattcaggatcaatg 1360



to top

>dbj|D83378.1|RICAS Oryza sativa (japonica cultivar-group) mRNA for asparagine
            synthetase, complete cds
          Length = 2141

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/165 (82%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            ||||||||||| ||||| ||||||||||||||||| ||||| || |||||||| ||||||
Sbjct: 1524 ccatcaatccaactgtacccaacaccatcactgaattgctccttttgcctgtatagaatg 1465

                                                                        
Query: 471  tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
            ||||| || |   | || | |||||| ||||||||||| ||||  |||||||| ||||||
Sbjct: 1464 tgcttaggtaaatagggcttctcctcatcatcaaatgcattccggagaacccatttctca 1405

                                                         
Query: 531  attcttccaagatcaggccggatcatcttccactcaggatcaatg 575
            || |  ||||||||| |    ||||| ||||| ||||||||||||
Sbjct: 1404 atacggccaagatcacgttttatcattttccattcaggatcaatg 1360



to top

>emb|X52180.1|PSAS2 Pea AS2 root mRNA for asparagine synthase (EC 6.3.5.4)
          Length = 2002

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            |||||||||||||| || ||||| ||||||||||| || ||||||||||| |||| ||||
Sbjct: 1492 ccatcaatccagctataaccaactccatcactgaattgttctttctgcctatacaaaatg 1433

                                                                        
Query: 471  tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
            ||||| |||||  | || | ||| |||||||||||||| ||||||| ||   ||||||||
Sbjct: 1432 tgctttggcagataaggattctcttcgtcatcaaatgccttcctcaaaatatacttctca 1373

                
Query: 531  attc 534
            ||||
Sbjct: 1372 attc 1369



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 268  ttgccgagttctgggggaagaacctctcaaatatcatcctgta 310
            ||||||||||||| |||||||||| |||||| ||||| |||||
Sbjct: 1635 ttgccgagttctgagggaagaaccgctcaaagatcattctgta 1593



to top

>emb|X67958.1|AOASPSYNM A.officinalis mRNA for asparagine synthetase
          Length = 1978

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 164/203 (80%)
 Strand = Plus / Minus

                                                                        
Query: 402  gcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctg 461
            ||||| || ||||||||||| || || ||||||||||||||||||||||| || ||||| 
Sbjct: 1455 gccttcagcccatcaatccaactatatccaacaccatcactgaactgctccttttgccta 1396

                                                                        
Query: 462  tacagaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacc 521
            || ||||| ||||| || ||  | || | ||| || |||||||| ||||||||||| |||
Sbjct: 1395 tagagaatatgctttggaagatagggattctcttcatcatcaaaagctttcctcagtacc 1336

                                                                        
Query: 522  cacttctcaattcttccaagatcaggccggatcatcttccactcaggatcaatgctcatt 581
            |||||||| || || || |||||||||   ||||| ||| | |||||||| || ||||| 
Sbjct: 1335 cacttctcgatcctcccgagatcaggcttaatcattttcgattcaggatctatactcata 1276

                                   
Query: 582  gcctcattgataaactccttgtc 604
            ||  |||  || |||||||||||
Sbjct: 1275 gcaacatccatgaactccttgtc 1253



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 160/201 (79%)
 Strand = Plus / Minus

                                                                        
Query: 152  atggactccaagtgctgctctccctgagggatccaggttccccgaccaccgagcatccca 211
            |||||| || || ||||||||||| || |||||||  ||   |||||| ||||| |||||
Sbjct: 1705 atggacgccgagagctgctctccccgacggatccaaattgttcgaccagcgagcgtccca 1646

                                                                        
Query: 212  ctctactgccttcgccgtgctgcatgcgacgcttggcccgcctggcactgtcaggattgc 271
             || |  ||||||||||||||||| || | |||||| || || || || || |   | ||
Sbjct: 1645 ttcgatagccttcgccgtgctgcaagcaatgcttggacctccagggacagtaaatctcgc 1586

                                                                        
Query: 272  cgagttctgggggaagaacctctcaaatatcatcctgtaacagtaggcctcttttgtagt 331
            ||||||||| ||||||||||| ||||| ||||| |||||  | || ||||||||||| ||
Sbjct: 1585 cgagttctgagggaagaacctttcaaagatcattctgtagtaataagcctcttttgtggt 1526

                                 
Query: 332  cggggtgttgtgtgggtaaat 352
             || |||||||| ||||||||
Sbjct: 1525 tggtgtgttgtgggggtaaat 1505



to top

>gb|BT013473.1| Lycopersicon esculentum clone 132134R, mRNA sequence
          Length = 1923

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 142/174 (81%)
 Strand = Plus / Minus

                                                                        
Query: 410  gccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaat 469
            |||||||||||| ||||||||||| |||||||||||||| || |||||||| |||| |||
Sbjct: 1458 gccatcaatccaactgtagccaactccatcactgaactgttccttctgcctatacaaaat 1399

                                                                        
Query: 470  gtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctc 529
             ||||| |||||  | || | ||  || || ||||| || || |  | ||||||||| ||
Sbjct: 1398 atgctttggcagataaggattctgatcatcgtcaaaagcattacgtacaacccacttttc 1339

                                                                  
Query: 530  aattcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
             |||||||| || ||||| |||||||| ||||| || ||||||||| |||||||
Sbjct: 1338 tattcttccgaggtcaggtcggatcattttccattccggatcaatgttcattgc 1285



to top

>emb|AL360334.1|ATF18D22 Arabidopsis thaliana DNA chromosome 5, BAC clone F18D22 (ESSA project)
          Length = 57180

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 64/70 (91%)
 Strand = Plus / Plus

                                                                         
Query: 405   tttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtac 464
             ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||| || 
Sbjct: 18256 tttagaccatcaatccagctgtatccaactccatcactgaactgttctttctgcctatat 18315

                       
Query: 465   agaatgtgct 474
             ||||||||||
Sbjct: 18316 agaatgtgct 18325



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 554   catcttccactcaggatcaatgctcattgc 583
             |||||||||||| ||||| |||||||||||
Sbjct: 18699 catcttccactctggatcgatgctcattgc 18728



to top

>gb|AY103777.1| Zea mays PCO113531 mRNA sequence
          Length = 2209

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||| |||||| |||||||||| || ||||||||||| |||||||||| ||| |||
Sbjct: 1488 aggccatcgatccagttgtagccaacgccgtcactgaactgttctttctgccggtagaga 1429

                                                                        
Query: 468  atgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttc 527
            || ||||| |||||| | || ||||| ||||| || || || |||||||  |||||||||
Sbjct: 1428 atatgcttgggcaggtaagggtgctcgtcgtcgtcgaacgccttcctcatgacccacttc 1369

              
Query: 528  tc 529
            ||
Sbjct: 1368 tc 1367



to top

>emb|AL356332.1|ATT31P16 Arabidopsis thaliana DNA chromosome 5, BAC clone T31P16 (ESSA project)
          Length = 80088

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 64/70 (91%)
 Strand = Plus / Plus

                                                                         
Query: 405   tttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtac 464
             ||||| ||||||||||||||||| ||||| |||||||||||||| ||||||||||| || 
Sbjct: 78158 tttagaccatcaatccagctgtatccaactccatcactgaactgttctttctgcctatat 78217

                       
Query: 465   agaatgtgct 474
             ||||||||||
Sbjct: 78218 agaatgtgct 78227



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 554   catcttccactcaggatcaatgctcattgc 583
             |||||||||||| ||||| |||||||||||
Sbjct: 78601 catcttccactctggatcgatgctcattgc 78630



to top

>dbj|AB050900.1| Raphanus sativus Asn1 mRNA for asparagine synthetase, complete cds
          Length = 2088

