Clone Name	rbags30p04
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds	135	2e-28
2	gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end	127	5e-26
3	ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone pro...	125	2e-25
4	ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_8822...	125	2e-25
5	ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_8822...	125	2e-25
6	ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_8822...	125	2e-25
7	emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes	125	2e-25
8	dbj|AB205017.1| Lolium multiflorum gene for replacement histone ...	125	2e-25
9	emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V	125	2e-25
10	gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complet...	125	2e-25
11	gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete...	125	2e-25
12	gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds	125	2e-25
13	gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds	125	2e-25
14	gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence	121	3e-24
15	emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3	119	1e-23
16	ref|NM_185612.1| Oryza sativa (japonica cultivar-group), predic...	117	5e-23
17	emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15	117	5e-23
18	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	117	5e-23
19	dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic D...	117	5e-23
20	dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic D...	117	5e-23
21	emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV	117	5e-23
22	gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds	117	5e-23
23	gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds	117	5e-23
24	gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds	117	5e-23
25	ref|XM_493701.1| Oryza sativa (japonica cultivar-group), mRNA	113	7e-22
26	gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence	113	7e-22
27	gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome...	113	7e-22
28	gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome...	113	7e-22
29	ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-...	113	7e-22
30	emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2	113	7e-22
31	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	113	7e-22
32	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	113	7e-22
33	dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D...	113	7e-22
34	dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic D...	113	7e-22
35	dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clon...	113	7e-22
36	gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds	113	7e-22
37	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	113	7e-22
38	gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds	113	7e-22
39	ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro...	111	3e-21
40	emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4...	111	3e-21
41	emb|X00937.1|TAHI02 Wheat histone H3 gene	109	1e-20
42	dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, comp...	109	1e-20
43	dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, comp...	109	1e-20
44	gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene	109	1e-20
45	gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence	107	4e-20
46	ref|XM_475315.1| Oryza sativa (japonica cultivar-group), predic...	105	2e-19
47	ref|NM_190750.1| Oryza sativa (japonica cultivar-group), predic...	105	2e-19
48	gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence	105	2e-19
49	ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2a...	105	2e-19
50	gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome...	105	2e-19
51	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	105	2e-19
52	dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clon...	105	2e-19
53	emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3	105	2e-19
54	emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene	105	2e-19
55	ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2a...	103	7e-19
56	ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2a...	103	7e-19
57	emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11	103	7e-19
58	emb|CR541858.1| Homo sapiens full open reading frame cDNA clone ...	103	7e-19
59	emb|X85102.1|OSRNAHIS3 O.sativa mRNA for histone H3	103	7e-19
60	emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a	103	7e-19
61	ref|NM_185609.1| Oryza sativa (japonica cultivar-group), predic...	101	3e-18
62	ref|XM_472456.1| Oryza sativa (japonica cultivar-group), predic...	101	3e-18
63	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	101	3e-18
64	emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4,...	101	3e-18
65	emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12	101	3e-18
66	gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequ...	100	1e-17
67	ref|XM_527253.1| PREDICTED: Pan troglodytes similar to histone 1...	100	1e-17
68	ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histo...	100	1e-17
69	ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histo...	100	1e-17
70	ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans...	98	4e-17
71	ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans...	98	4e-17
72	ref|NM_185607.1| Oryza sativa (japonica cultivar-group), predic...	98	4e-17
73	ref|NM_185613.1| Oryza sativa (japonica cultivar-group), predic...	98	4e-17
74	ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA	98	4e-17
75	gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	98	4e-17
76	gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	98	4e-17
77	gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	98	4e-17
78	ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2a...	98	4e-17
79	gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339	98	4e-17
80	ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2a...	98	4e-17
81	ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2a...	98	4e-17
82	gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MG...	98	4e-17
83	ref|NG_001335.1| Homo sapiens genomic large histone family clust...	98	4e-17
84	ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA	98	4e-17
85	ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA	98	4e-17
86	ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h...	98	4e-17
87	gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete...	98	4e-17
88	emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a...	98	4e-17
89	emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143	98	4e-17
90	emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes	98	4e-17
91	emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for h...	98	4e-17
92	emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr...	98	4e-17
93	dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RI...	98	4e-17
94	gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h...	98	4e-17
95	gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and...	98	4e-17
96	gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ...	98	4e-17
97	ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudoge...	98	4e-17
98	gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple...	98	4e-17
99	gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MG...	98	4e-17
100	dbj|AB185067.1| Conocephalum conicum H3 gene for histone 3, comp...	98	4e-17
101	gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, co...	98	4e-17
102	ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone...	98	4e-17
103	gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, compl...	98	4e-17
104	gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, comp...	98	4e-17
105	gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, compl...	98	4e-17
106	gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, comp...	98	4e-17
107	emb|Z61129.1|HS45E8R H.sapiens CpG island DNA genomic Mse1 fragm...	98	4e-17
108	gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	98	4e-17
109	gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	98	4e-17
110	gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC...	98	4e-17
111	gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp...	98	4e-17
112	gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple...	98	4e-17
113	ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA	98	4e-17
114	gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds	98	4e-17
115	ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476...	96	2e-16
116	ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA	96	2e-16
117	ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2a...	96	2e-16
118	ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2a...	96	2e-16
119	ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2a...	96	2e-16
120	ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA	96	2e-16
121	ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone ...	96	2e-16
122	ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone ...	96	2e-16
123	ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone ...	96	2e-16
124	ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone ...	96	2e-16
125	ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone ...	96	2e-16
126	ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone ...	96	2e-16
127	ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone ...	96	2e-16
128	ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone ...	96	2e-16
129	ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ...	96	2e-16
130	ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ...	96	2e-16
131	emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch...	96	2e-16
132	emb|X80325.1|MPMPH315 M.pahari mpH315 gene	96	2e-16
133	emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr...	96	2e-16
134	ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, ...	96	2e-16
135	ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (p...	96	2e-16
136	gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, compl...	96	2e-16
137	gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, compl...	96	2e-16
138	ref|XM_318362.1| Anopheles gambiae str. PEST ENSANGP00000016005 ...	96	2e-16
139	ref|XM_314446.2| Anopheles gambiae str. PEST ENSANGP00000016066 ...	96	2e-16
140	ref|XM_307081.1| Anopheles gambiae str. PEST ENSANGP00000001387 ...	96	2e-16
141	ref|XM_305996.1| Anopheles gambiae str. PEST ENSANGP00000012784 ...	96	2e-16
142	gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	96	2e-16
143	gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I...	96	2e-16
144	gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds	96	2e-16
145	gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds	96	2e-16
146	gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence	94	7e-16
147	ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone ...	94	7e-16
148	gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, c...	94	7e-16
149	gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds	94	7e-16
150	gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), com...	94	7e-16
151	gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I...	92	3e-15
152	emb|CR733515.2|CNS0GSRE Tetraodon nigroviridis full-length cDNA	90	1e-14
153	emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23	90	1e-14
154	emb|X80326.1|MPMPH312 M.pahari mpH312 gene	90	1e-14
155	ref|XM_686806.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	90	1e-14
156	ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	90	1e-14
157	ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	90	1e-14
158	ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	90	1e-14
159	emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ...	90	1e-14
160	ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA	88	4e-14
161	ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2a...	88	4e-14
162	ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2a...	88	4e-14
163	ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2a...	88	4e-14
164	ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA	88	4e-14
165	gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co...	88	4e-14
166	emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his...	88	4e-14
167	emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene	88	4e-14
168	emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr...	88	4e-14
169	ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	88	4e-14
170	dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-...	88	4e-14
171	gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist...	88	4e-14
172	dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-...	88	4e-14
173	gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, compl...	88	4e-14
174	gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, compl...	88	4e-14
