Clone Name	rbags31g04
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|BT018281.1| Zea mays clone EL01T0204F12.c mRNA sequence	428	e-117
2	gb|BT017941.1| Zea mays clone EL01N0521B03.c mRNA sequence	420	e-114
3	gb|BT017833.1| Zea mays clone EL01N0509B09.c mRNA sequence	412	e-112
4	ref|XM_473060.1| Oryza sativa (japonica cultivar-group), predic...	402	e-109
5	gb|BT016465.1| Zea mays clone Contig298 mRNA sequence	400	e-108
6	gb|AY104035.1| Zea mays PCO096331 mRNA sequence	385	e-103
7	ref|NM_184009.1| Oryza sativa (japonica cultivar-group), predic...	375	e-100
8	dbj|AK120842.1| Oryza sativa (japonica cultivar-group) cDNA clon...	371	2e-99
9	gb|AY110987.1| Zea mays CL1782_3 mRNA sequence	329	6e-87
10	dbj|AK102699.1| Oryza sativa (japonica cultivar-group) cDNA clon...	311	1e-81
11	emb|AL606594.4| Oryza sativa genomic DNA, chromosome 4, BAC clon...	293	3e-76
12	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	293	3e-76
13	emb|AL442115.2| Oryza sativa genomic DNA, chromosome 4, BAC clon...	293	3e-76
14	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	280	5e-72
15	dbj|AP003764.3| Oryza sativa (japonica cultivar-group) genomic D...	280	5e-72
16	dbj|AP003852.2| Oryza sativa (japonica cultivar-group) genomic D...	280	5e-72
17	gb|AF061508.1|AF061508 Zea mays ribosomal protein L25 mRNA, part...	266	8e-68
18	gb|BT018262.1| Zea mays clone EL01T0202C04.c mRNA sequence	218	2e-53
19	gb|AF031542.1|AF031542 Fritillaria agrestis ribosomal protein L2...	170	3e-39
20	gb|AF349961.1| Daucus carota ribosome protein L23a mRNA, complet...	168	1e-38
21	gb|DQ200381.1| Solanum tuberosum clone 062E11 ribosomal protein ...	153	8e-34
22	ref|NM_129504.3| Arabidopsis thaliana ATRPL23A (RIBOSOMAL PROTEI...	147	5e-32
23	gb|AY039850.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, com...	147	5e-32
24	gb|AY037235.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, com...	147	5e-32
25	gb|AF325056.2|AF325056 Arabidopsis thaliana At2g39460 (At2g39460...	147	5e-32
26	emb|BX819997.1|CNS0A8JW Arabidopsis thaliana Full-length cDNA Co...	147	5e-32
27	gb|AY086212.1| Arabidopsis thaliana clone 22479 mRNA, complete s...	147	5e-32
28	gb|AY060540.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, com...	141	3e-30
29	gb|AF034694.1|AF034694 Arabidopsis thaliana ribosomal protein L2...	139	1e-29
30	emb|X92350.1|SORPL23 S.oleracea mRNA for ribosomal protein L23 (...	125	2e-25
31	gb|DQ296187.1| Brassica rapa clone 135 unknown mRNA	125	2e-25
32	gb|L18908.1|TOBRPL25A Nicotiana tabacum ribosomal protein L25, c...	119	1e-23
33	ref|NM_115386.2| Arabidopsis thaliana RNA binding / structural c...	111	3e-21
34	emb|X92367.1|SORPL235 S.oleracea mRNA for ribosomal protein L23 ...	111	3e-21
35	gb|BT000478.1| Arabidopsis thaliana ribosomal L23a - like protei...	111	3e-21
36	gb|AY050445.1| Arabidopsis thaliana AT3g55280/T26I12_160 mRNA, c...	111	3e-21
37	gb|AY085736.1| Arabidopsis thaliana clone 17531 mRNA, complete s...	111	3e-21
38	emb|BX825416.1|CNS0A7I7 Arabidopsis thaliana Full-length cDNA Co...	103	7e-19
39	gb|AF548321.1| Branchiostoma belcheri ribosomal protein L23a mRN...	101	3e-18
40	gb|AY232233.1| Drosophila yakuba clone yak-ad_RpL23a mRNA sequence	98	4e-17
41	gb|AF281334.1| Oncorhynchus mykiss 60S ribosomal protein mRNA, p...	96	2e-16
42	gb|AC004218.3| Arabidopsis thaliana chromosome 2 clone F12L6 map...	94	6e-16
43	gb|AY874405.1| Solanum tuberosum isolate CT240 cultivar HH1-9, g...	94	6e-16
44	gb|AY874403.1| Solanum tuberosum isolate CT240 cultivar USW-2230...	94	6e-16
45	ref|XM_787855.1| PREDICTED: Strongylocentrotus purpuratus simila...	90	1e-14
46	emb|AL132954.1|ATT26I12 Arabidopsis thaliana DNA chromosome 3, B...	90	1e-14
47	emb|BX841999.1|CNS09YA4 Arabidopsis thaliana Full-length cDNA Co...	90	1e-14
48	gb|AY874404.1| Solanum berthaultii isolate CT240 cultivar B11B, ...	88	4e-14
49	gb|AF401578.1| Ictalurus punctatus ribosomal protein L23a mRNA, ...	86	2e-13
50	gb|DQ450529.1| Drosophila melanogaster L23A ribosomal protein na...	82	2e-12
51	gb|AC010038.5| Drosophila melanogaster 3L BAC RP98-14O14 (Roswel...	82	2e-12
52	gb|AC105264.3| Drosophila melanogaster 3L BAC RP98-17K18 (Roswel...	82	2e-12
53	gb|AC093192.2| Drosophila melanogaster 3L BAC RP98-48J18 (Roswel...	82	2e-12
54	gb|AY094921.1| Drosophila melanogaster RH35480 full insert cDNA	82	2e-12
55	ref|NM_079162.2| Drosophila melanogaster Ribosomal protein L23A ...	82	2e-12
56	gb|AF080130.1|AF080130 Drosophila melanogaster ribosomal protein...	82	2e-12
57	gb|AE003472.1| Drosophila melanogaster chromosome 3L, section 6 ...	82	2e-12
58	gb|AC005557.1|AC005557 Drosophila melanogaster, chromosome 3L, r...	82	2e-12
59	gb|U40948.1| Caenorhabditis elegans cosmid F55D10, complete sequ...	80	1e-11
60	gb|DQ138322.1| Myxobolus cerebralis ribosomal protein L23-like m...	80	1e-11
61	ref|NM_076407.3| Caenorhabditis elegans Ribosomal Protein, Large...	80	1e-11
62	emb|AL115487.1|CNS01CG7 Botrytis cinerea strain T4 cDNA library	80	1e-11
63	emb|AL115271.1|CNS01CA7 Botrytis cinerea strain T4 cDNA library	80	1e-11
64	emb|AL114669.1|CNS01BTH Botrytis cinerea strain T4 cDNA library	80	1e-11
65	emb|AL114551.1|CNS01BQ7 Botrytis cinerea strain T4 cDNA library	80	1e-11
66	emb|AL112682.1|CNS01AAA Botrytis cinerea strain T4 cDNA library	80	1e-11
67	emb|AL111598.1|CNS019G6 Botrytis cinerea strain T4 cDNA library	80	1e-11
68	emb|AL111416.1|CNS019B4 Botrytis cinerea strain T4 cDNA library	80	1e-11
69	emb|AL110748.1|CNS018SL Botrytis cinerea strain T4 cDNA library	80	1e-11
70	emb|AL110918.1|CNS018XB Botrytis cinerea strain T4 cDNA library	80	1e-11
71	ref|XM_757052.1| Ustilago maydis 521 hypothetical protein (UM059...	78	4e-11
72	gb|AC139707.10| Medicago truncatula clone mth2-16b22, complete s...	76	1e-10
73	gb|BC098550.1| Danio rerio ribosomal protein L23a, mRNA (cDNA cl...	74	6e-10
74	ref|XM_415820.1| PREDICTED: Gallus gallus similar to 60S ribosom...	74	6e-10
75	gb|AY561517.1| Danio rerio ribosomal protein L23a (rpl23a) mRNA,...	74	6e-10
76	ref|XM_677033.1| Aspergillus nidulans FGSC A4 hypothetical prote...	74	6e-10
77	ref|NM_001001593.1| Danio rerio ribosomal protein L23a (rpl23a),...	74	6e-10
78	gb|BT021430.1| Drosophila melanogaster GM06171 full insert cDNA	74	6e-10
79	emb|AL112366.1|CNS01A1I Botrytis cinerea strain T4 cDNA library	72	2e-09
80	emb|BX819433.1|CNS0A8ZH Arabidopsis thaliana Full-length cDNA Co...	70	9e-09
81	ref|XM_365965.1| Magnaporthe grisea 70-15 hypothetical protein (...	66	1e-07
82	ref|XM_382669.1| Gibberella zeae PH-1 chromosome 1 conserved hyp...	66	1e-07
83	emb|Z75541.1|CEF52B5 Caenorhabditis elegans Cosmid F52B5, comple...	66	1e-07
84	ref|NM_059862.2| Caenorhabditis elegans Ribosomal Protein, Large...	66	1e-07
85	gb|AY849680.1| Magnaporthe grisea 60S ribosomal protein L23-like...	66	1e-07
86	gb|U02032.1|HSU02032 Human ribosomal protein L23a mRNA, partial cds	66	1e-07
87	gb|AC068205.25| Homo sapiens chromosome 11, clone RP11-472I20, c...	64	6e-07
88	ref|XM_511611.1| PREDICTED: Pan troglodytes similar to breast ca...	62	2e-06
89	ref|XM_523627.1| PREDICTED: Pan troglodytes similar to Rpl23a pr...	62	2e-06
90	ref|XM_511361.1| PREDICTED: Pan troglodytes similar to ribosomal...	62	2e-06
91	ref|XM_528535.1| PREDICTED: Pan troglodytes similar to Rpl23a pr...	62	2e-06
92	ref|XM_514120.1| PREDICTED: Pan troglodytes similar to Rpl23a pr...	62	2e-06
93	gb|AC090426.1| Homo sapiens chromosome 17 clone 205m17 map 17q21...	62	2e-06
94	gb|BC058041.1| Homo sapiens ribosomal protein L23a, mRNA (cDNA c...	62	2e-06
95	gb|BC014459.1| Homo sapiens ribosomal protein L23a, mRNA (cDNA c...	62	2e-06
96	ref|NM_000984.5| Homo sapiens ribosomal protein L23a (RPL23A), mRNA	62	2e-06
97	gb|DP000044.2| Callithrix jacchus target 106 genomic scaffold	62	2e-06
98	ref|XM_505871.1| Yarrowia lipolytica CLIB122, YALI0F25531g predi...	62	2e-06
99	gb|AC018629.12| Homo sapiens chromosome 17, clone RP11-58O9, com...	62	2e-06
100	emb|BX054544.1|CNS09E90 Single read from an extremity of a full-...	62	2e-06
101	gb|AC112491.4| Homo sapiens 3 BAC RP11-3P17 (Roswell Park Cancer...	62	2e-06
102	gb|BC036642.1| Mus musculus, clone IMAGE:3371217, mRNA	62	2e-06
103	emb|CR616046.1| full-length cDNA clone CS0DE014YB21 of Placenta ...	62	2e-06
104	gb|AC011979.7| Homo sapiens chromosome 11, clone RP11-16F15, com...	62	2e-06
105	ref|NG_002546.1| Homo sapiens ribosomal protein L23a pseudogene ...	62	2e-06
106	ref|XM_937620.1| PREDICTED: Homo sapiens similar to 60S ribosoma...	62	2e-06
107	ref|XM_377521.3| PREDICTED: Homo sapiens similar to 60S ribosoma...	62	2e-06
108	ref|XM_939952.1| PREDICTED: Homo sapiens similar to 60S ribosoma...	62	2e-06
109	ref|XM_941396.1| PREDICTED: Homo sapiens similar to 60S ribosoma...	62	2e-06
110	ref|XM_930113.1| PREDICTED: Homo sapiens similar to 60S ribosoma...	62	2e-06
111	gb|AD000091.1|CH19F15314 Homo sapiens DNA from chromosome 19p13....	62	2e-06
112	ref|XM_340850.2| PREDICTED: Rattus norvegicus ribosomal protein ...	62	2e-06
113	ref|XM_577114.1| PREDICTED: Rattus norvegicus similar to 60S rib...	62	2e-06
114	gb|AC010761.10| Homo sapiens chromosome 17, clone RP11-386F9, co...	62	2e-06
115	dbj|AK130965.1| Homo sapiens cDNA FLJ27455 fis, clone UBA04121, ...	62	2e-06
116	emb|AJ277546.2|HSA277546 Homo sapiens WEE1 gene for protein kina...	62	2e-06
117	emb|X65228.1|RRRPL23A R.rattus mRNA for ribosomal protein L23a	62	2e-06
118	emb|AL132801.5|CNS01DTN Human chromosome 14 DNA sequence BAC R-6...	62	2e-06
119	gb|AF001689.1|AF001689 Homo sapiens ribosomal protein L23A (RPL2...	62	2e-06
120	emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1...	62	2e-06
121	gb|U37230.1|HSU37230 Human ribosomal protein L23a mRNA, complete...	62	2e-06
122	gb|U43701.1|HSU43701 Human ribosomal protein L23a mRNA, complete...	62	2e-06
123	emb|Y12508.1|HSIGFBP H.sapiens IGFBP-4 gene	62	2e-06
124	gb|L13799.1|HUMCH13C1A Homo sapiens (clone 01) liver expressed p...	62	2e-06
125	gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chr...	60	9e-06
126	gb|AC007683.5| Homo sapiens BAC clone RP11-401L13 from 7, comple...	60	9e-06
127	gb|AY498860.1| Homo sapiens tumor necrosis factor receptor super...	60	9e-06
128	ref|XM_569415.1| Cryptococcus neoformans var. neoformans JEC21 r...	60	9e-06
129	emb|AL357835.11| Human DNA sequence from clone RP11-426M1 on chr...	60	9e-06
130	emb|AL157386.14| Human DNA sequence from clone RP11-170J3 on chr...	60	9e-06
131	gb|DQ214298.1| Taeniopygia guttata clone 0061P0010E07 60S riboso...	58	4e-05
132	gb|BC077046.1| Xenopus tropicalis MGC89958 protein, mRNA (cDNA c...	58	4e-05
133	emb|BX019711.1|CNS08NDF Single read from an extremity of a full-...	58	4e-05
134	gb|AY972826.1| Aedes albopictus ribosomal protein L23a mRNA, com...	58	4e-05
135	gb|AY857437.1| Suberites domuncula L23a mRNA, complete cds	58	4e-05
136	ref|NM_001005109.1| Xenopus tropicalis MGC89958 protein (MGC8995...	58	4e-05
137	gb|AC153889.19| Mus musculus 10 BAC RP23-434A12 (Roswell Park Ca...	56	1e-04
138	gb|AC167202.8| Mus musculus BAC RP24-243A15 (Roswell Park Cance...	56	1e-04
139	ref|XM_521892.1| PREDICTED: Pan troglodytes similar to Rpl23a pr...	56	1e-04
140	ref|XM_508278.1| PREDICTED: Pan troglodytes similar to Rpl23a pr...	56	1e-04
141	gb|AC095247.5| Rattus norvegicus 4 BAC CH230-10C6 (Children's Ho...	56	1e-04
142	gb|AC087066.3| Rattus norvegicus strain Brown Norway clone RP31-...	56	1e-04
143	gb|AC087067.3| Rattus norvegicus strain Brown Norway clone RP31-...	56	1e-04
144	ref|XM_001002232.1| PREDICTED: Mus musculus similar to 60S ribos...	56	1e-04
145	ref|XM_984537.1| PREDICTED: Mus musculus similar to 60S ribosoma...	56	1e-04
146	ref|XM_984283.1| PREDICTED: Mus musculus similar to 60S ribosoma...	56	1e-04
147	ref|XM_983917.1| PREDICTED: Mus musculus similar to 60S ribosoma...	56	1e-04
148	gb|AC164642.3| Mus musculus BAC clone RP23-248L4 from chromosome...	56	1e-04
149	gb|AC164636.4| Mus musculus BAC clone RP23-70P16 from chromosome...	56	1e-04
150	emb|BX053332.1|CNS09DBC Single read from an extremity of a full-...	56	1e-04
151	emb|BX071919.1|CNS09RNN Single read from an extremity of a full-...	56	1e-04
152	emb|BX071918.1|CNS09RNM Single read from an extremity of a full-...	56	1e-04
153	emb|BX071899.1|CNS09RN3 Single read from an extremity of a full-...	56	1e-04
154	emb|BX071898.1|CNS09RN2 Single read from an extremity of a full-...	56	1e-04
155	emb|BX071572.1|CNS09RE0 Single read from an extremity of a full-...	56	1e-04
156	emb|BX070849.1|CNS09QTX Single read from an extremity of a full-...	56	1e-04
157	emb|BX070057.1|CNS09Q7X Single read from an extremity of a full-...	56	1e-04
158	emb|BX060970.1|CNS09J7I Single read from an extremity of a full-...	56	1e-04
159	emb|BX060969.1|CNS09J7H Single read from an extremity of a full-...	56	1e-04
160	emb|BX068513.1|CNS09P11 Single read from an extremity of a full-...	56	1e-04
161	emb|BX068512.1|CNS09P10 Single read from an extremity of a full-...	56	1e-04
162	emb|BX067321.1|CNS09O3X Single read from an extremity of a full-...	56	1e-04
163	emb|BX067206.1|CNS09O0Q Single read from an extremity of a full-...	56	1e-04
164	emb|BX066586.1|CNS09NJI Single read from an extremity of a full-...	56	1e-04
165	emb|BX066585.1|CNS09NJH Single read from an extremity of a full-...	56	1e-04
166	emb|BX066443.1|CNS09NFJ Single read from an extremity of a full-...	56	1e-04
167	emb|BX066442.1|CNS09NFI Single read from an extremity of a full-...	56	1e-04
168	emb|BX062873.1|CNS09KOD Single read from an extremity of a full-...	56	1e-04
169	emb|BX060551.1|CNS09IVV Single read from an extremity of a full-...	56	1e-04
170	emb|BX060550.1|CNS09IVU Single read from an extremity of a full-...	56	1e-04
171	emb|BX059628.1|CNS09I68 Single read from an extremity of a full-...	56	1e-04
172	emb|BX058866.1|CNS09HL2 Single read from an extremity of a full-...	56	1e-04
173	emb|BX058865.1|CNS09HL1 Single read from an extremity of a full-...	56	1e-04
174	emb|BX054450.1|CNS09E6E Single read from an extremity of a full-...	56	1e-04
175	emb|BX053901.1|CNS09DR5 Single read from an extremity of a full-...	56	1e-04
176	emb|BX053900.1|CNS09DR4 Single read from an extremity of a full-...	56	1e-04
177	emb|BX052734.1|CNS09CUQ Single read from an extremity of a full-...	56	1e-04
178	emb|BX052705.1|CNS09CTX Single read from an extremity of a full-...	56	1e-04
179	emb|BX051821.1|CNS09C5D Single read from an extremity of a full-...	56	1e-04
180	emb|BX051339.1|CNS09BRZ Single read from an extremity of a full-...	56	1e-04
181	emb|BX050056.1|CNS09ASC Single read from an extremity of a full-...	56	1e-04
182	emb|BX049916.1|CNS09AOG Single read from an extremity of a full-...	56	1e-04
183	emb|BX048611.1|CNS099O7 Single read from an extremity of a full-...	56	1e-04
184	emb|BX047300.1|CNS098NS Single read from an extremity of a full-...	56	1e-04
185	emb|BX047299.1|CNS098NR Single read from an extremity of a full-...	56	1e-04
186	emb|BX047041.1|CNS098GL Single read from an extremity of a full-...	56	1e-04
187	emb|BX045321.1|CNS0974T Single read from an extremity of a full-...	56	1e-04
188	emb|BX045193.1|CNS09719 Single read from an extremity of a full-...	56	1e-04
189	emb|BX045140.1|CNS096ZS Single read from an extremity of a full-...	56	1e-04
190	emb|BX044621.1|CNS096LD Single read from an extremity of a full-...	56	1e-04
191	emb|BX042669.1|CNS09535 Single read from an extremity of a full-...	56	1e-04
192	emb|BX041906.1|CNS094HY Single read from an extremity of a full-...	56	1e-04
193	emb|BX040647.1|CNS093IZ Single read from an extremity of a full-...	56	1e-04
194	emb|BX040287.1|CNS0938Z Single read from an extremity of a full-...	56	1e-04
195	emb|BX039799.1|CNS092VF Single read from an extremity of a full-...	56	1e-04
196	emb|BX039798.1|CNS092VE Single read from an extremity of a full-...	56	1e-04
197	emb|BX033324.1|CNS08XVK Single read from an extremity of a full-...	56	1e-04
198	emb|BX033323.1|CNS08XVJ Single read from an extremity of a full-...	56	1e-04
199	emb|BX033172.1|CNS08XRC Single read from an extremity of a full-...	56	1e-04
200	emb|BX022463.1|CNS08PHV Single read from an extremity of a full-...	56	1e-04
201	emb|BX022462.1|CNS08PHU Single read from an extremity of a full-...	56	1e-04
202	emb|BX022320.1|CNS08PDW Single read from an extremity of a full-...	56	1e-04
203	emb|BX026874.1|CNS08SWE Single read from an extremity of a full-...	56	1e-04
204	emb|BX026580.1|CNS08SO8 Single read from an extremity of a full-...	56	1e-04
205	emb|BX022838.1|CNS08PSA Single read from an extremity of a full-...	56	1e-04
206	emb|BX025008.1|CNS08RGK Single read from an extremity of a full-...	56	1e-04
207	emb|BX023269.1|CNS08Q49 Single read from an extremity of a full-...	56	1e-04
208	emb|BX023034.1|CNS08PXQ Single read from an extremity of a full-...	56	1e-04
209	emb|BX021957.1|CNS08P3T Single read from an extremity of a full-...	56	1e-04
210	emb|BX021487.1|CNS08OQR Single read from an extremity of a full-...	56	1e-04
211	emb|BX020862.1|CNS08O9E Single read from an extremity of a full-...	56	1e-04
212	emb|BX019000.1|CNS08MTO Single read from an extremity of a full-...	56	1e-04
213	emb|BX017300.1|CNS08LIG Single read from an extremity of a full-...	56	1e-04
214	emb|BX016716.1|CNS08L28 Single read from an extremity of a full-...	56	1e-04
215	emb|BX016715.1|CNS08L27 Single read from an extremity of a full-...	56	1e-04
216	emb|BX016430.1|CNS08KUA Single read from an extremity of a full-...	56	1e-04
217	emb|BX015793.1|CNS08KCL Single read from an extremity of a full-...	56	1e-04
218	emb|BX015752.1|CNS08KBG Single read from an extremity of a full-...	56	1e-04
219	emb|BX014341.1|CNS08J89 Single read from an extremity of a full-...	56	1e-04
220	emb|BX014340.1|CNS08J88 Single read from an extremity of a full-...	56	1e-04
221	emb|BX011071.1|CNS08GPF Single read from an extremity of a full-...	56	1e-04
222	emb|BX010970.1|CNS08GMM Single read from an extremity of a full-...	56	1e-04
223	emb|BX010969.1|CNS08GML Single read from an extremity of a full-...	56	1e-04
224	emb|BX010291.1|CNS08G3R Single read from an extremity of a full-...	56	1e-04
225	emb|BX010257.1|CNS08G2T Single read from an extremity of a full-...	56	1e-04
226	emb|BX010256.1|CNS08G2S Single read from an extremity of a full-...	56	1e-04
227	emb|BX009853.1|CNS08FRL Single read from an extremity of a full-...	56	1e-04
228	emb|BX009843.1|CNS08FRB Single read from an extremity of a full-...	56	1e-04
