Clone Information

BLAST Search Result

Clone Name	rbags30n03
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|BT009488.1\| Triticum aestivum clone wr1.pk0058.g3:fis, full i...	511	e-142
2	gb\|AC108500.3\| Oryza sativa (japonica cultivar-group) chromosome...	488	e-134
3	gb\|AC108876.2\| Oryza sativa (japonica cultivar-group) chromosome...	488	e-134
4	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	488	e-134
5	dbj\|AK105816.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	488	e-134
6	ref\|XM_475383.1\| Oryza sativa (japonica cultivar-group), predic...	484	e-133
7	emb\|X00043.1\|TAHI01 Wheat histone H4 gene	484	e-133
8	gb\|AC121361.3\| Oryza sativa (japonica cultivar-group) chromosome...	480	e-132
9	gb\|AC108503.4\| Oryza sativa (japonica cultivar-group) chromosome...	480	e-132
10	dbj\|AK119240.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	480	e-132
11	ref\|XM_475394.1\| Oryza sativa (japonica cultivar-group), predic...	476	e-131
12	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	468	e-128
13	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	468	e-128
14	gb\|AC118980.2\| Oryza sativa (japonica cultivar-group) chromosome...	468	e-128
15	dbj\|AK058741.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	468	e-128
16	ref\|NM_187563.1\| Oryza sativa (japonica cultivar-group), predic...	460	e-126
17	ref\|NM_185758.1\| Oryza sativa (japonica cultivar-group), mRNA	448	e-123
18	dbj\|AP008215.1\| Oryza sativa (japonica cultivar-group) genomic D...	448	e-123
19	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	448	e-123
20	dbj\|AP004401.5\| Oryza sativa (japonica cultivar-group) genomic D...	448	e-123
21	dbj\|AP005551.3\| Oryza sativa (japonica cultivar-group) genomic D...	448	e-123
22	dbj\|AK058686.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	448	e-123
23	emb\|X79715.1\|LTMRHISH4 L.temulentum mRNA for histone H4	444	e-121
24	ref\|XM_473659.1\| Oryza sativa (japonica cultivar-group), predic...	432	e-118
25	emb\|AL662987.3\|OSJN00188 Oryza sativa genomic DNA, chromosome 4,...	432	e-118
26	dbj\|AP008210.1\| Oryza sativa (japonica cultivar-group) genomic D...	432	e-118
27	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	432	e-118
28	dbj\|AP003271.3\| Oryza sativa (japonica cultivar-group) genomic D...	432	e-118
29	dbj\|AK059019.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	432	e-118
30	dbj\|AK058436.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	432	e-118
31	ref\|XM_467181.1\| Oryza sativa (japonica cultivar-group), mRNA	428	e-117
32	ref\|NM_190485.1\| Oryza sativa (japonica cultivar-group), predic...	428	e-117
33	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	428	e-117
34	dbj\|AP004255.3\| Oryza sativa (japonica cultivar-group) genomic D...	428	e-117
35	dbj\|AP004071.3\| Oryza sativa (japonica cultivar-group) genomic D...	428	e-117
36	gb\|M12277.1\|WHTH4091 Wheat histone H4 TH091 gene, complete cds	428	e-117
37	gb\|BT017776.1\| Zea mays clone EL01N0503B03.c mRNA sequence	424	e-115
38	gb\|M13370.1\|MZEH4C14 Maize (Zea mays) histone H4 gene (H4C14), c...	422	e-115
39	gb\|AC137596.2\| Oryza sativa (japonica cultivar-group) chromosome...	416	e-113
40	dbj\|AP005564.2\| Oryza sativa (japonica cultivar-group) genomic D...	416	e-113
41	ref\|NM_197569.1\| Oryza sativa (japonica cultivar-group) histone ...	414	e-112
42	gb\|AC096782.6\| Oryza sativa chromosome 10 BAC OSJNBa0025B05 geno...	414	e-112
43	gb\|AC073166.7\| Oryza sativa chromosome 10 BAC OSJNBb0064P21 geno...	414	e-112
44	dbj\|AP008216.1\| Oryza sativa (japonica cultivar-group) genomic D...	414	e-112
45	dbj\|AK119699.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	414	e-112
46	dbj\|AK059098.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	414	e-112
47	gb\|AE016959.3\| Oryza sativa (japonica cultivar-group) chromosome...	414	e-112
48	gb\|M13377.1\|MZEH4C7 Maize (Zea mays) histone H4 gene (H4C7), com...	402	e-109
49	gb\|M36659.1\|MZEH4A Corn histone H4 (H4C13) gene, complete cds	402	e-109
50	ref\|XM_849156.1\| PREDICTED: Canis familiaris similar to germinal...	400	e-108
51	gb\|U37575.1\|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H...	400	e-108
52	ref\|NM_001037845.1\| Gallus gallus germinal histone H4 gene (LOC4...	400	e-108
53	ref\|NM_001037843.1\| Gallus gallus similar to germinal histone H4...	400	e-108
54	gb\|M74534.1\|CHKHIST4B Chicken histone H4 protein gene, complete cds	400	e-108
55	emb\|X14732.1\|CMHIST34 Duck H3 and H4 histone genes	398	e-108
56	ref\|XM_425463.1\| PREDICTED: Gallus gallus similar to germinal hi...	396	e-107
57	ref\|XM_416192.1\| PREDICTED: Gallus gallus similar to germinal hi...	396	e-107
58	ref\|XM_849188.1\| PREDICTED: Canis familiaris similar to germinal...	396	e-107
59	ref\|XM_849161.1\| PREDICTED: Canis familiaris similar to germinal...	396	e-107
60	ref\|XM_848746.1\| PREDICTED: Canis familiaris similar to germinal...	396	e-107
61	ref\|XM_545382.1\| PREDICTED: Canis familiaris similar to germinal...	396	e-107
62	emb\|X02218.1\|GGHIS1 Chicken duplicated genes for histone H2A, H4...	396	e-107
63	ref\|XM_425458.1\| PREDICTED: Gallus gallus similar to germinal hi...	392	e-106
64	gb\|M74533.1\|CHKHIST4A Chicken histone H4 protein gene, complete cds	392	e-106
65	ref\|XM_848870.1\| PREDICTED: Canis familiaris similar to germinal...	389	e-105
66	ref\|XM_416193.1\| PREDICTED: Gallus gallus similar to histone pro...	387	e-104
67	ref\|XM_545387.2\| PREDICTED: Canis familiaris similar to germinal...	387	e-104
68	gb\|BT018251.1\| Zea mays clone EL01N0563H01.c mRNA sequence	385	e-103
69	gb\|U37576.1\|GGU37576 Gallus gallus histone H4-VIII gene, complet...	381	e-102
70	emb\|X84376.1\|ZMHIS4DNA Z.mays histone H4 gene	379	e-102
71	ref\|XM_848792.1\| PREDICTED: Canis familiaris similar to germinal...	377	e-101
72	ref\|XM_849000.1\| PREDICTED: Canis familiaris similar to germinal...	371	2e-99
73	ref\|XM_848834.1\| PREDICTED: Canis familiaris similar to germinal...	365	1e-97
74	emb\|Y12290.1\|MMHIST431 M.musculus genes encoding histone H4, his...	363	4e-97
75	emb\|AL590388.4\| Mouse DNA sequence from clone RP23-480B19 on chr...	363	4e-97
76	gb\|U62672.1\|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist...	363	4e-97
77	gb\|AY158965.1\| Mus musculus histone protein Hist1h4a gene, compl...	363	4e-97
78	ref\|NM_178192.1\| Mus musculus histone 1, H4a (Hist1h4a), mRNA	361	2e-96
79	gb\|J00866.1\|CHKH43D8 Chicken histone H4 gene, clone pch3dr8	357	3e-95
80	ref\|NM_178193.1\| Mus musculus histone 1, H4b (Hist1h4b), mRNA	351	2e-93
81	gb\|AY158964.1\| Mus musculus histone protein Hist1h4b gene, compl...	351	2e-93
82	dbj\|AK016310.1\| Mus musculus adult male testis cDNA, RIKEN full-...	349	6e-93
83	gb\|DQ213262.1\| Taeniopygia guttata clone 0061P0011F09 histone 1 ...	347	3e-92
84	ref\|NM_153173.1\| Mus musculus histone 1, H4h (Hist1h4h), mRNA	347	3e-92
85	gb\|BC058529.1\| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA...	347	3e-92
86	gb\|BC028550.1\| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA...	347	3e-92
87	gb\|AC034285.6\| Mus musculus chromosome 13, clone RP23-220G21, co...	347	3e-92
88	emb\|AL592149.8\| Mouse DNA sequence from clone RP23-283N14 on chr...	347	3e-92
89	emb\|AL589879.21\| Mouse DNA sequence from clone RP23-38E20 on chr...	347	3e-92
90	gb\|BC087952.1\| Mus musculus histone 1, H4h, mRNA (cDNA clone MGC...	347	3e-92
91	dbj\|AK007642.1\| Mus musculus 10 day old male pancreas cDNA, RIKE...	347	3e-92
92	gb\|AY158960.1\| Mus musculus histone protein Hist1h4h gene, compl...	347	3e-92
93	gb\|AY158958.1\| Mus musculus histone protein Hist1h4m gene, compl...	347	3e-92
94	ref\|NM_175657.1\| Mus musculus histone 1, H4m (Hist1h4m), mRNA	345	1e-91
95	gb\|AY158961.1\| Mus musculus histone protein Hist1h4f gene, compl...	337	2e-89
96	ref\|NM_175655.1\| Mus musculus histone 1, H4f (Hist1h4f), mRNA	333	4e-88
97	emb\|AL589651.8\| Mouse DNA sequence from clone RP23-138F20 on chr...	331	2e-87
98	dbj\|AK139521.1\| Mus musculus 2 cells egg cDNA, RIKEN full-length...	331	2e-87
99	gb\|BC096767.1\| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG...	331	2e-87
100	gb\|AY158957.1\| Mus musculus histone protein Hist1h4k gene, compl...	331	2e-87
101	ref\|NM_178211.1\| Mus musculus histone 1, H4k (Hist1h4k), mRNA	331	2e-87
102	gb\|BT017111.1\| Zea mays clone EL01N0363F03.c mRNA sequence	329	6e-87
103	gb\|BC019757.1\| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG...	327	2e-86
104	emb\|X13235.1\|MMHIS412 Mouse histone H4 gene (clone 12)	325	9e-86
105	ref\|NM_178210.1\| Mus musculus histone 1, H4j (Hist1h4j), mRNA	323	4e-85
106	gb\|AY158956.1\| Mus musculus histone protein Hist1h4j gene, compl...	323	4e-85
107	emb\|X13236.1\|MMHIS453 Mouse histone H4 gene	323	4e-85
108	gb\|BT017112.1\| Zea mays clone EL01N0363G04.c mRNA sequence	321	1e-84
109	gb\|BC052219.1\| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC...	319	6e-84
110	emb\|AL590614.8\| Mouse DNA sequence from clone RP23-9O16 on chrom...	319	6e-84
111	gb\|BC092144.1\| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC...	319	6e-84
112	ref\|NM_175656.2\| Mus musculus histone 1, H4i (Hist1h4i), mRNA	319	6e-84
113	gb\|AY158959.1\| Mus musculus histone protein Hist1h4i gene, compl...	319	6e-84
114	dbj\|AK010085.1\| Mus musculus adult male tongue cDNA, RIKEN full-...	315	9e-83
115	ref\|XM_341530.2\| PREDICTED: Rattus norvegicus histone 1, H2bm (p...	315	9e-83
116	gb\|AY158962.1\| Mus musculus histone protein Hist1h4d gene, compl...	315	9e-83
117	gb\|U16825.1\|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I...	315	9e-83
118	gb\|U16725.1\|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I...	315	9e-83
119	ref\|NM_175654.1\| Mus musculus histone 1, H4d (Hist1h4d), mRNA	313	4e-82
120	dbj\|AK011560.1\| Mus musculus 10 days embryo whole body cDNA, RIK...	311	1e-81
121	gb\|AY105603.1\| Zea mays PCO094685 mRNA sequence	311	1e-81
122	gb\|L41841.1\|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	307	2e-80
123	gb\|U16724.1\|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	307	2e-80
124	emb\|CR707537.2\|CNS0G8VX Tetraodon nigroviridis full-length cDNA	303	3e-79
125	ref\|XM_543797.1\| PREDICTED: Canis familiaris similar to germinal...	301	1e-78
126	emb\|CR719166.2\|CNS0GHUS Tetraodon nigroviridis full-length cDNA	301	1e-78
127	gb\|AY263810.1\| Eucalyptus globulus histone H4 mRNA, complete cds	301	1e-78
128	gb\|AY158963.1\| Mus musculus histone protein Hist1h4c gene, compl...	301	1e-78
129	ref\|NM_178208.1\| Mus musculus histone 1, H4c (Hist1h4c), mRNA	295	8e-77
130	gb\|AF140034.1\|AF140034 Phreatamoeba balamuthi histone H4 mRNA, c...	293	3e-76
131	gb\|BC100619.1\| Rattus norvegicus germinal histone H4 gene, mRNA ...	289	5e-75
132	ref\|NM_022686.2\| Rattus norvegicus germinal histone H4 gene (His...	289	5e-75
133	gb\|AY936209.1\| Rattus norvegicus histone H4 variant H4-v.1 mRNA,...	289	5e-75
134	emb\|AJ249813.1\|MAL249813 Mortierella alpina histone H3.2 and H4....	287	2e-74
135	gb\|BC114196.1\| Bos taurus histone H4, mRNA (cDNA clone IMAGE:818...	287	2e-74
136	dbj\|AB179406.1\| Macaca fascicularis testis cDNA clone: QtsA-1932...	287	2e-74
137	ref\|XM_868981.1\| PREDICTED: Bos taurus similar to germinal histo...	285	8e-74
138	gb\|BC062345.1\| Homo sapiens cDNA clone IMAGE:6597408	281	1e-72
139	ref\|NG_000009.2\| Homo sapiens small histone family cluster (HFS@...	281	1e-72
140	gb\|AY128664.1\| Homo sapiens clone HIST1H4K histone H4 gene, comp...	281	1e-72
141	gb\|AY128663.1\| Homo sapiens clone HIST1H4J histone H4 gene, comp...	281	1e-72
142	emb\|CR657174.2\|CNS0F61O Tetraodon nigroviridis full-length cDNA	281	1e-72
143	emb\|AL049822.30\|HSJ160A22 Human DNA sequence from clone RP1-160A...	281	1e-72
144	emb\|X60484.1\|HSH4EHIS H.sapiens H4/e gene for H4 histone	281	1e-72
145	emb\|X60483.1\|HSH4DHIS H.sapiens H4/d gene for H4 histone	281	1e-72
146	gb\|BC017361.2\| Homo sapiens cDNA clone MGC:29783 IMAGE:4647914, ...	281	1e-72
147	gb\|AF086564.1\|HUMZE16D01 Homo sapiens full length insert cDNA cl...	281	1e-72
148	ref\|NM_021968.3\| Homo sapiens histone 1, H4j (HIST1H4J), mRNA	280	5e-72
149	ref\|NM_003541.2\| Homo sapiens histone 1, H4k (HIST1H4K), mRNA	280	5e-72
150	gb\|DQ400915.1\| Elaeis guineensis histone 4 mRNA, complete cds	280	5e-72
151	ref\|XM_606749.2\| PREDICTED: Bos taurus similar to germinal histo...	278	2e-71
152	gb\|BC016336.1\| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC...	274	3e-70
153	gb\|AY128662.1\| Homo sapiens clone HIST1H4I histone H4 gene, comp...	274	3e-70
154	gb\|BC075806.1\| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC...	274	3e-70
155	gb\|BC066250.1\| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC...	274	3e-70
156	emb\|AL021807.2\|HS86C11 Human DNA sequence from clone RP1-86C11 o...	274	3e-70
157	emb\|CR599017.1\| full-length cDNA clone CS0DC001YE12 of Neuroblas...	274	3e-70
158	gb\|BC067497.1\| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC...	274	3e-70
159	ref\|NG_000827.2\| Homo sapiens genomic histone family microcluste...	274	3e-70
160	ref\|NM_003495.2\| Homo sapiens histone 1, H4i (HIST1H4I), mRNA	274	3e-70
161	dbj\|AB000905.1\| Homo sapiens DNA for H4 histone, complete cds	274	3e-70
162	ref\|XM_976380.1\| PREDICTED: Mus musculus similar to germinal his...	270	5e-69
163	gb\|AC122804.4\| Mus musculus BAC clone RP23-296J10 from 6, comple...	270	5e-69
164	gb\|AY158967.1\| Mus musculus histone protein Hist4h4 gene, comple...	270	5e-69
165	gb\|BC111813.1\| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG...	270	5e-69
166	ref\|NM_175652.1\| Mus musculus histone 4, H4 (Hist4h4), mRNA	270	5e-69
167	gb\|BC067496.1\| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC...	266	7e-68
168	emb\|BX061454.1\|CNS09JKY Single read from an extremity of a full-...	264	3e-67
169	emb\|BX057867.1\|CNS09GTB Single read from an extremity of a full-...	264	3e-67
170	emb\|BX053174.1\|CNS09D6Y Single read from an extremity of a full-...	264	3e-67
171	emb\|BX048034.1\|CNS09986 Single read from an extremity of a full-...	264	3e-67
172	emb\|BX037780.1\|CNS091BC Single read from an extremity of a full-...	264	3e-67
173	emb\|BX037779.1\|CNS091BB Single read from an extremity of a full-...	264	3e-67
174	emb\|BX020583.1\|CNS08O1N Single read from an extremity of a full-...	264	3e-67
175	emb\|BX009114.1\|CNS08F72 Single read from an extremity of a full-...	264	3e-67
176	ref\|XM_306825.2\| Anopheles gambiae str. PEST ENSANGP00000000125 ...	264	3e-67
177	emb\|X02916.1\|SGH4H2B Rainbow trout histone H4 and H2B genes	262	1e-66
178	gb\|M27433.1\|RATHIS4G Rattus norvegicus histone H4 gene, complete...	260	5e-66
179	gb\|M28409.1\|RATH1TH4T Rat testis-specific histone H1t and histon...	260	5e-66
180	ref\|XM_518300.1\| PREDICTED: Pan troglodytes similar to Histone H...	258	2e-65
181	ref\|NG_001335.1\| Homo sapiens genomic large histone family clust...	258	2e-65
182	ref\|NM_003538.3\| Homo sapiens histone 1, H4a (HIST1H4A), mRNA	258	2e-65
183	gb\|AY128654.1\| Homo sapiens clone HIST1H4A histone H4 gene, comp...	258	2e-65
184	gb\|U91328.1\|HSU91328 Human hereditary haemochromatosis region, h...	258	2e-65
185	gb\|BC069654.1\| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC...	258	2e-65
186	gb\|BC067495.1\| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC...	258	2e-65
187	ref\|XM_225382.1\| PREDICTED: Rattus norvegicus histone 1, H4m (pr...	258	2e-65
188	gb\|BC066248.1\| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC...	258	2e-65
189	gb\|BC066249.1\| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC...	258	2e-65
190	emb\|BX047092.1\|CNS098I0 Single read from an extremity of a full-...	256	7e-65
191	emb\|BX039313.1\|CNS092HX Single read from an extremity of a full-...	256	7e-65
192	emb\|BX032921.1\|CNS08XKD Single read from an extremity of a full-...	256	7e-65
193	dbj\|AK045187.1\| Mus musculus 9.5 days embryo parthenogenote cDNA...	256	7e-65
194	ref\|XM_311439.2\| Anopheles gambiae str. PEST ENSANGP00000018626 ...	256	7e-65
195	gb\|AF457966.1\| Zea mays clone cho1c.pk003.e4, mRNA sequence	254	3e-64
196	emb\|CR657322.2\|CNS0F65S Tetraodon nigroviridis full-length cDNA	252	1e-63
197	gb\|BC057955.1\| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA...	252	1e-63
198	emb\|V00753.1\|MMHI01 Mouse gene encoding the mouse histone H4	252	1e-63
199	ref\|NM_033596.1\| Mus musculus histone 2, H4 (Hist2h4), mRNA	252	1e-63
200	gb\|AY158966.1\| Mus musculus histone protein Hist2h4 gene, comple...	252	1e-63
201	gb\|AC093350.15\| Mus musculus chromosome 3, clone RP23-16G3, comp...	252	1e-63
202	gb\|AC125099.3\| Mus musculus BAC clone RP24-201C14 from 3, comple...	252	1e-63
203	gb\|BC051566.1\| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG...	252	1e-63
204	gb\|AY389612.1\| Hyacinthus orientalis unknown mRNA	250	4e-63
205	emb\|AJ249812.1\|MAL249812 Mortierella alpina H3.1 and H4.1 genes ...	250	4e-63
206	emb\|BX052400.1\|CNS09CLG Single read from an extremity of a full-...	250	4e-63
207	emb\|X60481.1\|HSH4AHIS H.sapiens H4/a gene for H4 histone	250	4e-63
208	emb\|BX066856.1\|CNS09NR0 Single read from an extremity of a full-...	248	2e-62
209	emb\|BX060419.1\|CNS09IS7 Single read from an extremity of a full-...	248	2e-62
210	emb\|BX053099.1\|CNS09D4V Single read from an extremity of a full-...	248	2e-62
211	emb\|BX036322.1\|CNS0906U Single read from an extremity of a full-...	248	2e-62
212	gb\|AE016818.1\| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	248	2e-62
213	ref\|NM_210226.1\| Eremothecium gossypii AER012Cp (AER012C), mRNA	248	2e-62
214	ref\|XM_545396.2\| PREDICTED: Canis familiaris similar to germinal...	246	7e-62
215	emb\|BX061529.1\|CNS09JN1 Single read from an extremity of a full-...	246	7e-62
216	emb\|BX047203.1\|CNS098L3 Single read from an extremity of a full-...	246	7e-62
217	emb\|BX053377.1\|CNS09DCL Single read from an extremity of a full-...	242	1e-60
218	emb\|BX053210.1\|CNS09D7Y Single read from an extremity of a full-...	242	1e-60
219	emb\|X00091.1\|HSHISH4 Human histone H4 gene	242	1e-60
220	emb\|BX061455.1\|CNS09JKZ Single read from an extremity of a full-...	240	4e-60
221	emb\|BX043671.1\|CNS095UZ Single read from an extremity of a full-...	240	4e-60
222	emb\|BX054530.1\|CNS09E8M Single read from an extremity of a full-...	238	2e-59
223	ref\|XM_227462.3\| PREDICTED: Rattus norvegicus histone 2, H4 (pre...	236	7e-59
224	emb\|BX041120.1\|CNS093W4 Single read from an extremity of a full-...	234	3e-58
225	emb\|BX061530.1\|CNS09JN2 Single read from an extremity of a full-...	232	1e-57
226	emb\|CR542172.1\| Homo sapiens full open reading frame cDNA clone ...	232	1e-57
227	dbj\|AK133404.1\| Mus musculus adult male testis cDNA, RIKEN full-...	232	1e-57
228	ref\|XM_601250.2\| PREDICTED: Bos taurus similar to germinal histo...	230	4e-57
229	emb\|BX047204.1\|CNS098L4 Single read from an extremity of a full-...	226	6e-56
230	gb\|DQ066258.1\| Ixodes scapularis isolate ISN-L-157 hist1h4i prot...	226	6e-56
231	gb\|BC019846.1\| Homo sapiens cDNA clone IMAGE:5113140	224	3e-55
232	ref\|NM_003548.2\| Homo sapiens histone 2, H4 (HIST2H4), mRNA	224	3e-55
233	ref\|XM_513765.1\| PREDICTED: Pan troglodytes LOC457262 (LOC457262...	224	3e-55
234	ref\|NM_001034077.3\| Homo sapiens histone H4/o (H4/o), mRNA	224	3e-55
235	gb\|AF525682.1\| Homo sapiens histone H4 (HIST2H4) gene, complete cds	224	3e-55
236	gb\|BC112193.1\| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:1...	224	3e-55
237	emb\|AL591493.14\| Human DNA sequence from clone RP11-196G18 on ch...	224	3e-55
238	emb\|BX057868.1\|CNS09GTC Single read from an extremity of a full-...	224	3e-55
239	emb\|X06963.1\|VCHIS34 Volvox carteri H3-I and H4-I genes for hist...	224	3e-55
240	ref\|XM_942850.1\| PREDICTED: Homo sapiens similar to germinal his...	224	3e-55
241	ref\|XM_942844.1\| PREDICTED: Homo sapiens similar to germinal his...	224	3e-55
242	ref\|XM_942841.1\| PREDICTED: Homo sapiens similar to germinal his...	224	3e-55
243	ref\|XM_936503.1\| PREDICTED: Homo sapiens similar to germinal his...	224	3e-55
244	gb\|BC093969.1\| Homo sapiens histone 2, H4, mRNA (cDNA clone MGC:...	224	3e-55
245	gb\|AY893103.1\| Synthetic construct Homo sapiens clone FLH141156....	224	3e-55
246	gb\|AY890621.1\| Synthetic construct Homo sapiens clone FLH141160....	224	3e-55
247	gb\|BC108260.1\| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:1...	224	3e-55
248	dbj\|AB197150.1\| Fragaria x ananassa mRNA for histone H4, partial...	222	1e-54
249	emb\|Z46226.1\|HTHISH4 H.tubulosa gene encoding histone H4	222	1e-54