175	ref|XM_560604.1| Anopheles gambiae str. PEST ENSANGP00000025641 ...	88	4e-14
176	ref|XM_320335.2| Anopheles gambiae str. PEST ENSANGP00000014183 ...	88	4e-14
177	ref|XM_307606.1| Anopheles gambiae str. PEST ENSANGP00000016172 ...	88	4e-14
178	emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3	88	4e-14
179	gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds	88	4e-14
180	gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence	86	2e-13
181	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	86	2e-13
182	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	86	2e-13
183	emb|AL844879.5|CNS08CB2 Oryza sativa chromosome 12, . BAC OSJNBa...	86	2e-13
184	gb|J00869.1|CHKH3A Chicken histone H3 gene (intronless)	86	2e-13
185	gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), com...	86	2e-13
186	ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA	84	6e-13
187	gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA...	84	6e-13
188	ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA	84	6e-13
189	gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds	84	6e-13
190	ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA	84	6e-13
191	ref|XM_871486.1| PREDICTED: Bos taurus similar to H3 histone, fa...	84	6e-13
192	ref|XM_871460.1| PREDICTED: Bos taurus similar to H3 histone, fa...	84	6e-13
193	ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa...	84	6e-13
194	ref|XM_866686.1| PREDICTED: Bos taurus similar to H3 histone, fa...	84	6e-13
195	gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC...	84	6e-13
196	gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNI...	84	6e-13
197	gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMA...	84	6e-13
198	ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus simila...	84	6e-13
199	emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for hist...	84	6e-13
200	ref|XM_780236.1| PREDICTED: Strongylocentrotus purpuratus simila...	84	6e-13
201	ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus simila...	84	6e-13
202	ref|XM_777897.1| PREDICTED: Strongylocentrotus purpuratus simila...	84	6e-13
203	ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	84	6e-13
204	ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (...	84	6e-13
205	dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-...	84	6e-13
206	gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, co...	84	6e-13
207	ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudoge...	84	6e-13
208	ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA	84	6e-13
209	gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE...	84	6e-13
210	gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete...	84	6e-13
211	gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, co...	84	6e-13
212	gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, compl...	84	6e-13
213	gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, compl...	84	6e-13
214	ref|XM_314445.2| Anopheles gambiae str. PEST ENSANGP00000016056 ...	84	6e-13
215	emb|Z56112.1|HS89C12R H.sapiens CpG island DNA genomic Mse1 frag...	84	6e-13
216	emb|Z56111.1|HS89C12F H.sapiens CpG island DNA genomic Mse1 frag...	84	6e-13
217	emb|Z63365.1|HS81H7R H.sapiens CpG island DNA genomic Mse1 fragm...	84	6e-13
218	gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC...	84	6e-13
219	gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC...	84	6e-13
220	gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC...	84	6e-13
221	emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3	84	6e-13
222	gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds	84	6e-13
223	gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H...	84	6e-13
224	gb|BC054666.1| Danio rerio zgc:66241, mRNA (cDNA clone MGC:66241...	82	2e-12
225	gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds	82	2e-12
226	ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus simila...	82	2e-12
227	ref|NM_199745.1| Danio rerio zgc:66241 (zgc:66241), mRNA	82	2e-12
228	ref|XM_686609.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	82	2e-12
229	ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	82	2e-12
230	ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	82	2e-12
231	ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	82	2e-12
232	ref|XM_694212.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	82	2e-12
233	ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	82	2e-12
234	ref|XM_701573.1| PREDICTED: Danio rerio similar to CG31613-PA, t...	82	2e-12
235	ref|XM_688339.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	82	2e-12
236	gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA...	80	1e-11
237	ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA	80	1e-11
238	gb|BC097060.1| Danio rerio zgc:113984, mRNA (cDNA clone MGC:1139...	80	1e-11
239	emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N2...	80	1e-11
240	emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3...	80	1e-11
241	emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant	80	1e-11
242	ref|NM_001025176.3| Danio rerio zgc:113984 (zgc:113984), mRNA	80	1e-11
243	ref|NM_001025303.1| Homo sapiens similar to histone H2B histone ...	80	1e-11
244	gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA	80	1e-11
245	ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA...	80	1e-11
246	gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA	80	1e-11
247	dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells...	80	1e-11
248	ref|XM_688063.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	80	1e-11
249	gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016	80	1e-11
250	gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108	80	1e-11
251	gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, co...	80	1e-11
252	gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone...	80	1e-11
253	gb|AC008233.3|AC008233 Drosophila melanogaster, chromosome 2L, r...	80	1e-11
254	gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, compl...	80	1e-11
255	gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, compl...	80	1e-11
256	gb|AE003608.5| Drosophila melanogaster chromosome 2L, section 17...	80	1e-11
257	ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA	80	1e-11
258	gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	80	1e-11
259	gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 p...	78	4e-11
260	dbj|AB185075.1| Conocephalum conicum H3 gene for histone 3, comp...	78	4e-11
261	dbj|AB185072.1| Conocephalum conicum H3 gene for histone 3, comp...	78	4e-11
262	dbj|AB185039.1| Conocephalum supradecompositum H3 gene for histo...	78	4e-11
263	gb|L19706.1| Rattus norvegicus H3 histone gene, complete cds	76	2e-10
264	gb|BC069079.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:...	76	2e-10
265	ref|XM_580747.2| PREDICTED: Bos taurus similar to CG31613-PA (LO...	76	2e-10
266	gb|AY231774.1| Drosophila yakuba clone yak-em_His3.3A mRNA sequence	76	2e-10
267	emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr...	76	2e-10
268	emb|Z49861.1|HS2132H3 H.sapiens gene for histone H3	76	2e-10
269	emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic ...	76	2e-10
270	ref|NM_003493.2| Homo sapiens histone 3, H3 (HIST3H3), mRNA	76	2e-10
271	emb|BX005126.10| Zebrafish DNA sequence from clone CH211-129O9 i...	76	2e-10
272	ref|XM_687893.1| PREDICTED: Danio rerio similar to CG31613-PA (L...	76	2e-10
273	ref|XM_692955.1| PREDICTED: Danio rerio similar to H3 histone, f...	76	2e-10
274	ref|NM_200003.1| Danio rerio zgc:64222 (zgc:64222), mRNA	76	2e-10
275	emb|BX510647.10| Zebrafish DNA sequence from clone CH211-87N9 in...	76	2e-10
276	ref|NM_001013056.1| Rattus norvegicus histone 1, H2ai (predicted...	76	2e-10
277	ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (pr...	76	2e-10
278	gb|AF531308.1| Homo sapiens histone H3 (HIST3H3) gene, complete cds	76	2e-10
279	ref|NM_214547.1| Strongylocentrotus purpuratus late embryonic hi...	76	2e-10
280	ref|XM_320336.2| Anopheles gambiae str. PEST ENSANGP00000014197 ...	76	2e-10
281	gb|BC057444.1| Danio rerio zgc:64222, mRNA (cDNA clone MGC:64222...	76	2e-10
282	gb|BC101837.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:...	76	2e-10
283	gb|BC101839.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:...	76	2e-10
284	gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial ...	76	2e-10
285	gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial ...	76	2e-10
286	gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cd...	76	2e-10
287	emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA	74	6e-10
288	gb|BC107980.1| Danio rerio zgc:123334, mRNA (cDNA clone MGC:1233...	74	6e-10
289	ref|XM_786159.1| PREDICTED: Strongylocentrotus purpuratus simila...	74	6e-10
290	ref|XM_789723.1| PREDICTED: Strongylocentrotus purpuratus simila...	74	6e-10
291	ref|NM_001040004.1| Danio rerio zgc:123334 (zgc:123334), mRNA	74	6e-10
292	ref|XM_779415.1| PREDICTED: Strongylocentrotus purpuratus simila...	74	6e-10
293	emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ...	74	6e-10
294	emb|X52393.1|TCH3H4 Tigriopus californicus DNA for histone H3 an...	74	6e-10
295	emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene	74	6e-10
296	gb|BC097059.1| Danio rerio zgc:113983, mRNA (cDNA clone MGC:1139...	74	6e-10
297	ref|NM_001025171.1| Danio rerio zgc:113983 (zgc:113983), mRNA	74	6e-10
298	ref|XM_677616.1| PREDICTED: Danio rerio similar to CG31613-PA, t...	74	6e-10
299	gb|AF304365.1|AF304365 Rubus idaeus histone H3 gene, partial cds	74	6e-10
300	gb|M84797.1|TIGH1234A Tigriopus californicus histone H1 gene, co...	74	6e-10
301	ref|XM_527285.1| PREDICTED: Pan troglodytes similar to HIST1H3I ...	72	2e-09
302	ref|XM_595303.1| PREDICTED: Bos taurus similar to histone 1, H2a...	72	2e-09
303	ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone ...	72	2e-09
304	emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chr...	72	2e-09
305	emb|X72950.1|XLH3LHIS X.laevis H3l gene for histone H3	72	2e-09
306	emb|X72949.1|XLH3HIS X.laevis H3r gene for histone H3	72	2e-09
307	emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	72	2e-09
308	ref|NM_001016636.3| Xenopus tropicalis histone 2, H3c (hist1h3g)...	72	2e-09
309	emb|AJ556872.1|XLA556872 Expression vector pET3-H3 H3 gene for X...	72	2e-09
310	gb|DQ096858.1| Xenopus laevis h3r mRNA, complete sequence	72	2e-09
311	ref|XM_932130.1| PREDICTED: Homo sapiens hypothetical protein LO...	72	2e-09
312	dbj|AK020421.1| Mus musculus 12 days embryo embryonic body betwe...	72	2e-09
313	emb|CR855729.2| Xenopus tropicalis finished cDNA, clone TGas081o10	72	2e-09
314	emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11	72	2e-09
315	gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	72	2e-09
316	gb|J00984.1|XELHIS3LB x.laevis histone gene h3 and flanks	72	2e-09
317	gb|AF520775.1| Hypocrea jecorina histone H3 gene, complete cds	70	9e-09
318	dbj|AB185078.1| Conocephalum conicum H3 gene for histone 3, comp...	70	9e-09
319	dbj|AB185074.1| Conocephalum conicum H3 gene for histone 3, comp...	70	9e-09
320	dbj|AB185035.1| Conocephalum supradecompositum H3 gene for histo...	70	9e-09
321	ref|XM_527604.1| PREDICTED: Pan troglodytes similar to histone 1...	68	4e-08
322	ref|XM_527254.1| PREDICTED: Pan troglodytes similar to HIST2H3C ...	68	4e-08
323	gb|BC067492.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC...	68	4e-08
324	ref|XM_610495.1| PREDICTED: Bos taurus similar to CG31613-PA (LO...	68	4e-08
325	gb|AF531279.1| Homo sapiens histone H3 (HIST1H3F) gene, complete...	68	4e-08
326	emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones	68	4e-08
327	emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o...	68	4e-08
328	gb|BC096131.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC...	68	4e-08
329	dbj|AB195651.1| Lilium longiflorum soH3-1 gene for histone soH3-...	68	4e-08
330	dbj|AB195650.1| Lilium longiflorum soH3-1 mRNA for histone soH3-...	68	4e-08
331	gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequ...	68	4e-08
332	gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence	68	4e-08
333	gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequ...	68	4e-08
334	gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequ...	68	4e-08
335	gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence	68	4e-08
336	ref|NM_021018.2| Homo sapiens histone 1, H3f (HIST1H3F), mRNA	68	4e-08
337	emb|CR542013.1| Homo sapiens full open reading frame cDNA clone ...	68	4e-08
338	emb|CR542011.1| Homo sapiens full open reading frame cDNA clone ...	68	4e-08
339	emb|CR541983.1| Homo sapiens full open reading frame cDNA clone ...	68	4e-08
340	dbj|AB044543.1| Drosophila lutescens H3 gene for histone 3, comp...	68	4e-08