229	emb|BX009817.1|CNS08FQL Single read from an extremity of a full-...	56	1e-04
230	emb|BX008690.1|CNS08EVA Single read from an extremity of a full-...	56	1e-04
231	emb|BX007724.1|CNS08E4G Single read from an extremity of a full-...	56	1e-04
232	emb|BX007723.1|CNS08E4F Single read from an extremity of a full-...	56	1e-04
233	emb|BX006872.1|CNS08DGS Single read from an extremity of a full-...	56	1e-04
234	emb|BX006131.1|CNS08CW7 Single read from an extremity of a full-...	56	1e-04
235	emb|BX006130.1|CNS08CW6 Single read from an extremity of a full-...	56	1e-04
236	gb|AY972825.1| Anopheles stephensi ribosomal protein L23a mRNA, ...	56	1e-04
237	gb|AC174742.8| Mus musculus BAC RP24-258O12 (Roswell Park Cance...	56	1e-04
238	gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold	56	1e-04
239	ref|XM_316082.2| Anopheles gambiae str. PEST ENSANGP00000024740 ...	56	1e-04
240	ref|XM_316083.2| Anopheles gambiae str. PEST ENSANGP00000012554 ...	56	1e-04
241	gb|AC172027.4| Mus musculus BAC RP24-219P17 (Roswell Park Cance...	56	1e-04
242	gb|AC171183.6| Mus musculus BAC RP24-545B2 (Roswell Park Cancer...	56	1e-04
243	emb|AL672193.10| Mouse DNA sequence from clone RP23-443O18 on ch...	56	1e-04
244	gb|AC123752.8| Mus musculus chromosome 1, clone RP24-194N4, comp...	54	5e-04
245	gb|BC086883.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c...	54	5e-04
246	gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome...	54	5e-04
247	gb|BC026656.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c...	54	5e-04
248	gb|BC029892.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c...	54	5e-04
249	gb|BC016558.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c...	54	5e-04
250	gb|AC103405.14| Mus musculus chromosome 19, clone RP23-98J4, com...	54	5e-04
251	ref|NM_207523.1| Mus musculus ribosomal protein L23a (Rpl23a), mRNA	54	5e-04
252	ref|XM_622785.3| PREDICTED: Mus musculus ribosomal protein L23a,...	54	5e-04
253	ref|XM_903849.2| PREDICTED: Mus musculus ribosomal protein L23a,...	54	5e-04
254	ref|XM_001002269.1| PREDICTED: Mus musculus similar to 60S ribos...	54	5e-04
255	ref|XR_003020.1| PREDICTED: Mus musculus similar to 60S ribosoma...	54	5e-04
256	ref|XR_003599.1| PREDICTED: Mus musculus hypothetical protein LO...	54	5e-04
257	gb|AF452721.1| Mus musculus ribosomal protein L23a mRNA, complet...	54	5e-04
258	gb|AC132259.3| Mus musculus BAC clone RP24-369B15 from chromosom...	54	5e-04
259	gb|AC122291.4| Mus musculus BAC clone RP23-255N20 from 15, compl...	54	5e-04
260	emb|AL360091.28| Human DNA sequence from clone RP11-384C4 on chr...	54	5e-04
261	emb|AL591070.19| Mouse DNA sequence from clone RP23-185A18 on ch...	54	5e-04
262	emb|AL390140.1|HSM802785 Homo sapiens genomic DNA; cDNA DKFZp547...	54	5e-04
263	emb|BX005100.9| Mouse DNA sequence from clone RP23-76P22 on chro...	54	5e-04
264	dbj|AK141850.1| Mus musculus 12 days embryo spinal ganglion cDNA...	54	5e-04
265	dbj|AK152095.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	54	5e-04
266	ref|NR_002229.1| Homo sapiens ribosomal protein L23a pseudogene ...	54	5e-04
267	dbj|AK165432.1| Mus musculus adult male kidney cDNA, RIKEN full-...	54	5e-04
268	dbj|AK161721.1| Mus musculus adult male thymus cDNA, RIKEN full-...	54	5e-04
269	gb|BC086884.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c...	54	5e-04
270	dbj|AK028387.1| Mus musculus 18 days pregnant adult female place...	54	5e-04
271	gb|BC096637.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c...	54	5e-04
272	gb|AC139452.4| Homo sapiens 3 BAC RP11-301L7 (Roswell Park Cance...	54	5e-04
273	gb|AC154563.2| Mus musculus BAC clone RP23-401E22 from chromosom...	54	5e-04
274	gb|AC154738.2| Mus musculus BAC clone RP24-390D14 from chromosom...	54	5e-04
275	gb|AC092839.4| Homo sapiens BAC clone RP11-257N16 from 2, comple...	54	5e-04
276	ref|XM_574848.1| PREDICTED: Rattus norvegicus similar to 60S rib...	54	5e-04
277	ref|XM_218061.3| PREDICTED: Rattus norvegicus similar to 60S rib...	54	5e-04
278	gb|AC093038.4| Homo sapiens BAC clone RP13-541C6 from 2, complet...	54	5e-04
279	gb|BC096740.1| Homo sapiens ribosomal protein L23a pseudogene 13...	54	5e-04
280	gb|BC098172.1| Homo sapiens ribosomal protein L23a pseudogene 13...	54	5e-04
281	gb|BC096706.1| Homo sapiens ribosomal protein L23a pseudogene 13...	54	5e-04
282	gb|AC154471.2| Mus musculus BAC clone RP23-195D3 from chromosome...	54	5e-04
283	gb|AC004807.1|AC004807 Mus musculus chromosome 11, clone mCIT.26...	54	5e-04
284	gb|AC113182.14| Mus musculus chromosome 8, clone RP23-39F24, com...	54	5e-04
285	emb|AL772308.4| Mouse DNA sequence from clone RP23-451I21 on chr...	54	5e-04
286	gb|DQ214299.1| Taeniopygia guttata clone 0061P0022D04 60S riboso...	52	0.002
287	gb|DQ214297.1| Taeniopygia guttata clone 0061P0010B09 60S riboso...	52	0.002
288	gb|AC146204.3| Pan troglodytes BAC clone RP43-25M3 from 7, compl...	52	0.002
289	emb|BX067205.1|CNS09O0P Single read from an extremity of a full-...	52	0.002
290	emb|BX026579.1|CNS08SO7 Single read from an extremity of a full-...	52	0.002
291	gb|AC005007.1|AC005007 Homo sapiens BAC clone GS1-51M12 from 7p2...	52	0.002
292	ref|XM_573792.1| PREDICTED: Rattus norvegicus similar to 60S rib...	52	0.002
293	ref|XM_222721.3| PREDICTED: Rattus norvegicus similar to 2310050...	52	0.002
294	gb|BC078526.1| Xenopus laevis MGC85348 protein, mRNA (cDNA clone...	50	0.009
295	ref|XR_003525.1| PREDICTED: Mus musculus hypothetical LOC633918 ...	50	0.009
296	gb|AC121855.3| Mus musculus BAC clone RP24-97C18 from chromosome...	50	0.009
297	emb|AL513016.5| Human DNA sequence from clone RP11-474O21 on chr...	50	0.009
298	emb|BX011072.1|CNS08GPG Single read from an extremity of a full-...	50	0.009
299	emb|CR855878.5| Human DNA sequence from clone RP13-469P20 on chr...	50	0.009
300	gb|AF234162.1|AF234162 Leishmania braziliensis ribosomal protein...	50	0.009
301	gb|AC005884.1|AC005884 Homo sapiens chromosome 17, clone hRPK.2...	50	0.009
302	gb|U44800.1|PGU44800 Puccinia graminis f. sp. avenae ribosomal p...	50	0.009
303	ref|XM_583734.2| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
304	ref|XM_864088.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
305	ref|XM_871857.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
306	ref|XM_871768.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
307	ref|XM_594319.2| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
308	ref|XM_863859.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
309	ref|XM_878778.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
310	ref|XM_878746.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
311	ref|XM_878716.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
312	ref|XM_866556.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
313	ref|XM_882175.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
314	ref|XM_868968.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
315	ref|XM_874719.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
316	ref|XM_874636.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
317	ref|XM_591988.2| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
318	ref|XM_868944.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	48	0.034
319	ref|XM_957984.1| Neurospora crassa OR74A hypothetical protein (N...	48	0.034
320	ref|XM_326080.1| Neurospora crassa OR74A hypothetical protein (N...	48	0.034
321	gb|BC114200.1| Bos taurus similar to 60S ribosomal protein L23a,...	48	0.034
322	emb|BX071573.1|CNS09RE1 Single read from an extremity of a full-...	48	0.034
323	emb|BX070668.1|CNS09QOW Single read from an extremity of a full-...	48	0.034
324	emb|BX067322.1|CNS09O3Y Single read from an extremity of a full-...	48	0.034
325	emb|BX063120.1|CNS09KV8 Single read from an extremity of a full-...	48	0.034
326	emb|BX057144.1|CNS09G98 Single read from an extremity of a full-...	48	0.034
327	emb|BX054545.1|CNS09E91 Single read from an extremity of a full-...	48	0.034
328	emb|BX050057.1|CNS09ASD Single read from an extremity of a full-...	48	0.034
329	emb|BX045141.1|CNS096ZT Single read from an extremity of a full-...	48	0.034
330	emb|BX044622.1|CNS096LE Single read from an extremity of a full-...	48	0.034
331	emb|BX039559.1|CNS092OR Single read from an extremity of a full-...	48	0.034
332	emb|BX031929.1|CNS08WST Single read from an extremity of a full-...	48	0.034
333	emb|BX022321.1|CNS08PDX Single read from an extremity of a full-...	48	0.034
334	emb|BX026300.1|CNS08SGG Single read from an extremity of a full-...	48	0.034
335	emb|BX018573.1|CNS08MHT Single read from an extremity of a full-...	48	0.034
336	emb|BX016431.1|CNS08KUB Single read from an extremity of a full-...	48	0.034
337	emb|BX015794.1|CNS08KCM Single read from an extremity of a full-...	48	0.034
338	emb|BX009854.1|CNS08FRM Single read from an extremity of a full-...	48	0.034
339	emb|BX009844.1|CNS08FRC Single read from an extremity of a full-...	48	0.034
340	emb|BX008691.1|CNS08EVB Single read from an extremity of a full-...	48	0.034
341	gb|DP000053.1| Oryctolagus cuniculus target 126 genomic scaffold	48	0.034
342	ref|XM_516856.1| PREDICTED: Pan troglodytes similar to Rpl23a pr...	46	0.13
343	gb|AC156576.3| Mus musculus BAC clone RP23-7C22 from chromosome ...	46	0.13
344	ref|XR_002727.1| PREDICTED: Mus musculus similar to 60S ribosoma...	46	0.13
345	ref|XM_982279.1| PREDICTED: Mus musculus similar to 60S ribosoma...	46	0.13
346	ref|XM_847323.1| PREDICTED: Canis familiaris similar to 60S ribo...	46	0.13
347	ref|XM_905447.2| PREDICTED: Mus musculus similar to 60S ribosoma...	46	0.13
348	ref|XM_136585.3| PREDICTED: Mus musculus similar to 60S ribosoma...	46	0.13
349	gb|AC123557.4| Mus musculus BAC clone RP23-183P22 from 1, comple...	46	0.13
350	emb|AL603865.4| Human DNA sequence from clone RP11-129H15 on chr...	46	0.13
351	emb|AL162411.23| Human DNA sequence from clone RP11-106A1 on chr...	46	0.13
352	emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr...	46	0.13
353	gb|AC099673.2| Homo sapiens chromosome 1 clone RP11-109H10, comp...	46	0.13
354	gb|AC132032.1| Homo sapiens 3 BAC RP11-4H14 (Roswell Park Cancer...	46	0.13
355	gb|AC099335.2| Homo sapiens chromosome 1 clone RP11-104D3, compl...	46	0.13
356	gb|AC153852.9| Mus musculus 10 BAC RP23-136F8 (Roswell Park Canc...	46	0.13
357	gb|AC148698.1| Macaca mulatta Major Histocompatibility Complex B...	46	0.13
358	gb|AC148682.1| Macaca mulatta Major Histocompatibility Complex M...	46	0.13
359	dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia...	46	0.13
360	ref|XM_224270.3| PREDICTED: Rattus norvegicus similar to putativ...	46	0.13
361	ref|XM_344325.2| PREDICTED: Rattus norvegicus similar to 60S rib...	46	0.13
362	gb|AC118202.8| Mus musculus chromosome 10, clone RP23-378J3, com...	46	0.13
363	gb|AC145303.4| Mus musculus BAC clone RP23-411P20 from 14, compl...	46	0.13
364	emb|AL714007.10| Mouse DNA sequence from clone RP23-295M3 on chr...	46	0.13
365	ref|NM_023006.1| Homo sapiens kallikrein 15 (KLK15), transcript ...	44	0.53
366	ref|NM_017509.2| Homo sapiens kallikrein 15 (KLK15), transcript ...	44	0.53
367	ref|NM_138563.1| Homo sapiens kallikrein 15 (KLK15), transcript ...	44	0.53
368	ref|NM_138564.1| Homo sapiens kallikrein 15 (KLK15), transcript ...	44	0.53
369	gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome	44	0.53
370	gb|AY373374.1| Homo sapiens kallikrein 15 isoform 6 preproprotei...	44	0.53
371	gb|AY373373.1| Homo sapiens kallikrein 15 isoform 5 preproprotei...	44	0.53
372	gb|AC008745.7| Homo sapiens chromosome 19 clone CTD-2571L23, com...	44	0.53
373	gb|AC010325.7| Homo sapiens chromosome 19 clone CTD-2568A17, com...	44	0.53
374	gb|AY094609.1| Homo sapiens kallikrein 1, renal/pancreas/salivar...	44	0.53
375	gb|AF303046.1|AF303046 Homo sapiens prostinogen mRNA, complete cds	44	0.53
376	gb|AF242195.1|AF242195 Homo sapiens KLK15 (KLK15) gene, complete...	44	0.53
377	gb|AF243527.1|AF243527 Homo sapiens serine protease gene cluster...	44	0.53
378	ref|XM_578099.1| PREDICTED: Rattus norvegicus similar to 60S rib...	44	0.53
379	emb|AL805935.6| Mouse DNA sequence from clone RP23-326E10 on chr...	44	0.53
380	gb|AY441143.1| Armigeres subalbatus ASAP ID: 42583 cytosolic lar...	42	2.1
381	gb|AY431258.1| Aedes aegypti ASAP ID: 37257 cytosolic large ribo...	42	2.1
382	gb|AC108777.7| Mus musculus chromosome 18, clone RP23-368H22, co...	42	2.1
383	gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence	42	2.1
384	gb|AC105378.10| Trypanosoma brucei chromosome 7 clone RPCI93-27E...	42	2.1
385	gb|AC154354.2| Mus musculus BAC clone RP23-203C5 from chromosome...	42	2.1
386	ref|XM_873448.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	42	2.1
387	ref|XM_864494.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	42	2.1
388	ref|XM_873326.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	42	2.1
389	ref|XM_873228.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	42	2.1
390	ref|XM_873124.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	42	2.1
391	ref|XM_873022.1| PREDICTED: Bos taurus similar to 60S ribosomal ...	42	2.1
392	ref|XM_589100.2| PREDICTED: Bos taurus similar to 60S ribosomal ...	42	2.1
393	ref|XM_603720.2| PREDICTED: Bos taurus similar to 60S ribosomal ...	42	2.1
394	ref|XM_905304.2| PREDICTED: Mus musculus similar to 60S ribosoma...	42	2.1
395	ref|XM_820575.1| Trypanosoma brucei TREU927 clone RPCI93-27E10 6...	42	2.1
396	ref|XM_820574.1| Trypanosoma brucei TREU927 clone RPCI93-27E10 6...	42	2.1
397	emb|CR936845.11| Mouse DNA sequence from clone DN-279H6 on chrom...	42	2.1
398	emb|AL110502.1|HSDJ635E8 Human DNA sequence from clone RP4-635E8...	42	2.1
399	emb|BX062946.1|CNS09KQE Single read from an extremity of a full-...	42	2.1
400	emb|BX061971.1|CNS09JZB Single read from an extremity of a full-...	42	2.1
401	emb|BX051417.1|CNS09BU5 Single read from an extremity of a full-...	42	2.1
402	emb|BX047042.1|CNS098GM Single read from an extremity of a full-...	42	2.1
403	emb|BX045322.1|CNS0974U Single read from an extremity of a full-...	42	2.1
404	emb|BX040648.1|CNS093J0 Single read from an extremity of a full-...	42	2.1
405	emb|BX021746.1|CNS08OXY Single read from an extremity of a full-...	42	2.1
406	emb|BX015401.1|CNS08K1P Single read from an extremity of a full-...	42	2.1
407	emb|BX013157.1|CNS08IBD Single read from an extremity of a full-...	42	2.1
408	emb|BX012975.1|CNS08I6B Single read from an extremity of a full-...	42	2.1
409	emb|BX009818.1|CNS08FQM Single read from an extremity of a full-...	42	2.1
410	emb|AL596136.5| Mouse DNA sequence from clone RP23-83I13 on chro...	42	2.1
411	gb|BC041993.1| Homo sapiens cDNA clone IMAGE:5304009	42	2.1
412	gb|AC067796.11| Homo sapiens chromosome 18, clone RP11-609K12, c...	42	2.1
413	gb|AC093690.5| Homo sapiens BAC clone RP11-731I19 from 2, comple...	42	2.1
414	gb|AC158388.2| Mus musculus BAC clone RP24-545I9 from chromosome...	42	2.1
415	ref|XM_574925.1| PREDICTED: Rattus norvegicus similar to 60S rib...	42	2.1
416	emb|AL445883.3|CNS07EEQ Human chromosome 14 DNA sequence BAC R-9...	42	2.1
417	emb|AL355885.4|CNS05TCW Human chromosome 14 DNA sequence BAC R-4...	42	2.1
418	gb|L21172.1|TRBRPL25A Trypanosoma brucei brucei ribosomal protei...	42	2.1
419	ref|XM_472119.1| Oryza sativa (japonica cultivar-group), predic...	40	8.2
420	ref|XM_361119.1| Magnaporthe grisea 70-15 hypothetical protein (...	40	8.2
421	ref|XM_369574.1| Magnaporthe grisea 70-15 chromosome III hypothe...	40	8.2
422	gb|AY658805.1| Synthetic construct Peudomonas aeruginosa clone F...	40	8.2
423	gb|AC134397.6| Mus musculus chromosome 13, clone RP23-265J12, co...	40	8.2
424	gb|AC009974.10| Homo sapiens BAC clone RP11-459I19 from 2, compl...	40	8.2
425	gb|AC094950.6| Rattus norvegicus 14 BAC CH230-6H12 (Children's H...	40	8.2
426	gb|BC065219.1| Homo sapiens cDNA clone IMAGE:5724338, partial cds	40	8.2
427	gb|CP000352.1| Ralstonia metallidurans CH34, complete genome	40	8.2
428	gb|AC008020.37| Mus musculus strain 129S6/SvEvTac chromosome 16 ...	40	8.2
429	ref|XM_748242.1| Aspergillus fumigatus Af293 hypothetical protei...	40	8.2
430	emb|AL592307.36| Human DNA sequence from clone RP11-458D21 on ch...	40	8.2
431	emb|AL589822.18| Human DNA sequence from clone RP11-109G10 on ch...	40	8.2
432	emb|AL355273.30| Human DNA sequence from clone RP11-714M16 on ch...	40	8.2
433	emb|AL354930.11| Human DNA sequence from clone RP11-185B14 on ch...	40	8.2
434	emb|AL133395.21| Human DNA sequence from clone RP11-446H13 on ch...	40	8.2
435	emb|BX052733.1|CNS09CUP Single read from an extremity of a full-...	40	8.2
436	emb|BX006514.1|CNS08D6U Single read from an extremity of a full-...	40	8.2
437	gb|AC116715.22| Mus musculus chromosome 5, clone RP23-129N14, co...	40	8.2
438	emb|AL663020.4|OSJN00220 Oryza sativa genomic DNA, chromosome 4,...	40	8.2
439	emb|AL732632.4| Zebrafish DNA sequence from clone CH211-140K5 in...	40	8.2
440	dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c...	40	8.2
441	gb|AE012414.1| Xanthomonas campestris pv. campestris str. ATCC 3...	40	8.2
442	gb|AC099789.2| Homo sapiens chromosome 1 clone RP11-377K22, comp...	40	8.2
443	gb|CP000249.1| Frankia sp. CcI3, complete genome	40	8.2
444	gb|AC139319.6| Mus musculus BAC clone RP24-439B16 from chromosom...	40	8.2
445	gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ...	40	8.2
446	emb|AJ621037.1| Tetraodon nigroviridis partial non-LTR retrotran...	40	8.2
447	gb|AC154460.2| Mus musculus BAC clone RP24-163G22 from chromosom...	40	8.2
448	gb|AC011298.7| Homo sapiens BAC clone RP11-118M12 from 2, comple...	40	8.2
449	gb|AE004675.1| Pseudomonas aeruginosa PAO1, section 236 of 529 o...	40	8.2
450	gb|AC079831.24| Mus musculus strain C57BL/6J chromosome 16 clone...	40	8.2
451	ref|NM_203458.2| Homo sapiens Notch homolog 2 (Drosophila) N-ter...	40	8.2
452	gb|AC112784.5| Homo sapiens BAC clone RP13-555N8 from 2, complet...	40	8.2
453	gb|AC133573.11| Mus musculus strain C57BL/6J clone rp23-139f17, ...	40	8.2
454	gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete...	40	8.2
455	dbj|AP003050.4| Homo sapiens genomic DNA, chromosome 11 clone:RP...	40	8.2
456	gb|AC113264.21| Mus musculus strain C57BL/6J chromosome 16 clone...	40	8.2
457	emb|AM167520.1| Malus x domestica transposon gene for putative D...	40	8.2
458	gb|AC111089.27| Mus musculus chromosome 5, clone RP23-156F20, co...	40	8.2