250	ref\|XM_703205.1\| PREDICTED: Danio rerio similar to germinal hist...	220	4e-54
251	ref\|NM_214550.1\| Strongylocentrotus purpuratus late histone gene...	220	4e-54
252	emb\|X06641.1\|SPH4L2 Strongylocentrotus purpuratus late histone g...	220	4e-54
253	emb\|X06639.1\|SPH4L1 Strongylocentrotus purpuratus late histone g...	218	2e-53
254	gb\|J01175.1\|SULHISL34 Sea urchin (L.pictus) late-stage histone H...	218	2e-53
255	emb\|BX032922.1\|CNS08XKE Single read from an extremity of a full-...	216	6e-53
256	dbj\|AK016178.1\| Mus musculus adult male testis cDNA, RIKEN full-...	216	6e-53
257	ref\|NM_214551.1\| Strongylocentrotus purpuratus late histone gene...	216	6e-53
258	gb\|AF007904.1\|CVHIST2 Chaetopterus variopedatus histone H4 and h...	216	6e-53
259	gb\|AY104535.1\| Zea mays PCO094675 mRNA sequence	214	2e-52
260	ref\|XM_608100.2\| PREDICTED: Bos taurus similar to germinal histo...	212	1e-51
261	ref\|XM_681121.1\| PREDICTED: Danio rerio similar to germinal hist...	212	1e-51
262	ref\|NM_001016869.2\| Xenopus tropicalis hypothetical protein LOC5...	210	4e-51
263	emb\|BX054531.1\|CNS09E8N Single read from an extremity of a full-...	210	4e-51
264	emb\|CR848633.2\| Xenopus tropicalis finished cDNA, clone TGas006m08	210	4e-51
265	ref\|XM_540284.1\| PREDICTED: Canis familiaris similar to germinal...	208	2e-50
266	emb\|BX055407.1\|CNS09EWZ Single read from an extremity of a full-...	208	2e-50
267	emb\|AJ626748.1\| Oikopleura dioica mRNA for histone H4.2	208	2e-50
268	ref\|XM_315129.2\| Anopheles gambiae str. PEST ENSANGP00000015255 ...	208	2e-50
269	ref\|XM_520759.1\| PREDICTED: Pan troglodytes similar to germinal ...	206	6e-50
270	ref\|XM_595652.2\| PREDICTED: Bos taurus similar to germinal histo...	206	6e-50
271	gb\|AY450353.1\| Bos grunniens histone H4.1 mRNA, partial cds	206	6e-50
272	ref\|XM_950909.1\| Neurospora crassa OR74A HISTONE H4 (NCU01634.1)...	204	2e-49
273	ref\|XM_328072.1\| Neurospora crassa OR74A HISTONE H4 (NCU01634.1)...	204	2e-49
274	ref\|XM_870205.1\| PREDICTED: Bos taurus similar to germinal histo...	202	9e-49
275	ref\|XM_605779.2\| PREDICTED: Bos taurus similar to germinal histo...	202	9e-49
276	emb\|X00038.1\|HSHIH4 Human H4 histone gene	202	9e-49
277	emb\|BX039314.1\|CNS092HY Single read from an extremity of a full-...	200	4e-48
278	emb\|AJ626751.1\| Oikopleura dioica mRNA for histone H4.5	200	4e-48
279	gb\|M16707.1\|HUMHIS4 Human histone H4 gene, complete cds, clone F...	200	4e-48
280	gb\|BT015217.1\| Drosophila melanogaster RE42129 full insert cDNA	198	1e-47
281	emb\|X97438.1\|DMHISH4 D.melanogaster mRNA for histone H4	198	1e-47
282	ref\|NM_169593.1\| Drosophila melanogaster Histone H4 replacement ...	198	1e-47
283	ref\|NM_169592.1\| Drosophila melanogaster Histone H4 replacement ...	198	1e-47
284	ref\|NM_079628.2\| Drosophila melanogaster Histone H4 replacement ...	198	1e-47
285	ref\|NM_173880.2\| Bos taurus histone H4 (H4), mRNA	198	1e-47
286	gb\|BT001842.1\| Drosophila melanogaster RH52884 full insert cDNA	198	1e-47
287	gb\|AF001288.1\|AF001288 Bos taurus histone H4.1 mRNA, complete cds	198	1e-47
288	emb\|X58895.1\|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones	196	6e-47
289	ref\|XM_595302.1\| PREDICTED: Bos taurus similar to germinal histo...	192	9e-46
290	ref\|NM_003546.2\| Homo sapiens histone 1, H4l (HIST1H4L), mRNA	192	9e-46
291	gb\|AY128665.1\| Homo sapiens clone HIST1H4L histone H4 gene, comp...	192	9e-46
292	emb\|Z98744.2\|HS193B12 Human DNA sequence from clone RP1-193B12 o...	192	9e-46
293	emb\|X83548.1\|HSHISTN4 H.sapiens gene for histone H4	192	9e-46
294	emb\|X03018.1\|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	192	9e-46
295	emb\|AJ626750.1\| Oikopleura dioica mRNA for histone H4.4	192	9e-46
296	gb\|BC069392.1\| Homo sapiens histone 1, H4l, mRNA (cDNA clone MGC...	192	9e-46
297	ref\|XM_702708.1\| PREDICTED: Danio rerio similar to germinal hist...	192	9e-46
298	ref\|XM_680087.1\| PREDICTED: Danio rerio similar to germinal hist...	192	9e-46
299	ref\|XM_307600.2\| Anopheles gambiae str. PEST ENSANGP00000016197 ...	192	9e-46
300	gb\|M21287.1\|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	192	9e-46
301	gb\|AY648850.1\| Homo sapiens histone H4/o gene, complete cds	190	4e-45
302	gb\|BC078038.1\| Xenopus laevis histone 1, H4l, mRNA (cDNA clone M...	190	4e-45
303	ref\|XM_871414.1\| PREDICTED: Bos taurus similar to germinal histo...	190	4e-45
304	gb\|AC150544.3\| Bos taurus BAC CH240-75C8 (Children's Hospital O...	190	4e-45
305	ref\|XM_322297.1\| Neurospora crassa OR74A hypothetical protein ( ...	190	4e-45
306	ref\|XM_951504.1\| Neurospora crassa OR74A hypothetical protein ( ...	190	4e-45
307	ref\|XM_385667.1\| Gibberella zeae PH-1 chromosome 3 H4_NEUCR Hist...	190	4e-45
308	gb\|AY128653.1\| Homo sapiens clone HIST4H4 histone H4 gene, compl...	190	4e-45
309	gb\|AC010168.6\| Homo sapiens 12p12-31.7-32.2 BAC RP11-174G6 (Rose...	190	4e-45
310	ref\|NM_175054.2\| Homo sapiens histone 4, H4 (HIST4H4), mRNA	190	4e-45
311	gb\|BC020884.1\| Homo sapiens histone 4, H4, mRNA (cDNA clone MGC:...	190	4e-45
312	emb\|BX066857.1\|CNS09NR1 Single read from an extremity of a full-...	186	6e-44
313	emb\|X77806.1\|PSHISTH4 P.salina histone H4 gene	186	6e-44
314	emb\|X13554.1\|RNH4G Rat H4 gene for somatic histone H4	186	6e-44
315	emb\|X00593.1\|LPH3H4 Lytechinus pictus H3 and H4 gene	186	6e-44
316	ref\|XM_527285.1\| PREDICTED: Pan troglodytes similar to HIST1H3I ...	184	2e-43
317	ref\|XM_604220.1\| PREDICTED: Bos taurus similar to germinal histo...	184	2e-43
318	emb\|AJ494855.1\|ODI494855 Oikopleura dioica partial mRNA for hist...	184	2e-43
319	gb\|J00985.1\|XELHIS4B Xenopus borealis h4 histone mRNA	184	2e-43
320	gb\|J00986.1\|XELHIS4L xenopus laevis h4 histone mrna	184	2e-43
321	ref\|XM_527602.1\| PREDICTED: Pan troglodytes similar to germinal ...	182	9e-43
322	ref\|XM_369778.1\| Magnaporthe grisea 70-15 hypothetical protein (...	182	9e-43
323	ref\|XM_865919.1\| PREDICTED: Bos taurus similar to germinal histo...	182	9e-43
324	ref\|NM_003540.3\| Homo sapiens histone 1, H4f (HIST1H4F), mRNA	182	9e-43
325	gb\|AY128659.1\| Homo sapiens clone HIST1H4F histone H4 gene, comp...	182	9e-43
326	emb\|AL031777.5\|HS34B20 Human DNA sequence from clone RP1-34B20 o...	182	9e-43
327	emb\|BX069194.1\|CNS09PJY Single read from an extremity of a full-...	182	9e-43
328	emb\|X00224.1\|XLHIS4 Xenopus laevis H4 histone gene and flanking ...	182	9e-43
329	gb\|BC093765.1\| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC...	182	9e-43
330	gb\|BC093763.1\| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC...	182	9e-43
331	gb\|M60749.1\|HUMHISAD Human histone H4 (H4) gene, complete cds	182	9e-43
332	gb\|BC069288.1\| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC...	182	9e-43
333	emb\|X04652.1\|MMHISH4S Mouse histone H4 gene 3' region with signa...	180	3e-42
334	emb\|BX060420.1\|CNS09IS8 Single read from an extremity of a full-...	178	1e-41
335	emb\|X54078.1\|TNHISTH4 T.nilotica gene for histone H4	178	1e-41
336	dbj\|AP007159.1\| Aspergillus oryzae RIB40 genomic DNA, SC026	178	1e-41
337	ref\|XM_687122.1\| PREDICTED: Danio rerio similar to germinal hist...	178	1e-41
338	ref\|XM_578415.1\| PREDICTED: Rattus norvegicus similar to germina...	178	1e-41
339	ref\|XM_575704.1\| PREDICTED: Rattus norvegicus similar to germina...	178	1e-41
340	gb\|AY675260.1\| Gallus gallus histone H4 gene, partial cds	178	1e-41
341	ref\|XM_602616.1\| PREDICTED: Bos taurus similar to germinal histo...	176	5e-41
342	emb\|AJ626749.1\| Oikopleura dioica mRNA for histone H4.3	176	5e-41
343	ref\|XM_609250.2\| PREDICTED: Bos taurus similar to germinal histo...	174	2e-40
344	emb\|BX043672.1\|CNS095V0 Single read from an extremity of a full-...	174	2e-40
345	emb\|BX036319.1\|CNS0906R Single read from an extremity of a full-...	174	2e-40
346	emb\|X06964.1\|VCHIS34A Volvox carteri H3-II and H4-II genes for h...	174	2e-40
347	ref\|XM_684085.1\| PREDICTED: Danio rerio similar to germinal hist...	174	2e-40
348	emb\|CR354435.20\| Zebrafish DNA sequence from clone CH211-113A14 ...	174	2e-40
349	gb\|J00987.1\|XELHIS4LB x.laevis histone gene h4 and flanks	174	2e-40
350	ref\|XM_597168.2\| PREDICTED: Bos taurus similar to germinal histo...	172	8e-40
351	ref\|XM_869215.1\| PREDICTED: Bos taurus similar to germinal histo...	172	8e-40
352	emb\|X52393.1\|TCH3H4 Tigriopus californicus DNA for histone H3 an...	172	8e-40
353	gb\|AF297469.1\|AF297469 Schistosoma mansoni strain LE histone H4 ...	172	8e-40
354	gb\|M84797.1\|TIGH1234A Tigriopus californicus histone H1 gene, co...	172	8e-40
355	emb\|BX057964.1\|CNS09GW0 Single read from an extremity of a full-...	170	3e-39
356	emb\|X03952.1\|SPHISH34 Sea urchin (S. purpuratus) late embryonic ...	170	3e-39
357	ref\|XM_684447.1\| PREDICTED: Danio rerio similar to germinal hist...	170	3e-39
358	ref\|XM_682981.1\| PREDICTED: Danio rerio similar to germinal hist...	170	3e-39
359	ref\|XM_688078.1\| PREDICTED: Danio rerio similar to germinal hist...	170	3e-39
360	ref\|XM_701706.1\| PREDICTED: Danio rerio similar to germinal hist...	170	3e-39
361	ref\|XM_677902.1\| PREDICTED: Danio rerio similar to germinal hist...	170	3e-39
362	ref\|XM_687827.1\| PREDICTED: Danio rerio similar to germinal hist...	170	3e-39
363	gb\|AC084653.1\|CBRG45O14 Caenorhabditis briggsae cosmid G45O14, c...	170	3e-39
364	ref\|NM_214548.1\| Strongylocentrotus purpuratus late embryonic hi...	170	3e-39
365	ref\|XM_600437.2\| PREDICTED: Bos taurus similar to germinal histo...	167	5e-38
366	emb\|CR858191.1\| Pongo pygmaeus mRNA; cDNA DKFZp469B0137 (from cl...	167	5e-38
367	ref\|XM_653246.1\| Aspergillus nidulans FGSC A4 histone H4 (AN0734...	165	2e-37
368	emb\|X53330.1\|PDHISTCL P.dumerilii histone gene cluster for core ...	165	2e-37
369	emb\|BX052401.1\|CNS09CLH Single read from an extremity of a full-...	163	8e-37
370	emb\|BX047093.1\|CNS098I1 Single read from an extremity of a full-...	163	8e-37
371	emb\|X54113.1\|POH4H3 P.ochraceus histone genes H4 and H3	163	8e-37
372	dbj\|AB183301.1\| Lactuca sativa LetH4 mRNA for histone H4, partia...	163	8e-37
373	dbj\|AB033943.1\| Aspergillus oryzae mRNA for histone H4, complete...	163	8e-37
374	ref\|XM_527254.1\| PREDICTED: Pan troglodytes similar to HIST2H3C ...	161	3e-36
375	gb\|AY128655.1\| Homo sapiens clone HIST1H4B histone H4 gene, comp...	161	3e-36
376	emb\|X67081.1\|HSH4HIST H.sapiens histone H4 gene	161	3e-36
377	gb\|AY675264.1\| Vulpes zerda histone H4 gene, partial cds	161	3e-36
378	gb\|AY675263.1\| Felis catus histone H4 gene, partial cds	161	3e-36
379	ref\|XM_594900.2\| PREDICTED: Bos taurus similar to germinal histo...	159	1e-35
380	ref\|NM_003544.2\| Homo sapiens histone 1, H4b (HIST1H4B), mRNA	159	1e-35
381	ref\|NM_003539.3\| Homo sapiens histone 1, H4d (HIST1H4D), mRNA	159	1e-35
382	gb\|AY128657.1\| Homo sapiens clone HIST1H4D histone H4 gene, comp...	159	1e-35
383	emb\|AL353759.8\| Human DNA sequence from clone RP1-221C16 on chro...	159	1e-35
384	emb\|X60482.1\|HSH4BHIS H.sapiens H4/b gene for H4 histone	159	1e-35
385	gb\|BC069467.1\| Homo sapiens histone 1, H4b, mRNA (cDNA clone MGC...	159	1e-35
386	emb\|Y16588.1\|PLY16588 Paracentrotus lividus histone H4 gene, ear...	159	1e-35
387	emb\|BX045468.1\|CNS0978W Single read from an extremity of a full-...	157	5e-35
388	emb\|X91511.1\|DPINH41 D.pini mRNA for histone H4, isoforme 1	157	5e-35
389	emb\|X03017.1\|XLHISH1 Xenopus laevis histone gene cluster Xlh1 wi...	157	5e-35
390	gb\|AY062172.1\| Neurospora crassa histone H4 (hh4-2) gene, comple...	157	5e-35
391	gb\|AC084502.1\|CBRG14F21 Caenorhabditis briggsae cosmid G14F21, c...	157	5e-35
392	gb\|M21286.1\|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 gene...	157	5e-35
393	ref\|XM_518290.1\| PREDICTED: Pan troglodytes similar to germinal ...	155	2e-34
394	ref\|XM_578442.1\| PREDICTED: Rattus norvegicus similar to germina...	155	2e-34
395	gb\|AY936210.1\| Rattus norvegicus pro-histogranin mRNA, complete cds	155	2e-34
396	emb\|Z61847.1\|HS59H5F H.sapiens CpG island DNA genomic Mse1 fragm...	155	2e-34
397	emb\|Y16587.1\|PLY16587 Paracentrotus lividus histone H4 gene, par...	155	2e-34
398	ref\|XM_750626.1\| Aspergillus fumigatus Af293 histone H4 (Afu2g13...	153	8e-34
399	emb\|X54115.1\|SSH4H3 S.stimpsoni histone genes H4 and H3	153	8e-34
400	emb\|X54114.1\|PHH4H3 P.helianthoides histone genes H4 and H3	153	8e-34
401	emb\|X54112.1\|PBH4H3 P.brevispinus histone genes H4 and H3	153	8e-34
402	gb\|AY675269.1\| Marmota monax histone H4 gene, partial cds	153	8e-34
403	gb\|AY675265.1\| Canis familiaris histone H4 gene, partial cds	153	8e-34
404	gb\|AY675261.1\| Coturnix japonica histone H4 gene, partial cds	153	8e-34
405	emb\|X55549.1\|ANH4GENE A.nidulans gene for core histone H4.1	151	3e-33
406	gb\|U12630.1\|ENU12630 Emericella nidulans R153 core histone H3 (H...	151	3e-33
407	gb\|BC056868.1\| Homo sapiens cDNA clone IMAGE:5194861	149	1e-32
408	gb\|BC012587.1\| Homo sapiens histone 1, H4e, mRNA (cDNA clone MGC...	149	1e-32
409	ref\|XM_568101.1\| Cryptococcus neoformans var. neoformans JEC21 h...	149	1e-32
410	ref\|XM_569504.1\| Cryptococcus neoformans var. neoformans JEC21 h...	149	1e-32
411	gb\|AY128658.1\| Homo sapiens clone HIST1H4E histone H4 gene, comp...	149	1e-32
412	gb\|AF517877.1\| Griffithsia japonica isolate Gj458 histone H4 pro...	149	1e-32
413	emb\|Z80787.1\|HSH4J H.sapiens H4/j gene	149	1e-32
414	emb\|X97436.1\|DHHISH4 D.hydei mRNA for histone H4	149	1e-32
415	emb\|X01611.1\|NCHISH4 Neurospora crassa DNA for histone H4	149	1e-32
416	emb\|AL670001.1\|NCB14H13 Neurospora crassa DNA linkage group II B...	149	1e-32
417	emb\|AL670543.1\|NCB7K22 Neurospora crassa DNA linkage group II BA...	149	1e-32
418	gb\|AY062173.1\| Neurospora crassa histone H3 (hh3) and histone H4...	149	1e-32
419	gb\|BC050615.1\| Homo sapiens histone 1, H4e, mRNA (cDNA clone MGC...	149	1e-32
420	ref\|NM_003545.3\| Homo sapiens histone 1, H4e (HIST1H4E), mRNA	147	5e-32
421	ref\|XM_384465.1\| Gibberella zeae PH-1 chromosome 2 hypothetical ...	147	5e-32
422	emb\|CR542180.1\| Homo sapiens full open reading frame cDNA clone ...	147	5e-32
423	dbj\|AB226260.1\| Aspergillus oryzae cDNA, contig sequence: AoEST3119	147	5e-32
424	ref\|XM_683785.1\| PREDICTED: Danio rerio similar to germinal hist...	147	5e-32
425	ref\|XM_683555.1\| PREDICTED: Danio rerio similar to germinal hist...	147	5e-32
426	ref\|XM_687940.1\| PREDICTED: Danio rerio similar to germinal hist...	147	5e-32
427	gb\|AY064471.1\| Aplysia californica histone H4 (His.H4) gene, com...	147	5e-32
428	ref\|XM_753764.1\| Ustilago maydis 521 histone H4 (UM02710.1) part...	145	2e-31
429	emb\|X15142.1\|PPHISH41 Physarum polycephalum H41 gene for histone...	145	2e-31
430	emb\|X00449.1\|PPHI01 Physarum polycephalum histone H4 gene	145	2e-31
431	emb\|CR542187.1\| Homo sapiens full open reading frame cDNA clone ...	145	2e-31
432	gb\|AY559154.1\| Columella edentula isolate 15 histone H3 and hist...	143	7e-31
433	gb\|DQ445629.1\| Giardia intestinalis strain WP clone 1267 histone...	143	7e-31
434	dbj\|AP007161.1\| Aspergillus oryzae RIB40 genomic DNA, SC012	143	7e-31
435	ref\|XM_702905.1\| PREDICTED: Danio rerio similar to germinal hist...	143	7e-31
436	ref\|XM_680378.1\| PREDICTED: Danio rerio similar to germinal hist...	143	7e-31
437	gb\|AC084589.1\|CBRG41K24 Caenorhabditis briggsae cosmid G41K24, c...	141	3e-30
438	gb\|AY675279.1\| Suricata suricatta histone H4 gene, partial cds	141	3e-30
439	gb\|BC010926.1\| Homo sapiens histone 1, H4h, mRNA (cDNA clone MGC...	139	1e-29
440	ref\|XM_654938.1\| Aspergillus nidulans FGSC A4 histone H4.2 (AN24...	139	1e-29
441	ref\|NM_003543.3\| Homo sapiens histone 1, H4h (HIST1H4H), mRNA	139	1e-29
442	gb\|AY559155.1\| Pupilla muscorum histone H3 and histone H4 genes,...	139	1e-29
443	gb\|AY559147.1\| Trichia villosa histone H3 and histone H4 genes, ...	139	1e-29
444	gb\|AY128661.1\| Homo sapiens clone HIST1H4H histone H4 gene, comp...	139	1e-29
445	emb\|AL021917.4\|HS45P21 Human DNA sequence from clone RP1-45P21 o...	139	1e-29
446	emb\|X60487.1\|HSH4HHIS H.sapiens H4/h gene for H4 histone	139	1e-29
447	emb\|X55550.1\|ANH4GE A.nidulans gene for core histone H4.2	139	1e-29
448	emb\|CR542169.1\| Homo sapiens full open reading frame cDNA clone ...	139	1e-29
449	gb\|AF361948.1\| Eimeria tenella histone 4 (H4) gene, complete cds	139	1e-29
450	ref\|XM_688557.1\| PREDICTED: Danio rerio similar to germinal hist...	139	1e-29
451	gb\|BC095254.1\| Danio rerio cDNA clone IMAGE:7224490	139	1e-29
452	gb\|U12631.1\|ENU12631 Emericella nidulans R153 core histone H4.2 ...	139	1e-29
453	gb\|AY389648.1\| Hyacinthus orientalis histone H4 mRNA, complete cds	137	5e-29
454	gb\|AY559151.1\| Truncatellina cylindrica histone H3 and histone H...	137	5e-29
455	emb\|X97437.1\|DMH4R D.melanogaster H4r gene	137	5e-29
456	gb\|AC007809.8\|AC007809 Drosophila melanogaster, chromosome 3R, r...	137	5e-29
457	gb\|AY675272.1\| Mus musculus histone H4 gene, partial cds	137	5e-29
458	gb\|AE003705.3\| Drosophila melanogaster chromosome 3R, section 43...	137	5e-29
459	gb\|AY559153.1\| Columella edentula isolate 48 histone H3 and hist...	135	2e-28
460	dbj\|AB226301.1\| Aspergillus oryzae cDNA, contig sequence: AoEST3163	135	2e-28
461	ref\|XM_601239.2\| PREDICTED: Bos taurus similar to germinal histo...	133	7e-28
462	gb\|AY675274.1\| Lonchura domestica histone H4 gene, partial cds	133	7e-28
463	emb\|Z93388.1\|CET10C6 Caenorhabditis elegans Cosmid T10C6, comple...	133	7e-28
464	gb\|U64845.1\| Caenorhabditis elegans cosmid F45F2, complete sequence	131	3e-27
465	ref\|XM_693883.1\| PREDICTED: Danio rerio similar to germinal hist...	131	3e-27
466	ref\|XM_687692.1\| PREDICTED: Danio rerio similar to germinal hist...	131	3e-27
467	ref\|NM_074633.1\| Caenorhabditis elegans HIStone family member (h...	131	3e-27
468	ref\|NM_072799.2\| Caenorhabditis elegans HIStone family member (h...	131	3e-27
469	emb\|AJ314735.1\|CSP314735 Colletotrichum sp. partial H4 gene, exo...	131	3e-27
470	emb\|AJ314731.1\|CAC314731 Colletotrichum acutatum partial H4 gene...	131	3e-27
471	emb\|CR542189.1\| Homo sapiens full open reading frame cDNA clone ...	129	1e-26
472	emb\|AJ314855.1\|PFU314855 Penicillium funiculosum H4.1 gene and H...	127	4e-26
473	gb\|U64843.2\| Caenorhabditis elegans cosmid K06C4, complete sequence	125	2e-25
474	gb\|M32426.1\|SUSH4AA S.purpuratus H4 histone mRNA, complete cds	125	2e-25
475	ref\|XM_871249.1\| PREDICTED: Bos taurus similar to germinal histo...	123	7e-25
476	gb\|AC024696.1\| Caenorhabditis elegans cosmid F07B7, complete seq...	123	7e-25
477	ref\|XM_601510.2\| PREDICTED: Bos taurus similar to histone 1, H2a...	123	7e-25
478	ref\|XM_871144.1\| PREDICTED: Bos taurus similar to germinal histo...	123	7e-25
479	ref\|XM_683282.1\| PREDICTED: Danio rerio similar to histone H2A (...	123	7e-25
480	ref\|NM_072897.1\| Caenorhabditis elegans HIStone family member (h...	123	7e-25
481	ref\|NM_072890.1\| Caenorhabditis elegans HIStone family member (h...	123	7e-25
482	ref\|NM_072874.1\| Caenorhabditis elegans HIStone family member (h...	123	7e-25
483	emb\|AJ314734.1\|CSP314734 Colletotrichum sp. partial H4 gene, exo...	123	7e-25
484	emb\|AJ314733.1\|CSP314733 Colletotrichum sp. partial H4 gene, exo...	123	7e-25
485	emb\|AJ314727.1\|CSP314727 Colletotrichum sp. partial H4 gene, exo...	123	7e-25
486	emb\|AJ314724.1\|CSP314724 Colletotrichum sp. partial H4 gene, exo...	123	7e-25
487	emb\|AJ314723.1\|CAC314723 Colletotrichum acutatum partial H4 gene...	123	7e-25
488	emb\|AJ132597.1\|DME132597 Drosophila melanogaster H4r gene,3'-fla...	123	7e-25
489	emb\|Z15134.1\|PCHISH41 P.chrysosporium gene for histone H4.1	121	3e-24
490	gb\|AY559152.1\| Columella edentula isolate 1 histone H3 and histo...	119	1e-23
491	dbj\|D10397.1\|RICT127 Oryza sativa mRNA for histone H4 (T127 gene...	117	4e-23
492	emb\|AJ646896.1\| Ustilago maydis h4 gene for histone 4, exons 1-2	115	2e-22
493	emb\|Y09953.1\|AGHISTH4 A.gambiae H4 gene, partial	115	2e-22
494	emb\|AJ314730.1\|CAC314730 Colletotrichum acutatum partial H4 gene...	115	2e-22
495	emb\|AJ314729.1\|CAC314729 Colletotrichum acutatum partial H4 gene...	115	2e-22
496	emb\|AJ314725.1\|CSP314725 Colletotrichum sp. partial H4 gene, exo...	115	2e-22
497	emb\|Z83245.4\|CEZK131 Caenorhabditis elegans Cosmid ZK131, comple...	111	3e-21
498	emb\|X15634.1\|CEHIS10 C. elegans core histone genes H4(his-10) an...	111	3e-21
499	dbj\|AB105185.1\| Drosophila sechellia H4, H2A, H2B, H1 genes for ...	111	3e-21
500	dbj\|AB105184.1\| Drosophila sechellia H4, H2A, H2B, H1 genes for ...	111	3e-21