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                        
Query: 399  tgggcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgc 458
            ||||| || |||||||| ||||||||||| |||||||||||||| |||||||||||||| 
Sbjct: 1458 tgggctttgaggccatcgatccagctgtacccaacaccatcactaaactgctctttctgt 1399

                          
Query: 459  ctgtacagaatgtg 472
            ||||| ||||||||
Sbjct: 1398 ctgtagagaatgtg 1385



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                      
Query: 268  ttgccgagttctgggggaagaacctctcaaatatcatcctgtaacagtaggcctcttt 325
            ||||||||||||| |||||||||||||| || ||||| |||||| |||| || |||||
Sbjct: 1589 ttgccgagttctgtgggaagaacctctcgaagatcattctgtaatagtaagcttcttt 1532



to top

>ref|NM_180941.1| Arabidopsis thaliana ASN2 (ASPARAGINE SYNTHETASE 2); asparagine
            synthase (glutamine-hydrolyzing) AT5G65010 (ASN2)
            transcript variant AT5G65010.1 mRNA, complete cds
          Length = 2068

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            ||||| |||||||| || ||||| |||||||| ||||| |||||||| || || ||||||
Sbjct: 1425 ccatctatccagctatacccaactccatcactaaactgttctttctgtctatatagaatg 1366

                                                                        
Query: 471  tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
            ||||| || ||  | ||| | || || |||||||| || || |  || ||||||||||| 
Sbjct: 1365 tgctttggtagataaggtcgttcttcatcatcaaaggcattgcgtagcacccacttctcg 1306

                                                                 
Query: 531  attcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
            || ||||| |||||||||  ||||| ||||||||| ||||| |||||||||||
Sbjct: 1305 atccttccgagatcaggcttgatcaacttccactctggatcgatgctcattgc 1253



to top

>ref|NM_125900.2| Arabidopsis thaliana ASN2 (ASPARAGINE SYNTHETASE 2); asparagine
            synthase (glutamine-hydrolyzing) AT5G65010 (ASN2)
            transcript variant AT5G65010.2 mRNA, complete cds
          Length = 2071

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            ||||| |||||||| || ||||| |||||||| ||||| |||||||| || || ||||||
Sbjct: 1425 ccatctatccagctatacccaactccatcactaaactgttctttctgtctatatagaatg 1366

                                                                        
Query: 471  tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
            ||||| || ||  | ||| | || || |||||||| || || |  || ||||||||||| 
Sbjct: 1365 tgctttggtagataaggtcgttcttcatcatcaaaggcattgcgtagcacccacttctcg 1306

                                                                 
Query: 531  attcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
            || ||||| |||||||||  ||||| ||||||||| ||||| |||||||||||
Sbjct: 1305 atccttccgagatcaggcttgatcaacttccactctggatcgatgctcattgc 1253



to top

>ref|NM_114602.2| Arabidopsis thaliana ASN1 (DARK INDUCIBLE 6) AT3G47340 (ASN1)
            transcript variant AT3G47340.1 mRNA, complete cds
          Length = 2206

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||| |||
Sbjct: 1593 aggccatcgatccaactgtagccaacaccatcactgaactgttctttctgtctgtagaga 1534

                 
Query: 468  atgtg 472
            |||||
Sbjct: 1533 atgtg 1529



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 273  gagttctgggggaagaacctctcaaatatcatcctgta 310
            |||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 1728 gagttctgcgggaagaacctttcaaagatcattctgta 1691



to top

>ref|NM_180332.1| Arabidopsis thaliana ASN1 (DARK INDUCIBLE 6) AT3G47340 (ASN1)
            transcript variant AT3G47340.2 mRNA, complete cds
          Length = 2299

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||| |||
Sbjct: 1593 aggccatcgatccaactgtagccaacaccatcactgaactgttctttctgtctgtagaga 1534

                 
Query: 468  atgtg 472
            |||||
Sbjct: 1533 atgtg 1529



to top

>ref|NM_180333.1| Arabidopsis thaliana ASN1 (DARK INDUCIBLE 6) AT3G47340 (ASN1)
            transcript variant AT3G47340.3 mRNA, complete cds
          Length = 2380

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||| |||
Sbjct: 1676 aggccatcgatccaactgtagccaacaccatcactgaactgttctttctgtctgtagaga 1617

                 
Query: 468  atgtg 472
            |||||
Sbjct: 1616 atgtg 1612



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 273  gagttctgggggaagaacctctcaaatatcatcctgta 310
            |||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 1902 gagttctgcgggaagaacctttcaaagatcattctgta 1865



to top

>gb|AY096592.1| Arabidopsis thaliana putative glutamine-dependent asparagine
            synthetase (At3g47340) mRNA, complete cds
          Length = 1786

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||| |||
Sbjct: 1394 aggccatcgatccaactgtagccaacaccatcactgaactgttctttctgtctgtagaga 1335

                 
Query: 468  atgtg 472
            |||||
Sbjct: 1334 atgtg 1330



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 273  gagttctgggggaagaacctctcaaatatcatcctgta 310
            |||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 1529 gagttctgcgggaagaacctttcaaagatcattctgta 1492



to top

>gb|AY072214.1| Arabidopsis thaliana putative glutamine-dependent asparagine
            synthetase (At3g47340) mRNA, complete cds
          Length = 2183

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||| |||
Sbjct: 1595 aggccatcgatccaactgtagccaacaccatcactgaactgttctttctgtctgtagaga 1536

                 
Query: 468  atgtg 472
            |||||
Sbjct: 1535 atgtg 1531



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 273  gagttctgggggaagaacctctcaaatatcatcctgta 310
            |||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 1730 gagttctgcgggaagaacctttcaaagatcattctgta 1693



to top

>emb|AL096860.1|ATT21L8 Arabidopsis thaliana DNA chromosome 3, BAC clone T21L8
          Length = 87224

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Plus

                                                                         
Query: 408   aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
             |||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||| |||
Sbjct: 38102 aggccatcgatccaactgtagccaacaccatcactgaactgttctttctgtctgtagaga 38161

                  
Query: 468   atgtg 472
             |||||
Sbjct: 38162 atgtg 38166



to top

>gb|AY124866.1| Arabidopsis thaliana AT5g65010/MXK3_25 mRNA, complete cds
          Length = 1737

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            ||||| |||||||| || ||||| |||||||| ||||| |||||||| || || ||||||
Sbjct: 1391 ccatctatccagctatacccaactccatcactaaactgttctttctgtctatatagaatg 1332

                                                                        
Query: 471  tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
            ||||| || ||  | ||| | || || |||||||| || || |  || ||||||||||| 
Sbjct: 1331 tgctttggtagataaggtcgttcttcatcatcaaaggcattgcgtagcacccacttctcg 1272

                                                                 
Query: 531  attcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
            || ||||| |||||||||  ||||| ||||||||| ||||| |||||||||||
Sbjct: 1271 atccttccgagatcaggcttgatcaacttccactctggatcgatgctcattgc 1219



to top

>gb|AF367340.1| Arabidopsis thaliana AT5g65010/MXK3_25 mRNA, complete cds
          Length = 2028

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            ||||| |||||||| || ||||| |||||||| ||||| |||||||| || || ||||||
Sbjct: 1424 ccatctatccagctatacccaactccatcactaaactgttctttctgtctatatagaatg 1365

                                                                        
Query: 471  tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
            ||||| || ||  | ||| | || || |||||||| || || |  || ||||||||||| 
Sbjct: 1364 tgctttggtagataaggtcgttcttcatcatcaaaggcattgcgtagcacccacttctcg 1305

                                                                 
Query: 531  attcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
            || ||||| |||||||||  ||||| ||||||||| ||||| |||||||||||
Sbjct: 1304 atccttccgagatcaggcttgatcaacttccactctggatcgatgctcattgc 1252



to top

>gb|AF419557.1|AF419557 Arabidopsis thaliana AT3g47340/T21L8_90 mRNA, complete cds
          Length = 2123