341	dbj|AB044540.1| Drosophila takahashii H3 gene for histone 3, com...	68	4e-08
342	gb|AY894086.1| Synthetic construct Homo sapiens clone FLH131254....	68	4e-08
343	emb|Z61668.1|HS56E3R H.sapiens CpG island DNA genomic Mse1 fragm...	68	4e-08
344	gb|BC069818.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC...	68	4e-08
345	emb|Z80786.1|HSH3I H.sapiens H3/i gene	68	4e-08
346	gb|BC084311.1| Xenopus laevis cDNA clone IMAGE:6865011	66	1e-07
347	emb|Z98866.1|CEY49E10 Caenorhabditis elegans YAC Y49E10, complet...	66	1e-07
348	emb|V01356.1|SPHIS1 Sea urchin genes for the histones H2B and H3	66	1e-07
349	emb|X07505.1|DIHIST3 Sea star (D.imbricata) histone H3 gene	66	1e-07
350	emb|X01345.1|PMHISH3 Psammechinus miliaris gene for histone H3 (...	66	1e-07
351	gb|BC092854.1| Danio rerio zgc:110292, mRNA (cDNA clone MGC:1102...	66	1e-07
352	ref|NM_067207.3| Caenorhabditis elegans HIStone family member (h...	66	1e-07
353	ref|NM_001017599.1| Danio rerio zgc:110292 (zgc:110292), mRNA	66	1e-07
354	ref|NM_214544.1| Strongylocentrotus purpuratus histone H3 (H3), ...	66	1e-07
355	gb|U96764.1|CVHIST1 Chaetopterus variopedatus histone H1, histon...	66	1e-07
356	gb|M36921.1|SUSH3N5A S.drobachiensis H3 histone, clone Nor5	66	1e-07
357	gb|M10558.1|SUPHISB3 P.miliaris histone H3 gene, clone h19, comp...	66	1e-07
358	gb|M36920.1|PALH319A P.lividus H3 histone, clone h19	66	1e-07
359	ref|XM_518888.1| PREDICTED: Pan troglodytes similar to histone 1...	64	6e-07
360	ref|XM_527263.1| PREDICTED: Pan troglodytes similar to histone 1...	64	6e-07
361	gb|BC069305.1| Homo sapiens histone 1, H3i, mRNA (cDNA clone IMA...	64	6e-07
362	gb|BC067494.1| Homo sapiens histone 1, H3i, mRNA (cDNA clone IMA...	64	6e-07
363	gb|BC067493.1| Homo sapiens histone 1, H3i, mRNA (cDNA clone MGC...	64	6e-07
364	gb|BC033095.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC...	64	6e-07
365	gb|BC052981.1| Homo sapiens histone 1, H3e, mRNA (cDNA clone MGC...	64	6e-07
366	gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC...	64	6e-07
367	ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA	64	6e-07
368	ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@...	64	6e-07
369	ref|NM_003533.2| Homo sapiens histone 1, H3i (HIST1H3I), mRNA	64	6e-07
370	ref|NM_003532.2| Homo sapiens histone 1, H3e (HIST1H3E), mRNA	64	6e-07
371	gb|AF531282.1| Homo sapiens histone H3 (HIST1H3I) gene, complete...	64	6e-07
372	gb|AF531278.1| Homo sapiens histone H3 (HIST1H3E) gene, complete...	64	6e-07
373	gb|AF531277.1| Homo sapiens histone H3 (HIST1H3D) gene, complete...	64	6e-07
374	emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o...	64	6e-07
375	gb|DQ445518.1| Graphocephala atropunctata isolate WHGA0430 putat...	64	6e-07
376	emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 wi...	64	6e-07
377	dbj|AK097020.1| Homo sapiens cDNA FLJ39701 fis, clone SMINT2011656	64	6e-07
378	dbj|AB195653.1| Lilium longiflorum soH3-2 gene for histone soH3-...	64	6e-07
379	dbj|AB195652.1| Lilium longiflorum soH3-2 mRNA for histone soH3-...	64	6e-07
380	emb|CR542014.1| Homo sapiens full open reading frame cDNA clone ...	64	6e-07
381	dbj|AB195974.1| Lilium longiflorum MPH3 mRNA for histone H3, com...	64	6e-07
382	emb|X03104.1|XLHISH3G Xenopus laevis gene for histone H3 (clone ...	64	6e-07
383	emb|X16496.1|MMHIST31 Murine H3.1 gene for histone H3.1	64	6e-07
384	gb|M60746.1|HUMHISAA Human histone H3.1 (H1F3) gene, complete cds	64	6e-07
385	gb|M21286.1|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 gene...	64	6e-07
386	emb|X83550.1|HSHISTN3F H.sapiens gene for histone H3	64	6e-07
387	ref|XM_322230.1| Neurospora crassa OR74A hypothetical protein (N...	62	2e-06
388	ref|XM_951565.1| Neurospora crassa OR74A hypothetical protein (N...	62	2e-06
389	gb|AF517876.1| Griffithsia japonica isolate Gj410 putative histo...	62	2e-06
390	emb|X54114.1|PHH4H3 P.helianthoides histone genes H4 and H3	62	2e-06
391	dbj|AB198670.1| Conocephalum conicum gene for histone 3, complet...	62	2e-06
392	dbj|AB185076.1| Conocephalum conicum H3 gene for histone 3, comp...	62	2e-06
393	dbj|AB185073.1| Conocephalum conicum H3 gene for histone 3, comp...	62	2e-06
394	dbj|AB185071.1| Conocephalum conicum H3 gene for histone 3, comp...	62	2e-06
395	dbj|AB185070.1| Conocephalum conicum H3 gene for histone 3, comp...	62	2e-06
396	dbj|AB185065.1| Marchantia polymorpha H3 gene for histone 3, com...	62	2e-06
397	dbj|AB185064.1| Marchantia polymorpha H3 gene for histone 3, com...	62	2e-06
398	dbj|AB185063.1| Marchantia polymorpha H3 gene for histone 3, com...	62	2e-06
399	dbj|AB185062.1| Marchantia polymorpha H3 gene for histone 3, com...	62	2e-06
400	dbj|AB185061.1| Marchantia polymorpha H3 gene for histone 3, com...	62	2e-06
401	dbj|AB185059.1| Marchantia polymorpha H3 gene for histone 3, com...	62	2e-06
402	dbj|AB185058.1| Marchantia polymorpha H3 gene for histone 3, com...	62	2e-06
403	dbj|AB185057.1| Marchantia polymorpha H3 gene for histone 3, com...	62	2e-06
404	dbj|AB185054.1| Conocephalum conicum H3 gene for histone 3, comp...	62	2e-06
405	dbj|AB185052.1| Conocephalum conicum H3 gene for histone 3, comp...	62	2e-06
406	dbj|AB185051.1| Conocephalum conicum H3 gene for histone 3, comp...	62	2e-06
407	dbj|AB185045.1| Conocephalum supradecompositum H3 gene for histo...	62	2e-06
408	dbj|AB185037.1| Conocephalum supradecompositum H3 gene for histo...	62	2e-06
409	dbj|AB185034.1| Conocephalum conicum H3 gene for histone 3, comp...	62	2e-06
410	dbj|AB185030.1| Conocephalum conicum H3 gene for histone 3, comp...	62	2e-06
411	dbj|AB185028.1| Conocephalum conicum H3 gene for histone 3, comp...	62	2e-06
412	dbj|AB185024.1| Conocephalum conicum H3 gene for histone 3, comp...	62	2e-06
413	gb|AY491505.1| Capsicum annuum histone H3-like protein mRNA, com...	60	9e-06
414	emb|CR733198.1|CNS0GSLF Tetraodon nigroviridis full-length cDNA	60	9e-06
415	emb|CR732463.2|CNS0GS44 Tetraodon nigroviridis full-length cDNA	60	9e-06
416	emb|CR732337.2|CNS0GS0M Tetraodon nigroviridis full-length cDNA	60	9e-06
417	emb|CR729702.2|CNS0GPZG Tetraodon nigroviridis full-length cDNA	60	9e-06
418	emb|CR728891.2|CNS0GPCX Tetraodon nigroviridis full-length cDNA	60	9e-06
419	emb|CR728060.2|CNS0GOPU Tetraodon nigroviridis full-length cDNA	60	9e-06
420	emb|CR726879.2|CNS0GNT1 Tetraodon nigroviridis full-length cDNA	60	9e-06
421	gb|DQ073573.1| Craterostigma plantagineum histone H3.3 mRNA, com...	60	9e-06
422	emb|X81207.1|DMHISH333 D.melanogaster genes for histone H3.3 and...	60	9e-06
423	emb|X81205.1|DMHSTH331 D.melanogaster mRNA for histone H3.3	60	9e-06
424	emb|X53822.1|DMH33Q D.melanogaster mRNA for histone H3.3Q (variant)	60	9e-06
425	gb|AC023729.5| Drosophila melanogaster X BAC RP98-39L4 (Roswell ...	60	9e-06
426	gb|AC023719.4| Drosophila melanogaster X BAC RP98-4L24 (Roswell ...	60	9e-06
427	gb|AY118325.1| Drosophila melanogaster LD17717 full insert cDNA	60	9e-06
428	ref|NM_176719.1| Drosophila melanogaster CG8989-RC, transcript v...	60	9e-06
429	ref|NM_167180.3| Drosophila melanogaster CG8989-RB, transcript v...	60	9e-06
430	ref|NM_078540.4| Drosophila melanogaster CG8989-RA, transcript v...	60	9e-06
431	gb|AC084502.1|CBRG14F21 Caenorhabditis briggsae cosmid G14F21, c...	60	9e-06
432	gb|AY105203.1| Zea mays PCO121645 mRNA sequence	60	9e-06
433	gb|AE003446.4| Drosophila melanogaster chromosome X, section 30 ...	60	9e-06
434	gb|AY725692.1| Calonectria ilicicola strain CPC 4873 histone H3 ...	58	4e-05
435	gb|AY725691.1| Calonectria ilicicola strain CBS 113903 histone H...	58	4e-05
436	gb|AY725690.1| Calonectria ilicicola strain CBS 113783 histone H...	58	4e-05
437	gb|AY725689.1| Calonectria ilicicola strain CBS 112223 histone H...	58	4e-05
438	gb|AY725688.1| Calonectria ilicicola strain CBS 112219 histone H...	58	4e-05
439	gb|AY725687.1| Calonectria ilicicola strain CBS 112218 histone H...	58	4e-05
440	gb|AY725686.1| Calonectria ilicicola strain CBS 112217 histone H...	58	4e-05
441	gb|AY725684.1| Calonectria ilicicola strain CBS 112215 histone H...	58	4e-05
442	gb|AY725683.1| Calonectria ilicicola strain CBS 112214 histone H...	58	4e-05
443	gb|AY725682.1| Calonectria ilicicola strain CBS 112213 histone H...	58	4e-05
444	gb|AY725681.1| Calonectria ilicicola strain CBS 112212 histone H...	58	4e-05
445	gb|AY725680.1| Calonectria ilicicola strain CBS 112211 histone H...	58	4e-05
446	gb|AY725679.1| Calonectria ilicicola strain CBS 112210 histone H...	58	4e-05
447	gb|AY725678.1| Calonectria ilicicola strain CBS 112209 histone H...	58	4e-05
448	gb|AY725677.1| Calonectria ilicicola strain CBS 111805 histone H...	58	4e-05
449	gb|AY725676.1| Calonectria ilicicola strain CBS 190.50 histone H...	58	4e-05
450	gb|AY725662.1| Cylindrocladium colombiense strain CBS 112220 his...	58	4e-05
451	gb|AY725658.1| Cylindrocladium asiaticum strain CBS 114073 histo...	58	4e-05
452	ref|NM_100790.2| Arabidopsis thaliana DNA binding AT1G09200 mRNA...	58	4e-05
453	ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H...	58	4e-05
454	ref|XM_527264.1| PREDICTED: Pan troglodytes similar to histone 1...	58	4e-05
455	ref|XM_527255.1| PREDICTED: Pan troglodytes similar to histone 1...	58	4e-05
456	gb|BC079835.1| Homo sapiens histone 1, H3g, mRNA (cDNA clone MGC...	58	4e-05
457	gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462	58	4e-05
458	gb|BC007518.2| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	58	4e-05
459	gb|BC058834.1| Homo sapiens histone 1, H3c, mRNA (cDNA clone IMA...	58	4e-05
460	ref|NM_003536.2| Homo sapiens histone 1, H3h (HIST1H3H), mRNA	58	4e-05
461	ref|NM_003534.2| Homo sapiens histone 1, H3g (HIST1H3G), mRNA	58	4e-05
462	gb|AF531281.1| Homo sapiens histone H3 (HIST1H3H) gene, complete...	58	4e-05
463	gb|AF531280.1| Homo sapiens histone H3 (HIST1H3G) gene, complete...	58	4e-05
464	gb|AF531276.1| Homo sapiens histone H3 (HIST1H3C) gene, complete...	58	4e-05
465	gb|U28732.1| Caenorhabditis elegans cosmid F45E1, complete sequence	58	4e-05
466	gb|AY125246.1| Timema knulli histone 3 gene, partial cds	58	4e-05
467	gb|AY125233.1| Isoperla davisi histone 3 gene, partial cds	58	4e-05
468	gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds	58	4e-05
469	gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds	58	4e-05
470	gb|AY125230.1| Stenopelmatus fuscus histone 3 gene, partial cds	58	4e-05
471	gb|AY125229.1| Argia vivida histone 3 gene, partial cds	58	4e-05
472	ref|XM_793816.1| PREDICTED: Strongylocentrotus purpuratus simila...	58	4e-05
473	emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o...	58	4e-05
474	emb|X01064.1|SGHIS2A3 Rainbow trout histone H2A and H3 genes	58	4e-05
475	emb|V01144.1|PMHIS8 Sea urchin (P. miliaris) gene for histones H...	58	4e-05
476	gb|BC096130.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	58	4e-05
477	gb|BC096128.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	58	4e-05
478	gb|BC096129.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	58	4e-05
479	gb|BC012185.1| Homo sapiens histone 1, H3g, mRNA (cDNA clone MGC...	58	4e-05
480	emb|Z83735.1|HSZ83735 H.sapiens hH3/k gene	58	4e-05
481	gb|AF323993.1|AF323993 Trichinella pseudospiralis histone H3.3 m...	58	4e-05
482	gb|AY035716.1| Anopheles gambiae histone 3A (HIS3A) mRNA, comple...	58	4e-05
483	ref|NM_076943.2| Caenorhabditis elegans HIStone family member (h...	58	4e-05
484	ref|NM_003531.2| Homo sapiens histone 1, H3c (HIST1H3C), mRNA	58	4e-05
485	gb|BT003162.1| Arabidopsis thaliana At1g09200 mRNA, complete cds	58	4e-05
486	gb|AY084316.1| Arabidopsis thaliana clone 10388 mRNA, complete s...	58	4e-05
487	ref|XM_321242.2| Anopheles gambiae str. PEST ENSANGP00000018496 ...	58	4e-05
488	emb|Z66415.1|HS95B11R H.sapiens CpG island DNA genomic Mse1 frag...	58	4e-05
489	gb|DQ275324.1| Acilius sulcatus voucher BYU KBMAcsu49 histone 3 ...	58	4e-05
490	gb|DQ275323.1| Acilius semisulcatus voucher BYU KBMAcse7 histone...	58	4e-05
491	gb|DQ275322.1| Acilius mediatus voucher BYU KBMAcme6 histone 3 (...	58	4e-05
492	gb|DQ275321.1| Acilius kishii voucher BYU KBMAcki83 histone 3 (H...	58	4e-05
493	gb|DQ275320.1| Acilius japonicus voucher BYU KBMAcja163 histone ...	58	4e-05
494	gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone...	58	4e-05
495	gb|DQ275318.1| Graphoderus fascicollis voucher BYU KBMGrfa65 his...	58	4e-05
496	gb|DQ275316.1| Acilius duvergeri voucher BYU KBMAcdu50 histone 3...	58	4e-05
497	gb|DQ275315.1| Acilius confusus voucher BYU KBMAcco157 histone 3...	58	4e-05
498	gb|DQ275314.1| Acilius canaliculatus voucher BYU KBMAcca70 histo...	58	4e-05
499	gb|DQ275313.1| Acilius athabascae voucher BYU KBMAcat158 histone...	58	4e-05
500	gb|DQ275312.1| Acilius abbreviatus voucher BYU KBMAcab159 histon...	58	4e-05