>gb|BT009488.1| Triticum aestivum clone wr1.pk0058.g3:fis, full insert mRNA sequence
          Length = 1768

 Score =  511 bits (258), Expect = e-142
 Identities = 303/318 (95%)
 Strand = Plus / Minus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            |||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 1598 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 1539

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1538 ccgtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 1479

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1478 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 1419

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            ||||||| ||||  ||||| |||||||| |||||||||||||||||||||||||||||||
Sbjct: 1418 cgccgccccgccgcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 1359

                                                                        
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
            |||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 1358 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 1299

                              
Query: 526  gaccggacatggttgacg 543
            | |||||||||| |||||
Sbjct: 1298 ggccggacatggctgacg 1281

to top

>gb|AC108500.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1280_A04,
            complete sequence
          Length = 88553

 Score =  488 bits (246), Expect = e-134
 Identities = 297/314 (94%)
 Strand = Plus / Plus

                                                                        
Query: 224  tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
            |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 4258 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 4317

                                                                        
Query: 284  ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4318 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 4377

                                                                        
Query: 344  ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
            ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 4378 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 4437

                                                                        
Query: 404  cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            ||||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 4438 cacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 4497

                                                                        
Query: 464  gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            ||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 4498 gcggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgcc 4557

                          
Query: 524  gcgaccggacatgg 537
            ||| || |||||||
Sbjct: 4558 gcgccccgacatgg 4571



 Score =  119 bits (60), Expect = 1e-23
 Identities = 180/220 (81%)
 Strand = Plus / Plus

                                                                         
Query: 240   tagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttg 299
             |||| |||||| |||||  |||||||||| || ||||| ||||||||  |||| ||||||
Sbjct: 11298 tagatggtgcggccctgaagcttgagcgcatatacgacatccatggccatgacagtcttg 11357

                                                                         
Query: 300   cggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttg 359
             ||| | || |||||||||||||| | ||| |||| |||||| |||| ||||||||||| |
Sbjct: 11358 cggtgagcatgctcggtgtaggtaatggcatcgcagatgacattcttgaggaagatctcg 11417

                                                                         
Query: 360   agcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctg 419
             ||||| || || ||||| | |||||| | ||| ||||||||||||||||| ||   ||| 
Sbjct: 11418 agcacgccacgagtctctttgtagatcaaccctgagatgcgcttcacgccacccttcctt 11477

                                                     
Query: 420   gccagacgccggatggccggcttggtgatgccctggatgt 459
             || || || |||||  ||||||||| |||||| |||||||
Sbjct: 11478 gcaaggcgtcggatcaccggcttggcgatgccttggatgt 11517

to top

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
             complete sequence
          Length = 93826

 Score =  488 bits (246), Expect = e-134
 Identities = 297/314 (94%)
 Strand = Plus / Plus

                                                                         
Query: 224   tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
             |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 86770 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 86829

                                                                         
Query: 284   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86830 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 86889

                                                                         
Query: 344   ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
             ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 86890 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 86949

                                                                         
Query: 404   cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
             ||||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 86950 cacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 87009

                                                                         
Query: 464   gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
             ||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 87010 gcggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgcc 87069

                           
Query: 524   gcgaccggacatgg 537
             ||| || |||||||
Sbjct: 87070 gcgccccgacatgg 87083

to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  488 bits (246), Expect = e-134
 Identities = 297/314 (94%)
 Strand = Plus / Plus

                                                                            
Query: 224      tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
                |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 22591720 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 22591779

                                                                            
Query: 284      ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22591780 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 22591839

                                                                            
Query: 344      ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
                ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 22591840 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 22591899

                                                                            
Query: 404      cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
                ||||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 22591900 cacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 22591959

                                                                            
Query: 464      gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
                ||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 22591960 gcggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgcc 22592019

                              
Query: 524      gcgaccggacatgg 537
                ||| || |||||||
Sbjct: 22592020 gcgccccgacatgg 22592033



 Score =  480 bits (242), Expect = e-132
 Identities = 296/314 (94%)
 Strand = Plus / Minus

                                                                            
Query: 224      tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
                |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 22758371 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 22758312

                                                                            
Query: 284      ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22758311 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 22758252

                                                                            
Query: 344      ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
                ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 22758251 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 22758192

                                                                            
Query: 404      cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
                ||||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 22758191 cacgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtc 22758132

                                                                            
Query: 464      gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
                ||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 22758131 gcggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgcc 22758072

                              
Query: 524      gcgaccggacatgg 537
                ||| || |||||||
Sbjct: 22758071 gcgccccgacatgg 22758058



 Score =  119 bits (60), Expect = 1e-23
 Identities = 180/220 (81%)
 Strand = Plus / Plus

                                                                            
Query: 240      tagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttg 299
                |||| |||||| |||||  |||||||||| || ||||| ||||||||  |||| ||||||
Sbjct: 22598760 tagatggtgcggccctgaagcttgagcgcatatacgacatccatggccatgacagtcttg 22598819

                                                                            
Query: 300      cggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttg 359
                ||| | || |||||||||||||| | ||| |||| |||||| |||| ||||||||||| |
Sbjct: 22598820 cggtgagcatgctcggtgtaggtaatggcatcgcagatgacattcttgaggaagatctcg 22598879

                                                                            
Query: 360      agcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctg 419
                ||||| || || ||||| | |||||| | ||| ||||||||||||||||| ||   ||| 
Sbjct: 22598880 agcacgccacgagtctctttgtagatcaaccctgagatgcgcttcacgccacccttcctt 22598939

                                                        
Query: 420      gccagacgccggatggccggcttggtgatgccctggatgt 459
                || || || |||||  ||||||||| |||||| |||||||
Sbjct: 22598940 gcaaggcgtcggatcaccggcttggcgatgccttggatgt 22598979

to top

>dbj|AK105816.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-C11, full
           insert sequence
          Length = 588

 Score =  488 bits (246), Expect = e-134
 Identities = 297/314 (94%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 416 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 357

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 356 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 297

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 296 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 237

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 236 cacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 177

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 176 gcggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgcc 117

                         
Query: 524 gcgaccggacatgg 537
           ||| || |||||||
Sbjct: 116 gcgccccgacatgg 103

to top

>ref|XM_475383.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  484 bits (244), Expect = e-133
 Identities = 295/312 (94%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 312 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 252 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 192 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 132 cacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 73

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 72  gcggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgcc 13

                       
Query: 524 gcgaccggacat 535
           ||| || |||||
Sbjct: 12  gcgccccgacat 1

to top

>emb|X00043.1|TAHI01 Wheat histone H4 gene
          Length = 1200

 Score =  484 bits (244), Expect = e-133
 Identities = 295/312 (94%)
 Strand = Plus / Minus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            |||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 1045 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 986

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 985  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcatcgcggatgacgttct 926

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 925  cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 866

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            ||||||| ||||  ||||| |||||||| |||||||||||||||||||||||||| ||||
Sbjct: 865  cgccgccccgccgcgccagccgccggatcgccggcttggtgatgccctggatgttatcgc 806

                                                                        
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
            | || ||||||||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 805  ggaggaccttccggtggcgcttggcgccgcccttgcctaggcccttgcctcccttgccgc 746

                        
Query: 526  gaccggacatgg 537
            | ||||||||||
Sbjct: 745  gcccggacatgg 734

to top

>gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009E21,
              complete sequence
          Length = 153214

 Score =  480 bits (242), Expect = e-132
 Identities = 296/314 (94%)
 Strand = Plus / Minus

                                                                          
Query: 224    tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
              |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 113570 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 113511

                                                                          
Query: 284    ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113510 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 113451

                                                                          
Query: 344    ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
              ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 113450 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 113391

                                                                          
Query: 404    cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
              ||||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 113390 cacgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtc 113331

                                                                          
Query: 464    gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
              ||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 113330 gcggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgcc 113271

                            
Query: 524    gcgaccggacatgg 537
              ||| || |||||||
Sbjct: 113270 gcgccccgacatgg 113257

to top

>gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1387_F08,
             complete sequence
          Length = 141535

 Score =  480 bits (242), Expect = e-132
 Identities = 296/314 (94%)
 Strand = Plus / Minus

                                                                         
Query: 224   tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
             |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 67821 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 67762

                                                                         
Query: 284   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67761 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 67702

                                                                         
Query: 344   ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
             ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 67701 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 67642

                                                                         
Query: 404   cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
             ||||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 67641 cacgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtc 67582

                                                                         
Query: 464   gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
             ||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 67581 gcggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgcc 67522

                           
Query: 524   gcgaccggacatgg 537
             ||| || |||||||
Sbjct: 67521 gcgccccgacatgg 67508

to top

>dbj|AK119240.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-A04, full
           insert sequence
          Length = 672

 Score =  480 bits (242), Expect = e-132
 Identities = 296/314 (94%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 402 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 343

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 342 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 283

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 282 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 223

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 222 cacgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtc 163

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 162 gcggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgcc 103

                         
Query: 524 gcgaccggacatgg 537
           ||| || |||||||
Sbjct: 102 gcgccccgacatgg 89

to top

>ref|XM_475394.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  476 bits (240), Expect = e-131
 Identities = 294/312 (94%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 312 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 252 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 192 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 132 cacgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtc 73

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 72  gcggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgcc 13

                       
Query: 524 gcgaccggacat 535
           ||| || |||||
Sbjct: 12  gcgccccgacat 1

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  468 bits (236), Expect = e-128
 Identities = 299/320 (93%)
 Strand = Plus / Minus

                                                                           
Query: 224     tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
               |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 1060864 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 1060805

                                                                           
Query: 284     ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 1060804 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 1060745

                                                                           
Query: 344     ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
               ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 1060744 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 1060685

                                                                           
Query: 404     cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
               ||||||||| | ||| ||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 1060684 cacgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtc 1060625

                                                                           
Query: 464     gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
               |||||||||||||| ||| ||||| |||||||||||||| || ||||| |||||||||||
Sbjct: 1060624 gcgcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgcc 1060565

                                   
Query: 524     gcgaccggacatggttgacg 543
               ||| || ||||||| |||||
Sbjct: 1060564 gcggcccgacatggctgacg 1060545



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 82/96 (85%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                            
Query: 308      gtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagcacacc 367
                |||||||||||||||||| | ||||  | ||||||||| |||||||||||||| ||| ||
Sbjct: 25649298 gtgctcggtgtaggtgacagtgtcgtaggtgacgttcttgaggaagatcttgatcacgcc 25649239

                                                    
Query: 368      gcgggtctcctcgtagatgagccccgagatgcgctt 403
                 |  || ||||||||||||||||  |||||||||||
Sbjct: 25649238 acatgt-tcctcgtagatgagcctggagatgcgctt 25649204

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  468 bits (236), Expect = e-128
 Identities = 299/320 (93%)
 Strand = Plus / Minus

                                                                           
Query: 224     tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
               |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 1060862 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 1060803

                                                                           
Query: 284     ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 1060802 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 1060743

                                                                           
Query: 344     ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
               ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 1060742 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 1060683

                                                                           
Query: 404     cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
               ||||||||| | ||| ||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 1060682 cacgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtc 1060623

                                                                           
Query: 464     gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
               |||||||||||||| ||| ||||| |||||||||||||| || ||||| |||||||||||
Sbjct: 1060622 gcgcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgcc 1060563

                                   
Query: 524     gcgaccggacatggttgacg 543
               ||| || ||||||| |||||
Sbjct: 1060562 gcggcccgacatggctgacg 1060543



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 82/96 (85%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                            
Query: 308      gtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagcacacc 367
                |||||||||||||||||| | ||||  | ||||||||| |||||||||||||| ||| ||
Sbjct: 25740607 gtgctcggtgtaggtgacagtgtcgtaggtgacgttcttgaggaagatcttgatcacgcc 25740548

                                                    
Query: 368      gcgggtctcctcgtagatgagccccgagatgcgctt 403
                 |  || ||||||||||||||||  |||||||||||
Sbjct: 25740547 acatgt-tcctcgtagatgagcctggagatgcgctt 25740513

to top

>gb|AC118980.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1263H11,
             complete sequence
          Length = 126827

 Score =  468 bits (236), Expect = e-128
 Identities = 299/320 (93%)
 Strand = Plus / Minus

                                                                         
Query: 224   tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
             |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 81079 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 81020

                                                                         
Query: 284   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 81019 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 80960

                                                                         
Query: 344   ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
             ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 80959 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 80900

                                                                         
Query: 404   cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
             ||||||||| | ||| ||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 80899 cacgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtc 80840

                                                                         
Query: 464   gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
             |||||||||||||| ||| ||||| |||||||||||||| || ||||| |||||||||||
Sbjct: 80839 gcgcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgcc 80780

                                 
Query: 524   gcgaccggacatggttgacg 543
             ||| || ||||||| |||||
Sbjct: 80779 gcggcccgacatggctgacg 80760

to top

>dbj|AK058741.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-G08, full
           insert sequence
          Length = 526

 Score =  468 bits (236), Expect = e-128
 Identities = 299/320 (93%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 379 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 320

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 319 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 260

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 259 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 200

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| | ||| ||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 199 cacgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtc 140

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||||| ||| ||||| |||||||||||||| || ||||| |||||||||||
Sbjct: 139 gcgcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgcc 80

                               
Query: 524 gcgaccggacatggttgacg 543
           ||| || ||||||| |||||
Sbjct: 79  gcggcccgacatggctgacg 60

to top

>ref|NM_187563.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  460 bits (232), Expect = e-126
 Identities = 292/312 (93%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 312 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 252 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 192 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| | ||| ||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 132 cacgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtc 73

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||||| ||| ||||| |||||||||||||| || ||||| |||||||||||
Sbjct: 72  gcgcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgcc 13

                       
Query: 524 gcgaccggacat 535
           ||| || |||||
Sbjct: 12  gcggcccgacat 1

to top

>ref|NM_185758.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 312

 Score =  448 bits (226), Expect = e-123
 Identities = 289/310 (93%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 190 cgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgcttca 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | ||||| | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||
Sbjct: 130 ccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtcgc 71

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | |||||||||||||| ||||| ||||| |||||||| ||||||||||||||||| ||||
Sbjct: 70  ggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctcccttcccgc 11

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 10  gcccagacat 1

to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  448 bits (226), Expect = e-123
 Identities = 289/310 (93%)
 Strand = Plus / Minus

                                                                            
Query: 226      agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
                |||||||||| |||||||||||||| ||||| |||||||| |||||||||||||||||||
Sbjct: 15861719 agccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtccatgg 15861660

                                                                            
Query: 286      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15861659 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 15861600

                                                                            
Query: 346      cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
                ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 15861599 cgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgcttca 15861540

                                                                            
Query: 406      cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
                | ||||| | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||
Sbjct: 15861539 ccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtcgc 15861480

                                                                            
Query: 466      gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
                | |||||||||||||| ||||| || |||||||||||||| |||||||||||||||||||
Sbjct: 15861479 ggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgccgc 15861420

                          
Query: 526      gaccggacat 535
                | || |||||
Sbjct: 15861419 gccccgacat 15861410



 Score =  416 bits (210), Expect = e-113
 Identities = 276/298 (92%)
 Strand = Plus / Plus

                                                                            
Query: 226      agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
                ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 21610889 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 21610948

                                                                            
Query: 286      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 21610949 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 21611008

                                                                            
Query: 346      cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
                ||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||
Sbjct: 21611009 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 21611068

                                                                            
Query: 406      cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
                ||||||| | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||
Sbjct: 21611069 cgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtcgc 21611128

                                                                          
Query: 466      gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
                |||||||||||| ||| | ||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 21611129 gcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttgcc 21611186



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 134      ctcagaattcagaaacgaaa 153
                ||||||||||||||||||||
Sbjct: 19819488 ctcagaattcagaaacgaaa 19819469

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  448 bits (226), Expect = e-123
 Identities = 289/310 (93%)
 Strand = Plus / Minus

                                                                            
Query: 226      agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
                |||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 21774019 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 21773960

                                                                            
Query: 286      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21773959 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 21773900

                                                                            
Query: 346      cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
                ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 21773899 cgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgcttca 21773840

                                                                            
Query: 406      cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
                | ||||| | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||
Sbjct: 21773839 ccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtcgc 21773780

                                                                            
Query: 466      gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
                | |||||||||||||| ||||| ||||| |||||||| ||||||||||||||||| ||||
Sbjct: 21773779 ggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctcccttcccgc 21773720

                          
Query: 526      gaccggacat 535
                | || |||||
Sbjct: 21773719 gcccagacat 21773710

to top

>dbj|AP004401.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0534A03
          Length = 153170

 Score =  448 bits (226), Expect = e-123
 Identities = 289/310 (93%)
 Strand = Plus / Minus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             |||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 91202 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 91143

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 91142 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 91083

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 91082 cgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgcttca 91023

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             | ||||| | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||
Sbjct: 91022 ccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtcgc 90963

                                                                         
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
             | |||||||||||||| ||||| ||||| |||||||| ||||||||||||||||| ||||
Sbjct: 90962 ggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctcccttcccgc 90903

                       
Query: 526   gaccggacat 535
             | || |||||
Sbjct: 90902 gcccagacat 90893

to top

>dbj|AP005551.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1081_G10
          Length = 107955

 Score =  448 bits (226), Expect = e-123
 Identities = 289/310 (93%)
 Strand = Plus / Minus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             |||||||||| |||||||||||||| ||||| |||||||| |||||||||||||||||||
Sbjct: 24845 agccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtccatgg 24786

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24785 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 24726

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 24725 cgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgcttca 24666

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             | ||||| | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||
Sbjct: 24665 ccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtcgc 24606

                                                                         
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
             | |||||||||||||| ||||| || |||||||||||||| |||||||||||||||||||
Sbjct: 24605 ggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgccgc 24546

                       
Query: 526   gaccggacat 535
             | || |||||
Sbjct: 24545 gccccgacat 24536

to top

>dbj|AK058686.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-A10, full
           insert sequence
          Length = 469

 Score =  448 bits (226), Expect = e-123
 Identities = 289/310 (93%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||| ||||| |||||||| |||||||||||||||||||
Sbjct: 360 agccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtccatgg 301

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 300 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 241

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 240 cgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgcttca 181

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | ||||| | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||
Sbjct: 180 ccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtcgc 121

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | |||||||||||||| ||||| || |||||||||||||| |||||||||||||||||||
Sbjct: 120 ggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgccgc 61

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 60  gccccgacat 51

to top

>emb|X79715.1|LTMRHISH4 L.temulentum mRNA for histone H4
          Length = 616

 Score =  444 bits (224), Expect = e-121
 Identities = 294/318 (92%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 359 agccgccgaagccgtagagagtgcgaccctggcgcttgagcgcgtagactacgtccatgg 300

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 299 cggtgacggtcttgcggcsggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 240

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           ||||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||
Sbjct: 239 cgaggaagatcttgagcacgccacgggtctcctcgtagatgagcccggagatgcgcttca 180

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| || |  ||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 179 cgccgccgcggcgagccaggcggcggatggccggcttggtgatgccctggatgttgtcgc 120

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | || ||||| ||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 119 ggaggaccttgcggtggcgcttggcgccgcccttgccgagcccctttcctcccttgccgc 60

                             
Query: 526 gaccggacatggttgacg 543
           | || ||||||| |||||
Sbjct: 59  ggcccgacatggctgacg 42

to top

>ref|XM_473659.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  432 bits (218), Expect = e-118
 Identities = 287/310 (92%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 310 agcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttga 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||||
Sbjct: 130 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 71

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | |||||||| ||||| ||||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 70  ggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgccgc 11

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 10  gccccgacat 1

to top

>emb|AL662987.3|OSJN00188 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088A01,
              complete sequence
          Length = 186325

 Score =  432 bits (218), Expect = e-118
 Identities = 287/310 (92%)
 Strand = Plus / Plus

                                                                          
Query: 226    agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
              |||| ||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 135381 agcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 135440

                                                                          
Query: 286    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135441 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 135500

                                                                          
Query: 346    cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
              ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
Sbjct: 135501 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttga 135560

                                                                          
Query: 406    cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
              ||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||||
Sbjct: 135561 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 135620

                                                                          
Query: 466    gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
              | |||||||| ||||| ||||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 135621 ggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgccgc 135680

                        
Query: 526    gaccggacat 535
              | || |||||
Sbjct: 135681 gccccgacat 135690

to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  432 bits (218), Expect = e-118
 Identities = 287/310 (92%)
 Strand = Plus / Plus

                                                                            
Query: 226      agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
                |||| ||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 29462365 agcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 29462424

                                                                            
Query: 286      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29462425 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 29462484

                                                                            
Query: 346      cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
                ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
Sbjct: 29462485 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttga 29462544

                                                                            
Query: 406      cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
                ||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||||
Sbjct: 29462545 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 29462604

                                                                            
Query: 466      gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
                | |||||||| ||||| ||||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 29462605 ggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgccgc 29462664

                          
Query: 526      gaccggacat 535
                | || |||||
Sbjct: 29462665 gccccgacat 29462674

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  432 bits (218), Expect = e-118
 Identities = 290/314 (92%)
 Strand = Plus / Minus

                                                                            
Query: 224      tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
                |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 35834193 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 35834134

                                                                            
Query: 284      ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
                |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 35834133 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 35834074

                                                                            
Query: 344      ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
                ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 35834073 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 35834014

                                                                            
Query: 404      cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
                ||||||||| | ||| ||||| | |||||| |||||||||||||||||||||||||||||
Sbjct: 35834013 cacgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtc 35833954

                                                                            
Query: 464      gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
                ||| |||||||| || || | ||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 35833953 gcggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgcc 35833894

                              
Query: 524      gcgaccggacatgg 537
                ||| || |||||||
Sbjct: 35833893 gcgccccgacatgg 35833880

to top

>dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0506B12
          Length = 170759

 Score =  432 bits (218), Expect = e-118
 Identities = 290/314 (92%)
 Strand = Plus / Minus

                                                                         
Query: 224   tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
             |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 98651 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 98592

                                                                         
Query: 284   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 98591 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 98532

                                                                         
Query: 344   ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
             ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 98531 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 98472

                                                                         
Query: 404   cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
             ||||||||| | ||| ||||| | |||||| |||||||||||||||||||||||||||||
Sbjct: 98471 cacgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtc 98412

                                                                         
Query: 464   gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
             ||| |||||||| || || | ||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 98411 gcggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgcc 98352

                           
Query: 524   gcgaccggacatgg 537
             ||| || |||||||
Sbjct: 98351 gcgccccgacatgg 98338

to top

>dbj|AK059019.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-B02, full
           insert sequence
          Length = 594