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||| |||
Sbjct: 1590 aggccatcgatccaactgtagccaacaccatcactgaactgttctttctgtctgtagaga 1531

                 
Query: 468  atgtg 472
            |||||
Sbjct: 1530 atgtg 1526



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 273  gagttctgggggaagaacctctcaaatatcatcctgta 310
            |||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 1725 gagttctgcgggaagaacctttcaaagatcattctgta 1688



to top

>gb|AF095453.1|AF095453 Arabidopsis thaliana asparagine synthetase (ASN2) mRNA, complete cds
          Length = 1960

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 141/173 (81%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            ||||| |||||||| || ||||| |||||||| ||||| |||||||| || || ||||||
Sbjct: 1391 ccatctatccagctatacccaactccatcactaaactgttctttctgtctatatagaatg 1332

                                                                        
Query: 471  tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
            ||||| || ||  | ||| | || || |||||||| || || |  || ||||||||||| 
Sbjct: 1331 tgctttggtagataaggtcgttcttcatcatcaaaggcattgcgtagcacccacttctcg 1272

                                                                 
Query: 531  attcttccaagatcaggccggatcatcttccactcaggatcaatgctcattgc 583
            || ||||| |||||||||  ||||| ||||||||| ||||| |||||||||||
Sbjct: 1271 atccttccgagatcaggcttgatcaacttccactctggatcgatgctcattgc 1219



to top

>emb|BX824817.1|CNS0A4VX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH75ZB03 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2052

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||| |||
Sbjct: 1572 aggccatcgatccaactgtagccaacaccatcactgaactgttctttctgtctgtagaga 1513

                 
Query: 468  atgtg 472
            |||||
Sbjct: 1512 atgtg 1508



to top

>gb|L29083.1|ATHMTGDAS Arabidopsis thaliana (clone At-ASN1) glutamine-dependent asparagine
            synthetase mRNA, complete cds
          Length = 1755

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||| |||
Sbjct: 1394 aggccatcgatccaactgtagccaacaccatcactgaactgttctttctgtctgtagaga 1335

                 
Query: 468  atgtg 472
            |||||
Sbjct: 1334 atgtg 1330



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 273  gagttctgggggaagaacctctcaaatatcatcctgta 310
            |||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 1529 gagttctgcgggaagaacctttcaaagatcattctgta 1492



to top

>emb|X89410.1|LJAS2GENE L.japonicus mRNA for asparagine synthetase (clone LJAS2)
          Length = 2187

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 104/124 (83%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            ||||||||||| |  |||||||| ||||||||||| || ||||||||||| |||||||||
Sbjct: 1535 ccatcaatccaaccatagccaactccatcactgaattgttctttctgcctatacagaatg 1476

                                                                        
Query: 471  tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
            ||||| || ||  | || | ||| || |||||||| || |||||||| ||||| ||||||
Sbjct: 1475 tgcttaggaagataaggattctcttcatcatcaaaggccttcctcagtacccatttctca 1416

                
Query: 531  attc 534
            ||||
Sbjct: 1415 attc 1412



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 270  gccgagttctgggggaagaacctctcaaatatcatcctgtaacagtaggcctcttt 325
            ||||||||||| || |||||||||||||| |||||||||||| | ||||| |||||
Sbjct: 1676 gccgagttctgaggaaagaacctctcaaagatcatcctgtaataataggcttcttt 1621



to top

>dbj|AB035248.1| Astragalus sinicus AsAS2 mRNA for asparagine synthetase, complete cds
          Length = 2133

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 113/136 (83%)
 Strand = Plus / Minus

                                                                        
Query: 403  cctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgt 462
            |||||| ||||||||||||||  |||||||| ||||||||||| || ||||||||||| |
Sbjct: 1485 cctttatgccatcaatccagccatagccaactccatcactgaattgttctttctgcctat 1426

                                                                        
Query: 463  acagaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaaccc 522
            | | ||||||| | |||||  | ||||  |  || |||||||| |||||||| || ||||
Sbjct: 1425 ataaaatgtgccttggcagataaggtttgttttcatcatcaaaagctttccttagtaccc 1366

                            
Query: 523  acttctcaattcttcc 538
            | ||||||||||||||
Sbjct: 1365 atttctcaattcttcc 1350



to top

>gb|AY081945.1| Securigera parviflora asparagine synthetase (As1) mRNA, complete cds
          Length = 2109

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||||||||| || |||||||| ||||||||||| || ||||||||||| |||| |
Sbjct: 1541 aggccatcaatccaactatagccaactccatcactgaattgttctttctgcctatacaaa 1482

                          
Query: 468  atgtgcttcggcag 481
            |||||||| |||||
Sbjct: 1481 atgtgctttggcag 1468



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 273  gagttctgggggaagaacctctcaaatatcat 304
            |||||||| ||||||||||||||||| |||||
Sbjct: 1676 gagttctgagggaagaacctctcaaagatcat 1645



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 563  ctcaggatcaatgctcattgcctcattgataaactccttgtcc 605
            ||||||||||||| |||||||  ||||||| || |||||||||
Sbjct: 1386 ctcaggatcaatgttcattgcaacattgatgaattccttgtcc 1344



to top

>emb|AJ496567.2|PSY496567 Pinus sylvestris mRNA for putative asparagine synthetase (asn1 gene)
          Length = 2110

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                        
Query: 410  gccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaat 469
            |||||||||||||||||||||||| ||||| ||||| ||| | ||||| |||||||||||
Sbjct: 1484 gccatcaatccagctgtagccaaccccatcgctgaattgccccttctgtctgtacagaat 1425

                  
Query: 470  gtgctt 475
            ||||||
Sbjct: 1424 gtgctt 1419



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 105/129 (81%)
 Strand = Plus / Minus

                                                                        
Query: 203  agcatcccactctactgccttcgccgtgctgcatgcgacgcttggcccgcctggcactgt 262
            ||||||||| || |||||||| || ||||| || || |||||||||||||| || || ||
Sbjct: 1691 agcatcccattccactgcctttgcggtgctacaagccacgcttggcccgcccgggaccgt 1632

                                                                        
Query: 263  caggattgccgagttctgggggaagaacctctcaaatatcatcctgtaacagtaggcctc 322
            ||    ||||| |||||| ||  |||| || |||||||||||||||||  |||| |||||
Sbjct: 1631 caaccgtgccgcgttctgaggatagaatctttcaaatatcatcctgtagtagtacgcctc 1572

                     
Query: 323  ttttgtagt 331
             ||||||||
Sbjct: 1571 ctttgtagt 1563



to top

>gb|AF005724.1| Sandersonia aurantiaca asparagine synthetase (SAND1) mRNA, complete
            cds
          Length = 2121

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 147/182 (80%)
 Strand = Plus / Minus

                                                                        
Query: 402  gcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctg 461
            ||||| || ||||||||||||||||||||||| |||||||| ||||| ||||||||||||
Sbjct: 1442 gccttaagtccatcaatccagctgtagccaactccatcactaaactgttctttctgcctg 1383

                                                                        
Query: 462  tacagaatgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacc 521
            || || || ||||| || ||| | || |  ||||| ||||| || ||  ||||||  | |
Sbjct: 1382 tagagtatatgctttggtaggtaggggttttcctcatcatcgaaagccctcctcaatatc 1323

                                                                        
Query: 522  cacttctcaattcttccaagatcaggccggatcatcttccactcaggatcaatgctcatt 581
            || ||||||||||  |||| ||| ||    ||||| ||||| ||||||||||| ||||||
Sbjct: 1322 catttctcaattcgcccaatatctggttttatcattttccattcaggatcaatactcatt 1263

              
Query: 582  gc 583
            ||
Sbjct: 1262 gc 1261



to top

>gb|DQ455293.1| Medicago truncatula cDNA-AFLP fragment BT11M44_226 sequence
          Length = 277