---

>gb|BT018281.1| Zea mays clone EL01T0204F12.c mRNA sequence
          Length = 912

 Score =  428 bits (216), Expect = e-117
 Identities = 404/466 (86%), Gaps = 3/466 (0%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           ||||||||||| ||||||||||| ||||||||||||||||| ||  | |||||||| || 
Sbjct: 608 atgatgccgattttgttggccacatcaagagcatcatagtcaggcataagcttcacgtaa 549

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||||| || || ||||||||||||||||| |||||||||||||| || || |||
Sbjct: 548 gccttcttctttccatcaggcctgatcagggtgttgaccttcttggcctgaatgtcatac 489

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||||||||||||||||||||||||||||||||||| || |||||||||
Sbjct: 488 atcttcttgacagcagccttgatcttcttcttgtctgccttgaggtcgacaatgaagaca 429

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           || |||||||| || || ||||||||||| || || || ||||| |  || |||||||| 
Sbjct: 428 agagtgttgttatcttcaatcttcttcatcgccgattctgtggtgaggggatacttgaga 369

                                                                       
Query: 341 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 400
           || ||||| || ||||||||||||||||| |  || ||||| || |||||||||||||||
Sbjct: 368 atttggtactgatcaagcttgttccttccggtagtgctgattcttgggtacttggggtcc 309

                                                                       
Query: 401 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttctttgcg 460
           || |||||   ||||||||||||||||||||||||||| |||||||||||||||||   |
Sbjct: 308 ctagccttcttcagggtcttggggcggtgaaatgtcacggacgtgcggatcttctt---g 252

                                                                       
Query: 461 gtcttcttgattgacccagacttcacagccttggcaaccttggcagcctgggccttggca 520
           |||||||| | ||||||||||||||||||||||||||||||    ||||||| |||||||
Sbjct: 251 gtcttctttactgacccagacttcacagccttggcaaccttcaaggcctgggtcttggca 192

                                                         
Query: 521 tcgcccttcttggcaacagcagctttgggagccatttgagcttctc 566
           || ||||||||||||  ||||||||| |||||||||| ||||||||
Sbjct: 191 tcacccttcttggcaggagcagctttaggagccatttcagcttctc 146

---

>gb|BT017941.1| Zea mays clone EL01N0521B03.c mRNA sequence
          Length = 770

 Score =  420 bits (212), Expect = e-114
 Identities = 403/466 (86%), Gaps = 3/466 (0%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           ||||||||||| ||||||||||| ||||||||||||||||| || || |||||||| || 
Sbjct: 609 atgatgccgattttgttggccacatcaagagcatcatagtcaggcgtaagcttcacgtaa 550

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||||| || || || |||||||||||||| |||||||||||||| || || |||
Sbjct: 549 gccttcttctttccatcaggtctgatcagggtgttgaccttcttggcctgaatgtcatac 490

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||||||||||||||||||||||||||||||||||| || |||||||| 
Sbjct: 489 atcttcttgacagcagccttgatcttcttcttgtctgccttgaggtcgacaatgaagacc 430

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           || |||||||| || || ||||||||||| || || || ||||| |  || |||||||| 
Sbjct: 429 agagtgttgttatcttcaatcttcttcatcgccgattctgtggtgaggggatacttgaga 370

                                                                       
Query: 341 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 400
           || ||||| || ||||||||||||||||| |  || ||||| || |||||||||||||||
Sbjct: 369 atttggtactgatcaagcttgttccttccggaagtgctgattcttgggtacttggggtcc 310

                                                                       
Query: 401 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttctttgcg 460
           || |||||   ||||||||||||||||||||||||||| |||||||||||||||||   |
Sbjct: 309 ctagccttcttcagggtcttggggcggtgaaatgtcacggacgtgcggatcttctt---g 253

                                                                       
Query: 461 gtcttcttgattgacccagacttcacagccttggcaaccttggcagcctgggccttggca 520
           |||||||| | ||||||||||||||||||||||||||||||    ||||||| |||||||
Sbjct: 252 gtcttctttactgacccagacttcacagccttggcaaccttcaaggcctgggtcttggca 193

                                                         
Query: 521 tcgcccttcttggcaacagcagctttgggagccatttgagcttctc 566
           || ||||||||||||  ||||||||| |||||||||| ||||||||
Sbjct: 192 tcacccttcttggcaggagcagctttaggagccatttcagcttctc 147

---

>gb|BT017833.1| Zea mays clone EL01N0509B09.c mRNA sequence
          Length = 824

 Score =  412 bits (208), Expect = e-112
 Identities = 406/472 (86%)
 Strand = Plus / Minus

                                                                       
Query: 95  acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 154
           ||||| ||||||||||| |||||||| || ||||||||||||||||| || |||||||||
Sbjct: 530 acttagatgatgccgattttgttggcaacatcaagagcatcatagtcaggagtcagcttc 471

                                                                       
Query: 155 acataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggata 214
           || || ||||||||||| || || |||||||||| |||||| |||||||| |||||||| 
Sbjct: 470 acgtaagccttcttcttcccatcaggcctgatcaaggtgttgaccttctttgcctggatg 411

                                                                       
Query: 215 tcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatg 274
           || |||||||| || || |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 410 tcatacatcttcttgacggcagccttgatcttcttcttgtctgccttgaggtcaacaatg 351

                                                                       
Query: 275 aagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtac 334
           ||||| || |||||||| || || ||||||||||| || || || ||||| |  ||||||
Sbjct: 350 aagaccagagtgttgttatcttcaatcttcttcatcgctgattctgtggtaagggggtac 291

                                                                       
Query: 335 ttgaggatctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttg 394
           ||||| || ||||| || ||||||||||||||||| |  || ||||| |  |||||||||
Sbjct: 290 ttgagaatttggtactgatcaagcttgttccttccggtagtgctgattcgtgggtacttg 231

                                                                       
Query: 395 gggtccctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttc 454
           |||||||| |||||   ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 230 gggtccctagccttcttcagggtcgtggggcggtgaaatgtcacagacgtgcggatcttc 171

                                                                       
Query: 455 tttgcggtcttcttgattgacccagacttcacagccttggcaaccttggcagcctgggcc 514
           || |   ||||||||  || |||||||||||||||||||||||||||     |||||| |
Sbjct: 170 ttggtcttcttcttggctgccccagacttcacagccttggcaaccttcaagacctgggtc 111

                                                               
Query: 515 ttggcatcgcccttcttggcaacagcagctttgggagccatttgagcttctc 566
           |||||||| ||||||||||||  ||||||||| |||||||||| ||||||||
Sbjct: 110 ttggcatcacccttcttggcaggagcagctttaggagccatttcagcttctc 59

---

>ref|XM_473060.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 459

 Score =  402 bits (203), Expect = e-109
 Identities = 392/455 (86%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||| ||||||||||||||||| |||||||| |||||||||||||||||||| || 
Sbjct: 455 atgatgccaatcttgttggccacgtcgagagcatcgtagtctggtgtcagcttcacgtaa 396

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||||| || || ||||||||||| ||||| || ||||| |||||||| ||||||
Sbjct: 395 gccttcttcttcccatcaggcctgatcagagtgttcactttctttgcctggatgtcgtac 336

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||||||||||||||||||||||| ||||| |||||||| |||||||| 
Sbjct: 335 atcttcttgacagcagccttgatcttcttcttgtcagccttaaggtcaacaatgaagacc 276

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           || ||||||||||| ||||||||||||||||| || || ||||| |  || ||||| |||
Sbjct: 275 agagtgttgttgtcttcgatcttcttcattgcggattcagtggtaaggggatacttaagg 216

                                                                       
Query: 341 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 400
           |||||||| || |||||||||||||| || ||||||||||  || |||||||||||||||
Sbjct: 215 atctggtactgatcaagcttgttcctcccaggggtactgactcttgggtacttggggtcc 156

                                                                       
Query: 401 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttctttgcg 460
           || | |||   || |||||||||||||||||||||||| || |||||||||||||| |  
Sbjct: 155 ctagacttcttcaaggtcttggggcggtgaaatgtcacggatgtgcggatcttcttggtc 96

                                                                       
Query: 461 gtcttcttgattgacccagacttcacagccttggcaaccttggcagcctgggccttggca 520
           |||||||||  || ||||||||| |||||||||||  ||||    || ||||||||||||
Sbjct: 95  gtcttcttggctgtcccagacttaacagccttggctgccttcaaggcttgggccttggca 36

                                              
Query: 521 tcgcccttcttggcaacagcagctttgggagccat 555
           || ||||||||||||  ||||||||| ||||||||
Sbjct: 35  tcacccttcttggcaggagcagctttaggagccat 1

---

>gb|BT016465.1| Zea mays clone Contig298 mRNA sequence
          Length = 630

 Score =  400 bits (202), Expect = e-108
 Identities = 403/470 (85%)
 Strand = Plus / Minus

                                                                       
Query: 95  acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 154
           ||||| ||||||||||| |||||||| || ||||||||||||||||| || |||||||||
Sbjct: 470 acttagatgatgccgattttgttggcaacatcaagagcatcatagtcaggagtcagcttc 411

                                                                       
Query: 155 acataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggata 214
           || || ||||| || || || || |||||||||| |||||| |||||||| |||||||| 
Sbjct: 410 acgtaagccttttttttcccatcaggcctgatcaaggtgttgaccttctttgcctggatg 351

                                                                       
Query: 215 tcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatg 274
           || |||||||| || || |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 350 tcatacatcttcttgacggcagccttgatcttcttcttgtctgccttgaggtcaacaatg 291

                                                                       
Query: 275 aagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtac 334
           ||||| || |||||||| || || ||||||||||| || || || ||||| |  ||||||
Sbjct: 290 aagaccagagtgttgttatcttcaatcttcttcatcgctgattctgtggtaagggggtac 231

                                                                       
Query: 335 ttgaggatctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttg 394
           ||||| || ||||| || ||||||||||||||||| |  || ||||| |  |||||||||
Sbjct: 230 ttgagaatttggtactgatcaagcttgttccttccggtagtgctgattcgtgggtacttg 171

                                                                       
Query: 395 gggtccctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttc 454
           |||||||| |||||   ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 170 gggtccctagccttcttcagggtcgtggggcggtgaaatgtcacagacgtgcggatcttc 111

                                                                       
Query: 455 tttgcggtcttcttgattgacccagacttcacagccttggcaaccttggcagcctgggcc 514
           || |   ||||||||  || |||||||||||||||||||||||||||    ||||||| |
Sbjct: 110 ttggtcttcttcttggctgccccagacttcacagccttggcaaccttcaaggcctgggtc 51

                                                             
Query: 515 ttggcatcgcccttcttggcaacagcagctttgggagccatttgagcttc 564
           |||||||| ||||||||||||  ||||||||| |||||||||| ||||||
Sbjct: 50  ttggcatcacccttcttggcaggagcagctttaggagccatttcagcttc 1

---

>gb|AY104035.1| Zea mays PCO096331 mRNA sequence
          Length = 1154

 Score =  385 bits (194), Expect = e-103
 Identities = 382/444 (86%), Gaps = 3/444 (0%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           ||||||||||| ||||||||||| ||||||||||||||||| ||  | |||||||| || 
Sbjct: 844 atgatgccgattttgttggccacatcaagagcatcatagtcaggcataagcttcacgtaa 785

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||||| || || |||||||||| |||||| |||||||||||||| || || |||
Sbjct: 784 gccttcttctttccatcaggcctgatcaaggtgttgaccttcttggcctgaatgtcatac 725

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||||||||||||||||||||||||||||||||||| || |||||||| 
Sbjct: 724 atcttcttgacagcagccttgatcttcttcttgtctgccttgaggtcgacaatgaagacc 665

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           || |||||||| || || ||||||||||| || || || ||||| |  || |||||||| 
Sbjct: 664 agagtgttgttatcttcaatcttcttcatcgccgattctgtggtgaggggatacttgaga 605

                                                                       
Query: 341 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 400
           || ||||| || ||||||||||||||||| |  || ||||| || |||||||||||||||
Sbjct: 604 atttggtactgatcaagcttgttccttccggtagtgctgattcttgggtacttggggtcc 545

                                                                       
Query: 401 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttctttgcg 460
           || |||||   ||||||||||||||||||||||||||| |||||||||||||||||   |
Sbjct: 544 ctagccttcttcagggtcttggggcggtgaaatgtcacggacgtgcggatcttctt---g 488

                                                                       
Query: 461 gtcttcttgattgacccagacttcacagccttggcaaccttggcagcctgggccttggca 520
           |||||||| | ||||||||||||||||||||||||||||||    ||||||| |||||||
Sbjct: 487 gtcttctttactgacccagacttcacagccttggcaaccttcaaggcctgggtcttggca 428

                                   
Query: 521 tcgcccttcttggcaacagcagct 544
           || ||||||||||||  |||||||
Sbjct: 427 tcacccttcttggcaggagcagct 404

---

>ref|NM_184009.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 459

 Score =  375 bits (189), Expect = e-100
 Identities = 348/401 (86%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||| || ||||||||||| |||||||||||||||||||| || |||||||| || 
Sbjct: 455 atgatgccaattttgttggccacatcaagagcatcatagtctggagtgagcttcacgtaa 396

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||||||||||| ||||||||||| |||||||| ||||| |||||||| || |||
Sbjct: 395 gccttcttcttgccgtcaggcctgatcagagtgttaactttctttgcctggatgtcatac 336

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || || |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 335 atcttcttgacagctgccttgatcttcttcttgtctgccttgaggtcgacgatgaagaca 276

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           |||||||||||||| || ||||||||||| ||||| ||||| || |  ||||||||||||
Sbjct: 275 agggtgttgttgtcttcaatcttcttcatggcagattcggtcgtaagggggtacttgagg 216

                                                                       
Query: 341 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 400
           || ||||| || |||||||||||||| || || | |||||  || |||||||| ||||| 
Sbjct: 215 atttggtactgatcaagcttgttcctgccaggtgcactgactcttgggtacttagggtct 156

                                                                       
Query: 401 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttctttgcg 460
           || |||||   ||||||||| || | |||||||||||| || ||||||||||||||||  
Sbjct: 155 ctcgccttcttcagggtctttggtctgtgaaatgtcaccgaagtgcggatcttctttgac 96

                                                    
Query: 461 gtcttcttgattgacccagacttcacagccttggcaacctt 501
            |  |||||||||||||||||||||| ||||||||||||||
Sbjct: 95  tttctcttgattgacccagacttcactgccttggcaacctt 55

---

>dbj|AK120842.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023022J07, full
           insert sequence
          Length = 687

 Score =  371 bits (187), Expect = 2e-99
 Identities = 352/407 (86%)
 Strand = Plus / Minus

                                                                       
Query: 95  acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 154
           ||||| |||||||| || ||||||||||| |||||||||||||||||||| |  ||||||
Sbjct: 544 acttaaatgatgccaattttgttggccacatcaagagcatcatagtctggagcgagcttc 485

                                                                       
Query: 155 acataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggata 214
           || || ||||||||||||||||| ||||||||||| |||||||| ||||| |||||||| 
Sbjct: 484 acgtaagccttcttcttgccgtcaggcctgatcagagtgttaactttctttgcctggatg 425

                                                                       
Query: 215 tcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatg 274
           || |||||||| || || || |||||||||||||||||||||||||||||||| ||||||
Sbjct: 424 tcatacatcttcttgacagctgccttgatcttcttcttgtctgccttgaggtcgacgatg 365

                                                                       
Query: 275 aagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtac 334
           |||||||||||||||||||| || ||||||||||| ||||| ||||| || |  ||||||
Sbjct: 364 aagacaagggtgttgttgtcttcaatcttcttcatggcagattcggtcgtaagggggtac 305

                                                                       
Query: 335 ttgaggatctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttg 394
           |||||||| ||||| || |||||||||||||| || || | |||||  || |||||||| 
Sbjct: 304 ttgaggatttggtactgatcaagcttgttcctgccaggtgcactgactcttgggtactta 245

                                                                       
Query: 395 gggtccctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttc 454
           ||||| || |||||   ||||||||| || | |||||||||||| || ||||||||||||
Sbjct: 244 gggtctctcgccttcttcagggtctttggtctgtgaaatgtcaccgaagtgcggatcttc 185

                                                          
Query: 455 tttgcggtcttcttgattgacccagacttcacagccttggcaacctt 501
           ||||   |  |||||||||||||||||||||| ||||||||||||||
Sbjct: 184 tttgactttctcttgattgacccagacttcactgccttggcaacctt 138

---

>gb|AY110987.1| Zea mays CL1782_3 mRNA sequence
          Length = 878

 Score =  329 bits (166), Expect = 6e-87
 Identities = 393/472 (83%)
 Strand = Plus / Minus

                                                                       
Query: 95  acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 154
           ||||| |||||||| || ||||||||||| ||||| ||||| ||||| |||||||| |||
Sbjct: 519 acttagatgatgccaattttgttggccacatcaagggcatcgtagtcgggtgtcagtttc 460