 Score =  432 bits (218), Expect = e-118
 Identities = 287/310 (92%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 386 agcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 327

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 267

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
Sbjct: 266 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttga 207

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| | ||| ||||| | |||||| |||||||||||||| ||||||||||||||||
Sbjct: 206 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 147

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | |||||||| ||||| ||||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 146 ggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgccgc 87

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 86  gccccgacat 77

to top

>dbj|AK058436.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-F07, full
            insert sequence
          Length = 1449

 Score =  432 bits (218), Expect = e-118
 Identities = 290/314 (92%)
 Strand = Plus / Minus

                                                                        
Query: 224  tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
            |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 1158 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 1099

                                                                        
Query: 284  ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 1098 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 1039

                                                                        
Query: 344  ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
            ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 1038 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 979

                                                                        
Query: 404  cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            ||||||||| | ||| ||||| | |||||| |||||||||||||||||||||||||||||
Sbjct: 978  cacgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtc 919

                                                                        
Query: 464  gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            ||| |||||||| || || | ||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 918  gcggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgcc 859

                          
Query: 524  gcgaccggacatgg 537
            ||| || |||||||
Sbjct: 858  gcgccccgacatgg 845

to top

>ref|XM_467181.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 312

 Score =  428 bits (216), Expect = e-117
 Identities = 288/312 (92%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 312 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 252 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 192 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           |||||| || | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 132 cacgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 73

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||| |||||||| ||||| ||||| || ||||||||||| || ||||| |||||||||||
Sbjct: 72  gcggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgcc 13

                       
Query: 524 gcgaccggacat 535
           ||| || |||||
Sbjct: 12  gcgcccagacat 1

to top

>ref|NM_190485.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  428 bits (216), Expect = e-117
 Identities = 288/312 (92%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 312 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 252 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 192 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| | ||| ||||| | |||||| |||||||||||||||||||||||||||||
Sbjct: 132 cacgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtc 73

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||| |||||||| || || | ||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 72  gcggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgcc 13

                       
Query: 524 gcgaccggacat 535
           ||| || |||||
Sbjct: 12  gcgccccgacat 1

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  428 bits (216), Expect = e-117
 Identities = 288/312 (92%)
 Strand = Plus / Plus

                                                                            
Query: 224      tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
                |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 28012829 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 28012888

                                                                            
Query: 284      ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
                |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 28012889 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 28012948

                                                                            
Query: 344      ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
                ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 28012949 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 28013008

                                                                            
Query: 404      cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
                |||||| || | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 28013009 cacgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 28013068

                                                                            
Query: 464      gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
                ||| |||||||| ||||| ||||| || ||||||||||| || ||||| |||||||||||
Sbjct: 28013069 gcggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgcc 28013128

                            
Query: 524      gcgaccggacat 535
                ||| || |||||
Sbjct: 28013129 gcgcccagacat 28013140

to top

>dbj|AP004255.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1212_A08
          Length = 119304

 Score =  428 bits (216), Expect = e-117
 Identities = 288/312 (92%)
 Strand = Plus / Plus

                                                                         
Query: 224   tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
             |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 56491 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 56550

                                                                         
Query: 284   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 56551 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 56610

                                                                         
Query: 344   ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
             ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 56611 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 56670

                                                                         
Query: 404   cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
             |||||| || | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 56671 cacgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 56730

                                                                         
Query: 464   gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
             ||| |||||||| ||||| ||||| || ||||||||||| || ||||| |||||||||||
Sbjct: 56731 gcggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgcc 56790

                         
Query: 524   gcgaccggacat 535
             ||| || |||||
Sbjct: 56791 gcgcccagacat 56802

to top

>dbj|AP004071.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1717_A09
          Length = 203132

 Score =  428 bits (216), Expect = e-117
 Identities = 288/312 (92%)
 Strand = Plus / Plus

                                                                        
Query: 224  tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
            |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 2476 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 2535

                                                                        
Query: 284  ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 2536 ggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgtt 2595

                                                                        
Query: 344  ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
            ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 2596 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 2655

                                                                        
Query: 404  cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            |||||| || | ||| ||||| | |||||| |||||||||||||| ||||||||||||||
Sbjct: 2656 cacgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 2715

                                                                        
Query: 464  gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            ||| |||||||| ||||| ||||| || ||||||||||| || ||||| |||||||||||
Sbjct: 2716 gcggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgcc 2775

                        
Query: 524  gcgaccggacat 535
            ||| || |||||
Sbjct: 2776 gcgcccagacat 2787

to top

>gb|M12277.1|WHTH4091 Wheat histone H4 TH091 gene, complete cds
          Length = 727

 Score =  428 bits (216), Expect = e-117
 Identities = 288/312 (92%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 562 agcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 503

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 502 cggtgacggttttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 443

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           |||||||||||||||| || ||||||||||||||||||||||| || |||||||||||||
Sbjct: 442 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 383

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| | ||||||||| | |||||| |||||||||||||||||||||||||||||||
Sbjct: 382 cgccgcccctcctggccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 323

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | || ||||||||||| |||||||||||||||||||| || ||||| || |||||| |||
Sbjct: 322 ggaggaccttccggtgccgcttggcgccgcccttgcccagccccttgccgcccttgtcgc 263

                       
Query: 526 gaccggacatgg 537
           | || |||||||
Sbjct: 262 gcccagacatgg 251

to top

>gb|BT017776.1| Zea mays clone EL01N0503B03.c mRNA sequence
          Length = 622

 Score =  424 bits (214), Expect = e-115
 Identities = 286/310 (92%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 380 agcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 321

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 320 cggtcacggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 261

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 260 cgagaaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 201

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           |||| || | ||| ||||| | |||||| |||||||||||||||||||||||||||||||
Sbjct: 200 cgccacccctcctagccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 141

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | |||||||||||||| ||||| |||||||||||||| || ||||| || ||||||||||
Sbjct: 140 ggagcaccttccggtggcgcttcgcgccgcccttgcccagacccttgccgcccttgccgc 81

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 80  gcccagacat 71

to top

>gb|M13370.1|MZEH4C14 Maize (Zea mays) histone H4 gene (H4C14), complete cds
          Length = 1135

 Score =  422 bits (213), Expect = e-115
 Identities = 282/305 (92%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||| 
Sbjct: 776 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtc 717

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 716 acggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaga 657

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 656 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgcca 597

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || | ||| ||||| | |||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 596 cccctcctagccagcctccggatcgccggcttggtgatgccctggatgttgtcgcggagc 537

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||||||||| ||||| |||||||||||||| || ||||| || ||||||||||| || 
Sbjct: 536 accttccggtggcgcttcgcgccgcccttgcccagacccttgccgcccttgccgcgccca 477

                
Query: 531 gacat 535
           |||||
Sbjct: 476 gacat 472

to top

>gb|AC137596.2| Oryza sativa (japonica cultivar-group) chromosome 9 clone
             OSJNBb0031H05, complete sequence
          Length = 141200

 Score =  416 bits (210), Expect = e-113
 Identities = 276/298 (92%)
 Strand = Plus / Plus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 67515 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 67574

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 67575 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 67634

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             ||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||
Sbjct: 67635 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 67694

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             ||||||| | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||
Sbjct: 67695 cgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtcgc 67754

                                                                       
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
             |||||||||||| ||| | ||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 67755 gcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttgcc 67812

to top

>dbj|AP005564.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1228_C03, complete sequence
          Length = 31468

 Score =  416 bits (210), Expect = e-113
 Identities = 276/298 (92%)
 Strand = Plus / Plus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 19213 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 19272

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 19273 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 19332

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             ||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||
Sbjct: 19333 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 19392

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             ||||||| | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||
Sbjct: 19393 cgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtcgc 19452

                                                                       
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
             |||||||||||| ||| | ||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 19453 gcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttgcc 19510

to top

>ref|NM_197569.1| Oryza sativa (japonica cultivar-group) histone H4
           (OSJNBb0064P21.1), mRNA
          Length = 372

 Score =  414 bits (209), Expect = e-112
 Identities = 287/313 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 372 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 313

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 253

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 252 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 193

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| | ||| ||||| | |||||| || ||||| ||||| ||||||||||||||
Sbjct: 192 cacgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtc 133

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||||| ||| | ||| ||||| |||||||| || ||||| |||||||||||
Sbjct: 132 gcgcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 73

                        
Query: 524 gcgaccggacatg 536
            || || ||||||
Sbjct: 72  acggcccgacatg 60

to top

>gb|AC096782.6| Oryza sativa chromosome 10 BAC OSJNBa0025B05 genomic sequence,
            complete sequence
          Length = 14849

 Score =  414 bits (209), Expect = e-112
 Identities = 287/313 (91%)
 Strand = Plus / Minus

                                                                        
Query: 224  tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
            |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 4264 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 4205

                                                                        
Query: 284  ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4204 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 4145

                                                                        
Query: 344  ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
            ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 4144 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 4085

                                                                        
Query: 404  cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            ||||||||| | ||| ||||| | |||||| || ||||| ||||| ||||||||||||||
Sbjct: 4084 cacgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtc 4025

                                                                        
Query: 464  gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            |||||||||||||| ||| | ||| ||||| |||||||| || ||||| |||||||||||
Sbjct: 4024 gcgcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 3965

                         
Query: 524  gcgaccggacatg 536
             || || ||||||
Sbjct: 3964 acggcccgacatg 3952

to top

>gb|AC073166.7| Oryza sativa chromosome 10 BAC OSJNBb0064P21 genomic sequence,
            complete sequence
          Length = 142114

 Score =  414 bits (209), Expect = e-112
 Identities = 287/313 (91%)
 Strand = Plus / Plus

                                                                        
Query: 224  tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
            |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 5634 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 5693

                                                                        
Query: 284  ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5694 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 5753

                                                                        
Query: 344  ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
            ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 5754 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 5813

                                                                        
Query: 404  cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            ||||||||| | ||| ||||| | |||||| || ||||| ||||| ||||||||||||||
Sbjct: 5814 cacgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtc 5873

                                                                        
Query: 464  gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            |||||||||||||| ||| | ||| ||||| |||||||| || ||||| |||||||||||
Sbjct: 5874 gcgcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 5933

                         
Query: 524  gcgaccggacatg 536
             || || ||||||
Sbjct: 5934 acggcccgacatg 5946

to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  414 bits (209), Expect = e-112
 Identities = 287/313 (91%)
 Strand = Plus / Plus

                                                                            
Query: 224      tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
                |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 20500344 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 20500403

                                                                            
Query: 284      ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20500404 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 20500463

                                                                            
Query: 344      ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
                ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 20500464 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 20500523

                                                                            
Query: 404      cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
                ||||||||| | ||| ||||| | |||||| || ||||| ||||| ||||||||||||||
Sbjct: 20500524 cacgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtc 20500583

                                                                            
Query: 464      gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
                |||||||||||||| ||| | ||| ||||| |||||||| || ||||| |||||||||||
Sbjct: 20500584 gcgcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 20500643

                             
Query: 524      gcgaccggacatg 536
                 || || ||||||
Sbjct: 20500644 acggcccgacatg 20500656

to top

>dbj|AK119699.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-D04, full
           insert sequence
          Length = 544

 Score =  414 bits (209), Expect = e-112
 Identities = 287/313 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 386 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 327

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 266 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 207

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| | ||| ||||| | |||||| || ||||| ||||| ||||||||||||||
Sbjct: 206 cacgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtc 147

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||||| ||| | ||| ||||| |||||||| || ||||| |||||||||||
Sbjct: 146 gcgcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 87

                        
Query: 524 gcgaccggacatg 536
            || || ||||||
Sbjct: 86  acggcccgacatg 74

to top

>dbj|AK059098.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-C07, full
           insert sequence
          Length = 531

 Score =  414 bits (209), Expect = e-112
 Identities = 287/313 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 382 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 323

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 322 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 263

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 262 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 203

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| | ||| ||||| | |||||| || ||||| ||||| ||||||||||||||
Sbjct: 202 cacgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtc 143

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||||| ||| | ||| ||||| |||||||| || ||||| |||||||||||
Sbjct: 142 gcgcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 83

                        
Query: 524 gcgaccggacatg 536
            || || ||||||
Sbjct: 82  acggcccgacatg 70

to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  414 bits (209), Expect = e-112
 Identities = 287/313 (91%)
 Strand = Plus / Plus

                                                                            
Query: 224      tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
                |||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 20511616 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 20511675

                                                                            
Query: 284      ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20511676 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 20511735

                                                                            
Query: 344      ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
                ||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 20511736 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgctt 20511795

                                                                            
Query: 404      cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
                ||||||||| | ||| ||||| | |||||| || ||||| ||||| ||||||||||||||
Sbjct: 20511796 cacgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtc 20511855

                                                                            
Query: 464      gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
                |||||||||||||| ||| | ||| ||||| |||||||| || ||||| |||||||||||
Sbjct: 20511856 gcgcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 20511915

                             
Query: 524      gcgaccggacatg 536
                 || || ||||||
Sbjct: 20511916 acggcccgacatg 20511928

to top

>gb|M13377.1|MZEH4C7 Maize (Zea mays) histone H4 gene (H4C7), complete cds
          Length = 868

 Score =  402 bits (203), Expect = e-109
 Identities = 287/315 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           ||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 661 tcagccgccaaatccgtagagggtgcggccctgccgcttgagcgcgtagacgacgtccat 602

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||| ||
Sbjct: 601 ggcggtgacggtcttacggcgggcgtgctccgtgtaggtgacagcgtcgcgaatgacatt 542

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 541 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 482

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| |  || ||||| | |||||| |||||||| || |||||||||||||||||
Sbjct: 481 cacgccgccccttctcgccagcctccggatcgccggcttcgtaatgccctggatgttgtc 422

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||| || ||||| ||||||||||| |||||||||||||| || |||||||| ||||| ||
Sbjct: 421 gcggaggaccttgcggtgacgcttcgcgccgcccttgcccagccccttcccgccctttcc 362

                          
Query: 524 gcgaccggacatggt 538
           ||| || ||||||||
Sbjct: 361 gcgccccgacatggt 347

to top

>gb|M36659.1|MZEH4A Corn histone H4 (H4C13) gene, complete cds
          Length = 949

 Score =  402 bits (203), Expect = e-109
 Identities = 287/315 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           ||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 649 tcagccgccaaatccgtagagggtgcggccctgccgcttgagcgcgtagacgacgtccat 590

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 589 ggcggtgacggtcttacggcgggcgtgctccgtgtaggtgacagcgtcgcgaatgacgtt 530

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 529 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 470

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||||||||| |  || ||||| | |||||| |||||||| || |||||||||||||||||
Sbjct: 469 cacgccgccccttctcgccagcctccggatcgccggcttcgtaatgccctggatgttgtc 410

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||| || ||||| ||||||||||| ||||||||||| || || |||||||| ||||| ||
Sbjct: 409 gcggaggaccttgcggtgacgcttcgcgccgccctttcccagccccttcccgccctttcc 350

                          
Query: 524 gcgaccggacatggt 538
           ||| || ||||||||
Sbjct: 349 gcgccccgacatggt 335

to top

>ref|XM_849156.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611486), mRNA
          Length = 444

 Score =  400 bits (202), Expect = e-108
 Identities = 280/306 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 444 tcagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccat 385

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||| ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 384 ggccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgtt 325

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 324 ctccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgctt 265

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            |||||||| |||| |||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 264 gacgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtc 205

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||| ||||| |||||||||||||||||||| || |||||||| ||||||||
Sbjct: 204 gcgcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgcc 145

                 
Query: 524 gcgacc 529
           ||||||
Sbjct: 144 gcgacc 139

to top

>gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H4-VII genes, complete cds
          Length = 2297

 Score =  400 bits (202), Expect = e-108
 Identities = 274/298 (91%)
 Strand = Plus / Plus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            |||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 1690 agccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatgg 1749

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            | ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1750 ccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 1809

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            | ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 1810 ccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttga 1869

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            ||||||| ||||  ||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 1870 cgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgc 1929

                                                                      
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            |||||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 1930 gcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 1987



 Score =  400 bits (202), Expect = e-108
 Identities = 274/298 (91%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 510 agccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatgg 451

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||
Sbjct: 450 ccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 391

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 390 ccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttga 331

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| ||||  ||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 330 cgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgc 271

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 270 gcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 213

to top

>ref|NM_001037845.1| Gallus gallus germinal histone H4 gene (LOC417946), mRNA
          Length = 312

 Score =  400 bits (202), Expect = e-108
 Identities = 274/298 (91%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 ccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 190 ccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttga 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| ||||  ||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgc 71

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13

to top

>ref|NM_001037843.1| Gallus gallus similar to germinal histone H4 gene (LOC417950), mRNA
          Length = 312

 Score =  400 bits (202), Expect = e-108
 Identities = 274/298 (91%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 ccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 190 ccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttga 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| ||||  ||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgc 71

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13

to top

>gb|M74534.1|CHKHIST4B Chicken histone H4 protein gene, complete cds
          Length = 661

 Score =  400 bits (202), Expect = e-108
 Identities = 274/298 (91%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 470 agccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatgg 411

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||
Sbjct: 410 ccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 350 ccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttga 291

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| ||||  ||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 290 cgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgc 231

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 230 gcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 173

to top

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  398 bits (201), Expect = e-108
 Identities = 285/313 (91%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 428 agccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagaccacgtccatgg 369

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| ||||||||   ||||||||||||||||||||||||||||||||| |||||||
Sbjct: 368 ccgtgaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttct 309

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 308 ccaggaacaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttga 249

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| ||||  ||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 248 cgccgccgcgccgcgccaggcgccggatggccggcttggtgatgccctggatgttgtcgc 189

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           |||||||||| ||||| ||||||||||| ||||||||||| |||||||| |||||||| |
Sbjct: 188 gcagcaccttgcggtgccgcttggcgccccccttgccgagccccttcccgcccttgcctc 129

                        
Query: 526 gaccggacatggt 538
             |||||||||||
Sbjct: 128 tgccggacatggt 116



 Score =  391 bits (197), Expect = e-105
 Identities = 284/313 (90%)
 Strand = Plus / Plus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            |||||||||| |||||||||||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 4290 agccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagaccacgtccatgg 4349

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            | ||||| ||||||||   ||||||||||||||||||||||||||||||||| |||||||
Sbjct: 4350 ccgtgaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttct 4409

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            | ||||| | ||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 4410 ccaggaacaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttga 4469

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            ||||||| ||||  ||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 4470 cgccgccgcgccgcgccaggcgccggatggccggcttggtgatgccctggatgttgtcgc 4529

                                                                        
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
            ||| |||||| ||||| ||||||||||| ||||||||||| |||||||| |||||||| |
Sbjct: 4530 gcaacaccttgcggtgccgcttggcgccccccttgccgagccccttcccgcccttgcctc 4589

                         
Query: 526  gaccggacatggt 538
              |||||||||||
Sbjct: 4590 tgccggacatggt 4602

to top

>ref|XM_425463.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC427889), mRNA
          Length = 312

 Score =  396 bits (200), Expect = e-107
 Identities = 272/296 (91%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| 
Sbjct: 308 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 249

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 248 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 189

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 188 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 129

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           ||||| ||||  ||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 128 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 69

                                                                   
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 68  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13

to top

>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC417952), mRNA
          Length = 1374

 Score =  396 bits (200), Expect = e-107
 Identities = 272/296 (91%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| 
Sbjct: 308 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 249

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 248 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 189

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 188 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 129

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           ||||| ||||  ||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 128 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 69

                                                                   
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 68  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13

to top

>ref|XM_849188.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611513), mRNA
          Length = 450

 Score =  396 bits (200), Expect = e-107
 Identities = 284/312 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 450 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccat 391

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||| ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 390 ggccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgtt 331

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 330 ctccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgctt 271

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            |||||||| |||| |||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 270 gacgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtc 211

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||| ||||| |||||||||||||||||||| || |||||||| ||||||||
Sbjct: 210 gcgcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgcc 151

                       
Query: 524 gcgaccggacat 535
           |||||| |||||
Sbjct: 150 gcgaccagacat 139

to top

>ref|XM_849161.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611490), mRNA
          Length = 312

 Score =  396 bits (200), Expect = e-107
 Identities = 284/312 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 312 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||| ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 252 ggccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgtt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 192 ctccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            |||||||| |||| |||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 132 gacgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtc 73

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||| ||||| |||||||||||||||||||| || |||||||| ||||||||
Sbjct: 72  gcgcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgcc 13

                       
Query: 524 gcgaccggacat 535
           |||||| |||||
Sbjct: 12  gcgaccagacat 1

to top

>ref|XM_848746.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611106), mRNA
          Length = 312

 Score =  396 bits (200), Expect = e-107
 Identities = 284/312 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 312 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||| ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 252 ggccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgtt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 192 ctccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            |||||||| |||| |||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 132 gacgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtc 73

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||| ||||| |||||||||||||||||||| || |||||||| ||||||||
Sbjct: 72  gcgcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgcc 13

                       
Query: 524 gcgaccggacat 535
           |||||| |||||
Sbjct: 12  gcgaccagacat 1

to top

>ref|XM_545382.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488260), mRNA
          Length = 312

 Score =  396 bits (200), Expect = e-107
 Identities = 284/312 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 312 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||| ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 252 ggccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgtt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 192 ctccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            |||||||| |||| |||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 132 gacgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtc 73

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||| ||||| |||||||||||||||||||| || |||||||| ||||||||
Sbjct: 72  gcgcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgcc 13

                       
Query: 524 gcgaccggacat 535
           |||||| |||||
Sbjct: 12  gcgaccagacat 1

to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  396 bits (200), Expect = e-107
 Identities = 272/296 (91%)
 Strand = Plus / Plus

                                                                        
Query: 228  ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
            |||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| 
Sbjct: 6357 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 6416

                                                                        
Query: 288  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
            ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 6417 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 6476

                                                                        
Query: 348  aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
            ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 6477 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 6536

                                                                        
Query: 408  ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
            ||||| ||||  ||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 6537 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 6596

                                                                    
Query: 468  agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            |||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 6597 agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 6652



 Score =  389 bits (196), Expect = e-105
 Identities = 271/296 (91%)
 Strand = Plus / Minus

                                                                        
Query: 228  ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
            |||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| 
Sbjct: 1095 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 1036

                                                                        
Query: 288  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
            ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1035 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 976

                                                                        
Query: 348  aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
            ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 975  aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 916

                                                                        
Query: 408  ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
            ||||| ||||  ||||| || ||||||||||||||||||||||||||||| |||||||||
Sbjct: 915  ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatattgtcgcgc 856

                                                                    
Query: 468  agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            |||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 855  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 800

to top

>ref|XM_425458.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC427884), mRNA
          Length = 516

 Score =  392 bits (198), Expect = e-106
 Identities = 273/298 (91%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 514 agccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatgg 455

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| ||||| |    ||||||||||||||||||||||||||||||||| |||||||
Sbjct: 454 ccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggataacgttct 395

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 394 ccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttga 335

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| ||||  ||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 334 cgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgc 275

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 274 gcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 217

to top

>gb|M74533.1|CHKHIST4A Chicken histone H4 protein gene, complete cds
          Length = 630

 Score =  392 bits (198), Expect = e-106
 Identities = 273/298 (91%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||| ||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 453 agccgccgaagccgtagagagtgcgtccctggcgcttgagcgcgtagaccacgtccatgg 394

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||
Sbjct: 393 ccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 334

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 333 ccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttga 274

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| ||||  ||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 273 cgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgc 214

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 213 gcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 156

to top

>ref|XM_848870.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
            (LOC611231), mRNA
          Length = 1428

 Score =  389 bits (196), Expect = e-105
 Identities = 283/312 (90%)
 Strand = Plus / Minus

                                                                        
Query: 224  tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
            |||||||||||| |||||||||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 1428 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcatagaccacgtccat 1369

                                                                        
Query: 284  ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
            ||| ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1368 ggccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgtt 1309

                                                                        
Query: 344  ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
            ||| ||||| | ||||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 1308 ctccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgctt 1249

                                                                        
Query: 404  cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
             |||||||| |||| |||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 1248 gacgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtc 1189

                                                                        
Query: 464  gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            |||||||||||| ||||| |||||||||||||||||||| || |||||||| ||||||||
Sbjct: 1188 gcgcagcaccttgcggtggcgcttggcgccgcccttgcctagtcccttcccgcccttgcc 1129

                        
Query: 524  gcgaccggacat 535
            |||||| |||||
Sbjct: 1128 gcgaccagacat 1117

to top

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC417953), mRNA
          Length = 2271

 Score =  387 bits (195), Expect = e-104
 Identities = 270/295 (91%)
 Strand = Plus / Minus

                                                                       
Query: 229 cgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcgg 288
           ||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| |
Sbjct: 640 cgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggccg 581

                                                                       
Query: 289 tgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcga 348
           |||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 580 tgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcca 521

                                                                       
Query: 349 ggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgc 408
           |||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 520 ggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacgc 461

                                                                       
Query: 409 cgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgca 468
           |||| ||||  ||||| || ||||||||||||||||||||||||||||||||||||||||
Sbjct: 460 cgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgca 401