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 106/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 411 ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
           |||||||||||||  |||||||| |||||||||||||| || ||||| || || | ||||
Sbjct: 258 ccatcaatccagccatagccaactccatcactgaactgttccttctgtctatataaaatg 199

                                                                       
Query: 471 tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
           ||||| |||||  | || | ||| || |||||||| || ||||| |||| ||| ||||||
Sbjct: 198 tgcttaggcagataaggattctcttcatcatcaaaagccttccttagaatccatttctca 139

                   
Query: 531 attcttcc 538
           ||||||||
Sbjct: 138 attcttcc 131



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                           
Query: 411     ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
               ||||||||||| ||||| ||||||||||||||||| ||||| || |||||||| ||||||
Sbjct: 8770709 ccatcaatccaactgtacccaacaccatcactgaattgctccttttgcctgtatagaatg 8770768

                   
Query: 471     tgct 474
               ||||
Sbjct: 8770769 tgct 8770772



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                      
Query: 491     ctcctcgtcatcaaatgctttcctcagaacccacttctcaattcttccaagatca 545
               |||||| ||||||||||| ||||  |||||||| |||||||| |  |||||||||
Sbjct: 8770884 ctcctcatcatcaaatgcattccggagaacccatttctcaatacggccaagatca 8770938



to top

>dbj|AP005382.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OJ1001_B06
          Length = 134810

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                         
Query: 411   ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
             ||||||||||| ||||| ||||||||||||||||| ||||| || |||||||| ||||||
Sbjct: 41030 ccatcaatccaactgtacccaacaccatcactgaattgctccttttgcctgtatagaatg 41089

                 
Query: 471   tgct 474
             ||||
Sbjct: 41090 tgct 41093



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                    
Query: 491   ctcctcgtcatcaaatgctttcctcagaacccacttctcaattcttccaagatca 545
             |||||| ||||||||||| ||||  |||||||| |||||||| |  |||||||||
Sbjct: 41205 ctcctcatcatcaaatgcattccggagaacccatttctcaatacggccaagatca 41259



to top

>gb|DQ227307.1| Glycine max asparagine synthetase mRNA, complete cds
          Length = 1752

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||||||||| |  |||||||| ||||||||||| || |||||||||||||| | |
Sbjct: 1401 aggccatcaatccaaccatagccaactccatcactgaattgttctttctgcctgtataaa 1342

                                                                        
Query: 468  atgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttc 527
            |||||||| |||||  | || || || || |||||||| ||  |||||||  |||| |||
Sbjct: 1341 atgtgctttggcagataaggatgttcttcatcatcaaaggccctcctcagtgcccatttc 1282

                   
Query: 528  tcaattc 534
            |||||||
Sbjct: 1281 tcaattc 1275



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 119/149 (79%)
 Strand = Plus / Minus

                                                                        
Query: 156  actccaagtgctgctctccctgagggatccaggttccccgaccaccgagcatcccactct 215
            ||||||||||||||||| || || ||||| |||||    |||||   |||||||||||| 
Sbjct: 1653 actccaagtgctgctctaccagatggatcaaggttgttagaccaagcagcatcccactca 1594

                                                                        
Query: 216  actgccttcgccgtgctgcatgcgacgcttggcccgcctggcactgtcaggattgccgag 275
            || || || || ||||| ||||| || ||||| || || || ||  ||||  | || |||
Sbjct: 1593 acagctttggctgtgctacatgcaacacttggtcctccaggaacactcagcctggctgag 1534

                                         
Query: 276  ttctgggggaagaacctctcaaatatcat 304
            ||||| |||||||||||||||||||||||
Sbjct: 1533 ttctgagggaagaacctctcaaatatcat 1505



to top

>gb|U55874.1|GMU55874 Glycine max asparagine synthetase mRNA, complete cds
          Length = 2211

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||||||||| |  |||||||| ||||||||||| || |||||||||||||| | |
Sbjct: 1567 aggccatcaatccaaccatagccaactccatcactgaattgttctttctgcctgtataaa 1508

                                                                        
Query: 468  atgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttc 527
            |||||||| |||||  | || || || || |||||||| ||  |||| || ||||| |||
Sbjct: 1507 atgtgctttggcagataaggatgttcttcatcatcaaaggccctccttagtacccatttc 1448

                   
Query: 528  tcaattc 534
            |||||||
Sbjct: 1447 tcaattc 1441



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 276  ttctgggggaagaacctctcaaatatcat 304
            ||||| |||||||||||||||||||||||
Sbjct: 1699 ttctgagggaagaacctctcaaatatcat 1671



to top

>gb|AY061820.1| Nicotiana tabacum asparagine synthetase (din6) mRNA, partial cds
          Length = 421

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Minus

                                                                       
Query: 411 ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
           ||||| ||||| || ||||| || ||||||||||| || |||||||||||||| || |||
Sbjct: 312 ccatctatccaactatagcctacgccatcactgaattgttctttctgcctgtataggatg 253

                                                                       
Query: 471 tgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctca 530
           ||||| || ||  | || |||||||| |||||||| ||  |||| ||| |||||||||||
Sbjct: 252 tgctttgggagatagggatgctcctcatcatcaaaggccctccttagagcccacttctca 193

             
Query: 531 at 532
           ||
Sbjct: 192 at 191



to top

>emb|AJ133522.1|PVU133522 Phaseolus vulgaris mRNA for asparagine synthetase type-I
          Length = 2086

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||||||||| |  || ||||| ||||||||||| || ||||||||||| || | |
Sbjct: 1541 aggccatcaatccaaccataaccaactccatcactgaattgttctttctgcctatataaa 1482

                                                                        
Query: 468  atgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttc 527
            || ||||| |||||  | || |||||  | |||||||||||  ||||||| ||||| |||
Sbjct: 1481 atatgctttggcagataaggatgctctccatcatcaaatgccctcctcagtacccatttc 1422

                    
Query: 528  tcaattct 535
            ||||||||
Sbjct: 1421 tcaattct 1414



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 118/149 (79%)
 Strand = Plus / Minus

                                                                        
Query: 156  actccaagtgctgctctccctgagggatccaggttccccgaccaccgagcatcccactct 215
            ||||||||||||||||| ||||| ||||| |||||    |||||   |||||||||||| 
Sbjct: 1793 actccaagtgctgctctacctgatggatcaaggttgttagaccaggcagcatcccactca 1734

                                                                        
Query: 216  actgccttcgccgtgctgcatgcgacgcttggcccgcctggcactgtcaggattgccgag 275
            || || || || ||||| ||||| || |||||||| || || ||  | ||  | || |||
Sbjct: 1733 acagcttttgctgtgctacatgcaacacttggccctccaggaacactgagtctagctgag 1674

                                         
Query: 276  ttctgggggaagaacctctcaaatatcat 304
            |  || |||||||||||||||||||||||
Sbjct: 1673 tcttgagggaagaacctctcaaatatcat 1645



to top

>gb|AF488726.1| Securigera parviflora asparagine synthetase (As2) mRNA, partial cds
          Length = 1367

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                        
Query: 435  ccatcactgaactgctctttctgcctgtacagaatgtgcttcggcaggaatggttgctcc 494
            ||||| ||||||||||| |||||||| |||| ||||||||| |||||  | || | ||| 
Sbjct: 1367 ccatcgctgaactgctccttctgcctatacaaaatgtgctttggcagataaggattctct 1308

                                                    
Query: 495  tcgtcatcaaatgctttcctcagaacccacttctcaattc 534
            || |||||||| || |||||||| | ||||||||||||||
Sbjct: 1307 tcatcatcaaaggccttcctcaggatccacttctcaattc 1268



to top

>emb|CT573508.2| Medicago truncatula chromosome 5 clone mth2-29p15, COMPLETE SEQUENCE
          Length = 125647