---

>gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds
          Length = 1177

 Score =  135 bits (68), Expect = 2e-28
 Identities = 71/72 (98%)
 Strand = Plus / Minus

                                                                       
Query: 550 cgcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggt 609
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 959 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 900

                       
Query: 610 gacgcgcttggc 621
           ||||||||||||
Sbjct: 899 gacgcgcttggc 888

---

>gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end
          Length = 505

 Score =  127 bits (64), Expect = 5e-26
 Identities = 67/68 (98%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 242 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 183

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 182 cgcttggc 175

---

>ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC427890), mRNA
          Length = 600

 Score =  125 bits (63), Expect = 2e-25
 Identities = 66/67 (98%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 598 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 539

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 538 gcttggc 532

---

>ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417958),
           mRNA
          Length = 1512

 Score =  125 bits (63), Expect = 2e-25
 Identities = 66/67 (98%)
 Strand = Plus / Plus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 570 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 629

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 630 gcttggc 636

---

>ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417949),
           mRNA
          Length = 752

 Score =  125 bits (63), Expect = 2e-25
 Identities = 66/67 (98%)
 Strand = Plus / Plus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 315 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 374

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 375 gcttggc 381

---

>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945),
           mRNA
          Length = 972

 Score =  125 bits (63), Expect = 2e-25
 Identities = 66/67 (98%)
 Strand = Plus / Plus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 378 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 437

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 438 gcttggc 444

---

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  125 bits (63), Expect = 2e-25
 Identities = 66/67 (98%)
 Strand = Plus / Minus

                                                                        
Query: 555  aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3244 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 3185

                   
Query: 615  gcttggc 621
            |||||||
Sbjct: 3184 gcttggc 3178



 Score =  125 bits (63), Expect = 2e-25
 Identities = 66/67 (98%)
 Strand = Plus / Plus

                                                                        
Query: 555  aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1477 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 1536

                   
Query: 615  gcttggc 621
            |||||||
Sbjct: 1537 gcttggc 1543

---

>dbj|AB205017.1| Lolium multiflorum gene for replacement histone H3, exon 1-2,
           complete cds
          Length = 784

 Score =  125 bits (63), Expect = 2e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                       
Query: 551 gcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtg 610
           |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 577 gcctaggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 518

                      
Query: 611 acgcgcttggc 621
           |||||||||||
Sbjct: 517 acgcgcttggc 507

---

>emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V
          Length = 1107

 Score =  125 bits (63), Expect = 2e-25
 Identities = 66/67 (98%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 823 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 764

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 763 gcttggc 757

---

>gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complete cds
          Length = 1809

 Score =  125 bits (63), Expect = 2e-25
 Identities = 66/67 (98%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 880 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 821

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 820 gcttggc 814

---

>gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete cds
          Length = 1204

 Score =  125 bits (63), Expect = 2e-25
 Identities = 66/67 (98%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 897 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 838

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 837 gcttggc 831

---

>gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds
          Length = 1271

 Score =  125 bits (63), Expect = 2e-25
 Identities = 66/67 (98%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 693 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 634

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 633 gcttggc 627

---

>gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds
          Length = 1017

 Score =  125 bits (63), Expect = 2e-25
 Identities = 66/67 (98%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 569 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 510

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 509 gcttggc 503

---

>gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence
          Length = 638

 Score =  121 bits (61), Expect = 3e-24
 Identities = 70/73 (95%)
 Strand = Plus / Minus

                                                                       
Query: 549 acgcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatgg 608
           ||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||
Sbjct: 357 acgcctaagcgcgctccccgcggatgcggcgggcgagctgaatgtccttgggcatgatgg 298

                        
Query: 609 tgacgcgcttggc 621
           |||||||||||||
Sbjct: 297 tgacgcgcttggc 285

---

>emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3
          Length = 657

 Score =  119 bits (60), Expect = 1e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 461 taggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 402

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 401 cgcttggc 394

---

>ref|NM_185612.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  117 bits (59), Expect = 5e-23
 Identities = 65/67 (97%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 409 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 350

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 349 gcttggc 343

---

>emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15
          Length = 578

 Score =  117 bits (59), Expect = 5e-23
 Identities = 65/67 (97%)
 Strand = Plus / Plus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 134 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 193

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 194 gcttggc 200

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  117 bits (59), Expect = 5e-23
 Identities = 65/67 (97%)
 Strand = Plus / Plus

                                                                           
Query: 555     aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
               |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3054206 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 3054265

                      
Query: 615     gcttggc 621
               |||||||
Sbjct: 3054266 gcttggc 3054272



 Score =  113 bits (57), Expect = 7e-22
 Identities = 63/65 (96%)
 Strand = Plus / Plus

                                                                           
Query: 557     gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
               |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1644700 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 1644759

                    
Query: 617     ttggc 621
               |||||
Sbjct: 1644760 ttggc 1644764



 Score =  103 bits (52), Expect = 7e-19
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                           
Query: 550     cgcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggt 609
               |||||| |||||||| || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 3039524 cgcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggt 3039583

                           
Query: 610     gacgcgcttggc 621
               ||||||||||||
Sbjct: 3039584 gacgcgcttggc 3039595



 Score =  101 bits (51), Expect = 3e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                           
Query: 551     gcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtg 610
               ||||| |||||||| || ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 3055575 gcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtg 3055516

                          
Query: 611     acgcgcttggc 621
               |||||||||||
Sbjct: 3055515 acgcgcttggc 3055505



 Score =  101 bits (51), Expect = 3e-18
 Identities = 63/67 (94%)
 Strand = Plus / Plus

                                                                           
Query: 555     aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
               |||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 3045559 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 3045618

                      
Query: 615     gcttggc 621
               |||||||
Sbjct: 3045619 gcttggc 3045625

---

>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0702F05
          Length = 145018

 Score =  117 bits (59), Expect = 5e-23
 Identities = 65/67 (97%)
 Strand = Plus / Plus

                                                                          
Query: 555    aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
              |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142155 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 142214

                     
Query: 615    gcttggc 621
              |||||||
Sbjct: 142215 gcttggc 142221



 Score =  103 bits (52), Expect = 7e-19
 Identities = 67/72 (93%)
 Strand = Plus / Plus

                                                                          
Query: 550    cgcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggt 609
              |||||| |||||||| || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 127473 cgcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggt 127532

                          
Query: 610    gacgcgcttggc 621
              ||||||||||||
Sbjct: 127533 gacgcgcttggc 127544



 Score =  101 bits (51), Expect = 3e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                          
Query: 551    gcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtg 610
              ||||| |||||||| || ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 143524 gcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtg 143465

                         
Query: 611    acgcgcttggc 621
              |||||||||||
Sbjct: 143464 acgcgcttggc 143454



 Score =  101 bits (51), Expect = 3e-18
 Identities = 63/67 (94%)
 Strand = Plus / Plus

                                                                          
Query: 555    aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
              |||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 133508 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 133567

                     
Query: 615    gcttggc 621
              |||||||
Sbjct: 133568 gcttggc 133574

---

>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone:P0681F10
          Length = 170371

 Score =  117 bits (59), Expect = 5e-23
 Identities = 65/67 (97%)
 Strand = Plus / Plus

                                                                        
Query: 555  aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
            |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8391 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 8450

                   
Query: 615  gcttggc 621
            |||||||
Sbjct: 8451 gcttggc 8457



 Score =  101 bits (51), Expect = 3e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                        
Query: 551  gcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtg 610
            ||||| |||||||| || ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 9760 gcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtg 9701

                       
Query: 611  acgcgcttggc 621
            |||||||||||
Sbjct: 9700 acgcgcttggc 9690

---

>emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV
          Length = 1094

 Score =  117 bits (59), Expect = 5e-23
 Identities = 65/67 (97%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 823 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 764

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 763 gcttggc 757

---

>gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds
          Length = 711

 Score =  117 bits (59), Expect = 5e-23
 Identities = 65/67 (97%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 639 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 580

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 579 gcttggc 573

---

>gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds
          Length = 784

 Score =  117 bits (59), Expect = 5e-23
 Identities = 65/67 (97%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 762 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 703

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 702 gcttggc 696

---

>gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds
          Length = 568

 Score =  117 bits (59), Expect = 5e-23
 Identities = 65/67 (97%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 546 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 487

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 486 gcttggc 480

---

>ref|XM_493701.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score =  113 bits (57), Expect = 7e-22
 Identities = 63/65 (96%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence
          Length = 639

 Score =  113 bits (57), Expect = 7e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                       
Query: 549 acgcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatgg 608
           ||||||| |||||||| || |||||||||||||||||||||||||| |||||||||||||
Sbjct: 414 acgcctacgcgcgctcgccgcggatgcggcgggcgagctggatgtctttgggcatgatgg 355

                        
Query: 609 tgacgcgcttggc 621
           |||||||||||||
Sbjct: 354 tgacgcgcttggc 342

---

>gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0076K20,
              complete sequence
          Length = 127338

 Score =  113 bits (57), Expect = 7e-22
 Identities = 63/65 (96%)
 Strand = Plus / Minus

                                                                          
Query: 557    gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
              |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118174 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 118115

                   
Query: 617    ttggc 621
              |||||
Sbjct: 118114 ttggc 118110

---

>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0030I09 map C83B, complete sequence
          Length = 123477

 Score =  113 bits (57), Expect = 7e-22
 Identities = 63/65 (96%)
 Strand = Plus / Minus

                                                                         
Query: 557   gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
             |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13780 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 13721