                                                                  
Query: 469 gcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||||||| ||||| ||||||||||||||||| ||||| |||||||| ||||||||
Sbjct: 400 gcaccttgcggtggcgcttggcgccgcccttaccgagccccttcccgcccttgcc 346

to top

>ref|XM_545387.2| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488265), mRNA
          Length = 714

 Score =  387 bits (195), Expect = e-104
 Identities = 279/307 (90%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||||| |||
Sbjct: 707 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggccgtg 648

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||| |||
Sbjct: 647 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttctccagg 588

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||
Sbjct: 587 aacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccg 528

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || |||| |||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 527 ccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgcgcagc 468

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| ||||| |||||||||||||||||||| || |||||||| |||||||||||||| 
Sbjct: 467 accttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgcgacca 408

                  
Query: 531 gacatgg 537
           |||||||
Sbjct: 407 gacatgg 401

to top

>gb|BT018251.1| Zea mays clone EL01N0563H01.c mRNA sequence
          Length = 594

 Score =  385 bits (194), Expect = e-103
 Identities = 281/310 (90%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||| ||||| |||||||| |||||||||||||||||||
Sbjct: 353 agccgccgaacccgtagagggtgcggccctggcgcttgagggcgtagacgacgtccatgg 294

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           |||||||||| || || ||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 293 cggtgacggtttttcgacgggcgtgctcagtgtaggtgacggcgtcgcggatgacgttct 234

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||
Sbjct: 233 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 174

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| | ||| || || | |||||| |||||||| ||||| || |||||||||||||
Sbjct: 173 cgccgcccctcctcgcaagcctccggatcgccggcttcgtgatcccttggatgttgtcgc 114

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | |||||||| ||||| |||||||||||||||||||| || ||||| || ||||||||||
Sbjct: 113 ggagcaccttgcggtgccgcttggcgccgcccttgcccagccccttgccgcccttgccgc 54

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 53  gcccagacat 44

to top

>gb|U37576.1|GGU37576 Gallus gallus histone H4-VIII gene, complete cds
          Length = 1481

 Score =  381 bits (192), Expect = e-102
 Identities = 270/296 (91%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| ||||||||||||||| |||| ||||||||||||||||| ||||||||||| 
Sbjct: 671 ccgccgaagccgtagagggtgcgttcctggcgcttgagcgcgtagaccacgtccatggcc 612

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 611 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 552

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||||| ||||||||| ||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 551 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgaaatgcgcttgacg 492

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           ||||| ||||  ||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 491 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 432

                                                                   
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 431 agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 376

to top

>emb|X84376.1|ZMHIS4DNA Z.mays histone H4 gene
          Length = 1029

 Score =  379 bits (191), Expect = e-102
 Identities = 283/311 (90%), Gaps = 2/311 (0%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 644 agcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 585

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 cggtcacggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 525

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           |||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 524 cgagaaagatcttgcgcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 465

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           |||| || | ||| ||||| | |||||| |||||||||||||||||||||||||||||||
Sbjct: 464 cgccacccctcctagccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 405

                                                                       
Query: 466 gcagcaccttccggtgacgctt-ggcgccgcccttgccgaggcccttccctcccttgccg 524
           | |||||||||||||| |||||  ||| ||||||| || || ||||| || |||||||||
Sbjct: 404 ggagcaccttccggtggcgcttccgcg-cgccctttcccagacccttgccgcccttgccg 346

                      
Query: 525 cgaccggacat 535
           || || |||||
Sbjct: 345 cgcccagacat 335

to top

>ref|XM_848792.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611148), mRNA
          Length = 312

 Score =  377 bits (190), Expect = e-101
 Identities = 271/298 (90%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 250 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 190 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| |||| |||||| ||||||||||| ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||| ||||| |||||||||||||||||||| || |||||||| ||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgcc 13

to top

>ref|XM_849000.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611344), mRNA
          Length = 456

 Score =  371 bits (187), Expect = 2e-99
 Identities = 271/299 (90%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtc 296
           |||||||||||||| ||||| ||||||||||||||||| ||||||||||| ||||| |||
Sbjct: 443 ccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggccgtgaccgtc 384

                                                                       
Query: 297 ttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatc 356
           |||||   ||||||||| ||||||||||||||||| ||||| |||||||| ||||| | |
Sbjct: 383 ttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttctccaggaacacc 324

                                                                       
Query: 357 ttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgc 416
           |||||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 323 ttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccgccgcgc 264

                                                                       
Query: 417 ctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttc 476
           | |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| 
Sbjct: 263 cgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgcgcagcaccttg 204

                                                                      
Query: 477 cggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccggacat 535
           ||||| |||||||||||||||||||| || |||||||| |||||||| ||||| |||||
Sbjct: 203 cggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccacgacctgacat 145

to top

>ref|XM_848834.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611192), mRNA
          Length = 405

 Score =  365 bits (184), Expect = 1e-97
 Identities = 256/280 (91%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 405 tcagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccat 346

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||| ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||
Sbjct: 345 ggccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgtt 286

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 285 ctccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgctt 226

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            |||||||| |||| |||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 225 gacgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtc 166

                                                   
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccg 503
           |||||||||||| ||||| |||||||||||||||||||||
Sbjct: 165 gcgcagcaccttgcggtggcgcttggcgccgcccttgccg 126

to top

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  363 bits (183), Expect = 4e-97
 Identities = 279/311 (89%)
 Strand = Plus / Plus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 1031 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 1090

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 1091 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 1150

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 1151 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 1210

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            | || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||
Sbjct: 1211 ctcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgc 1270

                                                                        
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
            | || ||||| ||||| ||||| |||||||| ||||| ||||| || |||||||||||||
Sbjct: 1271 ggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccgc 1330

                       
Query: 526  gaccggacatg 536
            |||| ||||||
Sbjct: 1331 gacccgacatg 1341

to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  363 bits (183), Expect = 4e-97
 Identities = 279/311 (89%)
 Strand = Plus / Minus

                                                                          
Query: 226    agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
              ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 127530 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 127471

                                                                          
Query: 286    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
              ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 127470 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 127411

                                                                          
Query: 346    cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
              | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 127410 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 127351

                                                                          
Query: 406    cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
              | || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||
Sbjct: 127350 ctcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgc 127291

                                                                          
Query: 466    gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
              | || ||||| ||||| ||||| |||||||| ||||| ||||| || |||||||||||||
Sbjct: 127290 ggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccgc 127231

                         
Query: 526    gaccggacatg 536
              |||| ||||||
Sbjct: 127230 gacccgacatg 127220



 Score =  351 bits (177), Expect = 2e-93
 Identities = 273/305 (89%)
 Strand = Plus / Plus

                                                                          
Query: 231    ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
              |||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 131053 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 131112

                                                                          
Query: 291    acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
              |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 131113 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 131172

                                                                          
Query: 351    aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
              || | ||| ||||||||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 131173 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 131232

                                                                          
Query: 411    ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
              || |||| |||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 131233 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 131292

                                                                          
Query: 471    accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
              || || || || ||||| ||||| || ||||| ||||| || ||||||||||||||||| 
Sbjct: 131293 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 131352

                   
Query: 531    gacat 535
              |||||
Sbjct: 131353 gacat 131357

to top

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
            complete cds
          Length = 2321

 Score =  363 bits (183), Expect = 4e-97
 Identities = 279/311 (89%)
 Strand = Plus / Minus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 1857 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 1798

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 1797 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 1738

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 1737 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 1678

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            | || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||
Sbjct: 1677 ctcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgc 1618

                                                                        
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
            | || ||||| ||||| ||||| |||||||| ||||| ||||| || |||||||||||||
Sbjct: 1617 ggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccgc 1558

                       
Query: 526  gaccggacatg 536
            |||| ||||||
Sbjct: 1557 gacccgacatg 1547

to top

>gb|AY158965.1| Mus musculus histone protein Hist1h4a gene, complete cds
          Length = 1246

 Score =  363 bits (183), Expect = 4e-97
 Identities = 279/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 747 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 688

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 687 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 628

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 627 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 568

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||
Sbjct: 567 ctcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgc 508

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | || ||||| ||||| ||||| |||||||| ||||| ||||| || |||||||||||||
Sbjct: 507 ggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccgc 448

                      
Query: 526 gaccggacatg 536
           |||| ||||||
Sbjct: 447 gacccgacatg 437

to top

>ref|NM_178192.1| Mus musculus histone 1, H4a (Hist1h4a), mRNA
          Length = 312

 Score =  361 bits (182), Expect = 2e-96
 Identities = 278/310 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 250 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 190 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||
Sbjct: 130 ctcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgc 71

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | || ||||| ||||| ||||| |||||||| ||||| ||||| || |||||||||||||
Sbjct: 70  ggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccgc 11

                     
Query: 526 gaccggacat 535
           |||| |||||
Sbjct: 10  gacccgacat 1

to top

>gb|J00866.1|CHKH43D8 Chicken histone H4 gene, clone pch3dr8
          Length = 675

 Score =  357 bits (180), Expect = 3e-95
 Identities = 267/296 (90%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| 
Sbjct: 578 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 519

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 518 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctca 459

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 458 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 399

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           ||||| ||||  ||||| || || |||||||||||||||||||||||||| |||||||||
Sbjct: 398 ccgccgcgccgcgccaggcggcgaatggccggcttggtgatgccctggatattgtcgcgc 339

                                                                   
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||| ||||| |||||||| || || |||||||| |||||||| ||||||||
Sbjct: 338 agcaccttgcggtggcgcttggcaccccctttgccgagccccttcccgcccttgcc 283

to top

>ref|NM_178193.1| Mus musculus histone 1, H4b (Hist1h4b), mRNA
          Length = 312

 Score =  351 bits (177), Expect = 2e-93
 Identities = 273/305 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 305 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 246

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 245 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 186

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 185 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 126

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || |||| |||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 125 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 66

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || || || ||||| ||||| || ||||| ||||| || ||||||||||||||||| 
Sbjct: 65  actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 6

                
Query: 531 gacat 535
           |||||
Sbjct: 5   gacat 1

to top

>gb|AY158964.1| Mus musculus histone protein Hist1h4b gene, complete cds
          Length = 1186

 Score =  351 bits (177), Expect = 2e-93
 Identities = 273/305 (89%)
 Strand = Plus / Plus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 505 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 564

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 565 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 624

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 625 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 684

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || |||| |||||| || |||||||| |||||||||||||||||||||||||||||||||
Sbjct: 685 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 744

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || || || ||||| ||||| || ||||| ||||| || ||||||||||||||||| 
Sbjct: 745 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 804

                
Query: 531 gacat 535
           |||||
Sbjct: 805 gacat 809

to top

>dbj|AK016310.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930578O05 product:histone 4 protein,
           full insert sequence
          Length = 541

 Score =  349 bits (176), Expect = 6e-93
 Identities = 279/312 (89%), Gaps = 1/312 (0%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 384 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 325

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 324 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 265

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 264 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 205

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||
Sbjct: 204 ctcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgc 145

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgc-ccttgccgaggcccttccctcccttgccg 524
           | || ||||| ||||| ||||| ||||||| | ||||| ||||| || ||||||||||||
Sbjct: 144 ggagaaccttacggtggcgcttagcgccgcgctttgcccaggccttttcctcccttgccg 85

                       
Query: 525 cgaccggacatg 536
           ||||| ||||||
Sbjct: 84  cgacccgacatg 73

to top

>gb|DQ213262.1| Taeniopygia guttata clone 0061P0011F09 histone 1 H4h-like mRNA,
           complete sequence
          Length = 874

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||| ||||| |||||||| |||||||| ||||||||||
Sbjct: 349 agccgccgaagccgtagagggtgcgaccctggcgcttgagggcgtagaccacgtccatgg 290

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| ||||| |    ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 289 ccgtgaccgtcttcctcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 230

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 229 ccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttga 170

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| ||||  ||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 169 cgccgccgcgccgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 110

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           |||||||||| ||||| ||||||||||||||||||||||| || || || |||||||| |
Sbjct: 109 gcagcaccttgcggtggcgcttggcgccgcccttgccgagccctttgccgcccttgcccc 50

                      
Query: 526 gaccggacatg 536
           | || ||||||
Sbjct: 49  ggccagacatg 39

to top

>ref|NM_153173.1| Mus musculus histone 1, H4h (Hist1h4h), mRNA
          Length = 472

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 375 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 316

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 315 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 256

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 255 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 196

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 195 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 136

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||| |||||||||||||| ||||| || || || || |||||||| |||
Sbjct: 135 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 76

                      
Query: 528 ccggacatggt 538
           || ||||||||
Sbjct: 75  ccagacatggt 65

to top

>gb|BC058529.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:6817839),
           partial cds
          Length = 457

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 316 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 257

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 256 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 197

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 196 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 137

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 136 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 77

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||| |||||||||||||| ||||| || || || || |||||||| |||
Sbjct: 76  agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 17

                      
Query: 528 ccggacatggt 538
           || ||||||||
Sbjct: 16  ccagacatggt 6

to top

>gb|BC028550.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:1398106),
           partial cds
          Length = 439

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 320 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 261

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 260 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 201

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 200 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 141

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 140 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 81

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||| |||||||||||||| ||||| || || || || |||||||| |||
Sbjct: 80  agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 21

                      
Query: 528 ccggacatggt 538
           || ||||||||
Sbjct: 20  ccagacatggt 10

to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Plus

                                                                          
Query: 228    ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
              ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 103956 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 104015

                                                                          
Query: 288    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
              ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 104016 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 104075

                                                                          
Query: 348    aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
              ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 104076 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 104135

                                                                          
Query: 408    ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
              || || |||| |||||| || |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 104136 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 104195

                                                                          
Query: 468    agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
              ||||| || ||||| |||||||||||||| ||||| || || || || |||||||| |||
Sbjct: 104196 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 104255

                         
Query: 528    ccggacatggt 538
              || ||||||||
Sbjct: 104256 ccagacatggt 104266



 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                         
Query: 228   ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
             ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 84042 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 83983

                                                                         
Query: 288   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 83982 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 83923

                                                                         
Query: 348   aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
             ||||| | ||| |||||||||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 83922 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 83863

                                                                         
Query: 408   ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
             || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 83862 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 83803

                                                                         
Query: 468   agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
             || ||||| ||||| ||||| |||||||| ||||| ||||| || |||||||| || |||
Sbjct: 83802 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 83743

                       
Query: 528   ccggacatgg 537
             || |||||||
Sbjct: 83742 ccagacatgg 83733



 Score =  315 bits (159), Expect = 9e-83
 Identities = 273/311 (87%)
 Strand = Plus / Plus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 53467 agccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatgg 53526

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 53527 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 53586

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             | ||||| | ||| |||||||| |||||||||||||||||||| || |||||||||||||
Sbjct: 53587 ccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttca 53646

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             | || || |||| |||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 53647 ctcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 53706

                                                                         
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
             |||| || || ||||| ||||| || || ||||| || || ||||| || || || ||||
Sbjct: 53707 gcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccgc 53766

                        
Query: 526   gaccggacatg 536
             | || ||||||
Sbjct: 53767 gtccagacatg 53777

to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Minus

                                                                         
Query: 228   ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
             ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 12024 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 11965

                                                                         
Query: 288   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 11964 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 11905

                                                                         
Query: 348   aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
             ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 11904 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 11845

                                                                         
Query: 408   ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
             || || |||| |||||| || |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 11844 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 11785

                                                                         
Query: 468   agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
             ||||| || ||||| |||||||||||||| ||||| || || || || |||||||| |||
Sbjct: 11784 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 11725

                        
Query: 528   ccggacatggt 538
             || ||||||||
Sbjct: 11724 ccagacatggt 11714



 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Plus

                                                                         
Query: 228   ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
             ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 31942 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 32001

                                                                         
Query: 288   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 32002 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 32061

                                                                         
Query: 348   aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
             ||||| | ||| |||||||||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 32062 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 32121

                                                                         
Query: 408   ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
             || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 32122 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 32181

                                                                         
Query: 468   agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
             || ||||| ||||| ||||| |||||||| ||||| ||||| || |||||||| || |||
Sbjct: 32182 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 32241

                       
Query: 528   ccggacatgg 537
             || |||||||
Sbjct: 32242 ccagacatgg 32251



 Score =  315 bits (159), Expect = 9e-83
 Identities = 273/311 (87%)
 Strand = Plus / Minus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 62326 agccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatgg 62267

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 62266 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 62207

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             | ||||| | ||| |||||||| |||||||||||||||||||| || |||||||||||||
Sbjct: 62206 ccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttca 62147

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             | || || |||| |||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 62146 ctcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 62087

                                                                         
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
             |||| || || ||||| ||||| || || ||||| || || ||||| || || || ||||
Sbjct: 62086 gcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccgc 62027

                        
Query: 526   gaccggacatg 536
             | || ||||||
Sbjct: 62026 gtccagacatg 62016



 Score =  301 bits (152), Expect = 1e-78
 Identities = 272/312 (87%)
 Strand = Plus / Plus

                                                                          
Query: 228    ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
              ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 178557 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 178616

                                                                          
Query: 288    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
              ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 178617 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 178676

                                                                          
Query: 348    aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
              ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 178677 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 178736

                                                                          
Query: 408    ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
              || || |||| |||||| || |||||||| |||||||| |||||||||||||| || || 
Sbjct: 178737 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 178796

                                                                          
Query: 468    agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
              || ||||| ||||| ||||| |||||||| || || ||||| || || ||||| || || 
Sbjct: 178797 agaaccttacggtggcgcttagcgccgcctttcccaaggcctttaccacccttaccacgt 178856

                          
Query: 528    ccggacatggtt 539
              || |||||||||
Sbjct: 178857 ccagacatggtt 178868

to top

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Plus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 32016 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 32075

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             ||||||| ||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 32076 cggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 32135

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 32136 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 32195

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             | || || |||| |||||| || |||||||| ||||| ||||||||||||||||| ||||
Sbjct: 32196 ctcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcgc 32255

                                                                         
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
             ||||||| || ||||| |||||||||||||| ||||| ||||| || ||||| ||||| |
Sbjct: 32256 gcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccac 32315

                        
Query: 526   gaccggacatg 536
             |||| ||||||
Sbjct: 32316 gaccagacatg 32326



 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Minus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 12260 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 12201

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             ||||||| ||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 12200 cggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 12141

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 12140 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 12081

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             | || || |||| |||||| || |||||||| ||||| ||||||||||||||||| ||||
Sbjct: 12080 ctcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcgc 12021

                                                                         
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
             ||||||| || ||||| |||||||||||||| ||||| ||||| || ||||| ||||| |
Sbjct: 12020 gcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccac 11961

                        
Query: 526   gaccggacatg 536
             |||| ||||||
Sbjct: 11960 gaccagacatg 11950

to top

>gb|BC087952.1| Mus musculus histone 1, H4h, mRNA (cDNA clone MGC:107599
           IMAGE:6787571), complete cds
          Length = 472

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 368 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 309

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 308 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 249

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 248 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 189

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 188 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 129

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||| |||||||||||||| ||||| || || || || |||||||| |||
Sbjct: 128 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 69

                      
Query: 528 ccggacatggt 538
           || ||||||||
Sbjct: 68  ccagacatggt 58

to top

>dbj|AK007642.1| Mus musculus 10 day old male pancreas cDNA, RIKEN full-length
           enriched library, clone:1810029H14 product:histone 4
           protein, full insert sequence
          Length = 472

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 375 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 316

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 315 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 256

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 255 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 196

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 195 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 136

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||| |||||||||||||| ||||| || || || || |||||||| |||
Sbjct: 135 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 76

                      
Query: 528 ccggacatggt 538
           || ||||||||
Sbjct: 75  ccagacatggt 65

to top

>gb|AY158960.1| Mus musculus histone protein Hist1h4h gene, complete cds
          Length = 1470

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 873 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 814

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 813 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 754

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 753 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 694

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| ||||| |||||||||||||||||||| |||
Sbjct: 693 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 634

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||| |||||||||||||| ||||| || || || || |||||||| |||
Sbjct: 633 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 574

                      
Query: 528 ccggacatggt 538
           || ||||||||
Sbjct: 573 ccagacatggt 563

to top

>gb|AY158958.1| Mus musculus histone protein Hist1h4m gene, complete cds
          Length = 1309

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 810 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 751

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||| ||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 750 cggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 691

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 690 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 631

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||| ||||||||||||||||| ||||
Sbjct: 630 ctcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcgc 571

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           ||||||| || ||||| |||||||||||||| ||||| ||||| || ||||| ||||| |
Sbjct: 570 gcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccac 511

                      
Query: 526 gaccggacatg 536
           |||| ||||||
Sbjct: 510 gaccagacatg 500

to top

>ref|NM_175657.1| Mus musculus histone 1, H4m (Hist1h4m), mRNA
          Length = 312

 Score =  345 bits (174), Expect = 1e-91
 Identities = 276/310 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||| ||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 250 cggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 190 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||| ||||||||||||||||| ||||
Sbjct: 130 ctcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcgc 71

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           ||||||| || ||||| |||||||||||||| ||||| ||||| || ||||| ||||| |
Sbjct: 70  gcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccac 11

                     
Query: 526 gaccggacat 535
           |||| |||||
Sbjct: 10  gaccagacat 1

to top

>gb|AY158961.1| Mus musculus histone protein Hist1h4f gene, complete cds
          Length = 1309

 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| |||||||||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 629

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 628 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 569

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           || ||||| ||||| ||||| |||||||| ||||| ||||| || |||||||| || |||
Sbjct: 568 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 509

                     
Query: 528 ccggacatgg 537
           || |||||||
Sbjct: 508 ccagacatgg 499

to top

>ref|NM_175655.1| Mus musculus histone 1, H4f (Hist1h4f), mRNA
          Length = 312

 Score =  333 bits (168), Expect = 4e-88
 Identities = 273/308 (88%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 308 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 249

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 248 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 189

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| |||||||||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 188 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 129

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 128 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 69

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           || ||||| ||||| ||||| |||||||| ||||| ||||| || |||||||| || |||
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 9

                   
Query: 528 ccggacat 535
           || |||||
Sbjct: 8   ccagacat 1

to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  331 bits (167), Expect = 2e-87
 Identities = 263/295 (89%)
 Strand = Plus / Plus

                                                                          
Query: 226    agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
              |||| |||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 171186 agcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 171245

                                                                          
Query: 286    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
              ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 171246 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 171305

                                                                          
Query: 346    cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
              | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 171306 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 171365

                                                                          
Query: 406    cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
              | || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||
Sbjct: 171366 ctcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgc 171425

                                                                     
Query: 466    gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
              ||||||| || ||||| ||||||||||| || || ||||| || ||||| |||||
Sbjct: 171426 gcagcactttgcggtggcgcttggcgccacctttaccgagccctttcccgccctt 171480



 Score =  323 bits (163), Expect = 4e-85
 Identities = 262/295 (88%)
 Strand = Plus / Minus

                                                                          
Query: 226    agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
              |||||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 156395 agccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 156336

                                                                          
Query: 286    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
              ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 156335 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 156276

                                                                          
Query: 346    cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
              | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 156275 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 156216

                                                                          
Query: 406    cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
              | || || |||| |||||| || |||||||| ||||| ||||||||||||||||||||||
Sbjct: 156215 ctcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcgc 156156

                                                                     
Query: 466    gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
              ||||||| || ||||| ||||| ||||| || || ||||| || ||||| |||||
Sbjct: 156155 gcagcactttgcggtggcgcttagcgccacctttaccgagccctttcccgccctt 156101

to top

>dbj|AK139521.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
           clone:B020002O07 product:histone 1, H4j, full insert
           sequence
          Length = 594

 Score =  331 bits (167), Expect = 2e-87
 Identities = 263/295 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| |||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 345 agcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 286

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 285 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 226

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 225 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 166

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||
Sbjct: 165 ctcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgc 106

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           ||||||| || ||||| ||||||||||| || || ||||| || ||||| |||||
Sbjct: 105 gcagcactttgcggtggcgcttggcgccacctttaccgagccctttcccgccctt 51

to top

>gb|BC096767.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:30094179)
          Length = 3447

 Score =  331 bits (167), Expect = 2e-87
 Identities = 263/295 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| |||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 325 agcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 266

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 265 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 206

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 205 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 146

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||
Sbjct: 145 ctcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgc 86

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           ||||||| || ||||| ||||||||||| || || ||||| || ||||| |||||
Sbjct: 85  gcagcactttgcggtggcgcttggcgccacctttaccgagccctttcccgccctt 31

to top

>gb|AY158957.1| Mus musculus histone protein Hist1h4k gene, complete cds
          Length = 1309

 Score =  331 bits (167), Expect = 2e-87
 Identities = 263/295 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| |||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 810 agcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 751

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 750 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 691

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 690 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 631

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||
Sbjct: 630 ctcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgc 571

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           ||||||| || ||||| ||||||||||| || || ||||| || ||||| |||||
Sbjct: 570 gcagcactttgcggtggcgcttggcgccacctttaccgagccctttcccgccctt 516

to top

>ref|NM_178211.1| Mus musculus histone 1, H4k (Hist1h4k), mRNA
          Length = 312

 Score =  331 bits (167), Expect = 2e-87
 Identities = 263/295 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| |||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 250 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 190 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||
Sbjct: 130 ctcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgc 71