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 59/67 (88%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||||||||| || || ||||||||||||||||| || || ||||||||||| | |
Sbjct: 6879 aggccatcaatccaactataaccaacaccatcactgaattgttccttctgcctgtataaa 6820

                   
Query: 468  atgtgct 474
            |||||||
Sbjct: 6819 atgtgct 6813



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 563  ctcaggatcaatgctcattgcctcattgataaactccttgtcc 605
            ||||||||||||  |||||||  ||||||||||||||||||||
Sbjct: 6485 ctcaggatcaatattcattgcaacattgataaactccttgtcc 6443



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 278  ctgggggaagaacctctcaaatatcatcctgta 310
            ||||||||||||||||||||| ||||| |||||
Sbjct: 7110 ctgggggaagaacctctcaaagatcattctgta 7078



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                        
Query: 156  actccaagtgctgctctccctgagggatccaggttccccgaccaccgagcatcccactct 215
            ||||||||||||||||| || || ||||| ||||||   |||||   |||||||||||| 
Sbjct: 7521 actccaagtgctgctctaccagaaggatcaaggttcttggaccaagaagcatcccactca 7462

                                   
Query: 216  actgccttcgccgtgctgcatgc 238
            || ||||| || ||||| |||||
Sbjct: 7461 acagccttagctgtgctacatgc 7439



to top

>gb|U77679.1|GMU77679 Glycine max asparagine synthetase 1 (AS1) mRNA, complete cds
          Length = 2108

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||||||||| |  |||||||| ||||||||||| || ||||||||||| || | |
Sbjct: 1544 aggccatcaatccaaccatagccaactccatcactgaattgttctttctgcctatataaa 1485

                                                                        
Query: 468  atgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttc 527
            |||||||| |||||  | || || || || |||||||| ||  |||||||  |||| |||
Sbjct: 1484 atgtgctttggcagataaggatgttcttcatcatcaaaggccctcctcagtgcccatttc 1425

                   
Query: 528  tcaattc 534
            |||||||
Sbjct: 1424 tcaattc 1418



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 273  gagttctgggggaagaacctctcaaatatcat 304
            |||||||| |||||||||||||||||||||||
Sbjct: 1679 gagttctgagggaagaacctctcaaatatcat 1648



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 156  actccaagtgctgctctccctgagggatccaggtt 190
            ||||||||||||||||| ||||| ||||| |||||
Sbjct: 1796 actccaagtgctgctctacctgatggatcaaggtt 1762



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 552  atcatcttccactcaggatcaatgctcattgcctcattgataaactccttgtcc 605
            ||||| || ||||||||||||||| |||||||  |  |||||||||| ||||||
Sbjct: 1400 atcattttacactcaggatcaatgttcattgcaactctgataaactctttgtcc 1347



to top

>gb|U89923.1|MSU89923 Medicago sativa asparagine synthetase mRNA, complete cds
          Length = 2184

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 103/126 (81%)
 Strand = Plus / Minus

                                                                        
Query: 410  gccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaat 469
            |||||||||||| |  |||||||| |||||||||||||| || |||||||| || | |||
Sbjct: 1578 gccatcaatccaaccatagccaactccatcactgaactgttccttctgcctatataaaat 1519

                                                                        
Query: 470  gtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctc 529
            |||||| || ||| | || | ||| || |||||||| || ||||| || | ||| |||||
Sbjct: 1518 gtgcttaggtaggtaaggattctcttcatcatcaaaagccttcctaagtatccatttctc 1459

                  
Query: 530  aattct 535
            ||||||
Sbjct: 1458 aattct 1453



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 268  ttgccgagttctgggggaagaacctctcaaatatcat 304
            |||| |||||||| ||||| ||||||||||| |||||
Sbjct: 1720 ttgctgagttctgagggaaaaacctctcaaagatcat 1684



to top

>emb|Z72354.1|VFAS1 V.faba mRNA for asparagine synthetase
          Length = 2154

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 105/129 (81%)
 Strand = Plus / Minus

                                                                        
Query: 410  gccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaat 469
            ||||||||||||||  || ||||| ||||||||||| || || ||||| || || | |||
Sbjct: 1512 gccatcaatccagccatatccaactccatcactgaattgttccttctgtctatataaaat 1453

                                                                        
Query: 470  gtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctc 529
            |||||| |||||  |||| | ||| || |||||||| || || || |||| ||| |||||
Sbjct: 1452 gtgcttaggcagatatggattctcttcatcatcaaaggcctttcttagaatccatttctc 1393

                     
Query: 530  aattcttcc 538
            |||||||||
Sbjct: 1392 aattcttcc 1384



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 118/149 (79%)
 Strand = Plus / Minus

                                                                        
Query: 156  actccaagtgctgctctccctgagggatccaggttccccgaccaccgagcatcccactct 215
            ||||||||||||||||| || || ||||| ||||| || |||||   ||||||||| || 
Sbjct: 1766 actccaagtgctgctctaccagatggatcaaggttgcctgaccaagaagcatcccattca 1707

                                                                        
Query: 216  actgccttcgccgtgctgcatgcgacgcttggcccgcctggcactgtcaggattgccgag 275
            |  || ||  | ||||||||||| || || || || || || ||||||||  ||||||||
Sbjct: 1706 atagctttttctgtgctgcatgcaacactaggtcctccaggaactgtcagccttgccgag 1647

                                         
Query: 276  ttctgggggaagaacctctcaaatatcat 304
            ||||| ||||| || || ||||| |||||
Sbjct: 1646 ttctgagggaaaaatctttcaaagatcat 1618



to top

>emb|X99552.1|AOASPS A.officinalis gene encoding asparagine synthetase
          Length = 3812

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 402  gcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctg 461
            ||||| || ||||||||||| || || ||||||||||||||||||||||| || ||||| 
Sbjct: 3150 gccttcagcccatcaatccaactatatccaacaccatcactgaactgctccttttgccta 3091

                         
Query: 462  tacagaatgtgct 474
            || ||||| ||||
Sbjct: 3090 tagagaatatgct 3078



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 282  gggaagaacctctcaaatatcatcctgtaacagtaggcctcttttgtagtcggggtgttg 341
            ||||||||||| ||||| ||||| |||||  | || ||||||||||| || || ||||||
Sbjct: 3365 gggaagaacctttcaaagatcattctgtagtaataagcctcttttgtggttggtgtgttg 3306

                       
Query: 342  tgtgggtaaat 352
            || ||||||||
Sbjct: 3305 tgggggtaaat 3295



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 498  tcatcaaatgctttcctcagaacccacttctcaattcttccaagatcaggc 548
            |||||||| ||||||||||| ||||||||||| || || || |||||||||
Sbjct: 2981 tcatcaaaagctttcctcagtacccacttctcgatcctcccgagatcaggc 2931



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 68/84 (80%)
 Strand = Plus / Minus

                                                                        
Query: 152  atggactccaagtgctgctctccctgagggatccaggttccccgaccaccgagcatccca 211
            |||||| || || ||||||||||| || |||||||  ||   |||||| ||||| |||||
Sbjct: 3689 atggacgccgagagctgctctccccgacggatccaaattgttcgaccagcgagcgtccca 3630

                                    
Query: 212  ctctactgccttcgccgtgctgca 235
             || |  |||||||||||||||||
Sbjct: 3629 ttcgatagccttcgccgtgctgca 3606



to top

>emb|X52179.1|PSAS1 Pea AS1 nodule mRNA for asparagine synthase (EC 6.3.5.4)
          Length = 2200

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 105/129 (81%)
 Strand = Plus / Minus

                                                                        
Query: 410  gccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaat 469
            |||||| |||||||  || ||||| ||||||||||| || || |||||||| || | |||
Sbjct: 1488 gccatctatccagccatatccaactccatcactgaattgttccttctgcctatataaaat 1429