                  
Query: 617   ttggc 621
             |||||
Sbjct: 13720 ttggc 13716

---

>ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-PA (LOC608586), mRNA
          Length = 411

 Score =  113 bits (57), Expect = 7e-22
 Identities = 66/69 (95%)
 Strand = Plus / Minus

                                                                       
Query: 553 ctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 612
           ||||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ctaggcgcgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                    
Query: 613 gcgcttggc 621
           |||||||||
Sbjct: 351 gcgcttggc 343

---

>emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2
          Length = 1200

 Score =  113 bits (57), Expect = 7e-22
 Identities = 63/65 (96%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 807 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 748

                
Query: 617 ttggc 621
           |||||
Sbjct: 747 ttggc 743

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  113 bits (57), Expect = 7e-22
 Identities = 63/65 (96%)
 Strand = Plus / Plus

                                                                           
Query: 557     gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
               |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2608624 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2608683

                    
Query: 617     ttggc 621
               |||||
Sbjct: 2608684 ttggc 2608688

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  113 bits (57), Expect = 7e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                            
Query: 549      acgcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatgg 608
                |||||||||| | ||| || ||||||||||||||||||||||||||||||||||||||||
Sbjct: 37507570 acgcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatgg 37507511

                             
Query: 609      tgacgcgcttggc 621
                |||||||||||||
Sbjct: 37507510 tgacgcgcttggc 37507498

---

>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0505D12
          Length = 146951

 Score =  113 bits (57), Expect = 7e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                          
Query: 549    acgcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatgg 608
              |||||||||| | ||| || ||||||||||||||||||||||||||||||||||||||||
Sbjct: 102107 acgcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatgg 102048

                           
Query: 609    tgacgcgcttggc 621
              |||||||||||||
Sbjct: 102047 tgacgcgcttggc 102035

---

>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0493C11
          Length = 143113

 Score =  113 bits (57), Expect = 7e-22
 Identities = 63/65 (96%)
 Strand = Plus / Plus

                                                                         
Query: 557   gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
             |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 47871 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 47930

                  
Query: 617   ttggc 621
             |||||
Sbjct: 47931 ttggc 47935

---

>dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E03, full
           insert sequence
          Length = 1296

 Score =  113 bits (57), Expect = 7e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                       
Query: 549 acgcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatgg 608
           |||||||||| | ||| || ||||||||||||||||||||||||||||||||||||||||
Sbjct: 493 acgcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatgg 434

                        
Query: 609 tgacgcgcttggc 621
           |||||||||||||
Sbjct: 433 tgacgcgcttggc 421

---

>gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds
          Length = 793

 Score =  113 bits (57), Expect = 7e-22
 Identities = 63/65 (96%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 495 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 436

                
Query: 617 ttggc 621
           |||||
Sbjct: 435 ttggc 431

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  113 bits (57), Expect = 7e-22
 Identities = 63/65 (96%)
 Strand = Plus / Plus

                                                                           
Query: 557     gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
               |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2617655 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2617714

                    
Query: 617     ttggc 621
               |||||
Sbjct: 2617715 ttggc 2617719

---

>gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds
          Length = 642

 Score =  113 bits (57), Expect = 7e-22
 Identities = 63/65 (96%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 478 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 419

                
Query: 617 ttggc 621
           |||||
Sbjct: 418 ttggc 414

---

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score =  111 bits (56), Expect = 3e-21
 Identities = 59/60 (98%)
 Strand = Plus / Minus

                                                                        
Query: 562  ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2262 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 2203

---

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  111 bits (56), Expect = 3e-21
 Identities = 59/60 (98%)
 Strand = Plus / Plus

                                                                        
Query: 562  ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3353 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 3412

---

>emb|X00937.1|TAHI02 Wheat histone H3 gene
          Length = 811

 Score =  109 bits (55), Expect = 1e-20
 Identities = 67/71 (94%)
 Strand = Plus / Minus

                                                                       
Query: 551 gcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtg 610
           |||||||| | ||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 660 gcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtg 601

                      
Query: 611 acgcgcttggc 621
           |||||||||||
Sbjct: 600 acgcgcttggc 590

---

>dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           T135
          Length = 473

 Score =  109 bits (55), Expect = 1e-20
 Identities = 61/63 (96%)
 Strand = Plus / Minus

                                                                       
Query: 559 gcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgctt 618
           |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 467 gcgctcgcctcggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgctt 408

              
Query: 619 ggc 621
           |||
Sbjct: 407 ggc 405

---

>dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           T117
          Length = 474

 Score =  109 bits (55), Expect = 1e-20
 Identities = 61/63 (96%)
 Strand = Plus / Minus

                                                                       
Query: 559 gcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgctt 618
           |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 468 gcgctcgcctcggatgcggcgggccagctggatgtccttgggcatgatggtgacgcgctt 409

              
Query: 619 ggc 621
           |||
Sbjct: 408 ggc 406

---

>gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene
          Length = 921

 Score =  109 bits (55), Expect = 1e-20
 Identities = 64/67 (95%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           ||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||||
Sbjct: 749 aggcgcgctccccgcggatgcggcgggtgagctggatgtccttgggcatgatggagacgc 690

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 689 gcttggc 683

---

>gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence
          Length = 636

 Score =  107 bits (54), Expect = 4e-20
 Identities = 60/62 (96%)
 Strand = Plus / Plus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 137 gcgcgctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 196

             
Query: 617 tt 618
           ||
Sbjct: 197 tt 198

---

>ref|XM_475315.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  105 bits (53), Expect = 2e-19
 Identities = 53/53 (100%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>ref|NM_190750.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  105 bits (53), Expect = 2e-19
 Identities = 53/53 (100%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence
          Length = 887

 Score =  105 bits (53), Expect = 2e-19
 Identities = 53/53 (100%)
 Strand = Plus / Plus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 238 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 290

---

>ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC617888), mRNA
          Length = 714

 Score =  105 bits (53), Expect = 2e-19
 Identities = 65/69 (94%)
 Strand = Plus / Minus

                                                                       
Query: 553 ctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 612
           |||||| | |||||| |||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 714 ctaggccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgac 655

                    
Query: 613 gcgcttggc 621
           |||||||||
Sbjct: 654 gcgcttggc 646

---

>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0042J17, complete sequence
          Length = 124139

 Score =  105 bits (53), Expect = 2e-19
 Identities = 53/53 (100%)
 Strand = Plus / Plus

                                                                  
Query: 569   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
             |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72777 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 72829

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  105 bits (53), Expect = 2e-19
 Identities = 53/53 (100%)
 Strand = Plus / Plus

                                                                     
Query: 569      cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
                |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21355455 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 21355507

---

>dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039F20, full
           insert sequence
          Length = 735

 Score =  105 bits (53), Expect = 2e-19
 Identities = 53/53 (100%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 480 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 428

---

>emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3
          Length = 529

 Score =  105 bits (53), Expect = 2e-19
 Identities = 62/65 (95%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 479 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggagacgcgc 420

                
Query: 617 ttggc 621
           |||||
Sbjct: 419 ttggc 415

---

>emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene
          Length = 1119

 Score =  105 bits (53), Expect = 2e-19
 Identities = 53/53 (100%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 779 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 727

---

>ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC525511), mRNA
          Length = 448

 Score =  103 bits (52), Expect = 7e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC521581), mRNA
          Length = 411

 Score =  103 bits (52), Expect = 7e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11
          Length = 1200

 Score =  103 bits (52), Expect = 7e-19
 Identities = 67/72 (93%)
 Strand = Plus / Minus

                                                                       
Query: 550 cgcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggt 609
           |||||| |||||||| || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 814 cgcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggt 755

                       
Query: 610 gacgcgcttggc 621
           ||||||||||||
Sbjct: 754 gacgcgcttggc 743

---

>emb|CR541858.1| Homo sapiens full open reading frame cDNA clone RZPDo834H0632D for
           gene HIST1H3A, histone 1, H3a; complete cds, incl.
           stopcodon
          Length = 411

 Score =  103 bits (52), Expect = 7e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 343

---

>emb|X85102.1|OSRNAHIS3 O.sativa mRNA for histone H3
          Length = 274

 Score =  103 bits (52), Expect = 7e-19
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                       
Query: 551 gcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtg 610
           ||||| ||| |||| || ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 101 gcctaagcgngctcgccgcggatccggcgggcgagctggatgtccttgggcatgatggtg 42

                      
Query: 611 acgcgcttggc 621
           |||||||||||
Sbjct: 41  acgcgcttggc 31

---

>emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a
          Length = 969

 Score =  103 bits (52), Expect = 7e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 709 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 650

---

>ref|NM_185609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 432

 Score =  101 bits (51), Expect = 3e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           |||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 430 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 371

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 370 gcttggc 364

---

>ref|XM_472456.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  101 bits (51), Expect = 3e-18
 Identities = 51/51 (100%)
 Strand = Plus / Minus

                                                              
Query: 571 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 393 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  101 bits (51), Expect = 3e-18
 Identities = 51/51 (100%)
 Strand = Plus / Minus

                                                                   
Query: 571      gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
                |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20749045 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 20748995



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                      
Query: 584      agctggatgtccttgggcatgatggtgacgcgcttggc 621
                ||||| |||||||||||||||||||| || ||||||||
Sbjct: 22438361 agctgaatgtccttgggcatgatggtcacacgcttggc 22438324

---

>emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0108J11,
             complete sequence
          Length = 124629

 Score =  101 bits (51), Expect = 3e-18
 Identities = 51/51 (100%)
 Strand = Plus / Minus

                                                                
Query: 571   gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
             |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95196 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 95146

---

>emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12
          Length = 1920

 Score =  101 bits (51), Expect = 3e-18
 Identities = 63/67 (94%)
 Strand = Plus / Minus

                                                                        
Query: 555  aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
            |||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 1529 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 1470

                   
Query: 615  gcttggc 621
            |||||||
Sbjct: 1469 gcttggc 1463

---

>gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequence
          Length = 188026

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 65/70 (92%)
 Strand = Plus / Plus

                                                                          
Query: 552    cctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtga 611
              ||||||| |||||||| |||||||||||||| ||||||||||||||||||||||| || |
Sbjct: 183192 cctaggcccgctccccgcggatgcggcgggccagctggatgtccttgggcatgatagtca 183251

                        
Query: 612    cgcgcttggc 621
              ||||||||||
Sbjct: 183252 cgcgcttggc 183261

---

>ref|XM_527253.1| PREDICTED: Pan troglodytes similar to histone 1, H3g (LOC471875),
           mRNA
          Length = 411

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 404 cgctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttg 345

             
Query: 620 gc 621
           ||
Sbjct: 344 gc 343

---

>ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483172), mRNA
          Length = 525

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           |||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 518 cgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 459

             
Query: 620 gc 621
           ||
Sbjct: 458 gc 457

---

>ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483167), mRNA
          Length = 525

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           |||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 518 cgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 459

             
Query: 620 gc 621
           ||
Sbjct: 458 gc 457

---

>ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 1,
           mRNA
          Length = 411

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 407 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 2,
           mRNA
          Length = 546

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 542 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 483

                
Query: 617 ttggc 621
           |||||
Sbjct: 482 ttggc 478

---

>ref|NM_185607.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 407 gcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>ref|NM_185613.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 407 gcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA
          Length = 480

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 419 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 367

---

>gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:97421
           IMAGE:7262697), complete cds
          Length = 461

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 343

---

>gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79343
           IMAGE:7002071), complete cds
          Length = 465