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           ||||||| || ||||| ||||||||||| || || ||||| || ||||| |||||
Sbjct: 70  gcagcactttgcggtggcgcttggcgccacctttaccgagccctttcccgccctt 16

to top

>gb|BT017111.1| Zea mays clone EL01N0363F03.c mRNA sequence
          Length = 525

 Score =  329 bits (166), Expect = 6e-87
 Identities = 265/298 (88%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || ||||| ||||| ||||| || ||||| ||||| ||||||||||| |
Sbjct: 364 agccgccgaagccatagagagtgcggccctggcgtttgagggcgtacacgacgtccatag 305

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           |||||||||| ||||| ||||||||||| |||||||| || |||||||||||||| ||||
Sbjct: 304 cggtgacggttttgcgacgggcgtgctccgtgtaggtcacagcgtcgcggatgacattct 245

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           |||| |||||||||||||| |||||||||||||||||||| ||||| |||||||||||||
Sbjct: 244 cgagaaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 185

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           |||| || | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||
Sbjct: 184 cgccacccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtcgc 125

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||||||||||||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 124 gcagcaccttccggtgacgcttcgcgccgcccttcccgagccccttgccgcccttgcc 67

to top

>gb|BC019757.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:4205460),
           partial cds
          Length = 733

 Score =  327 bits (165), Expect = 2e-86
 Identities = 273/309 (88%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| ||||| || || || ||||| ||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || |||||||||||||||||||| ||||| ||||| || ||||| ||||| |||
Sbjct: 97  agcactttgcggtgacgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                    
Query: 528 ccggacatg 536
           || ||||||
Sbjct: 37  ccagacatg 29

to top

>emb|X13235.1|MMHIS412 Mouse histone H4 gene (clone 12)
          Length = 637

 Score =  325 bits (164), Expect = 9e-86
 Identities = 275/312 (88%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 541 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 482

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 481 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 422

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 421 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 362

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 361 cccccgcgccgggccaggcggcggatggcaggcttggtgatgccctggatgttatcgcgg 302

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           || ||||| ||||| ||||| |||||||| || || ||||| || || |||||||| || 
Sbjct: 301 agaaccttacggtggcgcttagcgccgcctttcccaaggcctttaccacccttgccacgt 242

                       
Query: 528 ccggacatggtt 539
           || |||||||||
Sbjct: 241 ccagacatggtt 230

to top

>ref|NM_178210.1| Mus musculus histone 1, H4j (Hist1h4j), mRNA
          Length = 312

 Score =  323 bits (163), Expect = 4e-85
 Identities = 262/295 (88%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 250 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 190 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||| ||||||||||||||||||||||
Sbjct: 130 ctcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcgc 71

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           ||||||| || ||||| ||||| ||||| || || ||||| || ||||| |||||
Sbjct: 70  gcagcactttgcggtggcgcttagcgccacctttaccgagccctttcccgccctt 16

to top

>gb|AY158956.1| Mus musculus histone protein Hist1h4j gene, complete cds
          Length = 1776

 Score =  323 bits (163), Expect = 4e-85
 Identities = 262/295 (88%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 844 agccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 785

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 784 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 725

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 724 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 665

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||| ||||||||||||||||||||||
Sbjct: 664 ctcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcgc 605

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           ||||||| || ||||| ||||| ||||| || || ||||| || ||||| |||||
Sbjct: 604 gcagcactttgcggtggcgcttagcgccacctttaccgagccctttcccgccctt 550

to top

>emb|X13236.1|MMHIS453 Mouse histone H4 gene
          Length = 1678

 Score =  323 bits (163), Expect = 4e-85
 Identities = 269/305 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||||||||| ||||| || ||||||  |||||| |||||||||||||||
Sbjct: 964 ccgaatccgtagagggtgcggccctggcgyttgagccggtagaccacgtccatggcggtg 905

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 904 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 845

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 844 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 785

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || |||| |||||| || |||||||| ||||| |||||||||||||||||||||||||||
Sbjct: 784 ccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcgcgcagc 725

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || || || ||||| ||||| || ||||| ||||| || ||||||||||||||||| 
Sbjct: 724 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 665

                
Query: 531 gacat 535
           |||||
Sbjct: 664 gacat 660

to top

>gb|BT017112.1| Zea mays clone EL01N0363G04.c mRNA sequence
          Length = 666

 Score =  321 bits (162), Expect = 1e-84
 Identities = 264/298 (88%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || || || ||||| ||||| || ||||| ||||| ||||||||||| |
Sbjct: 384 agccgccgaagccataaagagtgcggccctggcgtttgagggcgtacacgacgtccatag 325

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           |||||||||| ||||| ||||||||||| |||||||| || |||||||||||||| ||||
Sbjct: 324 cggtgacggttttgcgacgggcgtgctccgtgtaggtcacagcgtcgcggatgacattct 265

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           |||| |||||||||||||| |||||||||||||||||||| ||||| |||||||||||||
Sbjct: 264 cgagaaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 205

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           |||| || | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||
Sbjct: 204 cgccacccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtcgc 145

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||||||||||||||||||| ||||||||||| ||||| ||||| || ||||||||
Sbjct: 144 gcagcaccttccggtgacgcttcgcgccgcccttcccgagccccttgccgcccttgcc 87

to top

>gb|BC052219.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC:60536
           IMAGE:30017176), complete cds
          Length = 724

 Score =  319 bits (161), Expect = 6e-84
 Identities = 272/309 (88%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| ||||| || || || ||||| ||||||||||||||||| ||||||||||||
Sbjct: 320 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 261

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 260 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 201

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 200 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 141

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| |||||||||||||||||||||||||| || 
Sbjct: 140 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 81

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||| |||||||||||||| ||||| ||||| || ||||| ||||| |||
Sbjct: 80  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 21

                    
Query: 528 ccggacatg 536
           || ||||||
Sbjct: 20  ccagacatg 12

to top

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score =  319 bits (161), Expect = 6e-84
 Identities = 272/309 (88%)
 Strand = Plus / Plus

                                                                         
Query: 228   ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
             |||||||| ||||| || || || ||||| ||||||||||||||||| ||||||||||||
Sbjct: 58372 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 58431

                                                                         
Query: 288   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 58432 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 58491

                                                                         
Query: 348   aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
             ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 58492 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 58551

                                                                         
Query: 408   ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
             || || |||| |||||| || |||||||| |||||||||||||||||||||||||| || 
Sbjct: 58552 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 58611

                                                                         
Query: 468   agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
             ||||| || ||||| |||||||||||||| ||||| ||||| || ||||| ||||| |||
Sbjct: 58612 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 58671

                      
Query: 528   ccggacatg 536
             || ||||||
Sbjct: 58672 ccagacatg 58680

to top

>gb|BC092144.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC:106611
           IMAGE:30612926), complete cds
          Length = 562

 Score =  319 bits (161), Expect = 6e-84
 Identities = 272/309 (88%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| ||||| || || || ||||| ||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||| |||||||||||||| ||||| ||||| || ||||| ||||| |||
Sbjct: 97  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                    
Query: 528 ccggacatg 536
           || ||||||
Sbjct: 37  ccagacatg 29

to top

>ref|NM_175656.2| Mus musculus histone 1, H4i (Hist1h4i), mRNA
          Length = 562

 Score =  319 bits (161), Expect = 6e-84
 Identities = 272/309 (88%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| ||||| || || || ||||| ||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||| |||||||||||||| ||||| ||||| || ||||| ||||| |||
Sbjct: 97  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                    
Query: 528 ccggacatg 536
           || ||||||
Sbjct: 37  ccagacatg 29

to top

>gb|AY158959.1| Mus musculus histone protein Hist1h4i gene, complete cds
          Length = 1309

 Score =  319 bits (161), Expect = 6e-84
 Identities = 272/309 (88%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| ||||| || || || ||||| ||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 629

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| |||||||||||||||||||||||||| || 
Sbjct: 628 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 569

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||| |||||||||||||| ||||| ||||| || ||||| ||||| |||
Sbjct: 568 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 509

                    
Query: 528 ccggacatg 536
           || ||||||
Sbjct: 508 ccagacatg 500

to top

>dbj|AK010085.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310067E17 product:histone 4 protein,
           full insert sequence
          Length = 778

 Score =  315 bits (159), Expect = 9e-83
 Identities = 261/295 (88%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 346 agccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 287

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 286 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 227

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 226 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 167

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||| | ||||| ||||||||||||||||||||||
Sbjct: 166 ctcccccgcgccgggccaggcggcggatgacgggcttcgtgatgccctggatgttgtcgc 107

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           ||||||| || ||||| ||||| ||||| || || ||||| || ||||| |||||
Sbjct: 106 gcagcactttgcggtggcgcttagcgccacctttaccgagccctttcccgccctt 52

to top

>ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (predicted)
            (Hist1h2bm_predicted), mRNA
          Length = 1023

 Score =  315 bits (159), Expect = 9e-83
 Identities = 273/311 (87%)
 Strand = Plus / Minus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            |||| ||||| || |||||||| || ||||| ||||||||||||||||| ||||||||||
Sbjct: 1012 agccaccgaagccatagagggtacggccctggcgcttgagcgcgtagaccacgtccatgg 953

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            ||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||| |
Sbjct: 952  cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgtttt 893

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 892  ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 833

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            | || || |||| |||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 832  ctcctccccgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 773

                                                                        
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
            |||| || || ||||| ||||| |||||||| ||||| || |||||||| |||||||| |
Sbjct: 772  gcaggactttgcggtggcgcttagcgccgcctttgcccagacccttcccgcccttgcctc 713

                       
Query: 526  gaccggacatg 536
            | || ||||||
Sbjct: 712  ggccagacatg 702

to top

>gb|AY158962.1| Mus musculus histone protein Hist1h4d gene, complete cds
          Length = 1309

 Score =  315 bits (159), Expect = 9e-83
 Identities = 273/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 810 agccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatgg 751

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 750 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 691

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| |||||||| |||||||||||||||||||| || |||||||||||||
Sbjct: 690 ccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttca 631

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 630 ctcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 571

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           |||| || || ||||| ||||| || || ||||| || || ||||| || || || ||||
Sbjct: 570 gcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccgc 511

                      
Query: 526 gaccggacatg 536
           | || ||||||
Sbjct: 510 gtccagacatg 500

to top

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
            genes, complete cds
          Length = 1338

 Score =  315 bits (159), Expect = 9e-83
 Identities = 273/311 (87%)
 Strand = Plus / Minus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            |||| ||||| ||||| |||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 1203 agccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 1144

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            |||| |||||||| ||||| |||||||||||||||||||| | |||||||||||||||||
Sbjct: 1143 cggtcacggtctttcggcgagcgtgctcggtgtaggtgaccgagtcgcggatgacgttct 1084

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            | |||||| ||||||||||   |||||||||||||||||| || ||   ||| |||||||
Sbjct: 1083 ccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccgctgatacgcttca 1024

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            | |||||||| |  |||||||| ||||| || ||||||||||||||||||||||||||||
Sbjct: 1023 caccgccacgacgagccagacggcggatagcgggcttggtgatgccctggatgttgtcgc 964

                                                                        
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
            | |||||||| || || |||||||||||||||||||| |||||||| || |||||||| |
Sbjct: 963  ggagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgccac 904

                       
Query: 526  gaccggacatg 536
            | |||||||||
Sbjct: 903  gtccggacatg 893

to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III),
            histone H2B (ch2b-III) and histone H2A (ch2a-III) genes,
            complete cds
          Length = 4582

 Score =  315 bits (159), Expect = 9e-83
 Identities = 273/311 (87%)
 Strand = Plus / Minus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            |||| ||||| ||||| |||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 1465 agccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 1406

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            |||| |||||||||||||| |||||||||||||||||||| | |||||||||||||||||
Sbjct: 1405 cggtcacggtcttgcggcgagcgtgctcggtgtaggtgaccgagtcgcggatgacgttct 1346

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            | |||||| |||| |||||   ||||||||||||||||||||| ||   ||| |||||||
Sbjct: 1345 ccaggaaggtcttcagcaccgtgcgggtctcctcgtagatgaggccgctgatacgcttca 1286

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            | |||||||| |  |||||||| ||||| || ||||| ||||||||||||||||||||||
Sbjct: 1285 caccgccacggcgagccagacggcggatagcgggcttcgtgatgccctggatgttgtcgc 1226

                                                                        
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
            | |||||||| || || |||||||||||||||||||| |||||||| || |||||||| |
Sbjct: 1225 ggagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgccac 1166

                       
Query: 526  gaccggacatg 536
            | |||||||||
Sbjct: 1165 gtccggacatg 1155

to top

>ref|NM_175654.1| Mus musculus histone 1, H4d (Hist1h4d), mRNA
          Length = 312

 Score =  313 bits (158), Expect = 4e-82
 Identities = 236/262 (90%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           ||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 250 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| |||||||| |||||||||||||||||||| || |||||||||||||
Sbjct: 190 ccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttca 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 130 ctcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 71

                                 
Query: 466 gcagcaccttccggtgacgctt 487
           |||| || || ||||| |||||
Sbjct: 70  gcagaactttgcggtggcgctt 49

to top

>dbj|AK011560.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610027B07 product:histone 4
           protein, full insert sequence
          Length = 720

 Score =  311 bits (157), Expect = 1e-81
 Identities = 271/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| ||||| || || || ||||| ||||||||||||||||| ||||||||||||
Sbjct: 348 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 289

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           |||||||||| |||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 288 gtgacggtctcgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 229

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 228 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 169

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| |||||||||||||||||||||||||| || 
Sbjct: 168 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 109

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||| |||||||||||||| ||||| ||||| || ||||| ||||| |||
Sbjct: 108 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 49

                    
Query: 528 ccggacatg 536
           || ||||||
Sbjct: 48  ccagacatg 40

to top

>gb|AY105603.1| Zea mays PCO094685 mRNA sequence
          Length = 731

 Score =  311 bits (157), Expect = 1e-81
 Identities = 268/305 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| ||||| || ||||| ||||| |||||||| ||||| || || ||||||||||||
Sbjct: 385 ccgaacccgtacagagtgcggccctggcgcttgagggcgtacacaacatccatggcggtg 326

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           |||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 325 acggtcttgcggcgagcgtgctcggtgtaggtgaccgcgtcgcggatgacattctcgagg 266

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           |||||||||||||| |||||||| ||||||||||| ||||| ||||| ||||||||||||
Sbjct: 265 aagatcttgagcacgccgcgggtttcctcgtagataagcccggagatacgcttcacgccg 206

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || | ||| ||||| | |||||| |||||||| ||||| ||||||||||||||||| || 
Sbjct: 205 cccctcctcgccagcctccggattgccggcttcgtgataccctggatgttgtcgcggaga 146

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| ||||| || || |||||||||||||| || ||||| || ||||||||||| || 
Sbjct: 145 accttacggtggcgtttcgcgccgcccttgcccagccccttgccgcccttgccgcgccca 86

                
Query: 531 gacat 535
           |||||
Sbjct: 85  gacat 81

to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            |||| ||||| ||||| |||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 1270 agccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 1211

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            |||| |||||||||||||| |||||||||||||| ||||| | |||||||||||||||||
Sbjct: 1210 cggtcacggtcttgcggcgagcgtgctcggtgtatgtgaccgagtcgcggatgacgttct 1151

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            | |||||| ||||||||||   |||||||||||||||||| || ||   ||| |||||||
Sbjct: 1150 ccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccgctgatacgcttca 1091

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            | |||||||| |  |||||||| ||||| || ||||||||||||||||||||||||||||
Sbjct: 1090 caccgccacgacgagccagacggcggatagcgggcttggtgatgccctggatgttgtcgc 1031

                                                                        
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
            | |||||||| || || |||||||| ||||||||||| |||||||| || |||||||| |
Sbjct: 1030 gaagcaccttgcgatggcgcttggcaccgcccttgcccaggcccttgccgcccttgccac 971

                       
Query: 526  gaccggacatg 536
            | |||||||||
Sbjct: 970  gtccggacatg 960

to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            |||| ||||| ||||| |||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 1278 agccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 1219

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            | || |||||||||||||| |||||||||||||||||||||| |||||||||||||||||
Sbjct: 1218 cagtcacggtcttgcggcgagcgtgctcggtgtaggtgacggagtcgcggatgacgttct 1159

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            | |||||| ||||||||||   |||||||||||||||||| || ||   ||| |||||||
Sbjct: 1158 ccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccactgatacgcttca 1099

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            | |||||||| |  |||||||| ||||| || ||||||||||| ||||||||||| ||||
Sbjct: 1098 caccgccacggcgagccagacggcggatagcgggcttggtgatcccctggatgttatcgc 1039

                                                                        
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
            | |||||||| || || |||||||||||||||||||| |||||||| || |||||||| |
Sbjct: 1038 gaagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgccac 979

                       
Query: 526  gaccggacatg 536
            | |||||||||
Sbjct: 978  gtccggacatg 968

to top

>emb|CR707537.2|CNS0G8VX Tetraodon nigroviridis full-length cDNA
          Length = 625

 Score =  303 bits (153), Expect = 3e-79
 Identities = 267/305 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||
Sbjct: 443 agcctccgaagccgtacagggtgcgtccctgccgcttgagcgcgtacaccacatccatgg 384

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||| |    |||||||||||||||||||||||| || ||||| |||||||
Sbjct: 383 cggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgttct 324

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||||||||| |||||||||||||||||||| || |||||||||||||| |
Sbjct: 323 ccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgcttga 264

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| || |  ||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 263 cgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 204

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | |||||||| ||||| ||||||||||| || ||||| ||||| || ||||| |||||||
Sbjct: 203 ggagcaccttgcggtggcgcttggcgcctcctttgcccaggcctttgcctcctttgccgc 144

                
Query: 526 gaccg 530
           |||||
Sbjct: 143 gaccg 139

to top

>ref|XM_543797.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC486670), mRNA
          Length = 561

 Score =  301 bits (152), Expect = 1e-78
 Identities = 272/312 (87%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| ||||| |||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 561 tcagccgccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccat 502

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||| ||||||||   ||||||||| |||||||| || ||||||||||| |||||
Sbjct: 501 ggcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcaccgcgtcgcggatcacgtt 442

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 441 ctccaggaacaccttgagcaccccgcgggtctcctcgtagatgagcccagaaatgcgctt 382

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||| ||||| || | ||| || || |||||||| ||||| ||||||||||||||||||||
Sbjct: 381 caccccgcctcggcgggcaagccggcggatggcgggcttcgtgatgccctggatgttgtc 322

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            ||||| ||||||||||| ||||||||||| |||||||| || || || || || || ||
Sbjct: 321 ccgcaggaccttccggtggcgcttggcgcctcccttgcccagccctttgccgcctttccc 262

                       
Query: 524 gcgaccggacat 535
           ||| ||||||||
Sbjct: 261 gcgcccggacat 250

to top

>emb|CR719166.2|CNS0GHUS Tetraodon nigroviridis full-length cDNA
          Length = 522

 Score =  301 bits (152), Expect = 1e-78
 Identities = 266/304 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||
Sbjct: 343 agcctccgaagccgtacagggtgcgtccctgccgcttgagcgcgtacaccacatccatgg 284

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||| |    |||||||||||||||||||||||| || ||||| |||||||
Sbjct: 283 cggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgttct 224

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||||||||| |||||||||||||||||||| || |||||||||||||| |
Sbjct: 223 ccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgcttga 164

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| || |  ||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 163 cgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 104

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           | |||||||| ||||| ||||||||||| || ||||| ||||| || ||||| |||||||
Sbjct: 103 ggagcaccttgcggtggcgcttggcgcctcctttgcccaggcctttgcctcctttgccgc 44

               
Query: 526 gacc 529
           ||||
Sbjct: 43  gacc 40

to top

>gb|AY263810.1| Eucalyptus globulus histone H4 mRNA, complete cds
          Length = 451

 Score =  301 bits (152), Expect = 1e-78
 Identities = 272/312 (87%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| || || ||||| |  ||||| | |||||||||||| |||||||||||
Sbjct: 312 tcagccgccgaagccatacagggtcctgccctgcctcttgagcgcgtacacgacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           |||||| || ||||| ||||| |||||||| |||||||| |||||||||||||| |||||
Sbjct: 252 ggcggtcaccgtcttccggcgcgcgtgctccgtgtaggtcacggcgtcgcggatcacgtt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||||||||| ||||| |||||||||||||||||||| |||||   ||| |||||
Sbjct: 192 ctccaggaagatcttcagcacgccgcgggtctcctcgtagatcagcccgctgatccgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||| |||||||| | |||||| |||||||| |||||||| ||||||||||||||||||||
Sbjct: 132 caccccgccacggcgggccagccgccggatcgccggcttcgtgatgccctggatgttgtc 73

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||||| ||||| | ||| ||||| |||||||||||||| || ||||| |||||||||||
Sbjct: 72  gcgcaggacctttctgtgccgcttcgcgccgcccttgccaagccccttgcctcccttgcc 13

                       
Query: 524 gcgaccggacat 535
           ||| || |||||
Sbjct: 12  gcggcccgacat 1

to top

>gb|AY158963.1| Mus musculus histone protein Hist1h4c gene, complete cds
          Length = 1309

 Score =  301 bits (152), Expect = 1e-78
 Identities = 272/312 (87%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 629

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| |||||||| |||||||||||||| || || 
Sbjct: 628 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 569

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           || ||||| ||||| ||||| |||||||| || || ||||| || || ||||| || || 
Sbjct: 568 agaaccttacggtggcgcttagcgccgcctttcccaaggcctttaccacccttaccacgt 509

                       
Query: 528 ccggacatggtt 539
           || |||||||||
Sbjct: 508 ccagacatggtt 497

to top

>ref|NM_178208.1| Mus musculus histone 1, H4c (Hist1h4c), mRNA
          Length = 312

 Score =  295 bits (149), Expect = 8e-77
 Identities = 239/269 (88%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 308 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 249

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 248 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 189

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 188 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 129

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |||| |||||| || |||||||| |||||||| |||||||||||||| || || 
Sbjct: 128 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 69

                                        
Query: 468 agcaccttccggtgacgcttggcgccgcc 496
           || ||||| ||||| ||||| ||||||||
Sbjct: 68  agaaccttacggtggcgcttagcgccgcc 40

to top

>gb|AF140034.1|AF140034 Phreatamoeba balamuthi histone H4 mRNA, complete cds
          Length = 394

 Score =  293 bits (148), Expect = 3e-76
 Identities = 238/268 (88%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 325 agccgccgaagccgtagagcgtgcggccctggcgcttgagcgcgtagacaacgtccatgg 266

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| |||||||| | ||||||||| ||||| ||||| | |||||||||||||||||
Sbjct: 265 ccgtgaccgtcttgcgcctggcgtgctccgtgtacgtgaccgagtcgcggatgacgttct 206

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           ||||||||| ||||||||| ||||| ||||||||||||||||||||   ||||||||| |
Sbjct: 205 cgaggaagaccttgagcacgccgcgcgtctcctcgtagatgagcccgctgatgcgcttga 146

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           |||| || || |  ||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 145 cgcccccgcggcgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgc 86

                                       
Query: 466 gcagcaccttccggtgacgcttggcgcc 493
           |||||||||| ||||| | |||||||||
Sbjct: 85  gcagcaccttgcggtgcctcttggcgcc 58

to top

>gb|BC100619.1| Rattus norvegicus germinal histone H4 gene, mRNA (cDNA clone
           MGC:124607 IMAGE:7938313), complete cds
          Length = 1326

 Score =  289 bits (146), Expect = 5e-75
 Identities = 260/298 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || |||||||| || ||||| || ||||| |||||||| ||||||||||
Sbjct: 333 agccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatgg 274

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 273 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 214

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 213 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 154

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || || ||||| ||||||||||||||||||||||||||||
Sbjct: 153 ctcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcgc 94

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||| || || ||||| ||||| |||||||| ||||| | ||| ||||| || |||||
Sbjct: 93  gcaggactttgcggtggcgcttagcgccgcctttgcccaagcctttcccgcctttgcc 36

to top

>ref|NM_022686.2| Rattus norvegicus germinal histone H4 gene (Hist1h4b), mRNA
          Length = 1296

 Score =  289 bits (146), Expect = 5e-75
 Identities = 260/298 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || |||||||| || ||||| || ||||| |||||||| ||||||||||
Sbjct: 329 agccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatgg 270

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 269 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 210

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 209 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 150

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || || ||||| ||||||||||||||||||||||||||||
Sbjct: 149 ctcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcgc 90

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||| || || ||||| ||||| |||||||| ||||| | ||| ||||| || |||||
Sbjct: 89  gcaggactttgcggtggcgcttagcgccgcctttgcccaagcctttcccgcctttgcc 32

to top

>gb|AY936209.1| Rattus norvegicus histone H4 variant H4-v.1 mRNA, complete cds
          Length = 1296

 Score =  289 bits (146), Expect = 5e-75
 Identities = 260/298 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || |||||||| || ||||| || ||||| |||||||| ||||||||||
Sbjct: 329 agccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatgg 270

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 269 cggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 210

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 209 ccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttca 150

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || |||| |||||| || || ||||| ||||||||||||||||||||||||||||
Sbjct: 149 ctcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcgc 90