                                                                       
Query: 155 acataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggata 214
           ||||| ||||||||||| || || ||||||||||||||||| |||||||| || || || 
Sbjct: 459 acataagccttcttcttcccatcaggcctgatcagggtgttgaccttctttgcttgaatg 400

                                                                       
Query: 215 tcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatg 274
           || |||||||| || |||||||||||||||     ||||||||||||||||||||| || 
Sbjct: 399 tcatacatcttcttgaccgcagccttgatcnnnnncttgtctgccttgaggtcaacaata 340

                                                                       
Query: 275 aagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtac 334
           ||||| || |||||||| || || ||||||||||||||||| || ||||| |     |||
Sbjct: 339 aagaccagagtgttgttatcttcaatcttcttcattgcagattctgtggtgannnnntac 280

                                                                       
Query: 335 ttgaggatctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttg 394
           ||||| || ||||| || ||||||||||| ||||| |  || ||||| || |||||||| 
Sbjct: 279 ttgagaatttggtactgatcaagcttgtttcttccagtagtgctgattcttgggtacttc 220

                                                                       
Query: 395 gggtccctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttc 454
           ||||||||||||||   ||||||||||||  |||||||||| ||||| ||||| ||||||
Sbjct: 219 gggtccctggccttcttcagggtcttgggctggtgaaatgttacagatgtgcgaatcttc 160

                                                                       
Query: 455 tttgcggtcttcttgattgacccagacttcacagccttggcaaccttggcagcctgggcc 514
           || |    ||| |||  || ||||||||||||||||||||| |||||    |||||||||
Sbjct: 159 ttggtctcctttttgcctgccccagacttcacagccttggccaccttcaaggcctgggcc 100

                                                               
Query: 515 ttggcatcgcccttcttggcaacagcagctttgggagccatttgagcttctc 566
           |||||||| ||||||||||||  ||| ||||| |||||||||||||||||||
Sbjct: 99  ttggcatcacccttcttggcaggagcggctttaggagccatttgagcttctc 48

---

>dbj|AK102699.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033103K16, full
           insert sequence
          Length = 1188

 Score =  311 bits (157), Expect = 1e-81
 Identities = 295/341 (86%)
 Strand = Plus / Minus

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||||||||||| ||||||||||| |||||||| ||||| |||||||| || |||
Sbjct: 475 gccttcttcttgccgtcaggcctgatcagagtgttaactttctttgcctggatgtcatac 416

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || || |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 415 atcttcttgacagctgccttgatcttcttcttgtctgccttgaggtcgacgatgaagaca 356

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           |||||||||||||| || ||||||||||| ||||| ||||| || |  ||||||||||||
Sbjct: 355 agggtgttgttgtcttcaatcttcttcatggcagattcggtcgtaagggggtacttgagg 296

                                                                       
Query: 341 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 400
           || ||||| || |||||||||||||| || || | |||||  || |||||||| ||||| 
Sbjct: 295 atttggtactgatcaagcttgttcctgccaggtgcactgactcttgggtacttagggtct 236

                                                                       
Query: 401 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttctttgcg 460
           || |||||   ||||||||| || | |||||||||||| || ||||||||||||||||  
Sbjct: 235 ctcgccttcttcagggtctttggtctgtgaaatgtcaccgaagtgcggatcttctttgac 176

                                                    
Query: 461 gtcttcttgattgacccagacttcacagccttggcaacctt 501
            |  |||||||||||||||||||||| ||||||||||||||
Sbjct: 175 tttctcttgattgacccagacttcactgccttggcaacctt 135

---

>emb|AL606594.4| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0029H02,
              complete sequence
          Length = 173171

 Score =  293 bits (148), Expect = 3e-76
 Identities = 310/364 (85%)
 Strand = Plus / Plus

                                                                          
Query: 181    cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 240
              ||||||||| ||||| || ||||| |||||||| ||||||||||| || || ||||||||
Sbjct: 104239 cctgatcagagtgttcactttctttgcctggatgtcgtacatcttcttgacagcagcctt 104298

                                                                          
Query: 241    gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 300
              ||||||||||||||| ||||| |||||||| |||||||| || ||||||||||| |||||
Sbjct: 104299 gatcttcttcttgtcagccttaaggtcaacaatgaagaccagagtgttgttgtcttcgat 104358

                                                                          
Query: 301    cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 360
              |||||||||||| || || ||||| |  || ||||| ||||||||||| || ||||||||
Sbjct: 104359 cttcttcattgcggattcagtggtaaggggatacttaaggatctggtactgatcaagctt 104418

                                                                          
Query: 361    gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 420
              |||||| || ||||||||||  || ||||||||||||||||| | |||   || ||||||
Sbjct: 104419 gttcctcccaggggtactgactcttgggtacttggggtccctagacttcttcaaggtctt 104478

                                                                          
Query: 421    ggggcggtgaaatgtcacagacgtgcggatcttctttgcggtcttcttgattgacccaga 480
              |||||||||||||||||| || |||||||||||||| |  |||||||||  || ||||||
Sbjct: 104479 ggggcggtgaaatgtcacggatgtgcggatcttcttggtcgtcttcttggctgtcccaga 104538

                                                                          
Query: 481    cttcacagccttggcaaccttggcagcctgggccttggcatcgcccttcttggcaacagc 540
              ||| |||||||||||  ||||    || |||||||||||||| ||||||||||||  |||
Sbjct: 104539 cttaacagccttggctgccttcaaggcttgggccttggcatcacccttcttggcaggagc 104598

                  
Query: 541    agct 544
              ||||
Sbjct: 104599 agct 104602



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                          
Query: 95     acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 154
              ||||| |||||||| ||||||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 104074 acttagatgatgccaatcttgttggccacgtcgagagcatcgtagtctggtgtcagcttc 104133

                                            
Query: 155    acataggccttcttcttgccgtccggcctg 184
              || || ||||||||||| || || ||||||
Sbjct: 104134 acgtaagccttcttcttcccatcaggcctg 104163



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 543    ctttgggagccatttgagcttctcaggacagcctcttgaact 584
              |||| ||||||||| ||||||| |||| | ||||||||||||
Sbjct: 104952 ctttaggagccattggagcttcacagggctgcctcttgaact 104993

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  293 bits (148), Expect = 3e-76
 Identities = 310/364 (85%)
 Strand = Plus / Plus

                                                                            
Query: 181      cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 240
                ||||||||| ||||| || ||||| |||||||| ||||||||||| || || ||||||||
Sbjct: 24983654 cctgatcagagtgttcactttctttgcctggatgtcgtacatcttcttgacagcagcctt 24983713

                                                                            
Query: 241      gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 300
                ||||||||||||||| ||||| |||||||| |||||||| || ||||||||||| |||||
Sbjct: 24983714 gatcttcttcttgtcagccttaaggtcaacaatgaagaccagagtgttgttgtcttcgat 24983773

                                                                            
Query: 301      cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 360
                |||||||||||| || || ||||| |  || ||||| ||||||||||| || ||||||||
Sbjct: 24983774 cttcttcattgcggattcagtggtaaggggatacttaaggatctggtactgatcaagctt 24983833

                                                                            
Query: 361      gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 420
                |||||| || ||||||||||  || ||||||||||||||||| | |||   || ||||||
Sbjct: 24983834 gttcctcccaggggtactgactcttgggtacttggggtccctagacttcttcaaggtctt 24983893

                                                                            
Query: 421      ggggcggtgaaatgtcacagacgtgcggatcttctttgcggtcttcttgattgacccaga 480
                |||||||||||||||||| || |||||||||||||| |  |||||||||  || ||||||
Sbjct: 24983894 ggggcggtgaaatgtcacggatgtgcggatcttcttggtcgtcttcttggctgtcccaga 24983953

                                                                            
Query: 481      cttcacagccttggcaaccttggcagcctgggccttggcatcgcccttcttggcaacagc 540
                ||| |||||||||||  ||||    || |||||||||||||| ||||||||||||  |||
Sbjct: 24983954 cttaacagccttggctgccttcaaggcttgggccttggcatcacccttcttggcaggagc 24984013

                    
Query: 541      agct 544
                ||||
Sbjct: 24984014 agct 24984017



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                            
Query: 95       acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 154
                ||||| |||||||| ||||||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 24983489 acttagatgatgccaatcttgttggccacgtcgagagcatcgtagtctggtgtcagcttc 24983548

                                              
Query: 155      acataggccttcttcttgccgtccggcctg 184
                || || ||||||||||| || || ||||||
Sbjct: 24983549 acgtaagccttcttcttcccatcaggcctg 24983578



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                          
Query: 543      ctttgggagccatttgagcttctcaggacagcctcttgaact 584
                |||| ||||||||| ||||||| |||| | ||||||||||||
Sbjct: 24984367 ctttaggagccattggagcttcacagggctgcctcttgaact 24984408



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 238      cttgatcttcttcttgtctg 257
                ||||||||||||||||||||
Sbjct: 17700188 cttgatcttcttcttgtctg 17700207

---

>emb|AL442115.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0711G06, complete
              sequence
          Length = 148644

 Score =  293 bits (148), Expect = 3e-76
 Identities = 310/364 (85%)
 Strand = Plus / Plus

                                                                          
Query: 181    cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 240
              ||||||||| ||||| || ||||| |||||||| ||||||||||| || || ||||||||
Sbjct: 111713 cctgatcagagtgttcactttctttgcctggatgtcgtacatcttcttgacagcagcctt 111772

                                                                          
Query: 241    gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 300
              ||||||||||||||| ||||| |||||||| |||||||| || ||||||||||| |||||
Sbjct: 111773 gatcttcttcttgtcagccttaaggtcaacaatgaagaccagagtgttgttgtcttcgat 111832

                                                                          
Query: 301    cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 360
              |||||||||||| || || ||||| |  || ||||| ||||||||||| || ||||||||
Sbjct: 111833 cttcttcattgcggattcagtggtaaggggatacttaaggatctggtactgatcaagctt 111892

                                                                          
Query: 361    gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 420
              |||||| || ||||||||||  || ||||||||||||||||| | |||   || ||||||
Sbjct: 111893 gttcctcccaggggtactgactcttgggtacttggggtccctagacttcttcaaggtctt 111952

                                                                          
Query: 421    ggggcggtgaaatgtcacagacgtgcggatcttctttgcggtcttcttgattgacccaga 480
              |||||||||||||||||| || |||||||||||||| |  |||||||||  || ||||||
Sbjct: 111953 ggggcggtgaaatgtcacggatgtgcggatcttcttggtcgtcttcttggctgtcccaga 112012

                                                                          
Query: 481    cttcacagccttggcaaccttggcagcctgggccttggcatcgcccttcttggcaacagc 540
              ||| |||||||||||  ||||    || |||||||||||||| ||||||||||||  |||
Sbjct: 112013 cttaacagccttggctgccttcaaggcttgggccttggcatcacccttcttggcaggagc 112072

                  
Query: 541    agct 544
              ||||
Sbjct: 112073 agct 112076



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                          
Query: 95     acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 154
              ||||| |||||||| ||||||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 111548 acttagatgatgccaatcttgttggccacgtcgagagcatcgtagtctggtgtcagcttc 111607

                                            
Query: 155    acataggccttcttcttgccgtccggcctg 184
              || || ||||||||||| || || ||||||
Sbjct: 111608 acgtaagccttcttcttcccatcaggcctg 111637



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 543    ctttgggagccatttgagcttctcaggacagcctcttgaact 584
              |||| ||||||||| ||||||| |||| | ||||||||||||
Sbjct: 112426 ctttaggagccattggagcttcacagggctgcctcttgaact 112467

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  280 bits (141), Expect = 5e-72
 Identities = 276/321 (85%)
 Strand = Plus / Minus

                                                                            
Query: 181      cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 240
                ||||||||| |||||||| ||||| |||||||| || |||||||| || || || |||||
Sbjct: 13880684 cctgatcagagtgttaactttctttgcctggatgtcatacatcttcttgacagctgcctt 13880625

                                                                            
Query: 241      gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 300
                ||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||
Sbjct: 13880624 gatcttcttcttgtctgccttgaggtcgacgatgaagacaagggtgttgttgtcttcaat 13880565

                                                                            
Query: 301      cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 360
                ||||||||| ||||| ||||| || |  |||||||||||||| ||||| || ||||||||
Sbjct: 13880564 cttcttcatggcagattcggtcgtaagggggtacttgaggatttggtactgatcaagctt 13880505

                                                                            
Query: 361      gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 420
                |||||| || || | |||||  || |||||||| ||||| || |||||   |||||||||
Sbjct: 13880504 gttcctgccaggtgcactgactcttgggtacttagggtctctcgccttcttcagggtctt 13880445

                                                                            
Query: 421      ggggcggtgaaatgtcacagacgtgcggatcttctttgcggtcttcttgattgacccaga 480
                 || | |||||||||||| || ||||||||||||||||   |  ||||||||||||||||
Sbjct: 13880444 tggtctgtgaaatgtcaccgaagtgcggatcttctttgactttctcttgattgacccaga 13880385

                                     
Query: 481      cttcacagccttggcaacctt 501
                |||||| ||||||||||||||
Sbjct: 13880384 cttcactgccttggcaacctt 13880364



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Minus

                                                                            
Query: 95       acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 154
                ||||| |||||||| || ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 13880857 acttaaatgatgccaattttgttggccacatcaagagcatcatagtctggagtgagcttc 13880798

                                              
Query: 155      acataggccttcttcttgccgtccggcctg 184
                || || ||||||||||||||||| ||||||
Sbjct: 13880797 acgtaagccttcttcttgccgtcaggcctg 13880768

---

>dbj|AP003764.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1051E10
          Length = 207782

 Score =  280 bits (141), Expect = 5e-72
 Identities = 276/321 (85%)
 Strand = Plus / Minus

                                                                         
Query: 181   cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 240
             ||||||||| |||||||| ||||| |||||||| || |||||||| || || || |||||
Sbjct: 40986 cctgatcagagtgttaactttctttgcctggatgtcatacatcttcttgacagctgcctt 40927

                                                                         
Query: 241   gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 300
             ||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||
Sbjct: 40926 gatcttcttcttgtctgccttgaggtcgacgatgaagacaagggtgttgttgtcttcaat 40867

                                                                         
Query: 301   cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 360
             ||||||||| ||||| ||||| || |  |||||||||||||| ||||| || ||||||||
Sbjct: 40866 cttcttcatggcagattcggtcgtaagggggtacttgaggatttggtactgatcaagctt 40807

                                                                         
Query: 361   gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 420
             |||||| || || | |||||  || |||||||| ||||| || |||||   |||||||||
Sbjct: 40806 gttcctgccaggtgcactgactcttgggtacttagggtctctcgccttcttcagggtctt 40747

                                                                         
Query: 421   ggggcggtgaaatgtcacagacgtgcggatcttctttgcggtcttcttgattgacccaga 480
              || | |||||||||||| || ||||||||||||||||   |  ||||||||||||||||
Sbjct: 40746 tggtctgtgaaatgtcaccgaagtgcggatcttctttgactttctcttgattgacccaga 40687

                                  
Query: 481   cttcacagccttggcaacctt 501
             |||||| ||||||||||||||
Sbjct: 40686 cttcactgccttggcaacctt 40666



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Minus

                                                                         
Query: 95    acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 154
             ||||| |||||||| || ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 41159 acttaaatgatgccaattttgttggccacatcaagagcatcatagtctggagtgagcttc 41100

                                           
Query: 155   acataggccttcttcttgccgtccggcctg 184
             || || ||||||||||||||||| ||||||
Sbjct: 41099 acgtaagccttcttcttgccgtcaggcctg 41070

---

>dbj|AP003852.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0440D10
          Length = 144340

 Score =  280 bits (141), Expect = 5e-72
 Identities = 276/321 (85%)
 Strand = Plus / Minus

                                                                          
Query: 181    cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 240
              ||||||||| |||||||| ||||| |||||||| || |||||||| || || || |||||
Sbjct: 118087 cctgatcagagtgttaactttctttgcctggatgtcatacatcttcttgacagctgcctt 118028

                                                                          
Query: 241    gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 300
              ||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||
Sbjct: 118027 gatcttcttcttgtctgccttgaggtcgacgatgaagacaagggtgttgttgtcttcaat 117968

                                                                          
Query: 301    cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 360
              ||||||||| ||||| ||||| || |  |||||||||||||| ||||| || ||||||||
Sbjct: 117967 cttcttcatggcagattcggtcgtaagggggtacttgaggatttggtactgatcaagctt 117908

                                                                          
Query: 361    gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 420
              |||||| || || | |||||  || |||||||| ||||| || |||||   |||||||||
Sbjct: 117907 gttcctgccaggtgcactgactcttgggtacttagggtctctcgccttcttcagggtctt 117848

                                                                          
Query: 421    ggggcggtgaaatgtcacagacgtgcggatcttctttgcggtcttcttgattgacccaga 480
               || | |||||||||||| || ||||||||||||||||   |  ||||||||||||||||
Sbjct: 117847 tggtctgtgaaatgtcaccgaagtgcggatcttctttgactttctcttgattgacccaga 117788

                                   
Query: 481    cttcacagccttggcaacctt 501
              |||||| ||||||||||||||
Sbjct: 117787 cttcactgccttggcaacctt 117767



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Minus

                                                                          
Query: 95     acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 154
              ||||| |||||||| || ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 118260 acttaaatgatgccaattttgttggccacatcaagagcatcatagtctggagtgagcttc 118201

                                            
Query: 155    acataggccttcttcttgccgtccggcctg 184
              || || ||||||||||||||||| ||||||
Sbjct: 118200 acgtaagccttcttcttgccgtcaggcctg 118171

---

>gb|AF061508.1|AF061508 Zea mays ribosomal protein L25 mRNA, partial cds
          Length = 599

 Score =  266 bits (134), Expect = 8e-68
 Identities = 269/314 (85%)
 Strand = Plus / Minus

                                                                       
Query: 95  acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 154
           ||||| |||||||| || ||||||||||| ||||||||||||||||| || |||||||||
Sbjct: 334 acttagatgatgccaattttgttggccacatcaagagcatcatagtcgggagtcagcttc 275

                                                                       
Query: 155 acataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggata 214
           || || ||||||||||| || || |||||||||| |||||| || ||||| |||||||| 
Sbjct: 274 acgtaagccttcttcttcccatcaggcctgatcaaggtgttgactttctttgcctggatg 215

                                                                       
Query: 215 tcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatg 274
           || |||||||| || || |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 214 tcatacatcttcttgacggcagccttgatcttcttcttgtctgccttgaggtcaacaatg 155

                                                                       
Query: 275 aagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtac 334
           ||||| || |||||||| || || ||||||||||| || || || ||||| |  ||||||
Sbjct: 154 aagaccagagtgttgttatcttcaatcttcttcatcgctgattctgtggtaagggggtac 95

                                                                       
Query: 335 ttgaggatctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttg 394
           ||||| || ||||| || ||||||||||||||||| |  || ||||| |  |||||||||
Sbjct: 94  ttgagaatttggtactgatcaagcttgttccttccggtagtgctgattcgtgggtacttg 35

                         
Query: 395 gggtccctggcctt 408
           |||||||| |||||
Sbjct: 34  gggtccctagcctt 21

---

>gb|BT018262.1| Zea mays clone EL01T0202C04.c mRNA sequence
          Length = 476

 Score =  218 bits (110), Expect = 2e-53
 Identities = 326/398 (81%)
 Strand = Plus / Minus

                                                                       
Query: 104 atgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacataggcc 163
           |||||||| |||||||| || |||||||||||||||||  | ||||||||||| || |||
Sbjct: 400 atgccgattttgttggcaacatcaagagcatcatagtcaagagtcagcttcacgtaagcc 341

                                                                       
Query: 164 ttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtacatc 223
           | |||||| || || || ||||||| || ||| |||||||| |||||||| || ||||||
Sbjct: 340 tgcttcttcccatcagggctgatcaaggggttgaccttctttgcctggatgtcatacatc 281

                                                                       
Query: 224 ttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagacaagg 283
           || || || ||||||||||||||||||||||||||||||||| |||| |||||||| |  
Sbjct: 280 ttcttgacggcagccttgatcttcttcttgtctgccttgagggcaaccatgaagaccaca 221

                                                                       
Query: 284 gtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgaggatc 343
           | || | | || || ||||||||||| ||  | || | ||| |  ||| ||||||| || 
Sbjct: 220 gggtggatatcttcaatcttcttcatcgctaattctgaggtaagggggcacttgagaatt 161

                                                                       
Query: 344 tggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtccctg 403
           ||||| || ||||||||||||||||| |  || ||||| |  ||| ||||||||||||| 
Sbjct: 160 tggtactgatcaagcttgttccttccggtagtgctgattcgtgggaacttggggtcccta 101

                                                                       
Query: 404 gccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttctttgcggtc 463
             |||   ||||||| |||||||||||||||||||||||  |||||||||||| |   ||
Sbjct: 100 cacttcttcagggtcgtggggcggtgaaatgtcacagacacgcggatcttcttggtcttc 41