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 343

---

>gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79344
           IMAGE:7002072), complete cds
          Length = 464

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 343

---

>ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618987), partial mRNA
          Length = 521

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 398 cggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 346

---

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                        
Query: 557  gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 1739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1680

                 
Query: 617  ttggc 621
            |||||
Sbjct: 1679 ttggc 1675

---

>ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC613840), partial mRNA
          Length = 547

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 424 cggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 372

---

>ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC523214), mRNA
          Length = 1459

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 915 cggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 863

---

>gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MGC:18559
           IMAGE:4240748), complete cds
          Length = 1124

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 593 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 534

                
Query: 617 ttggc 621
           |||||
Sbjct: 533 ttggc 529

---

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on
            chromosome 6
          Length = 269712

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                 
Query: 569  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
            |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 4826 cggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 4774



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                                
Query: 572    atgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
              |||||||| |||||||||||||||||||||||||| || || ||||||||
Sbjct: 234214 atgcggcgagcgagctggatgtccttgggcatgatagtcactcgcttggc 234263



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                          
Query: 562    ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
              |||||| || ||||||||||| ||||||||||| || ||||||||||| ||||| |||||
Sbjct: 209556 ctccccacgaatgcggcgggcaagctggatgtctttaggcatgatggtcacgcgtttggc 209497



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                          
Query: 562    ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
              |||||| || |||||||| || ||||||||||||||||||||||| || || ||||||||
Sbjct: 180849 ctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgcttggc 180908



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                           
Query: 562    ctcccctcggatgcggcgggcgagctggatgtccttgggcatgat 606
              |||||| || |||||||| |||||||| |||||||||||||||||
Sbjct: 254983 ctccccacgaatgcggcgagcgagctgaatgtccttgggcatgat 255027



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                  
Query: 563   tcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcg 615
             ||||| |||||||| || || |||||||| || ||||||||||||||||||||
Sbjct: 29753 tccccacggatgcgacgtgccagctggatatctttgggcatgatggtgacgcg 29701



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 572   atgcggcgggcgagctggatgtccttgggcat 603
             |||||||| |||||||||||||| ||||||||
Sbjct: 15611 atgcggcgagcgagctggatgtctttgggcat 15642

---

>ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA
          Length = 1124

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 593 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 534

                
Query: 617 ttggc 621
           |||||
Sbjct: 533 ttggc 529

---

>ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA
          Length = 469

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 343

---

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                        
Query: 557  gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 1739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1680

                 
Query: 617  ttggc 621
            |||||
Sbjct: 1679 ttggc 1675

---

>gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete cds
          Length = 1227

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 805 cggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 753

---

>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2
          Length = 2927

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                        
Query: 557  gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
            ||||||||||| |||||||| ||||| | |||||||||||||||||||||||||||||||
Sbjct: 2762 gcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgc 2703

                 
Query: 617  ttggc 621
            |||||
Sbjct: 2702 ttggc 2698

---

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                 
Query: 569  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
            |||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 3029 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 2977

---

>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes
          Length = 3098

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                        
Query: 557  gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 2579 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 2520

                 
Query: 617  ttggc 621
            |||||
Sbjct: 2519 ttggc 2515

---

>emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for histones H3 and H4
          Length = 1504

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                        
Query: 557  gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
            |||||||| || |||||||| ||||| |||||||||||||||||||||||||||||||||
Sbjct: 1157 gcgcgctcgccacggatgcgacgggccagctggatgtccttgggcatgatggtgacgcgc 1098

                 
Query: 617  ttggc 621
            |||||
Sbjct: 1097 ttggc 1093

---

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                   
Query: 569    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
              |||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 143275 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 143223



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                          
Query: 562    ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
              |||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 135597 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 135656



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                          
Query: 562    ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
              |||||| |||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 126426 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 126367

---

>dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
            enriched library, clone:6430517B15
            product:unclassifiable, full insert sequence
          Length = 3217

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Plus

                                                                        
Query: 557  gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 1191 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1250

                 
Query: 617  ttggc 621
            |||||
Sbjct: 1251 ttggc 1255

---

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
              hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
              sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Plus

                                                                   
Query: 569    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
              |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 120175 cggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 120227



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 563   tcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcg 615
             ||||| |||||||| || || |||||||| || ||||||||||||||||||||
Sbjct: 95248 tccccacggatgcgacgtgccagctggatatctttgggcatgatggtgacgcg 95300



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 572    atgcggcgggcgagctggatgtccttgggcat 603
              |||||||| |||||||||||||| ||||||||
Sbjct: 109390 atgcggcgagcgagctggatgtctttgggcat 109359

---

>gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and histone H2b-616
           (H2b-616) genes, complete cds
          Length = 2371

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 987 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 928

                
Query: 617 ttggc 621
           |||||
Sbjct: 927 ttggc 923

---

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                        
Query: 557  gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 2722 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 2663

                 
Query: 617  ttggc 621
            |||||
Sbjct: 2662 ttggc 2658

---

>ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudogene on chromosome 1
          Length = 1411

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                
Query: 617 ttggc 621
           |||||
Sbjct: 847 ttggc 843

---

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 64/69 (92%)
 Strand = Plus / Plus

                                                                          
Query: 553    ctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 612
              |||||| |||||||| |||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 102348 ctaggctcgctccccgcggatgcggcgggccagctggatgtctttgggcatgatggtgac 102407

                       
Query: 613    gcgcttggc 621
               ||||||||
Sbjct: 102408 ccgcttggc 102416

---

>gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MGC:102454
           IMAGE:5099464), complete cds
          Length = 1831

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 608 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 549

                
Query: 617 ttggc 621
           |||||
Sbjct: 548 ttggc 544

---

>dbj|AB185067.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           YFS1
          Length = 480

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 58/61 (95%)
 Strand = Plus / Minus

                                                                       
Query: 559 gcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgctt 618
           |||||| |||||||||||| |||| |||||||||||||||||||||||||||||||||||
Sbjct: 474 gcgctcgcctcggatgcggggggccagctggatgtccttgggcatgatggtgacgcgctt 415

            
Query: 619 g 619
           |
Sbjct: 414 g 414

---

>gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, complete sequence
          Length = 1411

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                
Query: 617 ttggc 621
           |||||
Sbjct: 847 ttggc 843

---

>ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone protein Hist2h3c1
           (LOC310679), mRNA
          Length = 573

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||| ||||| | |||||||||||||||||||||||||||||||
Sbjct: 569 gcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgc 510

                
Query: 617 ttggc 621
           |||||
Sbjct: 509 ttggc 505

---

>gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, complete cds
          Length = 1411

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                
Query: 617 ttggc 621
           |||||
Sbjct: 847 ttggc 843

---

>gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, complete cds
          Length = 1675

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                        
Query: 557  gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 1093 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1034

                 
Query: 617  ttggc 621
            |||||
Sbjct: 1033 ttggc 1029

---

>gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, complete cds
          Length = 1408

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 895 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 843

---

>gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, complete cds
          Length = 1500

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Plus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 514 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 573

                
Query: 617 ttggc 621
           |||||
Sbjct: 574 ttggc 578

---

>emb|Z61129.1|HS45E8R H.sapiens CpG island DNA genomic Mse1 fragment, clone 45e8, reverse
           read cpg45e8.rt1d
          Length = 257

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 157 cggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 105

---

>gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79341
           IMAGE:7002069), complete cds
          Length = 465

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 343

---

>gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79340
           IMAGE:7002068), complete cds
          Length = 465

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 343

---

>gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC:79342
           IMAGE:7002070), complete cds
          Length = 465

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgcttggc 343

---

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                         
Query: 557   gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
             ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 93739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 93680

                  
Query: 617   ttggc 621
             |||||
Sbjct: 93679 ttggc 93675



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                         
Query: 557   gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
             ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 71931 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 71872

                  
Query: 617   ttggc 621
             |||||
Sbjct: 71871 ttggc 71867



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Plus

                                                                         
Query: 557   gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
             ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 63174 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 63233

                  
Query: 617   ttggc 621
             |||||
Sbjct: 63234 ttggc 63238

---

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                         
Query: 557   gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
             ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 37519 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 37460

                  
Query: 617   ttggc 621
             |||||
Sbjct: 37459 ttggc 37455



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Plus

                                                                         
Query: 557   gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
             ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 28762 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 28821

                  
Query: 617   ttggc 621
             |||||
Sbjct: 28822 ttggc 28826



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Plus

                                                                        
Query: 557  gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 6954 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 7013

                 
Query: 617  ttggc 621
            |||||
Sbjct: 7014 ttggc 7018

---

>ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA
          Length = 411

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 407 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds
          Length = 1110

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 746 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 687

                
Query: 617 ttggc 621
           |||||
Sbjct: 686 ttggc 682

---

>ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476), mRNA
          Length = 576

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| |||||||| |||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 575 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 516

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 515 cgcttggc 508

---

>ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA
          Length = 411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 402 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 343

---

>ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618948), mRNA
          Length = 484

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC540148), mRNA
          Length = 484

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC539875), mRNA
          Length = 411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA
          Length = 488

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 433 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 374

---

>ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611519), mRNA
          Length = 471

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 462 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 403

---

>ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488298), mRNA
          Length = 411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488277), mRNA
          Length = 411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488275), mRNA
          Length = 459

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 450 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 391

---

>ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611167), mRNA
          Length = 504

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 495 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 436

---

>ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611138), mRNA
          Length = 411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488307), mRNA
          Length = 411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488263), mRNA
          Length = 411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
             (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
             IgG, high affinity Ia, receptor for (CD64), a novel gene
             similar to histone 2, H2be (HIST2H2BE), a novel gene
             similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
             histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
             HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
             pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
             (HIST2H2BC), a novel gene similar to histone 2, H2aa
             (HIST2H2AA), a novel gene similar to histone 2, H3c
             (HIST2H3C), a novel gene similar to histone 1, H4
             (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
             HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
             histone 2, H2ab, a novel protein similar to histone 2, a
             novel gene, the SV2A gene for synaptic vesicle
             glycoprotein 2A, the 3' end of the SF3B4 gene for splicing
             factor 3b, subunit 4, 49kDa and five CpG islands, complete
             sequence
          Length = 188956

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Plus

                                                                         
Query: 554   taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
             ||||| |||||||| |||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 74987 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 75046

                     
Query: 614   cgcttggc 621
             ||||||||
Sbjct: 75047 cgcttggc 75054



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                          
Query: 560    cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
              ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 114780 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 114721

                
Query: 620    gc 621
              ||
Sbjct: 114720 gc 114719



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                          
Query: 560    cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
              ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 102486 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 102545

                
Query: 620    gc 621
              ||
Sbjct: 102546 gc 102547

---

>emb|X80325.1|MPMPH315 M.pahari mpH315 gene
          Length = 974

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 583 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 524

---

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                          
Query: 562    ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
              |||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 139050 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 138991



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                          
Query: 562    ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
              |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 203959 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 204018

---

>ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, family 2 isoform 2
           (LOC653604), mRNA
          Length = 543

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| |||||||| |||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 542 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 483

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 482 cgcttggc 475

---

>ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (predicted)
           (Hist2h3c2_predicted), mRNA
          Length = 411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           |||||||||||||| |||||||| ||||| | ||||||||||||||||||||||||||||
Sbjct: 410 taggcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacg 351

                   
Query: 614 cgcttggc 621
           || |||||
Sbjct: 350 cgtttggc 343

---

>gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, complete cds
          Length = 1411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 902 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 843