                                                                     
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           |||| || || ||||| ||||| |||||||| ||||| | ||| ||||| || |||||
Sbjct: 89  gcaggactttgcggtggcgcttagcgccgcctttgcccaagcctttcccgcctttgcc 32

to top

>emb|AJ249813.1|MAL249813 Mortierella alpina histone H3.2 and H4.2 genes for histone H3 and for
            histone H4
          Length = 1860

 Score =  287 bits (145), Expect = 2e-74
 Identities = 268/309 (86%)
 Strand = Plus / Minus

                                                                        
Query: 228  ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
            |||||||| |||||||||||||||||||| |||||||| ||||||||||| || |  | |
Sbjct: 1596 ccgccgaaaccgtagagggtgcgtccctggcgcttgagggcgtagacgacatcgagcgag 1537

                                                                        
Query: 288  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
            ||||||||||||||   ||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 1536 gtgacggtcttgcgcttggcgtgctcagtgtaggtgacggcgtcacggatgacgttctcg 1477

                                                                        
Query: 348  aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
            ||||||| |||||| ||   ||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 1476 aggaagaccttgaggacggagcgggtctcctcgtagatgaggccggagatacgcttgaca 1417

                                                                        
Query: 408  ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
            || ||||| | ||| ||||| |||||||| ||||||||||| |||||||||||||| || 
Sbjct: 1416 ccaccacgacgggcgagacgacggatggcgggcttggtgattccctggatgttgtcacga 1357

                                                                        
Query: 468  agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
            || | ||| |||||||||||||| |||||||| ||||| ||||| |||||||||||||| 
Sbjct: 1356 agaatcttgcggtgacgcttggcaccgccctttccgagaccctttcctcccttgccgcgg 1297

                     
Query: 528  ccggacatg 536
            || ||||||
Sbjct: 1296 ccagacatg 1288

to top

>gb|BC114196.1| Bos taurus histone H4, mRNA (cDNA clone IMAGE:8186024)
          Length = 409

 Score =  287 bits (145), Expect = 2e-74
 Identities = 271/313 (86%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||||||||| ||||||||||| ||||||||
Sbjct: 342 tcagccgccgaagccgtagagggtgcggccctgtcgcttcagcgcgtagaccacgtccat 283

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||
Sbjct: 282 ggcggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgtt 223

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||| ||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 222 ctccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgctt 163

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||| || ||||| |  ||||| ||||| || || |||||||| |||||||||||||| ||
Sbjct: 162 cacaccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatc 103

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            || || || || ||||| ||||| ||||| || ||||| || ||||| || || |||||
Sbjct: 102 acgaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgcc 43

                        
Query: 524 gcgaccggacatg 536
           |||||| ||||||
Sbjct: 42  gcgaccagacatg 30

to top

>dbj|AB179406.1| Macaca fascicularis testis cDNA clone: QtsA-19327, similar to human
           histone 1, H4j (HIST1H4J), mRNA, RefSeq: NM_021968.3
          Length = 2002

 Score =  287 bits (145), Expect = 2e-74
 Identities = 268/309 (86%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| |||||||||||||| ||||| ||||| |||||||| || || |||||||||
Sbjct: 393 ccgccgaaaccgtagagggtgcgaccctggcgcttcagcgcgtaaaccacatccatggcg 334

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||| ||||||||   ||||||||| |||||||| || ||||| ||||| |||||||| 
Sbjct: 333 gtgaccgtcttgcgcttggcgtgctccgtgtaggtcacagcgtcccggatcacgttctcc 274

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           |||||||  || ||||| || |||||||||||||||||||| || |||||||||||||||
Sbjct: 273 aggaagactttcagcaccccacgggtctcctcgtagatgagaccagagatgcgcttcacg 214

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           ||||| || |  || || |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 213 ccgccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatgttgtcacgc 154

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           |||||||| ||||| ||||| |||||||| ||||| || |||||||| || |||||||| 
Sbjct: 153 agcaccttgcggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcgg 94

                    
Query: 528 ccggacatg 536
           || ||||||
Sbjct: 93  ccagacatg 85

to top

>ref|XM_868981.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC527645), mRNA
          Length = 312

 Score =  285 bits (144), Expect = 8e-74
 Identities = 270/312 (86%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||||||||| ||||||||||| ||||||||||| ||||||||
Sbjct: 312 tcagccgccgaagccgtagagggtgcggccctgtcgcttcagcgcgtagaccacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||
Sbjct: 252 ggcggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgtt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||| ||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 192 ctccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||| || ||||| |  ||||| ||||| || || |||||||| |||||||||||||| ||
Sbjct: 132 cacaccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatc 73

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            || || || || ||||| ||||| ||||| || ||||| || ||||| || || |||||
Sbjct: 72  acgaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgcc 13

                       
Query: 524 gcgaccggacat 535
           |||||| |||||
Sbjct: 12  gcgaccagacat 1

to top

>gb|BC062345.1| Homo sapiens cDNA clone IMAGE:6597408
          Length = 392

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 324 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 265

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 264 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 205

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 204 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 145

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 144 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 85

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 84  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 25

                 
Query: 531 gacatg 536
           ||||||
Sbjct: 24  gacatg 19

to top

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Plus

                                                                         
Query: 231   ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
             ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 70023 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 70082

                                                                         
Query: 291   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 70083 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 70142

                                                                         
Query: 351   aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
             || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 70143 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 70202

                                                                         
Query: 411   ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
             || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 70203 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 70262

                                                                         
Query: 471   accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
             || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 70263 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 70322

                   
Query: 531   gacatg 536
             ||||||
Sbjct: 70323 gacatg 70328



 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                         
Query: 231   ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
             ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 63229 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 63170

                                                                         
Query: 291   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 63169 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 63110

                                                                         
Query: 351   aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
             || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 63109 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 63050

                                                                         
Query: 411   ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
             || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 63049 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 62990

                                                                         
Query: 471   accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
             || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 62989 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 62930

                   
Query: 531   gacatg 536
             ||||||
Sbjct: 62929 gacatg 62924



 Score =  192 bits (97), Expect = 9e-46
 Identities = 259/313 (82%)
 Strand = Plus / Minus

                                                                         
Query: 224   tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
             ||||||||| || || || |||||||| ||||| |||||||||||||| || ||||||||
Sbjct: 21253 tcagccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccat 21194

                                                                         
Query: 284   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
             ||| ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||
Sbjct: 21193 ggctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacatt 21134

                                                                         
Query: 344   ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
             ||| |  || |  || || || ||||| ||||||||||| || || || |||||||||||
Sbjct: 21133 ctccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgctt 21074

                                                                         
Query: 404   cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
              ||||| |||||||  ||||| || |||||||| ||||||||||||||||| ||||||||
Sbjct: 21073 aacgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtc 21014

                                                                         
Query: 464   gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
             |||||| || || ||||| ||||| ||||| || ||||| || |||||||| || |||||
Sbjct: 21013 gcgcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgcc 20954

                          
Query: 524   gcgaccggacatg 536
             ||| || ||||||
Sbjct: 20953 gcgcccagacatg 20941

to top

>gb|AY128664.1| Homo sapiens clone HIST1H4K histone H4 gene, complete cds
          Length = 930

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 615 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 556

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 555 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 496

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 495 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 436

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 435 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 376

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 375 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 316

                 
Query: 531 gacatg 536
           ||||||
Sbjct: 315 gacatg 310

to top

>gb|AY128663.1| Homo sapiens clone HIST1H4J histone H4 gene, complete cds
          Length = 930

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 616 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 557

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 556 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 497

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 496 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 437

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 436 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 377

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 376 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 317

                 
Query: 531 gacatg 536
           ||||||
Sbjct: 316 gacatg 311

to top

>emb|CR657174.2|CNS0F61O Tetraodon nigroviridis full-length cDNA
          Length = 517

 Score =  281 bits (142), Expect = 1e-72
 Identities = 266/306 (86%), Gaps = 1/306 (0%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||
Sbjct: 343 tcagcctccgaagccgtacagggtgcgcccctgccgcttgagcgcgtacaccacatccat 284

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||||||||| |    |||||||||||||||||||||||| || ||||| |||||
Sbjct: 283 ggcggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgtt 224

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||||||||| |||||||||||||||||||| || ||||||||||||||
Sbjct: 223 ctccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgctt 164

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            |||||||| || |  ||||| || |||||||| ||||||||||||||||||||||||||
Sbjct: 163 gacgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtc 104

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||| | |||||| ||||| ||||||||||| || ||||| ||||| || ||||| |||||
Sbjct: 103 gcgga-caccttgcggtggcgcttggcgccccctttgcccaggcctttgcctcctttgcc 45

                 
Query: 524 gcgacc 529
           ||||||
Sbjct: 44  gcgacc 39

to top

>emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A22 on chromosome 6p21.2-22.2
             Contains histone genes H2AFE, H2BFE, H4FE and H4FD, ESTs,
             STSs, GSSs and three CpG islands, complete sequence
          Length = 24706

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Plus

                                                                         
Query: 231   ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
             ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 19570 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 19629

                                                                         
Query: 291   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 19630 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 19689

                                                                         
Query: 351   aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
             || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 19690 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 19749

                                                                         
Query: 411   ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
             || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 19750 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 19809

                                                                         
Query: 471   accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
             || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 19810 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 19869

                   
Query: 531   gacatg 536
             ||||||
Sbjct: 19870 gacatg 19875



 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                         
Query: 231   ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
             ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 12776 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 12717

                                                                         
Query: 291   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 12716 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 12657

                                                                         
Query: 351   aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
             || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 12656 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 12597

                                                                         
Query: 411   ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
             || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 12596 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 12537

                                                                         
Query: 471   accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
             || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 12536 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 12477

                   
Query: 531   gacatg 536
             ||||||
Sbjct: 12476 gacatg 12471

to top

>emb|X60484.1|HSH4EHIS H.sapiens H4/e gene for H4 histone
          Length = 859

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 615 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 556

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 555 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 496

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 495 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 436

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 435 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 376

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 375 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 316

                 
Query: 531 gacatg 536
           ||||||
Sbjct: 315 gacatg 310

to top

>emb|X60483.1|HSH4DHIS H.sapiens H4/d gene for H4 histone
          Length = 1528

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 916 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 857

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 856 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 797

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 796 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 737

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 736 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 677

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 676 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 617

                 
Query: 531 gacatg 536
           ||||||
Sbjct: 616 gacatg 611

to top

>gb|BC017361.2| Homo sapiens cDNA clone MGC:29783 IMAGE:4647914, complete cds
          Length = 416

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 324 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 265

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 264 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 205

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 204 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 145

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 144 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 85

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 84  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 25

                 
Query: 531 gacatg 536
           ||||||
Sbjct: 24  gacatg 19

to top

>gb|AF086564.1|HUMZE16D01 Homo sapiens full length insert cDNA clone ZE16D01
          Length = 382

 Score =  281 bits (142), Expect = 1e-72
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 322 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 263

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 262 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 203

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 202 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 143

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 142 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 83

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 82  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 23

                 
Query: 531 gacatg 536
           ||||||
Sbjct: 22  gacatg 17

to top

>ref|NM_021968.3| Homo sapiens histone 1, H4j (HIST1H4J), mRNA
          Length = 356

 Score =  280 bits (141), Expect = 5e-72
 Identities = 264/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 305 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 246

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 186

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 185 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 126

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 125 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 66

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 65  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 6

                
Query: 531 gacat 535
           |||||
Sbjct: 5   gacat 1

to top

>ref|NM_003541.2| Homo sapiens histone 1, H4k (HIST1H4K), mRNA
          Length = 354

 Score =  280 bits (141), Expect = 5e-72
 Identities = 264/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 305 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 246

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 186

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 185 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 126

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || || |  || || |||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 125 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 66

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || ||||| ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 65  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 6

                
Query: 531 gacat 535
           |||||
Sbjct: 5   gacat 1

to top

>gb|DQ400915.1| Elaeis guineensis histone 4 mRNA, complete cds
          Length = 561

 Score =  280 bits (141), Expect = 5e-72
 Identities = 255/293 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| |||||||| |||||||| |||||||||||||||
Sbjct: 358 ccgaagccgtagagggtgcggccctggcgcttgagagcgtagacaacgtccatggcggtg 299

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           |||||||| ||||| |||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 298 acggtcttccggcgagcgtgctccgtgtaggtgacggcgtcgcggataacgttctccagg 239

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           |||||||||||||| || |  ||||||||||||||||| ||   ||| ||||||||||| 
Sbjct: 238 aagatcttgagcacgcctcttgtctcctcgtagatgagaccgctgatacgcttcacgcca 179

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           |||||||  || |||||||||||||| |||||||||||||||||||||||||| || || 
Sbjct: 178 ccacgccgtgcgagacgccggatggcgggcttggtgatgccctggatgttgtcccggagg 119

                                                                
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||||| ||| | ||||| || || ||||| || |  ||||| |||||||||||
Sbjct: 118 accttgcgggggcgctttgcacctccctttcccaaacccttacctcccttgcc 66

to top

>ref|XM_606749.2| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC528329), mRNA
          Length = 312

 Score =  278 bits (140), Expect = 2e-71
 Identities = 269/312 (86%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| |||||||| ||||| ||||||||||| ||||||||||| ||||||||
Sbjct: 312 tcagccgccgaagccgtagagcgtgcggccctgtcgcttcagcgcgtagaccacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||
Sbjct: 252 ggcggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgtt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||| ||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 192 ctccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           ||| || ||||| |  ||||| ||||| || || |||||||| |||||||||||||| ||
Sbjct: 132 cacaccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatc 73

                                                                       
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
            || || || || ||||| ||||| ||||| || ||||| || ||||| || || |||||
Sbjct: 72  acgaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgcc 13

                       
Query: 524 gcgaccggacat 535
           |||||| |||||
Sbjct: 12  gcgaccagacat 1

to top

>gb|BC016336.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:24014
           IMAGE:4101102), complete cds
          Length = 1260

 Score =  274 bits (138), Expect = 3e-70
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 341 agccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 282

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 281 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttct 222

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| | ||| |||||||||||||| |||||||| || || ||||||||||
Sbjct: 221 ccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttca 162

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| || |  || || ||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 161 cgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcgc 102

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           |||||||||| ||||| |||||||| || || || || |||||||| ||||| |||||||
Sbjct: 101 gcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccgc 42

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 41  gtcctgacat 32

to top

>gb|AY128662.1| Homo sapiens clone HIST1H4I histone H4 gene, complete cds
          Length = 930

 Score =  274 bits (138), Expect = 3e-70
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 621 agccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 562

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 561 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttct 502

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| | ||| |||||||||||||| |||||||| || || ||||||||||
Sbjct: 501 ccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttca 442

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| || |  || || ||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 441 cgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcgc 382

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           |||||||||| ||||| |||||||| || || || || |||||||| ||||| |||||||
Sbjct: 381 gcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccgc 322

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 321 gtcctgacat 312

to top

>gb|BC075806.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:87855
           IMAGE:5225467), complete cds
          Length = 1418

 Score =  274 bits (138), Expect = 3e-70
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 322 agccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 263

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 262 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttct 203

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| | ||| |||||||||||||| |||||||| || || ||||||||||
Sbjct: 202 ccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttca 143

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| || |  || || ||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 142 cgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcgc 83

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           |||||||||| ||||| |||||||| || || || || |||||||| ||||| |||||||
Sbjct: 82  gcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccgc 23

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 22  gtcctgacat 13

to top

>gb|BC066250.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79353
           IMAGE:7002105), complete cds
          Length = 365

 Score =  274 bits (138), Expect = 3e-70
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 250 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| | ||| |||||||||||||| |||||||| || || ||||||||||
Sbjct: 190 ccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttca 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| || |  || || ||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 130 cgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcgc 71

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           |||||||||| ||||| |||||||| || || || || |||||||| ||||| |||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccgc 11

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 10  ggccagacat 1

to top

>emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 on chromosome 6p21.31-22.1
             Contains a vomeronasal olfactory 1 receptor chromosome 6-2
             (VN1R6-2P) pseudogene, histone genes H2BFN and H2AFA, the
             gene for a novel protein identical to H2B histone family
             member A (H2BFA), the gene for a novel protein identical
             to H2A histone family member I (H2AFI), a novel histone
             gene similar to H4F2 and three CpG islands, complete
             sequence
          Length = 89016

 Score =  274 bits (138), Expect = 3e-70
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             |||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 62923 agccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 62864

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             ||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 62863 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttct 62804

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             | ||||| | ||| | ||| |||||||||||||| |||||||| || || ||||||||||
Sbjct: 62803 ccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttca 62744

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             ||||||| || |  || || ||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 62743 cgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcgc 62684

                                                                         
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
             |||||||||| ||||| |||||||| || || || || |||||||| ||||| |||||||
Sbjct: 62683 gcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccgc 62624

                       
Query: 526   gaccggacat 535
             | || |||||
Sbjct: 62623 gtcctgacat 62614

to top

>emb|CR599017.1| full-length cDNA clone CS0DC001YE12 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1321

 Score =  274 bits (138), Expect = 3e-70
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 325 agccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 266

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 265 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttct 206

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| | ||| |||||||||||||| |||||||| || || ||||||||||
Sbjct: 205 ccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttca 146

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| || |  || || ||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 145 cgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcgc 86

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           |||||||||| ||||| |||||||| || || || || |||||||| ||||| |||||||
Sbjct: 85  gcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccgc 26

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 25  gtcctgacat 16

to top

>gb|BC067497.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79354
           IMAGE:7002106), complete cds
          Length = 365

 Score =  274 bits (138), Expect = 3e-70
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 250 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| | ||| |||||||||||||| |||||||| || || ||||||||||
Sbjct: 190 ccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttca 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| || |  || || ||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 130 cgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcgc 71

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           |||||||||| ||||| |||||||| || || || || |||||||| ||||| |||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccgc 11

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 10  ggccagacat 1

to top

>ref|NG_000827.2| Homo sapiens genomic histone family microcluster (HFM@) on chromosome 6
          Length = 20621

 Score =  274 bits (138), Expect = 3e-70
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             |||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 12124 agccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 12065

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             ||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 12064 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttct 12005

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             | ||||| | ||| | ||| |||||||||||||| |||||||| || || ||||||||||
Sbjct: 12004 ccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttca 11945

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             ||||||| || |  || || ||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 11944 cgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcgc 11885

                                                                         
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
             |||||||||| ||||| |||||||| || || || || |||||||| ||||| |||||||
Sbjct: 11884 gcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccgc 11825

                       
Query: 526   gaccggacat 535
             | || |||||
Sbjct: 11824 gtcctgacat 11815

to top

>ref|NM_003495.2| Homo sapiens histone 1, H4i (HIST1H4I), mRNA
          Length = 370

 Score =  274 bits (138), Expect = 3e-70
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 250 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| | ||| |||||||||||||| |||||||| || || ||||||||||
Sbjct: 190 ccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttca 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| || |  || || ||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 130 cgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcgc 71

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           |||||||||| ||||| |||||||| || || || || |||||||| ||||| |||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccgc 11

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 10  gtcctgacat 1

to top

>dbj|AB000905.1| Homo sapiens DNA for H4 histone, complete cds
          Length = 1293

 Score =  274 bits (138), Expect = 3e-70
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                        
Query: 226  agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
            |||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 1030 agccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 971

                                                                        
Query: 286  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
            ||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||
Sbjct: 970  cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttct 911

                                                                        
Query: 346  cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
            | ||||| | ||| | ||| |||||||||||||| |||||||| || || ||||||||||
Sbjct: 910  ccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttca 851

                                                                        
Query: 406  cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
            ||||||| || |  || || ||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 850  cgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcgc 791

                                                                        
Query: 466  gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
            |||||||||| ||||| |||||||| || || || || |||||||| ||||| |||||||
Sbjct: 790  gcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccgc 731

                      
Query: 526  gaccggacat 535
            | || |||||
Sbjct: 730  gtcctgacat 721

to top

>ref|XM_976380.1| PREDICTED: Mus musculus similar to germinal histone H4 gene
           (LOC674678), mRNA
          Length = 2984

 Score =  270 bits (136), Expect = 5e-69
 Identities = 235/268 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| ||||| || ||||| ||||| |||||||||||||| || |||||||| |
Sbjct: 475 agccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccatag 416

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| ||||||||   ||||||||||||||| ||||||||||||||||| || ||||
Sbjct: 415 ccgtgaccgtcttgcgcttggcgtgctcggtgtatgtgacggcgtcgcggatcacattct 356

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | |||||| |||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 355 caaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttca 296

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  ||||  |||||||| || |||||||| |||||||||||||||||||
Sbjct: 295 cgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcgc 236

                                       
Query: 466 gcagcaccttccggtgacgcttggcgcc 493
           | || ||||| ||||| |||||||||||
Sbjct: 235 ggagaaccttgcggtgtcgcttggcgcc 208

to top

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score =  270 bits (136), Expect = 5e-69
 Identities = 235/268 (87%)
 Strand = Plus / Minus

                                                                          
Query: 226    agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
              |||||||||| ||||| || ||||| ||||| |||||||||||||| || |||||||| |
Sbjct: 113213 agccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccatag 113154

                                                                          
Query: 286    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
              | || || ||||||||   ||||||||||||||||||||||||||||||||| || ||||
Sbjct: 113153 ccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattct 113094

                                                                          
Query: 346    cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
              | ||||| | |||||| |||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 113093 caaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttca 113034

                                                                          
Query: 406    cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
              ||||||||||||  ||||  |||||||| || |||||||| |||||||||||||||||||
Sbjct: 113033 cgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcgc 112974

                                          
Query: 466    gcagcaccttccggtgacgcttggcgcc 493
              | || ||||| ||||| |||||||||||
Sbjct: 112973 ggagaaccttgcggtgtcgcttggcgcc 112946

to top

>gb|AY158967.1| Mus musculus histone protein Hist4h4 gene, complete cds
          Length = 1200

 Score =  270 bits (136), Expect = 5e-69
 Identities = 235/268 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| ||||| || ||||| ||||| |||||||||||||| || |||||||| |
Sbjct: 701 agccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccatag 642

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | || || ||||||||   ||||||||||||||||||||||||||||||||| || ||||
Sbjct: 641 ccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattct 582

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | |||||| |||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 581 caaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttca 522

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  ||||  |||||||| || |||||||| |||||||||||||||||||
Sbjct: 521 cgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcgc 462

                                       
Query: 466 gcagcaccttccggtgacgcttggcgcc 493
           | || ||||| ||||| |||||||||||
Sbjct: 461 ggagaaccttgcggtgtcgcttggcgcc 434

to top

>gb|BC111813.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:40040608),
           partial cds
          Length = 311

 Score =  270 bits (136), Expect = 5e-69
 Identities = 235/268 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| ||||| || ||||| ||||| |||||||||||||| || |||||||| |
Sbjct: 309 agccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccatag 250

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||| ||||||||   ||||||||||||||| ||||||||||||||||| || ||||
Sbjct: 249 ccgtgaccgtcttgcgcttggcgtgctcggtgtatgtgacggcgtcgcggatcacattct 190

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | |||||| |||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 189 caaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttca 130

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  ||||  |||||||| || |||||||| |||||||||||||||||||
Sbjct: 129 cgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcgc 70

                                       
Query: 466 gcagcaccttccggtgacgcttggcgcc 493
           | || ||||| ||||| |||||||||||
Sbjct: 69  ggagaaccttgcggtgtcgcttggcgcc 42

to top

>ref|NM_175652.1| Mus musculus histone 4, H4 (Hist4h4), mRNA
          Length = 312

 Score =  270 bits (136), Expect = 5e-69
 Identities = 235/268 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| ||||| || ||||| ||||| |||||||||||||| || |||||||| |
Sbjct: 310 agccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccatag 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | || || ||||||||   ||||||||||||||||||||||||||||||||| || ||||
Sbjct: 250 ccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | |||||| |||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 190 caaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttca 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  ||||  |||||||| || |||||||| |||||||||||||||||||
Sbjct: 130 cgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcgc 71

                                       
Query: 466 gcagcaccttccggtgacgcttggcgcc 493
           | || ||||| ||||| |||||||||||
Sbjct: 70  ggagaaccttgcggtgtcgcttggcgcc 43

to top

>gb|BC067496.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79352
           IMAGE:7002103), complete cds
          Length = 364

 Score =  266 bits (134), Expect = 7e-68
 Identities = 266/310 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||| ||||||||   ||||||||| ||||||||  ||||||| ||||| |||||||
Sbjct: 250 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcgcggcgtcccggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| | ||| |||||||||||||| |||||||| || || ||||||||||
Sbjct: 190 ccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttca 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| || |  || || ||||| ||||| ||||||||||| ||||||||||||||||
Sbjct: 130 cgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcgc 71

                                                                       
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
           |||||||||| ||||| |||||||| || || || || |||||||| ||||| |||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccgc 11

                     
Query: 526 gaccggacat 535
           | || |||||
Sbjct: 10  ggccagacat 1

to top

>emb|BX061454.1|CNS09JKY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score =  264 bits (133), Expect = 3e-67
 Identities = 259/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 402 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 343