                                                 
Query: 464 ttcttgattgacccagacttcacagccttggcaacctt 501
           ||||||  || ||||||||||||| |||||||||||||
Sbjct: 40  ttcttggatgccccagacttcacacccttggcaacctt 3

---

>gb|AF031542.1|AF031542 Fritillaria agrestis ribosomal protein L23a (rpl23a) mRNA, complete
           cds
          Length = 715

 Score =  170 bits (86), Expect = 3e-39
 Identities = 266/326 (81%)
 Strand = Plus / Minus

                                                                       
Query: 131 gcatcatagtctggtgtcagcttcacataggccttcttcttgccgtccggcctgatcagg 190
           |||||||||||||| |||||    ||||| ||||||||| | || || ||||||||||||
Sbjct: 538 gcatcatagtctggcgtcagtcggacatacgccttcttcgttccatcaggcctgatcagg 479

                                                                       
Query: 191 gtgttaaccttcttggcctggatatcgtacatcttttttaccgcagccttgatcttcttc 250
           || || || ||||||| ||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 478 gtattgactttcttggtctgaatatcatacatcttcttcacagcagctttgatcttcttc 419

                                                                       
Query: 251 ttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcatt 310
           ||||| ||    | |||||| ||||| ||||| ||||||||||| || ||||| ||||| 
Sbjct: 418 ttgtccgctcgaatgtcaacaatgaaaacaagagtgttgttgtcttcaatctttttcatg 359

                                                                       
Query: 311 gcagactcggtggtcaaagggtacttgaggatctggtattggtcaagcttgttccttccc 370
           || ||||| |||||||  || ||||||||||||||||| || || ||||||||||||   
Sbjct: 358 gccgactcagtggtcagtggatacttgaggatctggtagtgatctagcttgttccttgga 299

                                                                       
Query: 371 ggggtactgatcctggggtacttggggtccctggccttggacagggtcttggggcggtga 430
           |||| |||||| |||||||| |||||||  ||  ||||   |||||||||||| || |||
Sbjct: 298 ggggcactgattctggggtatttggggtttctatccttcttcagggtcttgggacgatga 239

                                     
Query: 431 aatgtcacagacgtgcggatcttctt 456
           || || || || ||||||||||||||
Sbjct: 238 aaagttaccgatgtgcggatcttctt 213

---

>gb|AF349961.1| Daucus carota ribosome protein L23a mRNA, complete cds
          Length = 732

 Score =  168 bits (85), Expect = 1e-38
 Identities = 199/237 (83%)
 Strand = Plus / Minus

                                                                       
Query: 131 gcatcatagtctggtgtcagcttcacataggccttcttcttgccgtccggcctgatcagg 190
           ||||| |||||||| |||| | | |||||||| |||||  | ||||| ||||||||||  
Sbjct: 443 gcatcgtagtctggagtcaacctaacataggctttctttgttccgtcgggcctgatcaat 384

                                                                       
Query: 191 gtgttaaccttcttggcctggatatcgtacatcttttttaccgcagccttgatcttcttc 250
           ||||| |||||||||| ||| |||||||||||||| || || ||| |||| |||||||||
Sbjct: 383 gtgttgaccttcttggtctgaatatcgtacatcttcttgacagcatccttaatcttcttc 324

                                                                       
Query: 251 ttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcatt 310
           ||||  ||   || |||||| ||||| || |||||||| ||||| || ||||||||||||
Sbjct: 323 ttgttggcacggatgtcaacaatgaaaaccagggtgttattgtcttcaatcttcttcatt 264

                                                                    
Query: 311 gcagactcggtggtcaaagggtacttgaggatctggtattggtcaagcttgttcctt 367
           ||||| || |||||||| ||||||||||| |||||||| || |||||||||||||||
Sbjct: 263 gcagattcagtggtcaatgggtacttgagaatctggtactgatcaagcttgttcctt 207

---

>gb|DQ200381.1| Solanum tuberosum clone 062E11 ribosomal protein L25-like protein
           mRNA, complete cds
          Length = 696

 Score =  153 bits (77), Expect = 8e-34
 Identities = 221/269 (82%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           ||||| ||||| ||||||||||| || | ||||||||||||||| |||| | ||||||| 
Sbjct: 524 atgatcccgattttgttggccacatccaaagcatcatagtctggagtcaacctcacatat 465

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||  | || || |||||||||| ||| || |  ||||| | ||| || || |||
Sbjct: 464 gccttcttagtcccatcaggcctgatcaaggtattgattttctttgtctgaatgtcatac 405

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || |||||||||||||||||||| || || |||| ||| || ||||| |||
Sbjct: 404 atcttcttcacggcagccttgatcttcttcttatcagctttgatgtccacaatgaaaaca 345

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           |||||||||||||| || |||||||||||||||||||| ||||| | ||| ||||| || 
Sbjct: 344 agggtgttgttgtcttcaatcttcttcattgcagactcagtggtgagaggatactttaga 285

                                        
Query: 341 atctggtattggtcaagcttgttccttcc 369
           |||   || || ||||| |||||||||||
Sbjct: 284 atcgcatactgatcaagtttgttccttcc 256



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 479 gacttcacagccttggcaaccttg 502
           |||||||||||||||||| |||||
Sbjct: 143 gacttcacagccttggcagccttg 120

---

>ref|NM_129504.3| Arabidopsis thaliana ATRPL23A (RIBOSOMAL PROTEIN L23A); RNA binding
           / structural constituent of ribosome AT2G39460
           (ATRPL23A) mRNA, complete cds
          Length = 772

 Score =  147 bits (74), Expect = 5e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 94  gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 153
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 594 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 535

                                                                       
Query: 154 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 213
           ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 534 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 475

                                                                       
Query: 214 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 273
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 474 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 415

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 414 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 355

                                             
Query: 334 cttgaggatctggtattggtcaagcttgttcctt 367
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 354 cttaaggatttggtagtgatccaacttgttcctt 321

---

>gb|AY039850.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, complete cds
          Length = 666

 Score =  147 bits (74), Expect = 5e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 94  gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 153
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 521 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 462

                                                                       
Query: 154 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 213
           ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 461 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 402

                                                                       
Query: 214 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 273
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 401 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 342

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 341 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 282

                                             
Query: 334 cttgaggatctggtattggtcaagcttgttcctt 367
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 281 cttaaggatttggtagtgatccaacttgttcctt 248

---

>gb|AY037235.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, complete cds
          Length = 666

 Score =  147 bits (74), Expect = 5e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 94  gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 153
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 521 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 462

                                                                       
Query: 154 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 213
           ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 461 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 402

                                                                       
Query: 214 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 273
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 401 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 342

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 341 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 282

                                             
Query: 334 cttgaggatctggtattggtcaagcttgttcctt 367
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 281 cttaaggatttggtagtgatccaacttgttcctt 248

---

>gb|AF325056.2|AF325056 Arabidopsis thaliana At2g39460 (At2g39460/F12L6.12) mRNA, complete
           cds
          Length = 693

 Score =  147 bits (74), Expect = 5e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 94  gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 153
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 516 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 457

                                                                       
Query: 154 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 213
           ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 456 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 397

                                                                       
Query: 214 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 273
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 396 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 337

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 336 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 277

                                             
Query: 334 cttgaggatctggtattggtcaagcttgttcctt 367
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 276 cttaaggatttggtagtgatccaacttgttcctt 243

---

>emb|BX819997.1|CNS0A8JW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS59ZB09 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1400

 Score =  147 bits (74), Expect = 5e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                        
Query: 94   gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 153
            |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 1261 gacttacatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 1202

                                                                        
Query: 154  cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 213
            ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 1201 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 1142

                                                                        
Query: 214  atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 273
             || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 1141 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 1082

                                                                        
Query: 274  gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
            ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 1081 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 1022

                                              
Query: 334  cttgaggatctggtattggtcaagcttgttcctt 367
            ||| ||||| ||||| || || | ||||||||||
Sbjct: 1021 cttaaggatttggtagtgatccaacttgttcctt 988

---

>gb|AY086212.1| Arabidopsis thaliana clone 22479 mRNA, complete sequence
          Length = 701

 Score =  147 bits (74), Expect = 5e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 94  gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 153
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 528 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 469

                                                                       
Query: 154 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 213
           ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 468 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 409

                                                                       
Query: 214 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 273
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 408 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 349

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 348 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 289

                                             
Query: 334 cttgaggatctggtattggtcaagcttgttcctt 367
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 288 cttaaggatttggtagtgatccaacttgttcctt 255

---

>gb|AY060540.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, complete cds
          Length = 465

 Score =  141 bits (71), Expect = 3e-30
 Identities = 218/267 (81%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           ||||||||||||||||| || || || | |||||||||||||||||| ||| |||| || 
Sbjct: 461 atgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcctcacgtaa 402

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||  | || || |||||||| || ||||| || ||||||| |||||| || |||
Sbjct: 401 gccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggatgtcatac 342

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||| |||| |||||||||||||| ||    | |||||| ||||| |||
Sbjct: 341 atcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaatgaaaaca 282

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           || ||||||||||| || ||||||||||| ||||| || ||||| |  |||||||| |||
Sbjct: 281 agagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggtacttaagg 222

                                      
Query: 341 atctggtattggtcaagcttgttcctt 367
           || ||||| || || | ||||||||||
Sbjct: 221 atttggtagtgatccaacttgttcctt 195

---

>gb|AF034694.1|AF034694 Arabidopsis thaliana ribosomal protein L23a (AtrpL23a) mRNA,
           complete cds
          Length = 703

 Score =  139 bits (70), Expect = 1e-29
 Identities = 223/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 94  gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 153
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 504 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 445

                                                                       
Query: 154 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 213
           ||  || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 444 catgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 385

                                                                       
Query: 214 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 273
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 384 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 325

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 324 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 265

                                             
Query: 334 cttgaggatctggtattggtcaagcttgttcctt 367
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 264 cttaaggatttggtagtgatccaacttgttcctt 231

---

>emb|X92350.1|SORPL23 S.oleracea mRNA for ribosomal protein L23 (635bp)
          Length = 635

 Score =  125 bits (63), Expect = 2e-25
 Identities = 213/263 (80%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           ||||| ||||||||||| || || || | |||||||||||||||||| ||    || || 
Sbjct: 522 atgattccgatcttgtttgcaacatccaaagcatcatagtctggtgtaaggcggacgtat 463

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||  |||| || ||||||||||  || || || |||||||||||||| || |||
Sbjct: 462 gccttcttggtgccatcgggcctgatcaaagtattcactttcttggcctggatgtcatac 403

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||| |||||||||||||||| || ||   ||  || || || || || 
Sbjct: 402 atcttcttgacggcatccttgatcttcttcttatcagcacggatatcgacaataaacacc 343

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           | ||||||||||||||||||||||||||| ||||||||||| ||||| ||| | || |||
Sbjct: 342 aaggtgttgttgtcctcgatcttcttcatggcagactcggtagtcaacgggaatttaagg 283

                                  
Query: 341 atctggtattggtcaagcttgtt 363
           |||||||| ||||| | ||||||
Sbjct: 282 atctggtagtggtccaacttgtt 260

---

>gb|DQ296187.1| Brassica rapa clone 135 unknown mRNA
          Length = 705

 Score =  125 bits (63), Expect = 2e-25
 Identities = 171/207 (82%)
 Strand = Plus / Minus

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||| | || || |||||||| ||||| || || ||||||| ||| || || |||
Sbjct: 475 gccttcttcgttccatcaggcctgatgagggtattgactttcttggtctgaatgtcatac 416

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||| | ||||||||||||||||| ||   || |||||| |||||||| 
Sbjct: 415 atcttcttgacagcatctttgatcttcttcttgtcagcacggatgtcaacaatgaagacc 356

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           | ||| |||||||| ||||||||||||||||||||||||||||| |  ||||||||||||
Sbjct: 355 aaggtattgttgtcttcgatcttcttcattgcagactcggtggtgagtgggtacttgagg 296

                                      
Query: 341 atctggtattggtcaagcttgttcctt 367
           ||   ||| ||||| | ||||||||||
Sbjct: 295 attccgtagtggtccaacttgttcctt 269

---

>gb|L18908.1|TOBRPL25A Nicotiana tabacum ribosomal protein L25, complete cds
          Length = 695

 Score =  119 bits (60), Expect = 1e-23
 Identities = 174/212 (82%)
 Strand = Plus / Minus

                                                                       
Query: 113 ttgttggccacgtcaagagcatcatagtctggtgtcagcttcacataggccttcttcttg 172
           |||||||| ||||| | |||||||||||| || |||| | ||||||| || |||||| | 
Sbjct: 500 ttgttggcaacgtccaaagcatcatagtcaggagtcaacctcacatatgctttcttcgtc 441

                                                                       
Query: 173 ccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttacc 232
           || || ||||| || | ||| || || ||||| | ||| || || |||||||| || || 
Sbjct: 440 ccatcaggcctaattaaggtattgactttctttgtctgaatgtcatacatcttcttcacg 381

                                                                       
Query: 233 gcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttg 292
           ||| |||| |||||||| || || ||||||| ||| || ||||| |||||||||||||||
Sbjct: 380 gcatccttaatcttctttttatcagccttgatgtccacaatgaaaacaagggtgttgttg 321

                                           
Query: 293 tcctcgatcttcttcattgcagactcggtggt 324
           ||||| |||||||||||||||||||| |||||
Sbjct: 320 tcctcaatcttcttcattgcagactctgtggt 289



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 479 gacttcacagccttggcaaccttggcagcctgggccttgg 518
           ||||| ||||||||||||||||| || ||||| |||||||
Sbjct: 131 gacttgacagccttggcaaccttagctgcctgtgccttgg 92

---

>ref|NM_115386.2| Arabidopsis thaliana RNA binding / structural constituent of
           ribosome AT3G55280 mRNA, complete cds
          Length = 773

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           ||||| ||||| ||||| ||||| || | ||||||||| || || |||| | ||||||| 
Sbjct: 579 atgatcccgattttgttagccacatccaaagcatcataatcaggagtcaacctcacatac 520

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||  | || || ||||| || |||||||| || ||||||| ||| || || |||
Sbjct: 519 gccttctttgttccatcgggcctaatgagggtgttgactttcttggtctgaatgtcatac 460

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||| | |||||||| |||||||| ||   || |||||| |||||||| 
Sbjct: 459 atcttcttgacagcatctttgatctttttcttgtcagcacggatgtcaacaatgaagact 400

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           | |||||||||||| || ||||| ||||| ||||| || || || | |||||||||||||
Sbjct: 399 aaggtgttgttgtcttcaatctttttcatggcagattcagtagtgagagggtacttgagg 340

                   
Query: 341 atctggta 348
           ||||||||
Sbjct: 339 atctggta 332

---

>emb|X92367.1|SORPL235 S.oleracea mRNA for ribosomal protein L23 (578bp)
          Length = 578

 Score =  111 bits (56), Expect = 3e-21
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                       
Query: 134 tcatagtctggtgtcagcttcacataggccttcttcttgccgtccggcctgatcagggtg 193
           ||||||||||||||||     ||||| ||||||||  |||| || |||||||||| ||| 
Sbjct: 477 tcatagtctggtgtcaagcgaacataagccttcttggtgccatcgggcctgatcaaggta 418

                                                                       
Query: 194 ttaaccttcttggcctggatatcgtacatcttttttaccgcagccttgatcttcttcttg 253
           || || ||||||| ||| ||||| |||||||| || || ||  | || || |||||||||
Sbjct: 417 ttcactttcttggactgaatatcatacatcttcttgacggcgtctttaattttcttcttg 358

                                                                       
Query: 254 tctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgca 313
           || ||   ||  ||||||||||| || | ||||||||||||||| |||||||||||||||
Sbjct: 357 tcagcacggatatcaacgatgaaaaccaaggtgttgttgtcctcaatcttcttcattgca 298

                                           
Query: 314 gactcggtggtcaaagggtacttgaggatctg 345
           ||||| |||||||| ||||| || ||||||||
Sbjct: 297 gactcagtggtcaaggggtatttaaggatctg 266

---

>gb|BT000478.1| Arabidopsis thaliana ribosomal L23a - like protein
           (At3g55280/T26I12_160) mRNA, complete cds
          Length = 465

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           ||||| ||||| ||||| ||||| || | ||||||||| || || |||| | ||||||| 
Sbjct: 461 atgatcccgattttgttagccacatccaaagcatcataatcaggagtcaacctcacatac 402

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||  | || || ||||| || |||||||| || ||||||| ||| || || |||
Sbjct: 401 gccttctttgttccatcgggcctaatgagggtgttgactttcttggtctgaatgtcatac 342

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||| | |||||||| |||||||| ||   || |||||| |||||||| 
Sbjct: 341 atcttcttgacagcatctttgatctttttcttgtcagcacggatgtcaacaatgaagact 282

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           | |||||||||||| || ||||| ||||| ||||| || || || | |||||||||||||
Sbjct: 281 aaggtgttgttgtcttcaatctttttcatggcagattcagtagtgagagggtacttgagg 222

                   
Query: 341 atctggta 348
           ||||||||
Sbjct: 221 atctggta 214

---

>gb|AY050445.1| Arabidopsis thaliana AT3g55280/T26I12_160 mRNA, complete cds
          Length = 706

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           ||||| ||||| ||||| ||||| || | ||||||||| || || |||| | ||||||| 
Sbjct: 512 atgatcccgattttgttagccacatccaaagcatcataatcaggagtcaacctcacatac 453

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||  | || || ||||| || |||||||| || ||||||| ||| || || |||
Sbjct: 452 gccttctttgttccatcgggcctaatgagggtgttgactttcttggtctgaatgtcatac 393

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||| | |||||||| |||||||| ||   || |||||| |||||||| 
Sbjct: 392 atcttcttgacagcatctttgatctttttcttgtcagcacggatgtcaacaatgaagact 333

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           | |||||||||||| || ||||| ||||| ||||| || || || | |||||||||||||
Sbjct: 332 aaggtgttgttgtcttcaatctttttcatggcagattcagtagtgagagggtacttgagg 273

                   
Query: 341 atctggta 348
           ||||||||
Sbjct: 272 atctggta 265

---

>gb|AY085736.1| Arabidopsis thaliana clone 17531 mRNA, complete sequence
          Length = 725

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           ||||| ||||| ||||| ||||| || | ||||||||| || || |||| | ||||||| 
Sbjct: 578 atgatcccgattttgttagccacatccaaagcatcataatcaggagtcaacctcacatac 519

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||  | || || ||||| || |||||||| || ||||||| ||| || || |||
Sbjct: 518 gccttctttgttccatcgggcctaatgagggtgttgactttcttggtctgaatgtcatac 459

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||| | |||||||| |||||||| ||   || |||||| |||||||| 
Sbjct: 458 atcttcttgacagcatctttgatctttttcttgtcagcacggatgtcaacaatgaagact 399

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           | |||||||||||| || ||||| ||||| ||||| || || || | |||||||||||||
Sbjct: 398 aaggtgttgttgtcttcaatctttttcatggcagattcagtagtgagagggtacttgagg 339

                   
Query: 341 atctggta 348
           ||||||||
Sbjct: 338 atctggta 331

---

>emb|BX825416.1|CNS0A7I7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL35ZH04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 595

 Score =  103 bits (52), Expect = 7e-19
 Identities = 199/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           ||||| ||||| ||||| ||||| || | ||| ||||| || || |||| | ||||||| 
Sbjct: 447 atgatcccgattttgttagccacatccaaagcctcataatcaggagtcaacctcacatac 388

                                                                       
Query: 161 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 220
           ||||||||  | || || ||||| || |||||||| || ||||||| ||| || || |||
Sbjct: 387 gccttctttgttccatcgggcctaatgagggtgttgactttcttggtctgaatgtcatac 328

                                                                       
Query: 221 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 280
           ||||| || || ||| | |||||||| |||||||| ||   || |||||| |||||||| 
Sbjct: 327 atcttcttgacagcatctttgatctttttcttgtcagcacggatgtcaacaatgaagact 268

                                                                       
Query: 281 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 340
           | |||||||||||| || ||||| ||||| ||||| || || || | |||||||||||||
Sbjct: 267 aaggtgttgttgtcttcaatctttttcatggcagattcagtagtgagagggtacttgagg 208

                   
Query: 341 atctggta 348
           ||||||||
Sbjct: 207 atctggta 200

---

>gb|AF548321.1| Branchiostoma belcheri ribosomal protein L23a mRNA, complete cds
          Length = 748

 Score =  101 bits (51), Expect = 3e-18
 Identities = 57/59 (96%)
 Strand = Plus / Minus

                                                                      
Query: 266 tcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggt 324
           |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 456 tcaacgatgaagaccagcgtgttgttgtcctcgatcttcttcattgcagactcggtggt 398

---

>gb|AY232233.1| Drosophila yakuba clone yak-ad_RpL23a mRNA sequence
          Length = 432

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           |||||| ||||||||||||||||||||||||||||| |||| ||||||||||| ||||||
Sbjct: 258 gaagaccagggtgttgttgtcctcgatcttcttcatggcagcctcggtggtcagagggta 199