                                                                        
Query: 470  gtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttctc 529
            |||||| |||||  |||| | ||| || |||||||| || || || |||| ||| |||||
Sbjct: 1428 gtgcttaggcagatatggattctcttcatcatcaaaggcctttcttagaatccatttctc 1369

                     
Query: 530  aattcttcc 538
            |||||||||
Sbjct: 1368 aattcttcc 1360



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 118/149 (79%)
 Strand = Plus / Minus

                                                                        
Query: 156  actccaagtgctgctctccctgagggatccaggttccccgaccaccgagcatcccactct 215
            ||||||||||||||||| || || |||||||||||    |||||   ||||||||| || 
Sbjct: 1742 actccaagtgctgctctaccagaaggatccaggttgtttgaccatgaagcatcccattca 1683

                                                                        
Query: 216  actgccttcgccgtgctgcatgcgacgcttggcccgcctggcactgtcaggattgccgag 275
            |  || ||| | ||||||||||| || || || || || || ||||| ||  ||||||||
Sbjct: 1682 atagctttctctgtgctgcatgcaacactaggtcctccaggaactgtaagccttgccgag 1623

                                         
Query: 276  ttctgggggaagaacctctcaaatatcat 304
            ||||| ||||| ||||| ||||| |||||
Sbjct: 1622 ttctgagggaaaaacctttcaaagatcat 1594



to top

>dbj|AB019236.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXK3
          Length = 81494

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                         
Query: 519   acccacttctcaattcttccaagatcaggccggatcatcttccactcaggatcaatgctc 578
             ||||||||||| || ||||| |||||||||  ||||| ||||||||| ||||| ||||||
Sbjct: 68881 acccacttctcgatccttccgagatcaggcttgatcaacttccactctggatcgatgctc 68822

                  
Query: 579   attgc 583
             |||||
Sbjct: 68821 attgc 68817



to top

>ref|XM_656913.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4401.2), mRNA
          Length = 1716

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 398  gtgggcctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctg 457
            |||| |||| || ||||| |||||||||||||| ||||| |||||||||||||| |||||
Sbjct: 1488 gtggtccttcagaccatcgatccagctgtagccgacaccgtcactgaactgctccttctg 1429



to top

>gb|L40327.1|ALFASPSYN Medicago sativa asparagine synthetase gene, exons 1-13 and complete
            cds
          Length = 7969

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            ||||||||||| |  |||||||| ||||||||||||||||| |||||||| || | ||||
Sbjct: 6616 ccatcaatccaaccatagccaactccatcactgaactgctccttctgcctatataaaatg 6557

                
Query: 471  tgct 474
            ||||
Sbjct: 6556 tgct 6553



to top

>gb|AF061740.1| Elaeagnus umbellata asparagine synthetase (AS) mRNA, complete cds
          Length = 2092

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||||||||| || || ||||| || ||||| || || || |||||||  ||||||
Sbjct: 1486 aggccatcaatccaactataaccaaccccgtcactaaattgttccttctgccgatacaga 1427

                                                                        
Query: 468  atgtgcttcggcaggaatggttgctcctcgtcatcaaatgctttcctcagaacccacttc 527
            || ||||| |||||  | ||  | ||||| |||||||| || ||||| || ||||| |||
Sbjct: 1426 atatgctttggcagataaggacgttcctcatcatcaaaggccttcctaagcacccatttc 1367

                       
Query: 528  tcaattcttcc 538
            |||||||||||
Sbjct: 1366 tcaattcttcc 1356



to top

>gb|AY208747.1| Securigera parviflora asparagine synthetase (AS2) gene, complete cds
          Length = 7074

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                        
Query: 408  aggccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacaga 467
            |||||||||||||| | |||||| || ||||||||||| || || |||||||| |||| |
Sbjct: 5956 aggccatcaatccaaccgtagccgactccatcactgaattgttccttctgcctatacaaa 5897

                   
Query: 468  atgtgct 474
            |||||||
Sbjct: 5896 atgtgct 5890



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 498  tcatcaaatgctttcctcagaacccacttctcaattc 534
            |||||||| || |||||||| | ||||||||||||||
Sbjct: 5780 tcatcaaaggccttcctcaggatccacttctcaattc 5744



to top

>gb|AF014055.1| Triphysaria versicolor asparagine synthetase (AS) mRNA, complete cds
          Length = 2052

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 417  atccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatgtgctt 475
            |||||||| || || ||||||||||||||||| ||||||||||| |||| ||| |||||
Sbjct: 1385 atccagctatatccgacaccatcactgaactgttctttctgcctatacaaaatatgctt 1327



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gtgctgcatgcgacgcttggcccgcctggcactgtcaggattgccgagttctgggggaag 287
            |||||||| || || || ||||||||||| || || ||  | || |||||||| ||||| 
Sbjct: 1574 gtgctgcaagccacactcggcccgcctggaacagtgagcttggctgagttctgtgggaaa 1515

                                
Query: 288  aacctctcaaatatcatcct 307
            |||| ||| |||||||||||
Sbjct: 1514 aaccgctcgaatatcatcct 1495



to top

>gb|AF190729.1| Helianthus annuus asparagine synthetase (HAS2) mRNA, complete cds
          Length = 1850

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 204  gcatcccactctactgccttcgccgtgctgcatgcgacgcttggcccgcctgg 256
            |||||||||||||| ||||| |||||||||||||| || ||||| || |||||
Sbjct: 1623 gcatcccactctaccgccttagccgtgctgcatgccacacttggaccccctgg 1571



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgta 463
            ||||| ||||||||||| ||||| || ||||||||||| || || ||||||||
Sbjct: 1416 ccatcgatccagctgtatccaactccgtcactgaactgttccttttgcctgta 1364



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 552  atcatcttccactcaggatcaatgctcattgc 583
            |||||||||||||  || ||||||||||||||
Sbjct: 1275 atcatcttccactttgggtcaatgctcattgc 1244



to top

>gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome
          Length = 2679306

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                               
Query: 425    gtagccaacaccatcactgaactgctctttctg 457
              ||||||||||||||||||||||||||| |||||
Sbjct: 114646 gtagccaacaccatcactgaactgctccttctg 114614



to top

>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome
          Length = 2519802

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                               
Query: 425    gtagccaacaccatcactgaactgctctttctg 457
              ||||||||||||||||||||||||||| |||||
Sbjct: 113088 gtagccaacaccatcactgaactgctccttctg 113056



to top

>ref|XM_747043.1| Aspergillus fumigatus Af293 asparagine synthetase
            glutamine-hydrolyzing 2 (Afu4g06900) partial mRNA
          Length = 1920

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 403  cctttaggccatcaatccagctgtagccaacaccatcactgaactgctctttctg 457
            |||| ||||| ||||||||||||||||| ||||| || ||||| ||||| |||||
Sbjct: 1627 ccttcaggccgtcaatccagctgtagccgacaccgtcgctgaattgctccttctg 1573



to top

>gb|AF014057.1| Triphysaria versicolor asparagine synthetase (AS) mRNA, complete cds
          Length = 1906

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 417  atccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatgtgctt 475
            |||||||| || || ||||||||||| ||||| ||||||||||| |||| ||| |||||
Sbjct: 1385 atccagctatatccgacaccatcactaaactgttctttctgcctatacaaaatatgctt 1327



to top

>gb|AF014056.1| Triphysaria versicolor asparagine synthetase (AS) mRNA, complete cds
          Length = 2055

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 417  atccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatgtgctt 475
            |||||||| || || ||||||||||| ||||| ||||||||||| |||| ||| |||||
Sbjct: 1385 atccagctatatccgacaccatcactaaactgttctttctgcctatacaaaatatgctt 1327