---

>gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, complete cds
          Length = 1408

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 902 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 843

---

>ref|XM_318362.1| Anopheles gambiae str. PEST ENSANGP00000016005
           (ENSANGG00000013516), partial mRNA
          Length = 411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| ||||| || |||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 410 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 351

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 350 cgcttggc 343

---

>ref|XM_314446.2| Anopheles gambiae str. PEST ENSANGP00000016066
           (ENSANGG00000013577), partial mRNA
          Length = 411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| ||||| || ||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 410 taggcacgctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacg 351

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 350 cgcttggc 343

---

>ref|XM_307081.1| Anopheles gambiae str. PEST ENSANGP00000001387
           (ENSANGG00000001186), partial mRNA
          Length = 408

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| ||||| || |||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 407 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 348

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 347 cgcttggc 340

---

>ref|XM_305996.1| Anopheles gambiae str. PEST ENSANGP00000012784
           (ENSANGG00000010295), partial mRNA
          Length = 411

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| ||||| || |||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 410 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 351

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 350 cgcttggc 343

---

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
           histone H2A genes, complete cds
          Length = 4358

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Plus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||||||||| || |||||||||||||| |||||||||||||||||||||||||| || 
Sbjct: 267 taggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcaca 326

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 327 cgcttggc 334

---

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
           genes, complete cds
          Length = 1338

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 63/68 (92%)
 Strand = Plus / Plus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||||||||| || |||||||||||||| |||||||||||||||||||||||||| || 
Sbjct: 201 taggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcaca 260

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 261 cgcttggc 268

---

>gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds
          Length = 693

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 552 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 493

---

>gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds
          Length = 927

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 740 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 681

---

>gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence
          Length = 716

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 571 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           ||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 453 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 403

---

>ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488306), mRNA
          Length = 411

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 56/59 (94%)
 Strand = Plus / Minus

                                                                      
Query: 563 tcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           ||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 401 tccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, complete cds
          Length = 626

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                       
Query: 551 gcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtg 610
           |||||||||||||| || |||||||||||||| ||||||||||||||||||||||| || 
Sbjct: 424 gcctaggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtc 365

                      
Query: 611 acgcgcttggc 621
           || ||||||||
Sbjct: 364 acacgcttggc 354

---

>gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds
          Length = 411

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 571 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           ||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 393 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

---

>gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), complete cds
          Length = 1001

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 571 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           ||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 814 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 764

---

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4
           (ch4-III), histone H2B (ch2b-III) and histone H2A
           (ch2a-III) genes, complete cds
          Length = 4582

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 67/74 (90%)
 Strand = Plus / Plus

                                                                       
Query: 548 gacgcctaggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatg 607
           ||||| ||||| ||||| || |||||||||||||| ||||||||||||||||||||||||
Sbjct: 459 gacgcttaggcacgctcgccacggatgcggcgggccagctggatgtccttgggcatgatg 518

                         
Query: 608 gtgacgcgcttggc 621
           || || ||||||||
Sbjct: 519 gtcacacgcttggc 532

---

>emb|CR733515.2|CNS0GSRE Tetraodon nigroviridis full-length cDNA
          Length = 1545

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||| |||||||||||||| ||||||
Sbjct: 520 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtaacgcgc 461

                
Query: 617 ttggc 621
           |||||
Sbjct: 460 ttggc 456

---

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                        
Query: 557  gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
            |||||||| || |||||||||||| | | |||||||||||||||||||||||||||||||
Sbjct: 2548 gcgcgctcaccacggatgcggcggaccaactggatgtccttgggcatgatggtgacgcgc 2489

                 
Query: 617  ttggc 621
            |||||
Sbjct: 2488 ttggc 2484

---

>emb|X80326.1|MPMPH312 M.pahari mpH312 gene
          Length = 580

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 440 cggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 388

---

>ref|XM_686806.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC563445), mRNA
          Length = 444

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| | |
Sbjct: 440 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 381

                
Query: 617 ttggc 621
           |||||
Sbjct: 380 ttggc 376

---

>ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560897), mRNA
          Length = 471

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| | |
Sbjct: 467 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 408

                
Query: 617 ttggc 621
           |||||
Sbjct: 407 ttggc 403

---

>ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570590), mRNA
          Length = 411

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| | |
Sbjct: 407 gcgcgctctccacggatgcggcgggctagctggatgtccttgggcatgatggtgaccctc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570028), mRNA
          Length = 725

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25,
             complete sequence
          Length = 167326

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Plus

                                                                         
Query: 557   gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
             |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| | |
Sbjct: 79273 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 79332

                  
Query: 617   ttggc 621
             |||||
Sbjct: 79333 ttggc 79337



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                         
Query: 560   cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
             ||||| || |||||||||||||| ||||||||||||||||||||||||||||| | ||||
Sbjct: 99227 cgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttg 99286

               
Query: 620   gc 621
             ||
Sbjct: 99287 gc 99288



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                          
Query: 557    gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
              |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 116388 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 116447

                   
Query: 617    ttggc 621
              |||||
Sbjct: 116448 ttggc 116452



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                         
Query: 557   gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
             |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 85972 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 86031

                  
Query: 617   ttggc 621
             |||||
Sbjct: 86032 ttggc 86036



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                         
Query: 557   gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
             |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 63682 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 63623

                  
Query: 617   ttggc 621
             |||||
Sbjct: 63622 ttggc 63618

---

>ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA
          Length = 535

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 436 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 377

---

>ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618149), mRNA
          Length = 411

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||| |||||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatccggcgggcaagctggatgtctttgggcatgatggtgacgcgcttggc 343

---

>ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616819), mRNA
          Length = 411

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttggc 343

---

>ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616800), mRNA
          Length = 411

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| ||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttggc 343

---

>ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA
          Length = 492

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 430 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 371

---

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                         
Query: 562   ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
             |||||| |||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 99531 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 99590



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                         
Query: 560   cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
             ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 90490 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 90549

               
Query: 620   gc 621
             ||
Sbjct: 90550 gc 90551



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                         
Query: 560   cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
             ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 73416 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 73357

               
Query: 620   gc 621
             ||
Sbjct: 73356 gc 73355



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                         
Query: 562   ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
             |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 59175 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 59234

---

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                        
Query: 562  ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
            |||||| |||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 2135 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 2194

---

>emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene
          Length = 990

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| |||||||||||||| |||||||||||||| ||||||||
Sbjct: 842 ctccccgcggatgcggcgggccagctggatgtccttaggcatgatggtgacacgcttggc 783

---

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                         
Query: 562   ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
             |||||| |||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 16449 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 16390



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                         
Query: 560   cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
             ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 42568 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 42627

               
Query: 620   gc 621
             ||
Sbjct: 42628 gc 42629



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                         
Query: 560   cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
             ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 25490 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 25431

               
Query: 620   gc 621
             ||
Sbjct: 25430 gc 25429



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                         
Query: 562   ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
             |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 56809 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 56750

---

>ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570618), mRNA
          Length = 411

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||||||||| || ||||||||||| || ||||||||||||||||||||||||||||| 
Sbjct: 410 taggcgcgctctccacggatgcggcgagccagctggatgtccttgggcatgatggtgacc 351

                   
Query: 614 cgcttggc 621
           | ||||||
Sbjct: 350 ctcttggc 343

---

>dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700049H14 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 514

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 415 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 356

---

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
           complete cds
          Length = 2321

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 753 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 694

---

>dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700111A06 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 535

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 436 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 377

---

>gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, complete cds
          Length = 1408

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 902 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 843

---

>gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, complete cds
          Length = 1405

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 899 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 840

---

>ref|XM_560604.1| Anopheles gambiae str. PEST ENSANGP00000025641
           (ENSANGG00000024840), partial mRNA
          Length = 411

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| ||||| || || ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 410 taggcacgctctccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacg 351

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 350 cgcttggc 343

---

>ref|XM_320335.2| Anopheles gambiae str. PEST ENSANGP00000014183
           (ENSANGG00000011694), partial mRNA
          Length = 411

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| ||||| || ||||| |||||||| ||||||||||||||||||||||| ||||||
Sbjct: 410 taggcacgctcgccacggatacggcgggccagctggatgtccttgggcatgatcgtgacg 351

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 350 cgcttggc 343

---

>ref|XM_307606.1| Anopheles gambiae str. PEST ENSANGP00000016172
           (ENSANGG00000013683), partial mRNA
          Length = 411

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| ||||| || |||||||| ||||| | ||||||||||||||||||||||||||||
Sbjct: 410 taggcacgctctccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacg 351

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 350 cgcttggc 343

---

>emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3
          Length = 1244

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 754 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 695

---

>gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds
          Length = 1125

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 56/60 (93%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| |||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 754 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 695

---

>gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence
          Length = 663

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 49/51 (96%)
 Strand = Plus / Plus

                                                              
Query: 571 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||||||||||||||||||||||||||||||||||||||| | ||||||
Sbjct: 168 gatgcggcgggcgagctggatgtccttgggcatgatggtgaccctcttggc 218

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 49/51 (96%)
 Strand = Plus / Plus

                                                                   
Query: 571      gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
                ||||||||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 12852353 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgtttggc 12852403



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                                   
Query: 571      gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
                ||||| ||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 12836797 gatgcagcgtgcgagctggatgtccttgggcatgatggtgacgcgtttggc 12836847

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 49/51 (96%)
 Strand = Plus / Plus

                                                                   
Query: 571      gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
                ||||||||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 12806627 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgtttggc 12806677



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                                   
Query: 571      gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
                ||||| ||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 12791071 gatgcagcgtgcgagctggatgtccttgggcatgatggtgacgcgtttggc 12791121

---

>emb|AL844879.5|CNS08CB2 Oryza sativa chromosome 12, . BAC OSJNBa0036H15 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 156724

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                                
Query: 571   gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
             ||||||||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 66874 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgtttggc 66824



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                                
Query: 571   gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
             ||||| ||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 82430 gatgcagcgtgcgagctggatgtccttgggcatgatggtgacgcgtttggc 82380

---

>gb|J00869.1|CHKH3A Chicken histone H3 gene (intronless)
          Length = 411

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 555 aggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 614
           |||||||||| || ||||| ||||| ||||||||||| ||||||||||| ||||||||||
Sbjct: 409 aggcgcgctctccacggatacggcgagcgagctggatatccttgggcataatggtgacgc 350

                  
Query: 615 gcttggc 621
           |||||||
Sbjct: 349 gcttggc 343

---

>gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), complete cds
          Length = 1264

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                              
Query: 571 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           ||||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 918 gatgcggcgcgcgagctgaatgtccttgggcatgatggtgacgcgcttggc 868

---

>ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA
          Length = 1851

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 924 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 865

             
Query: 620 gc 621
           ||
Sbjct: 864 gc 863

---

>gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053006),
           partial cds
          Length = 417

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 402 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 343

             
Query: 620 gc 621
           ||
Sbjct: 342 gc 341

---

>ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA
          Length = 507

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 440 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 381

             
Query: 620 gc 621
           ||
Sbjct: 380 gc 379

---

>gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds
          Length = 1227

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 813 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 754

             
Query: 620 gc 621
           ||
Sbjct: 753 gc 752

---

>ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA
          Length = 411

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 404 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 345

             
Query: 620 gc 621
           ||
Sbjct: 344 gc 343

---

>ref|XM_871486.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
           (LOC619165), partial mRNA
          Length = 552