                
Query: 334 cttga 338
           |||||
Sbjct: 198 cttga 194



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 tatgatgccgatcttgttggc 120
           |||||||||||||||||||||
Sbjct: 432 tatgatgccgatcttgttggc 412

---

>gb|AF281334.1| Oncorhynchus mykiss 60S ribosomal protein mRNA, partial cds
          Length = 347

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 257 gccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagac 316
           ||||||| ||| ||||||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 131 gccttgacgtctacgatgaagacgagggtgttgttgtcctcgatcttcttcatggcagac 72

                               
Query: 317 tcggtggtcaaagggtactt 336
           || || |||| |||| ||||
Sbjct: 71  tctgtcgtcagagggaactt 52

---

>gb|AC004218.3| Arabidopsis thaliana chromosome 2 clone F12L6 map CIC10A06, complete
             sequence
          Length = 102312

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 152/187 (81%)
 Strand = Plus / Minus

                                                                         
Query: 181   cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 240
             |||||| || ||||| || ||||||| |||||| || |||||||| || || ||| ||||
Sbjct: 44422 cctgatgagtgtgttcactttcttggtctggatgtcatacatcttcttaacagcatcctt 44363

                                                                         
Query: 241   gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 300
              |||||||||||||| ||    | |||||| ||||| ||||| ||||||||||| || ||
Sbjct: 44362 aatcttcttcttgtcagcacgaatgtcaacaatgaaaacaagagtgttgttgtcttcaat 44303

                                                                         
Query: 301   cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 360
             ||||||||| ||||| || ||||| |  |||||||| ||||| ||||| || || | |||
Sbjct: 44302 cttcttcatcgcagattcagtggtgagtgggtacttaaggatttggtagtgatccaactt 44243

                    
Query: 361   gttcctt 367
             |||||||
Sbjct: 44242 gttcctt 44236



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                         
Query: 94    gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 153
             |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 44597 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 44538

                            
Query: 154   cacataggccttctt 168
             ||| || ||||||||
Sbjct: 44537 cacgtaagccttctt 44523

---

>gb|AY874405.1| Solanum tuberosum isolate CT240 cultivar HH1-9, genomic sequence
          Length = 840

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                       
Query: 242 atcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatc 301
           |||||||||||||| || |  | |||||| ||||| |||||||| ||||||||||| |||
Sbjct: 253 atcttcttcttgtcagcatgaatgtcaacaatgaaaacaagggtattgttgtcctcaatc 194

                                  
Query: 302 ttcttcattgcagactcggtggt 324
           |||||||||||||||||||||||
Sbjct: 193 ttcttcattgcagactcggtggt 171

---

>gb|AY874403.1| Solanum tuberosum isolate CT240 cultivar USW-2230 Saco, genomic
           sequence
          Length = 873

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                       
Query: 242 atcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatc 301
           |||||||||||||| || |  | |||||| ||||| |||||||| ||||||||||| |||
Sbjct: 253 atcttcttcttgtcagcatgaatgtcaacaatgaaaacaagggtattgttgtcctcaatc 194

                                  
Query: 302 ttcttcattgcagactcggtggt 324
           |||||||||||||||||||||||
Sbjct: 193 ttcttcattgcagactcggtggt 171

---

>ref|XM_787855.1| PREDICTED: Strongylocentrotus purpuratus similar to 60S ribosomal
           protein L23a (LOC588157), mRNA
          Length = 486

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||||||| ||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 333 cttgtttgccttgagggcaacgatgaagacgagggtgttgttctcctcgatcttcttcat 274

                                        
Query: 310 tgcagactcggtggtcaaagggtacttga 338
            ||   |||||| ||||  ||||||||||
Sbjct: 273 ggcgctctcggtcgtcagggggtacttga 245

---

>emb|AL132954.1|ATT26I12 Arabidopsis thaliana DNA chromosome 3, BAC clone T26I12
          Length = 88997

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 132/161 (81%)
 Strand = Plus / Minus

                                                                         
Query: 188   agggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagccttgatcttc 247
             |||||||| || ||||||| ||| || || |||||||| || || ||| | |||||||| 
Sbjct: 69736 agggtgttgactttcttggtctgaatgtcatacatcttcttgacagcatctttgatcttt 69677

                                                                         
Query: 248   ttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttc 307
             |||||||| ||   || |||||| |||||||| | |||||||||||| || ||||| |||
Sbjct: 69676 ttcttgtcagcacggatgtcaacaatgaagactaaggtgttgttgtcttcaatctttttc 69617

                                                      
Query: 308   attgcagactcggtggtcaaagggtacttgaggatctggta 348
             || ||||| || || || | |||||||||||||||||||||
Sbjct: 69616 atggcagattcagtagtgagagggtacttgaggatctggta 69576

---

>emb|BX841999.1|CNS09YA4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB55ZB10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 743

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 222/277 (80%), Gaps = 3/277 (1%)
 Strand = Plus / Minus

                                                                       
Query: 94  gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 153
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 597 gacttagatgatgccgatcttgttagctacatccaaagcatcatagtctggtgtaagcct 538

                                                                       
Query: 154 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 213
            || || ||||||||  | || || |||||||| || |||||||| ||||||| |||| |
Sbjct: 537 tacgtaagccttcttggttccatcaggcctgatgagtgtgttaactttcttggtctggtt 478

                                                                       
Query: 214 atcgtac-atcttttttac-cgcagccttgatcttcttcttgtctgccttgaggtcaacg 271
            || ||| ||||| || ||  ||| |||| |||||||||||||| ||    | ||| || 
Sbjct: 477 gtcatactatcttcttaactagcatccttaatcttcttcttgtcagcacgaatgtctaca 418

                                                                       
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtg-gtcaaagg 330
           ||||| ||||| ||||||||||| || ||||||||||| ||||| || ||| || |  ||
Sbjct: 417 atgaacacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtgtgtgagtgg 358

                                                
Query: 331 gtacttgaggatctggtattggtcaagcttgttcctt 367
           |||||| ||||| ||||| || || | ||||||||||
Sbjct: 357 gtacttaaggatttggtagtgatccaacttgttcctt 321

---

>gb|AY874404.1| Solanum berthaultii isolate CT240 cultivar B11B, genomic sequence
          Length = 858

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 242 atcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatc 301
           |||||||||||||| || |  | |||||| ||||| |||||||| ||||||||||| |||
Sbjct: 253 atcttcttcttgtcagcatgaatgtcaacaatgaaaacaagggtattgttgtcctcaatc 194

                               
Query: 302 ttcttcattgcagactcggt 321
           ||||||||||||||||||||
Sbjct: 193 ttcttcattgcagactcggt 174

---

>gb|AF401578.1| Ictalurus punctatus ribosomal protein L23a mRNA, partial cds
          Length = 507

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 260 ttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcg 319
           |||| |||||| |||||||| || |||||||||||||||||||||||||| || ||||||
Sbjct: 300 ttgacgtcaacaatgaagaccagagtgttgttgtcctcgatcttcttcatggctgactcg 241

                  
Query: 320 gtggtca 326
           |||||||
Sbjct: 240 gtggtca 234

---

>gb|DQ450529.1| Drosophila melanogaster L23A ribosomal protein natural variant
           (RpL23A) mRNA, complete cds
          Length = 834

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 657 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 598

                
Query: 334 cttga 338
           |||||
Sbjct: 597 cttga 593



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 97  ttatatgatgccgatcttgttggc 120
           ||||||||||||||||||||||||
Sbjct: 834 ttatatgatgccgatcttgttggc 811

---

>gb|AC010038.5| Drosophila melanogaster 3L BAC RP98-14O14 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 172175

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                         
Query: 274   gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
             |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 53316 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 53257

                  
Query: 334   cttga 338
             |||||
Sbjct: 53256 cttga 53252



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 96    cttatatgatgccgatcttgttggc 120
             |||||||||||||||||||||||||
Sbjct: 53494 cttatatgatgccgatcttgttggc 53470

---

>gb|AC105264.3| Drosophila melanogaster 3L BAC RP98-17K18 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 177583

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                         
Query: 274   gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
             |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 55697 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 55756

                  
Query: 334   cttga 338
             |||||
Sbjct: 55757 cttga 55761



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 96    cttatatgatgccgatcttgttggc 120
             |||||||||||||||||||||||||
Sbjct: 55519 cttatatgatgccgatcttgttggc 55543

---

>gb|AC093192.2| Drosophila melanogaster 3L BAC RP98-48J18 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 166862

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                          
Query: 274    gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
              |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 141438 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 141497

                   
Query: 334    cttga 338
              |||||
Sbjct: 141498 cttga 141502



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 96     cttatatgatgccgatcttgttggc 120
              |||||||||||||||||||||||||
Sbjct: 141260 cttatatgatgccgatcttgttggc 141284

---

>gb|AY094921.1| Drosophila melanogaster RH35480 full insert cDNA
          Length = 1054

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 708 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 649

                
Query: 334 cttga 338
           |||||
Sbjct: 648 cttga 644



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 96  cttatatgatgccgatcttgttggc 120
           |||||||||||||||||||||||||
Sbjct: 886 cttatatgatgccgatcttgttggc 862

---

>ref|NM_079162.2| Drosophila melanogaster Ribosomal protein L23A CG7977-RA (RpL23A),
           mRNA
          Length = 1041

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 708 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 649

                
Query: 334 cttga 338
           |||||
Sbjct: 648 cttga 644



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 96  cttatatgatgccgatcttgttggc 120
           |||||||||||||||||||||||||
Sbjct: 886 cttatatgatgccgatcttgttggc 862

---

>gb|AF080130.1|AF080130 Drosophila melanogaster ribosomal protein L23a (rpl23a) mRNA,
           partial cds
          Length = 982

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 633 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 574

                
Query: 334 cttga 338
           |||||
Sbjct: 573 cttga 569



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 96  cttatatgatgccgatcttgttggc 120
           |||||||||||||||||||||||||
Sbjct: 811 cttatatgatgccgatcttgttggc 787

---

>gb|AE003472.1| Drosophila melanogaster chromosome 3L, section 6 of 83 of the complete
              sequence
          Length = 303191

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                          
Query: 274    gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
              |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 132825 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 132884

                   
Query: 334    cttga 338
              |||||
Sbjct: 132885 cttga 132889



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 96     cttatatgatgccgatcttgttggc 120
              |||||||||||||||||||||||||
Sbjct: 132647 cttatatgatgccgatcttgttggc 132671

---

>gb|AC005557.1|AC005557 Drosophila melanogaster, chromosome 3L, region 62A10-62B5, P1 clones
             DS02777, DS03222, DS02345, and DS04808, complete sequence
          Length = 257867

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                         
Query: 274   gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
             |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 55991 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 56050

                  
Query: 334   cttga 338
             |||||
Sbjct: 56051 cttga 56055



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 96    cttatatgatgccgatcttgttggc 120
             |||||||||||||||||||||||||
Sbjct: 55813 cttatatgatgccgatcttgttggc 55837

---

>gb|U40948.1| Caenorhabditis elegans cosmid F55D10, complete sequence
          Length = 29498

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                        
Query: 269  acgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaa 328
            ||||||||||||||||||||||  ||||||||||||||||| || ||||| |||||||| 
Sbjct: 3244 acgatgaagacaagggtgttgtgctcctcgatcttcttcatggcggactcagtggtcaat 3185

                
Query: 329  gggt 332
            ||||
Sbjct: 3184 gggt 3181



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 110  atcttgttggccacgtcaagagcatcatagtc 141
            ||||||||||| ||||| |||||||| |||||
Sbjct: 3460 atcttgttggcaacgtcgagagcatcgtagtc 3429

---

>gb|DQ138322.1| Myxobolus cerebralis ribosomal protein L23-like mRNA, complete
            sequence
          Length = 1461

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                        
Query: 265  gtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggt 324
            |||||||||||| || || |||||||||||||||||||||||||| |||||||| || ||
Sbjct: 1285 gtcaacgatgaacacgagcgtgttgttgtcctcgatcttcttcatcgcagactccgtcgt 1226

                                
Query: 325  caaagggtacttgaggatct 344
            ||  ||| |||||| |||||
Sbjct: 1225 cagcgggaacttgatgatct 1206

---

>ref|NM_076407.3| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-25.1) (rpl-25.1) mRNA, complete cds
          Length = 504

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                       
Query: 269 acgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaa 328
           ||||||||||||||||||||||  ||||||||||||||||| || ||||| |||||||| 
Sbjct: 278 acgatgaagacaagggtgttgtgctcctcgatcttcttcatggcggactcagtggtcaat 219

               
Query: 329 gggt 332
           ||||
Sbjct: 218 gggt 215



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 110 atcttgttggccacgtcaagagcatcatagtc 141
           ||||||||||| ||||| |||||||| |||||
Sbjct: 437 atcttgttggcaacgtcgagagcatcgtagtc 406

---

>emb|AL115487.1|CNS01CG7 Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 359 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 300

---

>emb|AL115271.1|CNS01CA7 Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 351 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 292

---

>emb|AL114669.1|CNS01BTH Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 347 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 288

---

>emb|AL114551.1|CNS01BQ7 Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 344 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 285

---

>emb|AL112682.1|CNS01AAA Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 361 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 302

---

>emb|AL111598.1|CNS019G6 Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 359 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 300

---

>emb|AL111416.1|CNS019B4 Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 265 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 206

---

>emb|AL110748.1|CNS018SL Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 354 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 295

---

>emb|AL110918.1|CNS018XB Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 323 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 264

---

>ref|XM_757052.1| Ustilago maydis 521 hypothetical protein (UM05998.1) partial mRNA
          Length = 444

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 264 ggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtg 322
           |||||||||||||||| || |||||||| ||||||||||||||||| || |||||||||
Sbjct: 277 ggtcaacgatgaagacgagcgtgttgttctcctcgatcttcttcatggccgactcggtg 219

---

>gb|AC139707.10| Medicago truncatula clone mth2-16b22, complete sequence
          Length = 113689

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Minus

                                                                         
Query: 181   cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 240
             |||||||| ||||||||| |||||||||||||| || ||||| || || || ||| ||||
Sbjct: 27071 cctgatcaaggtgttaactttcttggcctggatgtcatacattttcttcacggcatcctt 27012

                                                                         
Query: 241   gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 300
             ||| ||||| ||||| ||    | |||||| ||||| || |  ||||||||||| || ||
Sbjct: 27011 gattttctttttgtcagctcgcaagtcaacaatgaaaaccaaagtgttgttgtcttcaat 26952

                               
Query: 301   cttcttcattgcagactc 318
             |||||||||||| |||||
Sbjct: 26951 cttcttcattgcggactc 26934

---

>gb|BC098550.1| Danio rerio ribosomal protein L23a, mRNA (cDNA clone MGC:110139
           IMAGE:7288150), complete cds
          Length = 626

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||| | |||||| || || || || ||||||||||||||||||||||||||
Sbjct: 325 cttgtttgcctttacgtcaacaataaacaccagagtgttgttgtcctcgatcttcttcat 266

                                        
Query: 310 tgcagactcggtggtcaaagggtacttga 338
            || ||||| |||||||| ||| ||||||
Sbjct: 265 ggccgactcagtggtcaaggggaacttga 237



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtg 146
           |||||||||||||||||||| || || |  |||||||| |||||||
Sbjct: 474 atgatgccgatcttgttggcaacatccaatgcatcataatctggtg 429

---

>ref|XM_415820.1| PREDICTED: Gallus gallus similar to 60S ribosomal protein L23a
            (LOC417574), mRNA
          Length = 1542

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                        
Query: 250  cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
            ||||| ||||||||  ||||| ||||| || || || ||||| ||||| |||||||||||
Sbjct: 1338 cttgtttgccttgacatcaacaatgaaaaccagagtattgttatcctctatcttcttcat 1279

                                         
Query: 310  tgcagactcggtggtcaaagggtacttga 338
            |||||| || |||||||||||| ||||||
Sbjct: 1278 tgcagattctgtggtcaaagggaacttga 1250

---

>gb|AY561517.1| Danio rerio ribosomal protein L23a (rpl23a) mRNA, complete cds
          Length = 553

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||| | |||||| || || || || ||||||||||||||||||||||||||
Sbjct: 340 cttgtttgcctttacgtcaacaataaacaccagagtgttgttgtcctcgatcttcttcat 281

                                        
Query: 310 tgcagactcggtggtcaaagggtacttga 338
            || ||||| |||||||| ||| ||||||
Sbjct: 280 ggccgactcagtggtcaaggggaacttga 252



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtg 146
           |||||||||||||||||||| || || |  |||||||| |||||||
Sbjct: 489 atgatgccgatcttgttggcaacatccaatgcatcataatctggtg 444

---

>ref|XM_677033.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8856.2), mRNA
          Length = 462

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 257 gccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagac 316
           ||||||| ||| |||||||| |||||||||||||| ||||| ||||||||||| |||  |
Sbjct: 299 gccttgacgtccacgatgaacacaagggtgttgttctcctcaatcttcttcatagcactc 240

                            
Query: 317 tcggtggtcaaagggta 333
           |||||| |||| |||||
Sbjct: 239 tcggtgttcaaggggta 223

---

>ref|NM_001001593.1| Danio rerio ribosomal protein L23a (rpl23a), mRNA
          Length = 553

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||| | |||||| || || || || ||||||||||||||||||||||||||
Sbjct: 340 cttgtttgcctttacgtcaacaataaacaccagagtgttgttgtcctcgatcttcttcat 281

                                        
Query: 310 tgcagactcggtggtcaaagggtacttga 338
            || ||||| |||||||| ||| ||||||
Sbjct: 280 ggccgactcagtggtcaaggggaacttga 252



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtg 146
           |||||||||||||||||||| || || |  |||||||| |||||||
Sbjct: 489 atgatgccgatcttgttggcaacatccaatgcatcataatctggtg 444

---

>gb|BT021430.1| Drosophila melanogaster GM06171 full insert cDNA
          Length = 955

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           |||||| ||||||||||||||||||||||||||||| || | |||||||||||
Sbjct: 605 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtca 553



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 96  cttatatgatgccgatcttgttggc 120
           |||||||||||||||||||||||||
Sbjct: 783 cttatatgatgccgatcttgttggc 759

---

>emb|AL112366.1|CNS01A1I Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||| ||||||||
Sbjct: 343 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgattttcttcat 284

---

>emb|BX819433.1|CNS0A8ZH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB77ZC10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 267

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 94  gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 153
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 91  gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 32

                          
Query: 154 cacataggccttctt 168
           ||| || ||||||||
Sbjct: 31  cacgtaagccttctt 17

---

>ref|XM_365965.1| Magnaporthe grisea 70-15 hypothetical protein (MG10185.4) partial
           mRNA
          Length = 474

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 257 gccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||||| ||| ||||||||||| ||||||||||| ||||| |||||||||||
Sbjct: 311 gccttgatgtcgacgatgaagaccagggtgttgttctcctcaatcttcttcat 259

---

>ref|XM_382669.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG02493.1) partial mRNA
          Length = 522

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 257 gccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||||| ||| ||||||||||| ||||||||||| ||||| |||||||||||
Sbjct: 359 gccttgacgtcgacgatgaagacgagggtgttgttctcctccatcttcttcat 307

---

>emb|Z75541.1|CEF52B5 Caenorhabditis elegans Cosmid F52B5, complete sequence
          Length = 33274

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                          
Query: 265   gtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
             |||||| ||||||||||||||||||| ||| ||||||||||||||
Sbjct: 32586 gtcaacaatgaagacaagggtgttgtggtcttcgatcttcttcat 32630



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 107   ccgatcttgttggccacgtcaagagcatcatagtc 141
             |||||||||||||| || ||||||||||| |||||
Sbjct: 32384 ccgatcttgttggcaacatcaagagcatcgtagtc 32418

---

>ref|NM_059862.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-25.2) (rpl-25.2) mRNA, complete cds
          Length = 498

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 265 gtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| ||||||||||||||||||| ||| ||||||||||||||
Sbjct: 277 gtcaacaatgaagacaagggtgttgtggtcttcgatcttcttcat 233



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 107 ccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||| || ||||||||||| |||||
Sbjct: 435 ccgatcttgttggcaacatcaagagcatcgtagtc 401

---

>gb|AY849680.1| Magnaporthe grisea 60S ribosomal protein L23-like protein mRNA,
           complete cds
          Length = 1101

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 257 gccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||||| ||| ||||||||||| ||||||||||| ||||| |||||||||||
Sbjct: 609 gccttgatgtcgacgatgaagaccagggtgttgttctcctcaatcttcttcat 557

---

>gb|U02032.1|HSU02032 Human ribosomal protein L23a mRNA, partial cds
          Length = 492

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 266 tcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtc 325
           ||||| ||||| ||||| ||||||||||| || ||||||||||| |||||||| ||||||
Sbjct: 304 tcaacaatgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtc 245

            
Query: 326 a 326
           |
Sbjct: 244 a 244

---

>gb|AC068205.25| Homo sapiens chromosome 11, clone RP11-472I20, complete sequence
          Length = 205069