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                        
Query: 417     atccagctgtagccaacaccatcactgaactgctctttctg 457
               ||||||| |||||| || || ||||||||||||||||||||
Sbjct: 1677700 atccagccgtagcccacgccgtcactgaactgctctttctg 1677660



to top

>emb|AL627267.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
              complete chromosome; segment 3/20
          Length = 240050

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                           
Query: 413    atcaatccagctgtagccaacaccatcactgaactgctctttctg 457
              |||||||||||||||||| || || |||  |||||||||||||||
Sbjct: 196195 atcaatccagctgtagcctacgccgtcagagaactgctctttctg 196239



to top

>emb|AJ549919.1|LJA549919 Lotus japonicus mRNA for asparagine synthetase 3 (as3 gene)
          Length = 2401

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 417  atccagctgtagccaacaccatcactgaactgctctttctg 457
            |||||||||||||| || ||||| ||||||||||| |||||
Sbjct: 1517 atccagctgtagcccacgccatcgctgaactgctccttctg 1477



to top

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                            
Query: 413     atcaatccagctgtagccaacaccatcactgaactgctctttctg 457
               |||||||||||||||||| || || |||  |||||||||||||||
Sbjct: 2265876 atcaatccagctgtagcctacgccgtcagagaactgctctttctg 2265832



to top

>gb|AE017131.1| Yersinia pestis biovar Medievalis str. 91001 section 5 of 16 of the
             complete genome
          Length = 291847

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 414   tcaatccagctgtagccaacaccatcactgaactgctctttctg 457
             ||||||||||| |||||||||||||||  ||| || ||||||||
Sbjct: 10474 tcaatccagctatagccaacaccatcagagaattgttctttctg 10431



to top

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                           
Query: 414     tcaatccagctgtagccaacaccatcactgaactgctctttctg 457
               ||||||||||| |||||||||||||||  ||| || ||||||||
Sbjct: 1343515 tcaatccagctatagccaacaccatcagagaattgttctttctg 1343558



to top

>emb|CR378666.1| Photobacterium profundum SS9; segment 4/12
          Length = 348313

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 405   tttaggccatcaatccagctgtagccaacaccatca 440
             ||||||| |||||||||||| ||||| |||||||||
Sbjct: 95623 tttaggctatcaatccagctatagccgacaccatca 95658



to top

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                           
Query: 414     tcaatccagctgtagccaacaccatcactgaactgctctttctg 457
               ||||||||||| |||||||||||||||  ||| || ||||||||
Sbjct: 1336316 tcaatccagctatagccaacaccatcagagaattgttctttctg 1336359



to top

>emb|AJ414153.1| Yersinia pestis strain CO92 complete genome; segment 13/20
          Length = 258050

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 414   tcaatccagctgtagccaacaccatcactgaactgctctttctg 457
             ||||||||||| |||||||||||||||  ||| || ||||||||
Sbjct: 34225 tcaatccagctatagccaacaccatcagagaattgttctttctg 34268



to top

>gb|AF263432.1| Helianthus annuus asparagine synthetase (HAS1.1) mRNA, complete cds
          Length = 2035

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 411  ccatcaatccagctgtagccaacaccatcactgaactgctctttctgcctgtacagaatg 470
            |||||||||||||| || || || ||||| || ||||| |||||||| || |||| ||| 
Sbjct: 1439 ccatcaatccagctatatccgactccatcgctaaactgttctttctgtctatacaaaata 1380

                       
Query: 471  tgcttcggcag 481
            ||||| |||||
Sbjct: 1379 tgcttaggcag 1369



to top

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 432    acaccatcactgaactgctcttt 454
              |||||||||||||||||||||||
Sbjct: 677276 acaccatcactgaactgctcttt 677298



to top

>emb|BX823779.1|CNS0A6KC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZG11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 513

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 gagttctgggggaagaacctctcaaatatcatcctgta 310
           |||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 113 gagttctgcgggaagaacctttcaaagatcattctgta 76



to top

>ref|XM_561050.1| Anopheles gambiae str. PEST ENSANGP00000025823
           (ENSANGG00000022672), partial mRNA
          Length = 1158

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 417 atccagctgtagccaacaccatcactgaactgctcttt 454
           |||||||| ||||| ||||||||||| || ||||||||
Sbjct: 881 atccagctatagccgacaccatcactaaattgctcttt 844



to top

>gb|AC116394.22| Mus musculus chromosome 8, clone RP23-100C12, complete sequence
          Length = 186505

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 444    aactgctctttctgcctgtacagaatgtg 472
              |||||||||||||||||||  ||||||||
Sbjct: 113578 aactgctctttctgcctgtttagaatgtg 113550



to top

>ref|XM_453910.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D19118g predicted mRNA
          Length = 3138

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 516 agaacccacttctcaattcttccaa 540
           |||||||| ||||||||||||||||
Sbjct: 199 agaacccatttctcaattcttccaa 175



to top

>gb|AC163997.3| Mus musculus chromosome 8, clone RP24-273M3, complete sequence
          Length = 147745

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 444    aactgctctttctgcctgtacagaatgtg 472
              |||||||||||||||||||  ||||||||
Sbjct: 104416 aactgctctttctgcctgtttagaatgtg 104444



to top

>gb|AY275111.1| Abrothrix olivaceus cytochrome b gene, partial cds; mitochondrial
           gene for mitochondrial product
          Length = 1140

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 1715506

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 516     agaacccacttctcaattcttccaa 540
               |||||||| ||||||||||||||||
Sbjct: 1606987 agaacccatttctcaattcttccaa 1606963



to top

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                        
Query: 417     atccagctgtagccaacaccatcactgaactgctctttctg 457
               |||||||||||||| || ||||||  |||||| ||||||||
Sbjct: 1497707 atccagctgtagcccacgccatcagagaactgttctttctg 1497747



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 197     ccaccgagcatcccactctac 217
               |||||||||||||||||||||
Sbjct: 3292410 ccaccgagcatcccactctac 3292390