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           |||||||| ||||||||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 469 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 410

             
Query: 620 gc 621
           ||
Sbjct: 409 gc 408

---

>ref|XM_871460.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
           (LOC619141), partial mRNA
          Length = 552

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           |||||||| ||||||||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 469 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 410

             
Query: 620 gc 621
           ||
Sbjct: 409 gc 408

---

>ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
            (LOC615056), mRNA
          Length = 1029

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                        
Query: 560  cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
            |||||||| ||||||||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 1022 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 963

              
Query: 620  gc 621
            ||
Sbjct: 962  gc 961

---

>ref|XM_866686.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
           (LOC615006), mRNA
          Length = 886

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           |||||||| ||||||||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 803 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 744

             
Query: 620 gc 621
           ||
Sbjct: 743 gc 742

---

>gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123925
           IMAGE:40044771), complete cds
          Length = 1003

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

             
Query: 620 gc 621
           ||
Sbjct: 777 gc 776

---

>gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNING: chimeric clone
           ****
          Length = 1047

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 417 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 358

             
Query: 620 gc 621
           ||
Sbjct: 357 gc 356

---

>gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMAGE:3913365)
          Length = 1672

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 440 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 381

             
Query: 620 gc 621
           ||
Sbjct: 380 gc 379

---

>ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC582332), mRNA
          Length = 411

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 404 cgctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 345

             
Query: 620 gc 621
           ||
Sbjct: 344 gc 343

---

>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4
          Length = 1898

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                              
Query: 572  atgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
            |||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 1495 atgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 1446

---

>ref|XM_780236.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC580163), mRNA
          Length = 363

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||| ||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 356 cgctcgccacggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttg 297

             
Query: 620 gc 621
           ||
Sbjct: 296 gc 295

---

>ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC579977), mRNA
          Length = 411

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||| ||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 404 cgctcgccacggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttg 345

             
Query: 620 gc 621
           ||
Sbjct: 344 gc 343

---

>ref|XM_777897.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC577682), mRNA
          Length = 411

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 404 cgctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 345

             
Query: 620 gc 621
           ||
Sbjct: 344 gc 343

---

>ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560090), mRNA
          Length = 411

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| ||||||||||||||||||||||||||||| | ||||
Sbjct: 404 cgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttg 345

             
Query: 620 gc 621
           ||
Sbjct: 344 gc 343

---

>ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (LOC653611), mRNA
          Length = 824

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 693 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 634

             
Query: 620 gc 621
           ||
Sbjct: 633 gc 632

---

>dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310069A13 product:HISTONE H3-VI homolog
           [Gallus gallus], full insert sequence
          Length = 852

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 426 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 367

             
Query: 620 gc 621
           ||
Sbjct: 366 gc 365

---

>gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, complete cds
          Length = 1100

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 890 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 831

             
Query: 620 gc 621
           ||
Sbjct: 830 gc 829

---

>ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudogene on chromosome 1
          Length = 1323

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 927 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 868

             
Query: 620 gc 621
           ||
Sbjct: 867 gc 866

---

>ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA
          Length = 411

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 404 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 345

             
Query: 620 gc 621
           ||
Sbjct: 344 gc 343

---

>gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE:30915509),
           partial cds
          Length = 481

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 432 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 373

             
Query: 620 gc 621
           ||
Sbjct: 372 gc 371

---

>gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete cds
          Length = 1227

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 813 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 754

             
Query: 620 gc 621
           ||
Sbjct: 753 gc 752

---

>gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, complete sequence
          Length = 1323

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 927 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 868

             
Query: 620 gc 621
           ||
Sbjct: 867 gc 866

---

>gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, complete cds
          Length = 1408

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 904 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 845

             
Query: 620 gc 621
           ||
Sbjct: 844 gc 843

---

>gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, complete cds
          Length = 1851

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 924 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 865

             
Query: 620 gc 621
           ||
Sbjct: 864 gc 863

---

>ref|XM_314445.2| Anopheles gambiae str. PEST ENSANGP00000016056
           (ENSANGG00000013567), partial mRNA
          Length = 411

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| ||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 404 cgctctccacggatacggcgagccagctggatgtccttgggcatgatggtgacgcgcttg 345

             
Query: 620 gc 621
           ||
Sbjct: 344 gc 343

---

>emb|Z56112.1|HS89C12R H.sapiens CpG island DNA genomic Mse1 fragment, clone 89c12,
           reverse read cpg89c12.rt1a
          Length = 172

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 5   cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 64

             
Query: 620 gc 621
           ||
Sbjct: 65  gc 66

---

>emb|Z56111.1|HS89C12F H.sapiens CpG island DNA genomic Mse1 fragment, clone 89c12,
           forward read cpg89c12.ft1a
          Length = 171

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 168 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 109

             
Query: 620 gc 621
           ||
Sbjct: 108 gc 107

---

>emb|Z63365.1|HS81H7R H.sapiens CpG island DNA genomic Mse1 fragment, clone 81h7, reverse
           read cpg81h7.rt1a
          Length = 171

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 5   cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 64

             
Query: 620 gc 621
           ||
Sbjct: 65  gc 66

---

>gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123923
           IMAGE:40044769), complete cds
          Length = 1004

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

             
Query: 620 gc 621
           ||
Sbjct: 777 gc 776

---

>gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123922
           IMAGE:40044765), complete cds
          Length = 1004

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

             
Query: 620 gc 621
           ||
Sbjct: 777 gc 776

---

>gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123924
           IMAGE:40044770), complete cds
          Length = 1004

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

             
Query: 620 gc 621
           ||
Sbjct: 777 gc 776

---

>emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3
          Length = 702

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 555 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 496

             
Query: 620 gc 621
           ||
Sbjct: 495 gc 494

---

>gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds
          Length = 982

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 560 cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 812 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 753

             
Query: 620 gc 621
           ||
Sbjct: 752 gc 751

---

>gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H3 and H4 genes
          Length = 2133

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                        
Query: 560  cgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 619
            ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 1917 cgctcgccacggatacggcgggcaagctggatgtccttgggcatgatggtgacacgcttg 1858

              
Query: 620  gc 621
            ||
Sbjct: 1857 gc 1856

---

>gb|BC054666.1| Danio rerio zgc:66241, mRNA (cDNA clone MGC:66241 IMAGE:3818929),
           complete cds
          Length = 2172

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 419 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgactctc 360

                
Query: 617 ttggc 621
           |||||
Sbjct: 359 ttggc 355

---

>gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds
          Length = 411

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           ||||||||||| |||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 395 cggatgcggcgagcgagctgaatgtccttgggcatgatggtgacacgcttggc 343

---

>ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC581030), mRNA
          Length = 411

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 569 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           ||||| |||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 395 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 343

---

>ref|NM_199745.1| Danio rerio zgc:66241 (zgc:66241), mRNA
          Length = 2172

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 419 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgactctc 360

                
Query: 617 ttggc 621
           |||||
Sbjct: 359 ttggc 355

---

>ref|XM_686609.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC563243), mRNA
          Length = 411

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgactctc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC561114), mRNA
          Length = 411

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560616), mRNA
          Length = 411

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC559765), mRNA
          Length = 411

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>ref|XM_694212.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570703), mRNA
          Length = 411

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570644), mRNA
          Length = 411

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>ref|XM_701573.1| PREDICTED: Danio rerio similar to CG31613-PA, transcript variant 2
           (LOC556568), mRNA
          Length = 411

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgactctc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>ref|XM_688339.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC565028), mRNA
          Length = 411

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 616
           |||||||| || |||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                
Query: 617 ttggc 621
           |||||
Sbjct: 347 ttggc 343

---

>gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053019),
           partial cds
          Length = 415

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 398 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 339

---

>ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA
          Length = 411

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 402 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 343

---

>gb|BC097060.1| Danio rerio zgc:113984, mRNA (cDNA clone MGC:113984 IMAGE:7448238),
           complete cds
          Length = 1814

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 612
           |||||||| || |||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 434 gcgcgctctccgcggatgcggcgggccagctgaatgtccttgggcatgatggtgac 379

---

>emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N21 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme HBUCE1 pseudogene, the FCGR1C
             gene for Fc fragment of IgG high affinity Ic receptor for
             (CD64), two novel genes, the HIST2H2BA gene for histone 2
             H2ba, the gene for a novel protein similar to histone 2
             H3c (HIST2H3C), a novel gene, a ribosomal protein L22
             (RPL22) pseudogene, a novel gene and three CpG islands,
             complete sequence
          Length = 129426

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 61/68 (89%)
 Strand = Plus / Plus

                                                                         
Query: 554   taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
             ||||| |||||||| |||||||||| | | | |||||||||||||||||||||||| |||
Sbjct: 69914 taggcccgctccccgcggatgcggctgaccaactggatgtccttgggcatgatggtcacg 69973

                     
Query: 614   cgcttggc 621
             ||||||||
Sbjct: 69974 cgcttggc 69981

---

>emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3, CD-1
          Length = 287

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 168 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 109

---

>emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant
          Length = 772

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| ||||| || |||||||| | ||| |||||||||||||||||||| |||||||||
Sbjct: 507 taggcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacg 448

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 447 cgcttggc 440

---

>ref|NM_001025176.3| Danio rerio zgc:113984 (zgc:113984), mRNA
          Length = 1814

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 612
           |||||||| || |||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 434 gcgcgctctccgcggatgcggcgggccagctgaatgtccttgggcatgatggtgac 379

---

>ref|NM_001025303.1| Homo sapiens similar to histone H2B histone family (LOC440686),
           mRNA
          Length = 411

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| |||||||| |||||||||| | | | |||||||||||||||||||||||| |||
Sbjct: 410 taggcccgctccccgcggatgcggctgaccaactggatgtccttgggcatgatggtcacg 351

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 350 cgcttggc 343

---

>gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA
          Length = 824

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| ||||| || |||||||| | ||| |||||||||||||||||||| |||||||||
Sbjct: 572 taggcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacg 513

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 512 cgcttggc 505

---

>ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA, transcript variant
           A (His3.3A), mRNA
          Length = 853

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| ||||| || |||||||| | ||| |||||||||||||||||||| |||||||||
Sbjct: 611 taggcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacg 552

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 551 cgcttggc 544

---

>gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA
          Length = 824

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 554 taggcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 613
           ||||| ||||| || |||||||| | ||| |||||||||||||||||||| |||||||||
Sbjct: 572 taggcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacg 513

                   
Query: 614 cgcttggc 621
           ||||||||
Sbjct: 512 cgcttggc 505

---

>dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F730210F11
           product:histone 1, H3h, full insert sequence
          Length = 1806

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 562 ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
           |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 430 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 371

---

>ref|XM_688063.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC564732), mRNA
          Length = 441

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 52/56 (92%)
 Strand = Plus / Minus

                                                                   
Query: 557 gcgcgctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 612
           |||||||| || |||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 437 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgac 382

---

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                        
Query: 562  ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
            |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 2003 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 1944

---

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                        
Query: 562  ctcccctcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 621
            |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 2001 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 1942


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,969,141
Number of Sequences: 3902068
Number of extensions: 5969141
Number of successful extensions: 122277
Number of sequences better than 10.0: 1155
Number of HSP's better than 10.0 without gapping: 1156
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 120267
Number of HSP's gapped (non-prelim): 2010
length of query: 622
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 599
effective length of database: 17,143,297,704
effective search space: 10268835324696
effective search space used: 10268835324696
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---