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                      
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 327
              ||||| ||||| ||||||||||| || ||||||||||| |||||||| ||||||||
Sbjct: 144443 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtcaa 144388

---

>ref|XM_511611.1| PREDICTED: Pan troglodytes similar to breast carcinoma amplified
            sequence 3; metastasis associated antigen of breast
            cancer (LOC454802), mRNA
          Length = 4255

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 272  atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
            ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 2370 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 2316

---

>ref|XM_523627.1| PREDICTED: Pan troglodytes similar to Rpl23a protein (LOC468236),
           mRNA
          Length = 381

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 206 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 152

---

>ref|XM_511361.1| PREDICTED: Pan troglodytes similar to ribosomal protein L23a; 60S
           ribosomal protein L23a; cDNA sequence BC029892
           (LOC454532), mRNA
          Length = 743

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 521 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 467

---

>ref|XM_528535.1| PREDICTED: Pan troglodytes similar to Rpl23a protein (LOC473165),
           mRNA
          Length = 423

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 248 atgaacacaagtgtgttgttgtcttccatcttcttcatggcagactcagtggtca 194

---

>ref|XM_514120.1| PREDICTED: Pan troglodytes similar to Rpl23a protein (LOC457651),
           mRNA
          Length = 642

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 322 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 268

---

>gb|AC090426.1| Homo sapiens chromosome 17 clone 205m17 map 17q21.1, complete
           sequence
          Length = 138999

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 82  atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 28

---

>gb|BC058041.1| Homo sapiens ribosomal protein L23a, mRNA (cDNA clone MGC:61848
           IMAGE:6716166), complete cds
          Length = 985

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 312 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 258

---

>gb|BC014459.1| Homo sapiens ribosomal protein L23a, mRNA (cDNA clone MGC:23063
           IMAGE:4872948), complete cds
          Length = 545

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 300 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 246

---

>ref|NM_000984.5| Homo sapiens ribosomal protein L23a (RPL23A), mRNA
          Length = 979

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 320 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 266

---

>gb|DP000044.2| Callithrix jacchus target 106 genomic scaffold
          Length = 574594

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                     
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
              ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 127462 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 127516

---

>ref|XM_505871.1| Yarrowia lipolytica CLIB122, YALI0F25531g predicted mRNA
          Length = 426

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcag 314
           ||||||||||||||||||  |||||||||||||||||| ||||
Sbjct: 251 atgaagacaagggtgttggagtcctcgatcttcttcatggcag 209



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 107 ccgatcttgttggccacgtcaagagcatc 135
           |||||||||||||| | ||||||||||||
Sbjct: 416 ccgatcttgttggcaatgtcaagagcatc 388

---

>gb|AC018629.12| Homo sapiens chromosome 17, clone RP11-58O9, complete sequence
          Length = 166234

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                    
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
             ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 94709 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 94763

---

>emb|BX054544.1|CNS09E90 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 333
           |||||| || |||||||||||||||||||||||||| || || ||||| ||||  |||||
Sbjct: 422 gaagacgagcgtgttgttgtcctcgatcttcttcatcgccgattcggtcgtcagcgggta 363

              
Query: 334 ctt 336
           |||
Sbjct: 362 ctt 360



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 595 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 536

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 535 gccttcttcttgccgtccgg 516

---

>gb|AC112491.4| Homo sapiens 3 BAC RP11-3P17 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 154758

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                    
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
             ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 55469 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 55415

---

>gb|BC036642.1| Mus musculus, clone IMAGE:3371217, mRNA
          Length = 565

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 311 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 257

---

>emb|CR616046.1| full-length cDNA clone CS0DE014YB21 of Placenta of Homo sapiens
            (human)
          Length = 1761

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 272  atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
            ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 1607 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 1553

---

>gb|AC011979.7| Homo sapiens chromosome 11, clone RP11-16F15, complete sequence
          Length = 154995

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                     
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
              ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 120072 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 120126

---

>ref|NG_002546.1| Homo sapiens ribosomal protein L23a pseudogene 11 (RPL23AP11) on
           chromosome 14
          Length = 689

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| || |||||||||||| |||||||||| |||||||| |||||||
Sbjct: 396 atgaacacaagtgtcttgttgtcctcgctcttcttcatggcagactcagtggtca 342

---

>ref|XM_937620.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L23a
           (LOC401904), mRNA
          Length = 960

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 305 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 251

---

>ref|XM_377521.3| PREDICTED: Homo sapiens similar to 60S ribosomal protein L23a
           (LOC401904), mRNA
          Length = 960

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 305 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 251

---

>ref|XM_939952.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L23a
           (LOC648294), mRNA
          Length = 534

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 307 atgaacacaagtgtgttgttgtcttccatcttcttcatggcagactcagtggtca 253

---

>ref|XM_941396.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L23a
           (LOC652071), mRNA
          Length = 582

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 317 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 263

---

>ref|XM_930113.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L23a
           (LOC647099), mRNA
          Length = 582

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 317 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 263

---

>gb|AD000091.1|CH19F15314 Homo sapiens DNA from chromosome 19p13.1 cosmid f15314, genomic
             sequence
          Length = 41369

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                    
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
             ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 39693 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 39639

---

>ref|XM_340850.2| PREDICTED: Rattus norvegicus ribosomal protein L23a (predicted)
           (Rpl23a_predicted), mRNA
          Length = 541

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| |||||||||||||| || |||||||| || |||||||||||||
Sbjct: 309 atgaacacaagcgtgttgttgtcctctattttcttcatagccgactcggtggtca 255

---

>ref|XM_577114.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L23a
           (LOC501709), mRNA
          Length = 471

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| |||||||||||||| || |||||||| || |||||||||||||
Sbjct: 296 atgaacacaagcgtgttgttgtcctctattttcttcatagctgactcggtggtca 242

---

>gb|AC010761.10| Homo sapiens chromosome 17, clone RP11-386F9, complete sequence
          Length = 177773

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                    
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
             ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 74961 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 74907

---

>dbj|AK130965.1| Homo sapiens cDNA FLJ27455 fis, clone UBA04121, highly similar to
           60S ribosomal protein L23a
          Length = 538

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 309 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 255

---

>emb|AJ277546.2|HSA277546 Homo sapiens WEE1 gene for protein kinase and partial ZNF143 gene for
             zinc finger transcription factor
          Length = 131998

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                    
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
             ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 92737 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 92683

---

>emb|X65228.1|RRRPL23A R.rattus mRNA for ribosomal protein L23a
          Length = 534

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| |||||||||||||| || |||||||| || |||||||||||||
Sbjct: 311 atgaacacaagcgtgttgttgtcctctattttcttcatagctgactcggtggtca 257

---

>emb|AL132801.5|CNS01DTN Human chromosome 14 DNA sequence BAC R-661D19 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 168624

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                     
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
              ||||| ||||| || |||||||||||| |||||||||| |||||||| |||||||
Sbjct: 136980 atgaacacaagtgtcttgttgtcctcgctcttcttcatggcagactcagtggtca 136926

---

>gb|AF001689.1|AF001689 Homo sapiens ribosomal protein L23A (RPL23A) gene, complete cds
          Length = 4111

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 272  atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
            ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 2523 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 2469

---

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                          
Query: 272     atgaagacaagggtgttgttgtcctcgatcttcttcattgcag 314
               ||||||||||||||||||  |||||||||||||||||| ||||
Sbjct: 3279802 atgaagacaagggtgttggagtcctcgatcttcttcatggcag 3279844



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 107     ccgatcttgttggccacgtcaagagcatc 135
               |||||||||||||| | ||||||||||||
Sbjct: 3279637 ccgatcttgttggcaatgtcaagagcatc 3279665

---

>gb|U37230.1|HSU37230 Human ribosomal protein L23a mRNA, complete cds
          Length = 578

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 319 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 265

---

>gb|U43701.1|HSU43701 Human ribosomal protein L23a mRNA, complete cds
          Length = 546

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 317 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 263

---

>emb|Y12508.1|HSIGFBP H.sapiens IGFBP-4 gene
          Length = 21619

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 58  atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 112

---

>gb|L13799.1|HUMCH13C1A Homo sapiens (clone 01) liver expressed protein mRNA, 3'end
          Length = 500

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 270 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 216

---

>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete
              sequence
          Length = 2105742

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                          
Query: 237    ccttgatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcct 296
              ||||||| ||| ||||||  ||||||| ||||||||||||||| |  |||||||  || |
Sbjct: 102286 ccttgatgttcctcttgttggccttgatgtcaacgatgaagaccaaagtgttgtgctctt 102345

                                    
Query: 297    cgatcttcttcattgcagactc 318
              | ||||||||||| ||||||||
Sbjct: 102346 caatcttcttcatggcagactc 102367

---

>gb|AC007683.5| Homo sapiens BAC clone RP11-401L13 from 7, complete sequence
          Length = 155735

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                   
Query: 273   tgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
             |||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 90064 tgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 90011

---

>gb|AY498860.1| Homo sapiens tumor necrosis factor receptor superfamily, member 8
             (TNFRSF8) gene, complete cds
          Length = 84102

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 273   tgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
             |||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 18288 tgaatacaagtgtgttgttgtcttctatcttcttcatggcagactctgtggtca 18341

---

>ref|XM_569415.1| Cryptococcus neoformans var. neoformans JEC21 ribosomal protein
            (CNC00350) partial mRNA
          Length = 1382

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                        
Query: 237  ccttgatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcct 296
            ||||||| ||| ||||||  ||||||| ||||||||||||||| |  |||||||  || |
Sbjct: 1124 ccttgatgttcctcttgttggccttgatgtcaacgatgaagaccaaagtgttgtgctctt 1065

                                  
Query: 297  cgatcttcttcattgcagactc 318
            | ||||||||||| ||||||||
Sbjct: 1064 caatcttcttcatggcagactc 1043



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 101  atgatgccgatcttgttggccacgtcaagagc 132
            |||| ||||||||||||||| || ||||||||
Sbjct: 1260 atgaagccgatcttgttggcaacctcaagagc 1229

---

>emb|AL357835.11| Human DNA sequence from clone RP11-426M1 on chromosome 1 Contains the
             TNFRSF8 gene for tumor necrosis factor receptor
             superfamily member 8, a ribosomal protein L23a (RPL23A)
             pseudogene, the 5' end of the TNFRSF1B gene for tumor
             necrosis factor receptor superfamily member 1B and three
             CpG islands, complete sequence
          Length = 151498

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 273   tgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
             |||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 33910 tgaatacaagtgtgttgttgtcttctatcttcttcatggcagactctgtggtca 33963

---

>emb|AL157386.14| Human DNA sequence from clone RP11-170J3 on chromosome 10 Contains part
             of the SUFU gene for suppressor of fused homolog
             (Drosophila) and a 60S ribosomal protein L23a (RPL23A)
             pseudogene, complete sequence
          Length = 72536

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 273   tgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
             |||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 52819 tgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 52872

---

>gb|DQ214298.1| Taeniopygia guttata clone 0061P0010E07 60S ribosomal protein
           L23a-like mRNA, complete sequence
          Length = 538

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 250 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 309
           ||||| ||||||||  || |||||||| || || |||||||| |||||||||||||||||
Sbjct: 323 cttgtttgccttgacatccacgatgaacaccagcgtgttgttatcctcgatcttcttcat 264

                            
Query: 310 tgcagactcggtggtca 326
            || || || |||||||
Sbjct: 263 cgctgattctgtggtca 247

---

>gb|BC077046.1| Xenopus tropicalis MGC89958 protein, mRNA (cDNA clone MGC:89958
           IMAGE:7025723), complete cds
          Length = 544

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 266 tcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtc 325
           ||||| ||||| || || || ||||||||||||||||||||||| || ||||| ||||||
Sbjct: 312 tcaacaatgaaaaccagagtattgttgtcctcgatcttcttcatggctgactcagtggtc 253

            
Query: 326 a 326
           |
Sbjct: 252 a 252

---

>emb|BX019711.1|CNS08NDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                        
Query: 284 gtgttgttgtcctcgatcttcttcattgc 312
           |||||||||||||||||||||||||||||
Sbjct: 557 gtgttgttgtcctcgatcttcttcattgc 585



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 374 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 414



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 433 gccttcttcttgccgtccgg 452

---

>gb|AY972826.1| Aedes albopictus ribosomal protein L23a mRNA, complete cds
          Length = 1355

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 281 agggtgttgttgtcctcgatcttcttcat 309
           |||||||||||||||||||||||||||||
Sbjct: 975 agggtgttgttgtcctcgatcttcttcat 947



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 158  taggccttcttcttgccgtccgg 180
            |||||||||||||||||||||||
Sbjct: 1098 taggccttcttcttgccgtccgg 1076

---

>gb|AY857437.1| Suberites domuncula L23a mRNA, complete cds
          Length = 462

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 284 gtgttgttgtcctcgatcttcttcattgcagactcggtggt 324
           |||||||||||||| ||||||||||| || |||||||||||
Sbjct: 275 gtgttgttgtcctcaatcttcttcatggccgactcggtggt 235

---

>ref|NM_001005109.1| Xenopus tropicalis MGC89958 protein (MGC89958), mRNA
          Length = 544

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 266 tcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtc 325
           ||||| ||||| || || || ||||||||||||||||||||||| || ||||| ||||||
Sbjct: 312 tcaacaatgaaaaccagagtattgttgtcctcgatcttcttcatggctgactcagtggtc 253

            
Query: 326 a 326
           |
Sbjct: 252 a 252

---

>gb|AC153889.19| Mus musculus 10 BAC RP23-434A12 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190042

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                          
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 165178 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 165237

                                              
Query: 332    tacttgaggatctggtattggtcaagcttgtt 363
               |||||| |||    || ||||||||||||||
Sbjct: 165238 aacttgatgatagcatagtggtcaagcttgtt 165269



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                         
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 54416 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 54357

                                             
Query: 332   tacttgaggatctggtattggtcaagcttgtt 363
              |||||| |||    || ||||||||||||||
Sbjct: 54356 aacttgatgatagcatagtggtcaagcttgtt 54325



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 32055 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 32114

                                             
Query: 332   tacttgaggatctggtattggtcaagcttgtt 363
              |||||| |||    || ||||||||||||||
Sbjct: 32115 aacttgatgatagcatagtggtcaagcttgtt 32146



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 187751 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtca 187697

---

>gb|AC167202.8| Mus musculus  BAC RP24-243A15 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 180658

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                         
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 36158 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 36099

                                             
Query: 332   tacttgaggatctggtattggtcaagcttgtt 363
              |||||| |||    || ||||||||||||||
Sbjct: 36098 aacttgatgatagcatagtggtcaagcttgtt 36067



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 13814 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 13873

                                             
Query: 332   tacttgaggatctggtattggtcaagcttgtt 363
              |||||| |||    || ||||||||||||||
Sbjct: 13874 aacttgatgatagcatagtggtcaagcttgtt 13905

---

>ref|XM_521892.1| PREDICTED: Pan troglodytes similar to Rpl23a protein (LOC466493),
           mRNA
          Length = 471

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 327
           ||||| ||||| ||||||||||| || ||||||||||  |||||||| ||||||||
Sbjct: 296 atgaacacaagtgtgttgttgtcttctatcttcttcacggcagactcagtggtcaa 241

---

>ref|XM_508278.1| PREDICTED: Pan troglodytes similar to Rpl23a protein (LOC451018),
           mRNA
          Length = 417

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 279 caagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           |||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 235 caagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 188

---

>gb|AC095247.5| Rattus norvegicus 4 BAC CH230-10C6 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 238466

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 272  atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 327
            ||||| ||||| |||||||||||||| || |||||||| || |||||| |||||||
Sbjct: 4597 atgaacacaagcgtgttgttgtcctctattttcttcatggctgactcgatggtcaa 4652

---

>gb|AC087066.3| Rattus norvegicus strain Brown Norway clone RP31-194D8, complete
           sequence
          Length = 166751

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 327
           ||||| ||||| |||||||||||||| || |||||||| || |||||| |||||||
Sbjct: 163 atgaacacaagcgtgttgttgtcctctattttcttcatggctgactcgatggtcaa 218

---

>gb|AC087067.3| Rattus norvegicus strain Brown Norway clone RP31-40H10, complete sequence
          Length = 178746

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 327
              ||||| ||||| |||||||||||||| || |||||||| || |||||| |||||||
Sbjct: 172802 atgaacacaagcgtgttgttgtcctctattttcttcatggctgactcgatggtcaa 172857

---

>ref|XM_001002232.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L23a
           (LOC666738), mRNA
          Length = 548

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 308 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 249

                                           
Query: 332 tacttgaggatctggtattggtcaagcttgtt 363
            |||||| |||    || ||||||||||||||
Sbjct: 248 aacttgatgatagcatagtggtcaagcttgtt 217

---

>ref|XM_984537.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L23a
           (LOC666548), mRNA
          Length = 559

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 308 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 249

                                           
Query: 332 tacttgaggatctggtattggtcaagcttgtt 363
            |||||| |||    || ||||||||||||||
Sbjct: 248 aacttgatgatagcatagtggtcaagcttgtt 217

---

>ref|XM_984283.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L23a
           (LOC666501), mRNA
          Length = 549

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 309 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 250

                                           
Query: 332 tacttgaggatctggtattggtcaagcttgtt 363
            |||||| |||    || ||||||||||||||
Sbjct: 249 aacttgatgatagcatagtggtcaagcttgtt 218

---

>ref|XM_983917.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L23a
           (LOC666448), mRNA
          Length = 548

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 308 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 249

                                           
Query: 332 tacttgaggatctggtattggtcaagcttgtt 363
            |||||| |||    || ||||||||||||||
Sbjct: 248 aacttgatgatagcatagtggtcaagcttgtt 217

---

>gb|AC164642.3| Mus musculus BAC clone RP23-248L4 from chromosome 6, complete sequence
          Length = 212166

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                              
Query: 284    gtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
              ||||| |||||||| ||||||||||| || ||||||||||||| ||||
Sbjct: 178813 gtgtttttgtcctctatcttcttcatggctgactcggtggtcacaggg 178860

---

>gb|AC164636.4| Mus musculus BAC clone RP23-70P16 from chromosome 6, complete sequence
          Length = 212096

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 284    gtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
              ||||| |||||||| ||||||||||| || ||||||||||||| ||||
Sbjct: 183841 gtgtttttgtcctctatcttcttcatggctgactcggtggtcacaggg 183794

---

>emb|BX053332.1|CNS09DBC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 553 gaagacgagcgtgttgttgtcctcgatcttcttcat 588



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 381 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 421



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 440 gccttcttcttgccgtccgg 459

---

>emb|BX071919.1|CNS09RNN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 546 gaagacgagcgtgttgttgtcctcgatcttcttcat 581



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 374 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 414



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 433 gccttcttcttgccgtccgg 452

---

>emb|BX071918.1|CNS09RNM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 799 gaagacgagcgtgttgttgtcctcgatcttcttcat 764



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 912 gccttcttcttgccgtccgg 893

---

>emb|BX071899.1|CNS09RN3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 389 gaagacgagcgtgttgttgtcctcgatcttcttcat 424



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 217 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 257



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 276 gccttcttcttgccgtccgg 295

---

>emb|BX071898.1|CNS09RN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 872 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 813

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 812 gccttcttcttgccgtccgg 793



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 699 gaagacgagcgtgttgttgtcctcgatcttcttcat 664

---

>emb|BX071572.1|CNS09RE0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 844 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 785

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 784 gccttcttcttgccgtccgg 765



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 671 gaagacgagcgtgttgttgtcctcgatcttcttcat 636

---

>emb|BX070849.1|CNS09QTX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 729 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 670

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 669 gccttcttcttgccgtccgg 650



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 556 gaagacgagcgtgttgttgtcctcgatcttcttcat 521

---

>emb|BX070057.1|CNS09Q7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 547 gaagacgagcgtgttgttgtcctcgatcttcttcat 582



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 375 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 415



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 434 gccttcttcttgccgtccgg 453

---

>emb|BX060970.1|CNS09J7I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 555 gaagacgagcgtgttgttgtcctcgatcttcttcat 590



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 383 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 423



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 442 gccttcttcttgccgtccgg 461

---

>emb|BX060969.1|CNS09J7H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 831 gaagacgagcgtgttgttgtcctcgatcttcttcat 796



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 944 gccttcttcttgccgtccgg 925

---

>emb|BX068513.1|CNS09P11 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 535 gaagacgagcgtgttgttgtcctcgatcttcttcat 570



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 363 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 403



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 422 gccttcttcttgccgtccgg 441

---

>emb|BX068512.1|CNS09P10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 985 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 926

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 925 gccttcttcttgccgtccgg 906



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 812 gaagacgagcgtgttgttgtcctcgatcttcttcat 777

---

>emb|BX067321.1|CNS09O3X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 606 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 547

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 546 gccttcttcttgccgtccgg 527



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 433 gaagacgagcgtgttgttgtcctcgatcttcttcat 398

---

>emb|BX067206.1|CNS09O0Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 542 gaagacgagcgtgttgttgtcctcgatcttcttcat 577



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 370 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 410



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 429 gccttcttcttgccgtccgg 448