to top

>gb|AF297902.1|AF297902 Abrothrix xanthorhinus canescens number FMNH 132593 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297901.1|AF297901 Abrothrix xanthorhinus canescens number FMNH 132592 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297900.1|AF297900 Abrothrix xanthorhinus canescens number FMNH 129880 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297899.1|AF297899 Abrothrix xanthorhinus canescens number FMNH 129879 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297898.1|AF297898 Abrothrix xanthorhinus canescens number FMNH 129878 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297897.1|AF297897 Abrothrix xanthorhinus canescens number FMNH 129877 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297896.1|AF297896 Abrothrix xanthorhinus canescens number FMNH 132591 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297895.1|AF297895 Abrothrix sp. FMNH129874 number FMNH 129858 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297894.1|AF297894 Abrothrix sp. FMNH129874 number FMNH 129855 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297893.1|AF297893 Abrothrix sp. FMNH129874 number FMNH 129874 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297892.1|AF297892 Abrothrix olivaceus brachiotis number FMNH 129876 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297891.1|AF297891 Abrothrix olivaceus brachiotis number FMNH 129875 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297890.1|AF297890 Abrothrix olivaceus brachiotis number FMNH 129969 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297889.1|AF297889 Abrothrix olivaceus brachiotis number FMNH 129968 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297888.1|AF297888 Abrothrix olivaceus brachiotis number FMNH 129842 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297887.1|AF297887 Abrothrix olivaceus brachiotis number FMNH 129927 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297886.1|AF297886 Abrothrix olivaceus brachiotis number FMNH 129926 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297885.1|AF297885 Abrothrix olivaceus brachiotis number FMNH 130968 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297884.1|AF297884 Abrothrix olivaceus brachiotis number FMNH 130967 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297883.1|AF297883 Abrothrix olivaceus brachiotis number FMNH 131471 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297882.1|AF297882 Abrothrix olivaceus brachiotis number FMNH 131468 cytochrome b
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297881.1|AF297881 Abrothrix olivaceus pencanus number FMNH 132370 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297880.1|AF297880 Abrothrix olivaceus pencanus number FMNH 132369 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF297878.1|AF297878 Abrothrix olivaceus olivaceus number FMNH 132310 cytochrome b gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027329.1| Akodon olivaceus canescens museum catalog number MVZ 182649
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027328.1| Akodon olivaceus canescens museum catalog number MVZ 182645
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027327.1| Akodon olivaceus canescens museum catalog number MVZ 182644
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027325.1| Akodon olivaceus canescens museum catalog number MVZ 182130
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027324.1| Akodon olivaceus canescens museum catalog number MVZ 182129
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027323.1| Akodon olivaceus canescens museum catalog number MVZ 182633
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027322.1| Akodon olivaceus beatus museum catalog number MVZ 176750 cytochrome
           b gene, mitochondrial gene encoding mitochondrial
           protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027321.1| Akodon olivaceus beatus museum catalog number MVZ 155754 cytochrome
           b gene, mitochondrial gene encoding mitochondrial
           protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027320.1| Akodon olivaceus beatus museum catalog number MVZ 155753 cytochrome
           b gene, mitochondrial gene encoding mitochondrial
           protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027319.1| Akodon olivaceus beatus museum catalog number MVZ 182616 cytochrome
           b gene, mitochondrial gene encoding mitochondrial
           protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027318.1| Akodon olivaceus beatus museum catalog number MVZ 182614 cytochrome
           b gene, mitochondrial gene encoding mitochondrial
           protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027316.1| Akodon olivaceus beatus museum catalog number MVZ 154571 cytochrome
           b gene, mitochondrial gene encoding mitochondrial
           protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027315.1| Akodon olivaceus beatus museum catalog number MVZ 182622 cytochrome
           b gene, mitochondrial gene encoding mitochondrial
           protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027314.1| Akodon olivaceus beatus museum catalog number MVZ 182621 cytochrome
           b gene, mitochondrial gene encoding mitochondrial
           protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027313.1| Akodon olivaceus beatus museum catalog number MVZ 182604 cytochrome
           b gene, mitochondrial gene encoding mitochondrial
           protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027312.1| Akodon olivaceus beatus museum catalog number MVZ 182603 cytochrome
           b gene, mitochondrial gene encoding mitochondrial
           protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027311.1| Akodon olivaceus brachiotis museum catalog number FMNH 131733
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027310.1| Akodon olivaceus brachiotis museum catalog number MVZ 183258
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027309.1| Akodon olivaceus brachiotis museum catalog number MVZ 183257
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027308.1| Akodon olivaceus brachiotis museum catalog number FMNH 131622
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027307.1| Akodon olivaceus brachiotis museum catalog number FMNH 131621
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|AF027305.1| Akodon olivaceus olivaceus museum catalog number FMNH 132309
           cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 1144

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 520 cccacttctcaattcttccaa 540
           |||||||||||||||||||||
Sbjct: 912 cccacttctcaattcttccaa 932



to top

>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                        
Query: 417     atccagctgtagccaacaccatcactgaactgctctttctg 457
               |||||||||||||| || || |||  |||||||||||||||
Sbjct: 2151539 atccagctgtagcctacgccgtcagagaactgctctttctg 2151499



to top

>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
              complete genome
          Length = 4755700

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 417    atccagctgtagccaacaccatcactgaactgctctttctg 457
              |||||||||||||| || || |||  |||||||||||||||
Sbjct: 781105 atccagctgtagcctacgccgtcagagaactgctctttctg 781145



to top

>emb|CT009733.13| Mouse DNA sequence from clone RP23-157D19 on chromosome 13, complete
              sequence
          Length = 192464

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 424    tgtagccaacaccatcactga 444
              |||||||||||||||||||||
Sbjct: 101503 tgtagccaacaccatcactga 101523



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 127     gatgctcctgctcataggcc 146
               ||||||||||||||||||||
Sbjct: 2224484 gatgctcctgctcataggcc 2224503



to top

>gb|AC140841.2| Mus musculus BAC clone RP24-470M20 from chromosome 9, complete sequence
          Length = 163348

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 518    aacccacttctcaattcttc 537
              ||||||||||||||||||||
Sbjct: 154948 aacccacttctcaattcttc 154967



to top

>gb|AC125357.4| Mus musculus BAC clone RP23-235J18 from chromosome 9, complete sequence
          Length = 217511

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 518   aacccacttctcaattcttc 537
             ||||||||||||||||||||
Sbjct: 35948 aacccacttctcaattcttc 35967



to top

>ref|XM_382770.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG02594.1)
            partial mRNA
          Length = 2007

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 469  tgtgcttcggcaggaatggt 488
            ||||||||||||||||||||
Sbjct: 1061 tgtgcttcggcaggaatggt 1042



to top

>emb|AL139385.12| Human DNA sequence from clone RP11-90L1 on chromosome 13 Contains the
            3' end of the COL4A2 gene for collagen type IV alpha 2,
            the RAB20 gene for a RAS oncogene family member, a novel
            gene (FLJ10769 FLJ25038 FLJ14198), the 5' end of a novel
            gene (FLJ12118) and three CpG islands, complete sequence
          Length = 177392

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 94   tcttgctggttcctgccatgatgg 117
            |||||||| |||||||||||||||
Sbjct: 8457 tcttgctgtttcctgccatgatgg 8480



to top

>emb|AL162756.2|NMA5Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment
              5/7
          Length = 329861

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 469    tgtgcttcggcaggaatggt 488
              ||||||||||||||||||||
Sbjct: 155699 tgtgcttcggcaggaatggt 155718



to top

>gb|AC087692.7| Homo sapiens chromosome 8, clone RP11-67D13, complete sequence
          Length = 146549

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 163  gtgctgctctccctgagggatcca 186
            |||||||||||| |||||||||||
Sbjct: 3400 gtgctgctctccatgagggatcca 3423



to top

>gb|AC021523.8| Homo sapiens chromosome 8, clone RP11-336N16, complete sequence
          Length = 170299

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 163    gtgctgctctccctgagggatcca 186
              |||||||||||| |||||||||||
Sbjct: 156531 gtgctgctctccatgagggatcca 156554



to top

>emb|BX571800.8| Zebrafish DNA sequence from clone DKEY-29B15 in linkage group 5,
             complete sequence
          Length = 195520

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 390   gattctgtgtgggcctttag 409
             ||||||||||||||||||||
Sbjct: 99965 gattctgtgtgggcctttag 99946



to top

>gb|AE002098.2| Neisseria meningitidis MC58, complete genome
          Length = 2272360

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 469     tgtgcttcggcaggaatggt 488
               ||||||||||||||||||||
Sbjct: 1394417 tgtgcttcggcaggaatggt 1394436



to top

>gb|AC132436.3| Mus musculus BAC clone RP23-226J18 from 1, complete sequence
          Length = 248067

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 163    gtgctgctctccctgagggatcca 186
              ||||||||||||| ||||||||||
Sbjct: 165502 gtgctgctctcccagagggatcca 165479



to top

>gb|AC137516.3| Mus musculus BAC clone RP23-259P18 from 1, complete sequence
          Length = 162037

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 499    catcaaatgctttcctcaga 518
              ||||||||||||||||||||
Sbjct: 139845 catcaaatgctttcctcaga 139826


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,225,533
Number of Sequences: 3902068
Number of extensions: 5225533
Number of successful extensions: 92553
Number of sequences better than 10.0: 159
Number of HSP's better than 10.0 without gapping: 159
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91836
Number of HSP's gapped (non-prelim): 700
length of query: 605
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 582
effective length of database: 17,143,297,704
effective search space: 9977399263728
effective search space used: 9977399263728
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top