---

>emb|BX066586.1|CNS09NJI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 547 gaagacgagcgtgttgttgtcctcgatcttcttcat 582



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 375 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 415



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 434 gccttcttcttgccgtccgg 453

---

>emb|BX066585.1|CNS09NJH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 617 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 558

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 557 gccttcttcttgccgtccgg 538



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 444 gaagacgagcgtgttgttgtcctcgatcttcttcat 409

---

>emb|BX066443.1|CNS09NFJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 546 gaagacgagcgtgttgttgtcctcgatcttcttcat 581



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 374 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 414



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 433 gccttcttcttgccgtccgg 452

---

>emb|BX066442.1|CNS09NFI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 935 gaagacgagcgtgttgttgtcctcgatcttcttcat 900

---

>emb|BX062873.1|CNS09KOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 540 gaagacgagcgtgttgttgtcctcgatcttcttcat 575



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 368 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 408



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 427 gccttcttcttgccgtccgg 446

---

>emb|BX060551.1|CNS09IVV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 531 gaagacgagcgtgttgttgtcctcgatcttcttcat 566



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 359 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 399



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 418 gccttcttcttgccgtccgg 437

---

>emb|BX060550.1|CNS09IVU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 958 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 899

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 898 gccttcttcttgccgtccgg 879



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 785 gaagacgagcgtgttgttgtcctcgatcttcttcat 750

---

>emb|BX059628.1|CNS09I68 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 551 gaagacgagcgtgttgttgtcctcgatcttcttcat 586



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 379 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 419



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 438 gccttcttcttgccgtccgg 457

---

>emb|BX058866.1|CNS09HL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 541 gaagacgagcgtgttgttgtcctcgatcttcttcat 576



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 369 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 409



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 428 gccttcttcttgccgtccgg 447

---

>emb|BX058865.1|CNS09HL1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 867 gaagacgagcgtgttgttgtcctcgatcttcttcat 832

---

>emb|BX054450.1|CNS09E6E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 630

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 440 gaagacgagcgtgttgttgtcctcgatcttcttcat 475



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 268 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 308



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 327 gccttcttcttgccgtccgg 346

---

>emb|BX053901.1|CNS09DR5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 567 gaagacgagcgtgttgttgtcctcgatcttcttcat 602



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 395 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 435



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 454 gccttcttcttgccgtccgg 473

---

>emb|BX053900.1|CNS09DR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 892 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 833

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 832 gccttcttcttgccgtccgg 813



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 719 gaagacgagcgtgttgttgtcctcgatcttcttcat 684

---

>emb|BX052734.1|CNS09CUQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 553 gaagacgagcgtgttgttgtcctcgatcttcttcat 588



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 381 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 421



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 440 gccttcttcttgccgtccgg 459

---

>emb|BX052705.1|CNS09CTX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 413 gaagacgagcgtgttgttgtcctcgatcttcttcat 448



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 241 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 281



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 300 gccttcttcttgccgtccgg 319

---

>emb|BX051821.1|CNS09C5D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 587

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 583 gaagacgagcgtgttgttgtcctcgatcttcttcat 548

---

>emb|BX051339.1|CNS09BRZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 723

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 550 gaagacgagcgtgttgttgtcctcgatcttcttcat 585



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 378 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 418



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 437 gccttcttcttgccgtccgg 456

---

>emb|BX050056.1|CNS09ASC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 625 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 566

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 565 gccttcttcttgccgtccgg 546



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 452 gaagacgagcgtgttgttgtcctcgatcttcttcat 417

---

>emb|BX049916.1|CNS09AOG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 472 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 413

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 412 gccttcttcttgccgtccgg 393



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 299 gaagacgagcgtgttgttgtcctcgatcttcttcat 264

---

>emb|BX048611.1|CNS099O7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 551 gaagacgagcgtgttgttgtcctcgatcttcttcat 586



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 378 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 437

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 438 gccttcttcttgccgtccgg 457

---

>emb|BX047300.1|CNS098NS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 674

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 488 gaagacgagcgtgttgttgtcctcgatcttcttcat 523



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 316 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 356



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 375 gccttcttcttgccgtccgg 394

---

>emb|BX047299.1|CNS098NR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 746

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 736 gaagacgagcgtgttgttgtcctcgatcttcttcat 701

---

>emb|BX047041.1|CNS098GL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 441

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 402 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 343

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 342 gccttcttcttgccgtccgg 323



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 229 gaagacgagcgtgttgttgtcctcgatcttcttcat 194

---

>emb|BX045321.1|CNS0974T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 619

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 575 gaagacgagcgtgttgttgtcctcgatcttcttcat 540

---

>emb|BX045193.1|CNS09719 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 195 gaagacgagcgtgttgttgtcctcgatcttcttcat 230



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 82  gccttcttcttgccgtccgg 101

---

>emb|BX045140.1|CNS096ZS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 656 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 597

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 596 gccttcttcttgccgtccgg 577



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 483 gaagacgagcgtgttgttgtcctcgatcttcttcat 448

---

>emb|BX044621.1|CNS096LD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 618 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 559

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 558 gccttcttcttgccgtccgg 539



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 445 gaagacgagcgtgttgttgtcctcgatcttcttcat 410

---

>emb|BX042669.1|CNS09535 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 556 gaagacgagcgtgttgttgtcctcgatcttcttcat 591



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 384 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 424



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 443 gccttcttcttgccgtccgg 462

---

>emb|BX041906.1|CNS094HY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 556 gaagacgagcgtgttgttgtcctcgatcttcttcat 591



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 384 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 424



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 443 gccttcttcttgccgtccgg 462

---

>emb|BX040647.1|CNS093IZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 608 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 549

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 548 gccttcttcttgccgtccgg 529



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 435 gaagacgagcgtgttgttgtcctcgatcttcttcat 400

---

>emb|BX040287.1|CNS0938Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 823

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 386 gaagacgagcgtgttgttgtcctcgatcttcttcat 421



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 214 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 254



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 273 gccttcttcttgccgtccgg 292

---

>emb|BX039799.1|CNS092VF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 372 gaagacgagcgtgttgttgtcctcgatcttcttcat 407



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 200 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 240



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 259 gccttcttcttgccgtccgg 278

---

>emb|BX039798.1|CNS092VE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 300 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 241

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 240 gccttcttcttgccgtccgg 221



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 127 gaagacgagcgtgttgttgtcctcgatcttcttcat 92

---

>emb|BX033324.1|CNS08XVK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 582 gaagacgagcgtgttgttgtcctcgatcttcttcat 617



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 469 gccttcttcttgccgtccgg 488



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 101 atgatgccgatcttgttggc 120
           ||||||||||||||||||||
Sbjct: 410 atgatgccgatcttgttggc 429

---

>emb|BX033323.1|CNS08XVJ Single read from an extremity of a full-length cDNA clone made from
            Anopheles gambiae total adult females. 5-PRIME end of
            clone FK0AAA49DA06 of strain 6-9 of Anopheles gambiae
            (African malaria mosquito)
          Length = 1061

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                        
Query: 101  atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
            |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 1008 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 949

                                
Query: 161  gccttcttcttgccgtccgg 180
            ||||||||||||||||||||
Sbjct: 948  gccttcttcttgccgtccgg 929



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 835 gaagacgagcgtgttgttgtcctcgatcttcttcat 800

---

>emb|BX033172.1|CNS08XRC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 719

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 538 gaagacgagcgtgttgttgtcctcgatcttcttcat 573



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 425 gccttcttcttgccgtccgg 444



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 101 atgatgccgatcttgttggc 120
           ||||||||||||||||||||
Sbjct: 366 atgatgccgatcttgttggc 385

---

>emb|BX022463.1|CNS08PHV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 545 gaagacgagcgtgttgttgtcctcgatcttcttcat 580



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 373 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 413



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 432 gccttcttcttgccgtccgg 451

---

>emb|BX022462.1|CNS08PHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 821 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 762

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 761 gccttcttcttgccgtccgg 742



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 647 gaagacgagcgtgttgttgtcctcgatcttcttcat 612

---

>emb|BX022320.1|CNS08PDW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 826 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 767

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 766 gccttcttcttgccgtccgg 747



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 653 gaagacgagcgtgttgttgtcctcgatcttcttcat 618

---

>emb|BX026874.1|CNS08SWE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 570

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 503 gaagacgagcgtgttgttgtcctcgatcttcttcat 468

---

>emb|BX026580.1|CNS08SO8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 706

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 526 gaagacgagcgtgttgttgtcctcgatcttcttcat 561



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 354 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 394



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 413 gccttcttcttgccgtccgg 432

---

>emb|BX022838.1|CNS08PSA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 534 gaagacgagcgtgttgttgtcctcgatcttcttcat 569



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 362 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 402



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 421 gccttcttcttgccgtccgg 440

---

>emb|BX025008.1|CNS08RGK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 539 gaagacgagcgtgttgttgtcctcgatcttcttcat 574



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 67/80 (83%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | |||| |  ||| || 
Sbjct: 367 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgtca-ccgcacgtac 425

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 426 gccttcttcttgccgtccgg 445

---

>emb|BX023269.1|CNS08Q49 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 802

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 600 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 541

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 540 gccttcttcttgccgtccgg 521



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 274 gaagacaagggtgttgttgtcctcgatcttct 305
           |||||| || ||||||||||||||||||||||
Sbjct: 427 gaagacgagcgtgttgttgtcctcgatcttct 396

---

>emb|BX023034.1|CNS08PXQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 583

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 531 gaagacgagcgtgttgttgtcctcgatcttcttcat 566



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 359 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 399



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 418 gccttcttcttgccgtccgg 437

---

>emb|BX021957.1|CNS08P3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 329

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 238 gaagacgagcgtgttgttgtcctcgatcttcttcat 273



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 66  atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 106



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 125 gccttcttcttgccgtccgg 144

---

>emb|BX021487.1|CNS08OQR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 570 gaagacgagcgtgttgttgtcctcgatcttcttcat 605



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 398 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 438



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 457 gccttcttcttgccgtccgg 476

---

>emb|BX020862.1|CNS08O9E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 675

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 375 gaagacgagcgtgttgttgtcctcgatcttcttcat 410



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 203 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 243



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 262 gccttcttcttgccgtccgg 281

---

>emb|BX019000.1|CNS08MTO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 545 gaagacgagcgtgttgttgtcctcgatcttcttcat 580



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 373 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 413



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 432 gccttcttcttgccgtccgg 451

---

>emb|BX017300.1|CNS08LIG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 302

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 255 gaagacgagcgtgttgttgtcctcgatcttcttcat 220

---

>emb|BX016716.1|CNS08L28 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 557 gaagacgagcgtgttgttgtcctcgatcttcttcat 592



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 385 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 425



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 444 gccttcttcttgccgtccgg 463

---

>emb|BX016715.1|CNS08L27 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 991 gaagacgagcgtgttgttgtcctcgatcttcttcat 956

---

>emb|BX016430.1|CNS08KUA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 852 gaagacgagcgtgttgttgtcctcgatcttcttcat 817



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 965 gccttcttcttgccgtccgg 946

---

>emb|BX015793.1|CNS08KCL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 614 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 555

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 554 gccttcttcttgccgtccgg 535



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||  ||||||||||||||
Sbjct: 441 gaagacgagcgtgttgttgtaatcgatcttcttcat 406

---

>emb|BX015752.1|CNS08KBG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 543 gaagacgagcgtgttgttgtcctcgatcttcttcat 578



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 371 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 411



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 430 gccttcttcttgccgtccgg 449

---

>emb|BX014341.1|CNS08J89 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 549 gaagacgagcgtgttgttgtcctcgatcttcttcat 584



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 377 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 417



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 436 gccttcttcttgccgtccgg 455

---

>emb|BX014340.1|CNS08J88 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 865 gaagacgagcgtgttgttgtcctcgatcttcttcat 830



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 978 gccttcttcttgccgtccgg 959

---

>emb|BX011071.1|CNS08GPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 877 gaagacgagcgtgttgttgtcctcgatcttcttcat 842



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 990 gccttcttcttgccgtccgg 971

---

>emb|BX010970.1|CNS08GMM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 549 gaagacgagcgtgttgttgtcctcgatcttcttcat 584



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 377 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 417



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 436 gccttcttcttgccgtccgg 455

---

>emb|BX010969.1|CNS08GML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 888 gaagacgagcgtgttgttgtcctcgatcttcttcat 853

---

>emb|BX010291.1|CNS08G3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 543 gaagacgagcgtgttgttgtcctcgatcttcttcat 578



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 369 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 409

---

>emb|BX010257.1|CNS08G2T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 566

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 214 gaagacgagcgtgttgttgtcctcgatcttcttcat 249

---

>emb|BX010256.1|CNS08G2S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 731 gaagacgagcgtgttgttgtcctcgatcttcttcat 696



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 844 gccttcttcttgccgtccgg 825

---

>emb|BX009853.1|CNS08FRL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 628 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 569

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 568 gccttcttcttgccgtccgg 549



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 455 gaagacgagcgtgttgttgtcctcgatcttcttcat 420

---

>emb|BX009843.1|CNS08FRB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1046

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 628 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 569

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 568 gccttcttcttgccgtccgg 549



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 455 gaagacgagcgtgttgttgtcctcgatcttcttcat 420

---

>emb|BX009817.1|CNS08FQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 944 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 885

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 884 gccttcttcttgccgtccgg 865



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 771 gaagacgagcgtgttgttgtcctcgatcttcttcat 736

---

>emb|BX008690.1|CNS08EVA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 659 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 600

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 599 gccttcttcttgccgtccgg 580



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 486 gaagacgagcgtgttgttgtcctcgatcttcttcat 451

---

>emb|BX007724.1|CNS08E4G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 549 gaagacgagcgtgttgttgtcctcgatcttcttcat 584



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 377 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 417



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 436 gccttcttcttgccgtccgg 455

---

>emb|BX007723.1|CNS08E4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 997 gaagacgagcgtgttgttgtcctcgatcttcttcat 962

---

>emb|BX006872.1|CNS08DGS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 550 gaagacgagcgtgttgttgtcctcgatcttcttcat 585



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 377 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 417



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 437 gccttcttcttgccgtccgg 456

---

>emb|BX006131.1|CNS08CW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 689

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 513 gaagacgagcgtgttgttgtcctcgatcttcttcat 548



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtc 141
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 341 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 381



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 400 gccttcttcttgccgtccgg 419

---

>emb|BX006130.1|CNS08CW6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 792 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 733

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 732 gccttcttcttgccgtccgg 713



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 619 gaagacgagcgtgttgttgtcctcgatcttcttcat 584

---

>gb|AY972825.1| Anopheles stephensi ribosomal protein L23a mRNA, complete cds
          Length = 1535

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 274  gaagacaagggtgttgttgtcctcgatcttcttcat 309
            |||||| || ||||||||||||||||||||||||||
Sbjct: 1001 gaagacgagcgtgttgttgtcctcgatcttcttcat 966



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 96   cttatatgatgccgatcttgttggccacgtcaagagcatcatagtc 141
            |||| |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 1179 cttagatgatgccgatcttgttggcaatgtccagcgcatcgtagtc 1134

---

>gb|AC174742.8| Mus musculus  BAC RP24-258O12 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 163118

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                         
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 71833 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 71774

                                             
Query: 332   tacttgaggatctggtattggtcaagcttgtt 363
              |||||| |||    || ||||||||||||||
Sbjct: 71773 aacttgatgatagcatagtggtcaagcttgtt 71742



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 49489 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 49548

                                             
Query: 332   tacttgaggatctggtattggtcaagcttgtt 363
              |||||| |||    || ||||||||||||||
Sbjct: 49549 aacttgatgatagcatagtggtcaagcttgtt 49580

---

>gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold
          Length = 1888123

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 327
              ||||| ||||| |||||||||||||| || |||||||| || |||||| |||||||
Sbjct: 828501 atgaacacaagcgtgttgttgtcctctattttcttcatggctgactcgatggtcaa 828556

---

>ref|XM_316082.2| Anopheles gambiae str. PEST ENSANGP00000024740
           (ENSANGG00000010065), partial mRNA
          Length = 912

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 101 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 866 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 807

                               
Query: 161 gccttcttcttgccgtccgg 180
           ||||||||||||||||||||
Sbjct: 806 gccttcttcttgccgtccgg 787



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 274 gaagacaagggtgttgttgtcctcgatcttcttcat 309
           |||||| || ||||||||||||||||||||||||||
Sbjct: 693 gaagacgagcgtgttgttgtcctcgatcttcttcat 658

---

>ref|XM_316083.2| Anopheles gambiae str. PEST ENSANGP00000012554 (ENSANGG00000010065),
            mRNA
          Length = 1567

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                        
Query: 101  atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 160
            |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 1187 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 1128

                                
Query: 161  gccttcttcttgccgtccgg 180
            ||||||||||||||||||||
Sbjct: 1127 gccttcttcttgccgtccgg 1108



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 274  gaagacaagggtgttgttgtcctcgatcttcttcat 309
            |||||| || ||||||||||||||||||||||||||
Sbjct: 1014 gaagacgagcgtgttgttgtcctcgatcttcttcat 979

---

>gb|AC172027.4| Mus musculus  BAC RP24-219P17 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 185679

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                          
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 121968 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 121909

                                              
Query: 332    tacttgaggatctggtattggtcaagcttgtt 363
               |||||| |||    || ||||||||||||||
Sbjct: 121908 aacttgatgatagcatagtggtcaagcttgtt 121877



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 99607 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 99666

                                             
Query: 332   tacttgaggatctggtattggtcaagcttgtt 363
              |||||| |||    || ||||||||||||||
Sbjct: 99667 aacttgatgatagcatagtggtcaagcttgtt 99698



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 65268 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 65327

                                             
Query: 332   tacttgaggatctggtattggtcaagcttgtt 363
              |||||| |||    || ||||||||||||||
Sbjct: 65328 aacttgatgatagcatagtggtcaagcttgtt 65359

---

>gb|AC171183.6| Mus musculus  BAC RP24-545B2 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 211697

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                          
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 118130 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 118189

                                              
Query: 332    tacttgaggatctggtattggtcaagcttgtt 363
               |||||| |||    || ||||||||||||||
Sbjct: 118190 aacttgatgatagcatagtggtcaagcttgtt 118221



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 272  atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 331
            ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 7368 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 7309

                                            
Query: 332  tacttgaggatctggtattggtcaagcttgtt 363
             |||||| |||    || ||||||||||||||
Sbjct: 7308 aacttgatgatagcatagtggtcaagcttgtt 7277



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 140703 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtca 140649

---

>emb|AL672193.10| Mouse DNA sequence from clone RP23-443O18 on chromosome X, complete
            sequence
          Length = 210236

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 284  gtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 327
            ||||||||||||||||| |||||||| || ||||| ||||||||
Sbjct: 9341 gtgttgttgtcctcgatattcttcatggctgactcagtggtcaa 9384

---

>gb|AC123752.8| Mus musculus chromosome 1, clone RP24-194N4, complete sequence
          Length = 223110

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 175284 atgaatacaagagtgttgttgtcctctattttcttcatggctgactcagtggtca 175230

---

>gb|BC086883.1| Mus musculus ribosomal protein L23a, mRNA (cDNA clone MGC:107550
           IMAGE:6756980), complete cds
          Length = 550

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 312 atgaacacaagagtgttgttgtcctctattttcttcatggctgactccgtggtca 258

---

>gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome 14, complete sequence
          Length = 200560

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                    
Query: 272   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 43004 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtca 42950

---

>gb|BC026656.1| Mus musculus ribosomal protein L23a, mRNA (cDNA clone
           IMAGE:4988735), partial cds
          Length = 611

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 294 atgaacacaagagtgttgttgtcctctattttcttcatggctgactccgtggtca 240

---

>gb|BC029892.1| Mus musculus ribosomal protein L23a, mRNA (cDNA clone MGC:36820
           IMAGE:4163533), complete cds
          Length = 531

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 296 atgaacacaagagtgttgttgtcctctattttcttcatggctgactccgtggtca 242

---

>gb|BC016558.1| Mus musculus ribosomal protein L23a, mRNA (cDNA clone
           IMAGE:3586350), partial cds
          Length = 513

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 272 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 276 atgaacacaagagtgttgttgtcctctattttcttcatggctgactccgtggtca 222

---

>gb|AC103405.14| Mus musculus chromosome 19, clone RP23-98J4, complete sequence
          Length = 227074

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 272    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 326
              ||||| ||||| ||| |||||||||| ||| ||||||| || |||||||||||||
Sbjct: 142181 atgaacacaagcgtggtgttgtcctctatcgtcttcatggctgactcggtggtca 142127


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,249,731
Number of Sequences: 3902068
Number of extensions: 5249731
Number of successful extensions: 96610
Number of sequences better than 10.0: 458
Number of HSP's better than 10.0 without gapping: 459
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94856
Number of HSP's gapped (non-prelim): 1656
length of query: 605
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 582
effective length of database: 17,143,297,704
effective search space: 9977399263728
effective search space used: 9977399263728
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---