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 342 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 283

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 282 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 223

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 222 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 163

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 162 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 103

            
Query: 531 g 531
           |
Sbjct: 102 g 102

to top

>emb|BX057867.1|CNS09GTB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score =  264 bits (133), Expect = 3e-67
 Identities = 259/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 413 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 354

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 353 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 294

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 293 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 234

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 233 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 174

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 173 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 114

            
Query: 531 g 531
           |
Sbjct: 113 g 113

to top

>emb|BX053174.1|CNS09D6Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 626

 Score =  264 bits (133), Expect = 3e-67
 Identities = 259/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 402 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 343

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 342 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 283

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 282 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 223

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 222 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 163

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 162 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 103

            
Query: 531 g 531
           |
Sbjct: 102 g 102

to top

>emb|BX048034.1|CNS09986 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score =  264 bits (133), Expect = 3e-67
 Identities = 259/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 382 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 323

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 322 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 263

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 262 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 203

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 202 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 143

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 142 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 83

            
Query: 531 g 531
           |
Sbjct: 82  g 82

to top

>emb|BX037780.1|CNS091BC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 622

 Score =  264 bits (133), Expect = 3e-67
 Identities = 259/301 (86%)
 Strand = Plus / Plus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 237 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 296

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 297 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 356

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 357 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 416

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 417 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 476

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 477 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 536

            
Query: 531 g 531
           |
Sbjct: 537 g 537

to top

>emb|BX037779.1|CNS091BB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 604

 Score =  264 bits (133), Expect = 3e-67
 Identities = 259/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 421 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 362

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 361 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 302

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 301 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 242

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 241 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 182

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 181 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 122

            
Query: 531 g 531
           |
Sbjct: 121 g 121

to top

>emb|BX020583.1|CNS08O1N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 394

 Score =  264 bits (133), Expect = 3e-67
 Identities = 259/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 323 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 264

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 263 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 204

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 203 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 144

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 143 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 84

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 83  accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 24

            
Query: 531 g 531
           |
Sbjct: 23  g 23

to top

>emb|BX009114.1|CNS08F72 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score =  264 bits (133), Expect = 3e-67
 Identities = 259/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 384 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 325

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 324 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 265

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 264 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 205

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 204 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 145

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 144 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 85

            
Query: 531 g 531
           |
Sbjct: 84  g 84

to top

>ref|XM_306825.2| Anopheles gambiae str. PEST ENSANGP00000000125
           (ENSANGG00000000123), partial mRNA
          Length = 312

 Score =  264 bits (133), Expect = 3e-67
 Identities = 259/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 305 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 246

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 186

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 185 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 126

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 125 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 66

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 65  accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 6

            
Query: 531 g 531
           |
Sbjct: 5   g 5

to top

>emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes
          Length = 2930

 Score =  262 bits (132), Expect = 1e-66
 Identities = 246/284 (86%)
 Strand = Plus / Minus

                                                                        
Query: 228  ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
            |||||||| ||||| |||||||||||||| || || || |||||||| ||||||||||| 
Sbjct: 1145 ccgccgaaaccgtacagggtgcgtccctggcgtttcagagcgtagaccacgtccatggcc 1086

                                                                        
Query: 288  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
            || |||||||| |    ||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 1085 gtaacggtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttctca 1026

                                                                        
Query: 348  aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
            ||||| | ||| || ||||||||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 1025 aggaacaccttcaggacaccgcgggtctcctcgtagatcagcccggagatacgcttcacg 966

                                                                        
Query: 408  ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
            |||||||| |  |||||||| || ||||| ||||||||||| ||||||||||| ||||| 
Sbjct: 965  ccgccacggcgagccagacggcgaatggcgggcttggtgattccctggatgttatcgcgg 906

                                                        
Query: 468  agcaccttccggtgacgcttggcgccgcccttgccgaggccctt 511
            || ||||| ||||||||||||||||| || || ||||| |||||
Sbjct: 905  agaaccttacggtgacgcttggcgcctccttttccgagtccctt 862

to top

>gb|M27433.1|RATHIS4G Rattus norvegicus histone H4 gene, complete cds
          Length = 594

 Score =  260 bits (131), Expect = 5e-66
 Identities = 230/263 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||| ||||| ||||| || || ||||||||||| ||||||||||| |||
Sbjct: 494 ccgaagccgtagagtgtgcggccctggcgtttaagcgcgtagaccacgtccatggcagtg 435

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 434 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 375

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 374 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 315

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || |||| |||||| || |||||||| ||||| |||||||||||||||||||||||||| 
Sbjct: 314 ccgcgccgggccaggcggcggatggcgggctttgtgatgccctggatgttgtcgcgcagg 255

                                  
Query: 471 accttccggtgacgcttggcgcc 493
           || || || |||||||| |||||
Sbjct: 254 actttgcgatgacgcttagcgcc 232

to top

>gb|M28409.1|RATH1TH4T Rat testis-specific histone H1t and histone H4t, complete cds
          Length = 6861

 Score =  260 bits (131), Expect = 5e-66
 Identities = 230/263 (87%)
 Strand = Plus / Plus

                                                                        
Query: 231  ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
            ||||| |||||||| ||||| ||||| || || ||||||||||| ||||||||||| |||
Sbjct: 4742 ccgaagccgtagagtgtgcggccctggcgtttaagcgcgtagaccacgtccatggcagtg 4801

                                                                        
Query: 291  acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
            || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 4802 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 4861

                                                                        
Query: 351  aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
            || | ||| ||||||||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 4862 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 4921

                                                                        
Query: 411  ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
            || |||| |||||| || |||||||| ||||| |||||||||||||||||||||||||| 
Sbjct: 4922 ccgcgccgggccaggcggcggatggcgggctttgtgatgccctggatgttgtcgcgcagg 4981

                                   
Query: 471  accttccggtgacgcttggcgcc 493
            || || || |||||||| |||||
Sbjct: 4982 actttgcgatgacgcttagcgcc 5004

to top

>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507),
           mRNA
          Length = 846

 Score =  258 bits (130), Expect = 2e-65
 Identities = 262/306 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 830 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 771

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 770 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 711

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 710 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 651

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || || |  || || |||||||| ||||||||||||||||||||||| ||||||||||  
Sbjct: 650 ccgcggcgagcaaggcgccggatagccggcttggtgatgccctggatattgtcgcgcaat 591

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || || || ||||| |||||||| ||||| || |||||||| || |||||||| || 
Sbjct: 590 actttacgatggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 531

                 
Query: 531 gacatg 536
           ||||||
Sbjct: 530 gacatg 525

to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on
            chromosome 6
          Length = 269712

 Score =  258 bits (130), Expect = 2e-65
 Identities = 241/278 (86%)
 Strand = Plus / Minus

                                                                        
Query: 243  agggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 302
            |||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 5913 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 5854

                                                                        
Query: 303  cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 362
              ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 5853 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 5794

                                                                        
Query: 363  acaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctggcc 422
            || ||||| |||||||||||||| || || ||||| |||||||| |||||||||| ||||
Sbjct: 5793 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 5734

                                                                        
Query: 423  agacgccggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtga 482
            ||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| 
Sbjct: 5733 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 5674

                                                  
Query: 483  cgcttggcgccgcccttgccgaggcccttccctccctt 520
            |||||||| || ||||| || |  |||||||| |||||
Sbjct: 5673 cgcttggcaccccccttacccaaacccttcccgccctt 5636



 Score =  182 bits (92), Expect = 9e-43
 Identities = 230/276 (83%)
 Strand = Plus / Minus

                                                                          
Query: 224    tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
              |||||| || || ||||| || ||||||||||| ||||||||||||||||| || |||||
Sbjct: 224737 tcagccaccaaagccgtacagagtgcgtccctggcgcttgagcgcgtagacaacatccat 224678

                                                                          
Query: 284    ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
               || ||||| ||||| ||   ||||||||| |||||||| |||||||| || || || ||
Sbjct: 224677 tgcagtgactgtcttacgcttggcgtgctccgtgtaggttacggcgtcccgtatcacatt 224618

                                                                          
Query: 344    ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
              ||| ||||| | ||| || ||||||||||||||||| || ||||| ||||| ||||| ||
Sbjct: 224617 ctccaggaacaccttaagaacaccgcgggtctcctcataaatgaggcccgaaatgcgttt 224558

                                                                          
Query: 404    cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
              ||||||||| || | |||||  || |||||||| ||||| ||||||||||| ||||||||
Sbjct: 224557 cacgccgccgcgtcgggccaagcgacggatggcgggcttcgtgatgccctgtatgttgtc 224498

                                                  
Query: 464    gcgcagcaccttccggtgacgcttggcgccgccctt 499
               |||||||| || || || ||||||||||| |||||
Sbjct: 224497 acgcagcactttgcgatggcgcttggcgcctccctt 224462



 Score =  161 bits (81), Expect = 3e-36
 Identities = 252/309 (81%)
 Strand = Plus / Plus

                                                                         
Query: 228   ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
             |||||||| ||||| || |||||||| || |||||||||||||| || || |||||||| 
Sbjct: 10887 ccgccgaagccgtacagagtgcgtccttgacgcttgagcgcgtaaaccacatccatggca 10946

                                                                         
Query: 288   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
             ||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||| 
Sbjct: 10947 gtgacagtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttctcc 11006

                                                                         
Query: 348   aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
             || || | |||||| || || || |||||||| || || |  || || || ||||| || 
Sbjct: 11007 agaaacaccttgagaacgccacgagtctcctcataaatcaaaccggaaattcgcttaacc 11066

                                                                         
Query: 408   ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
             || |||||||| || || ||||| |||||||| ||||||||||| |||||||| || |||
Sbjct: 11067 ccaccacgcctagcaaggcgccgaatggccggtttggtgatgccttggatgttatcccgc 11126

                                                                         
Query: 468   agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
             ||||| || |||||||||||||| || ||||| || |  || || || || |||||||||
Sbjct: 11127 agcacttttcggtgacgcttggcacctcccttacccaaacctttaccgcctttgccgcga 11186

                      
Query: 528   ccggacatg 536
             || ||||||
Sbjct: 11187 ccagacatg 11195



 Score =  159 bits (80), Expect = 1e-35
 Identities = 254/312 (81%)
 Strand = Plus / Plus

                                                                          
Query: 224    tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
              |||||||||||| || || || ||||||||||| |||||||||||||| || ||||||||
Sbjct: 172765 tcagccgccgaagccataaagagtgcgtccctggcgcttgagcgcgtacaccacgtccat 172824

                                                                          
Query: 284    ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
              ||| ||||| ||||||||   |||||| || ||||||||||| || |||||||| || ||
Sbjct: 172825 ggctgtgactgtcttgcgtttggcgtgttccgtgtaggtgacagcatcgcggattacatt 172884

                                                                          
Query: 344    ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
               || ||||| |  || ||||| ||||| || ||||| || ||||| || || || |||||
Sbjct: 172885 ttccaggaaaactttcagcactccgcgagtttcctcataaatgaggccagaaatacgctt 172944

                                                                          
Query: 404    cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
               |||||||| || |  ||||| || ||||| || ||||||||||| || ||||| |||||
Sbjct: 172945 gacgccgccgcggcgagccaggcggcggatagcgggcttggtgattccttggatattgtc 173004

                                                                          
Query: 464    gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
               ||||  ||||| ||||||||||||||||| ||||| || || ||||| || ||||| ||
Sbjct: 173005 acgcaataccttacggtgacgcttggcgccacccttacctagaccctttccgcccttacc 173064

                          
Query: 524    gcgaccggacat 535
              ||| || |||||
Sbjct: 173065 gcggccagacat 173076



 Score =  149 bits (75), Expect = 1e-32
 Identities = 252/311 (81%)
 Strand = Plus / Minus

                                                                          
Query: 226    agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
              |||||||||| ||||| || ||||||||||||| ||| ||||||||||| || ||||| |
Sbjct: 188954 agccgccgaagccgtaaagagtgcgtccctgtctcttcagcgcgtagaccacatccatcg 188895

                                                                          
Query: 286    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
              | || || ||||||||   ||||||||| ||||| || || || || || || ||||| |
Sbjct: 188894 ctgtcactgtcttgcgtttggcgtgctccgtgtaagtcacagcatcacgaatcacgtttt 188835

                                                                          
Query: 346    cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
              | || || | ||| || || ||||| ||||||||||||||||| || || |||||||| |
Sbjct: 188834 ccagaaacaccttcagaaccccgcgagtctcctcgtagatgagaccagaaatgcgcttga 188775

                                                                          
Query: 406    cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
              | || || || |  || || ||||||||||| |||||||| |||||||||||||| || |
Sbjct: 188774 cacccccgcgacgagcaaggcgccggatggcaggcttggtaatgccctggatgttatctc 188715

                                                                          
Query: 466    gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgc 525
              |||| ||||| ||||||||||| ||||| || || || || ||||| || || |||||||
Sbjct: 188714 gcaggaccttacggtgacgcttagcgcctcctttacccagtccctttccgcctttgccgc 188655

                         
Query: 526    gaccggacatg 536
              |||| ||||||
Sbjct: 188654 gaccagacatg 188644



 Score =  139 bits (70), Expect = 1e-29
 Identities = 214/262 (81%)
 Strand = Plus / Plus

                                                                          
Query: 226    agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
              |||| ||||| ||||| || ||||||||||||||||| ||||||||||| || ||||| |
Sbjct: 269190 agccaccgaagccgtaaagagtgcgtccctgtcgcttcagcgcgtagaccacatccattg 269249

                                                                          
Query: 286    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
              | || |||||||||||   ||||||||| ||||| ||||| ||||| || || |||||||
Sbjct: 269250 ctgtcacggtcttgcgtttggcgtgctctgtgtaagtgacagcgtcacgaatcacgttct 269309

                                                                          
Query: 346    cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
              | ||||| | ||| || ||||| || |||||||| ||||| || || || || ||||| |
Sbjct: 269310 ccaggaacaccttcagaacaccacgagtctcctcatagataaggccagaaattcgcttga 269369

                                                                          
Query: 406    cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
              | ||||| || |  || || |||||||| || ||||| ||||||||||||||||| ||||
Sbjct: 269370 caccgccgcgacgagcaaggcgccggatagctggcttagtgatgccctggatgttatcgc 269429

                                    
Query: 466    gcagcaccttccggtgacgctt 487
              |||  ||||| || ||||||||
Sbjct: 269430 gcaaaaccttgcgatgacgctt 269451



 Score =  105 bits (53), Expect = 2e-19
 Identities = 248/313 (79%)
 Strand = Plus / Minus

                                                                         
Query: 224   tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
             |||||||||||| || || || ||||| ||||| || || || || || || || |||||
Sbjct: 88201 tcagccgccgaagccatacagagtgcgcccctgacgttttagggcatatactacatccat 88142

                                                                         
Query: 284   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
             ||| ||||| || |||||   ||||||||| || |||||||||||||| || || |||||
Sbjct: 88141 ggctgtgacagttttgcgcttggcgtgctccgtataggtgacggcgtctcgaataacgtt 88082

                                                                         
Query: 344   ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
             ||| | ||| | ||| |||||||| || |||||||| ||||| || || || ||||||||
Sbjct: 88081 ctctaagaaaaccttaagcacacctcgagtctcctcatagataagaccggaaatgcgctt 88022

                                                                         
Query: 404   cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
              ||||| || ||||  |||| ||| || || ||||| || || |||||||||||||| ||
Sbjct: 88021 gacgccaccgcgccgagccaaacggcgaatagccggttttgtaatgccctggatgttatc 87962

                                                                         
Query: 464   gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
              || |||||||| || || ||||| || || ||||| || | ||| || || || |||||
Sbjct: 87961 ccggagcaccttacgatggcgcttagcaccacccttccccaagccttttccgcctttgcc 87902

                          
Query: 524   gcgaccggacatg 536
             |||||| ||||||
Sbjct: 87901 gcgaccagacatg 87889



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 149/183 (81%)
 Strand = Plus / Plus

                                                                          
Query: 251    tccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcggcgggcgtg 310
              |||||| || |||||| ||||||| ||| ||||||||||||| ||||||||   ||||||
Sbjct: 230693 tccctggcgtttgagcacgtagaccacggccatggcggtgaccgtcttgcgcttggcgtg 230752

                                                                          
Query: 311    ctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagcacaccgcg 370
              ||| |||| ||| |||||||  | ||| || || || ||||| | ||||| ||| | |||
Sbjct: 230753 ctccgtgttggtcacggcgtaccagatcacattttccaggaacaccttgaacacccggcg 230812

                                                                          
Query: 371    ggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctggccagacgccg 430
              ||||||||| || ||||| ||| |||||||||| || |||||| ||| |||||  |||||
Sbjct: 230813 ggtctcctcataaatgaggcccaagatgcgcttgacaccgccatgccgggccaagcgccg 230872

                 
Query: 431    gat 433
              |||
Sbjct: 230873 gat 230875

to top

>ref|NM_003538.3| Homo sapiens histone 1, H4a (HIST1H4A), mRNA
          Length = 372

 Score =  258 bits (130), Expect = 2e-65
 Identities = 241/278 (86%)
 Strand = Plus / Minus

                                                                       
Query: 243 agggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 302
           |||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 303 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 362
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 363 acaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctggcc 422
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||||| ||||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 423 agacgccggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtga 482
           ||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| 
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                                                 
Query: 483 cgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||||||| || ||||| || |  |||||||| |||||
Sbjct: 53  cgcttggcaccccccttacccaaacccttcccgccctt 16

to top

>gb|AY128654.1| Homo sapiens clone HIST1H4A histone H4 gene, complete cds
          Length = 930

 Score =  258 bits (130), Expect = 2e-65
 Identities = 241/278 (86%)
 Strand = Plus / Minus

                                                                       
Query: 243 agggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 302
           |||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 604 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 545

                                                                       
Query: 303 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 362
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 544 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 485

                                                                       
Query: 363 acaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctggcc 422
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||||| ||||
Sbjct: 484 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 425

                                                                       
Query: 423 agacgccggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtga 482
           ||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| 
Sbjct: 424 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 365

                                                 
Query: 483 cgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||||||| || ||||| || |  |||||||| |||||
Sbjct: 364 cgcttggcaccccccttacccaaacccttcccgccctt 327

to top

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
              hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
              sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score =  258 bits (130), Expect = 2e-65
 Identities = 241/278 (86%)
 Strand = Plus / Plus

                                                                          
Query: 243    agggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 302
              |||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 119088 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 119147

                                                                          
Query: 303    cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 362
                ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 119148 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 119207

                                                                          
Query: 363    acaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctggcc 422
              || ||||| |||||||||||||| || || ||||| |||||||| |||||||||| ||||
Sbjct: 119208 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 119267

                                                                          
Query: 423    agacgccggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtga 482
              ||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| 
Sbjct: 119268 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 119327

                                                    
Query: 483    cgcttggcgccgcccttgccgaggcccttccctccctt 520
              |||||||| || ||||| || |  |||||||| |||||
Sbjct: 119328 cgcttggcaccccccttacccaaacccttcccgccctt 119365



 Score =  161 bits (81), Expect = 3e-36
 Identities = 252/309 (81%)
 Strand = Plus / Minus

                                                                          
Query: 228    ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
              |||||||| ||||| || |||||||| || |||||||||||||| || || |||||||| 
Sbjct: 114114 ccgccgaagccgtacagagtgcgtccttgacgcttgagcgcgtaaaccacatccatggca 114055

                                                                          
Query: 288    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
              ||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||| 
Sbjct: 114054 gtgacagtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttctcc 113995

                                                                          
Query: 348    aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
              || || | |||||| || || || |||||||| || || |  || || || ||||| || 
Sbjct: 113994 agaaacaccttgagaacgccacgagtctcctcataaatcaaaccggaaattcgcttaacc 113935

                                                                          
Query: 408    ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
              || |||||||| || || ||||| |||||||| ||||||||||| |||||||| || |||
Sbjct: 113934 ccaccacgcctagcaaggcgccgaatggccggtttggtgatgccttggatgttatcccgc 113875

                                                                          
Query: 468    agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
              ||||| || |||||||||||||| || ||||| || |  || || || || |||||||||
Sbjct: 113874 agcacttttcggtgacgcttggcacctcccttacccaaacctttaccgcctttgccgcga 113815

                       
Query: 528    ccggacatg 536
              || ||||||
Sbjct: 113814 ccagacatg 113806



 Score =  105 bits (53), Expect = 2e-19
 Identities = 248/313 (79%)
 Strand = Plus / Plus

                                                                         
Query: 224   tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
             |||||||||||| || || || ||||| ||||| || || || || || || || |||||
Sbjct: 36800 tcagccgccgaagccatacagagtgcgcccctgacgttttagggcatatactacatccat 36859

                                                                         
Query: 284   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
             ||| ||||| || |||||   ||||||||| || |||||||||||||| || || |||||
Sbjct: 36860 ggctgtgacagttttgcgcttggcgtgctccgtataggtgacggcgtctcgaataacgtt 36919

                                                                         
Query: 344   ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
             ||| | ||| | ||| |||||||| || |||||||| ||||| || || || ||||||||
Sbjct: 36920 ctctaagaaaaccttaagcacacctcgagtctcctcatagataagaccggaaatgcgctt 36979

                                                                         
Query: 404   cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
              ||||| || ||||  |||| ||| || || ||||| || || |||||||||||||| ||
Sbjct: 36980 gacgccaccgcgccgagccaaacggcgaatagccggttttgtaatgccctggatgttatc 37039

                                                                         
Query: 464   gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
              || |||||||| || || ||||| || || ||||| || | ||| || || || |||||
Sbjct: 37040 ccggagcaccttacgatggcgcttagcaccacccttccccaagccttttccgcctttgcc 37099

                          
Query: 524   gcgaccggacatg 536
             |||||| ||||||
Sbjct: 37100 gcgaccagacatg 37112

to top

>gb|BC069654.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:97476
           IMAGE:7262752), complete cds
          Length = 365

 Score =  258 bits (130), Expect = 2e-65
 Identities = 241/278 (86%)
 Strand = Plus / Minus

                                                                       
Query: 243 agggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 302
           |||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 303 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 362
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 363 acaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctggcc 422
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||||| ||||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 423 agacgccggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtga 482
           ||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| 
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                                                 
Query: 483 cgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||||||| || ||||| || |  |||||||| |||||
Sbjct: 53  cgcttggcaccccccttacccaaacccttcccgccctt 16

to top

>gb|BC067495.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79351
           IMAGE:7002090), complete cds
          Length = 349

 Score =  258 bits (130), Expect = 2e-65
 Identities = 241/278 (86%)
 Strand = Plus / Minus

                                                                       
Query: 243 agggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 302
           |||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 303 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 362
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 363 acaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctggcc 422
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||||| ||||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 423 agacgccggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtga 482
           ||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| 
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                                                 
Query: 483 cgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||||||| || ||||| || |  |||||||| |||||
Sbjct: 53  cgcttggcaccccccttacccaaacccttcccgccctt 16

to top

>ref|XM_225382.1| PREDICTED: Rattus norvegicus histone 1, H4m (predicted)
           (Hist1h4m_predicted), mRNA
          Length = 312

 Score =  258 bits (130), Expect = 2e-65
 Identities = 250/290 (86%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||| ||||| ||||| ||||| ||||| ||||| || |||||||| |||
Sbjct: 305 ccgaagccgtagagagtgcggccctggcgcttaagcgcatagacaacatccatggcagtg 246

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 245 acagtcttgcgcttggcgtgctctgtgtaggtgacggcgtcgcggatcacgttctccagg 186

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 185 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 126

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || ||||  ||||  || |||||||| ||||| |||||||||||||||||||||||||| 
Sbjct: 125 ccccgccgagccaagcggcggatggcgggcttagtgatgccctggatgttgtcgcgcagg 66

                                                             
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           || || ||||| ||||| |||||||| ||||| || |||||||| |||||
Sbjct: 65  actttgcggtggcgcttagcgccgcctttgcccagacccttcccgccctt 16

to top

>gb|BC066248.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79349
           IMAGE:7002088), complete cds
          Length = 349

 Score =  258 bits (130), Expect = 2e-65
 Identities = 241/278 (86%)
 Strand = Plus / Minus

                                                                       
Query: 243 agggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 302
           |||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 303 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 362
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 363 acaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctggcc 422
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||||| ||||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 423 agacgccggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtga 482
           ||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| 
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                                                 
Query: 483 cgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||||||| || ||||| || |  |||||||| |||||
Sbjct: 53  cgcttggcaccccccttacccaaacccttcccgccctt 16

to top

>gb|BC066249.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79350
           IMAGE:7002089), complete cds
          Length = 349

 Score =  258 bits (130), Expect = 2e-65
 Identities = 241/278 (86%)
 Strand = Plus / Minus

                                                                       
Query: 243 agggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 302
           |||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 303 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 362
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 363 acaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctggcc 422
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||||| ||||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 423 agacgccggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtga 482
           ||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| 
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                                                 
Query: 483 cgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||||||| || ||||| || |  |||||||| |||||
Sbjct: 53  cgcttggcaccccccttacccaaacccttcccgccctt 16

to top

>emb|BX047092.1|CNS098I0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score =  256 bits (129), Expect = 7e-65
 Identities = 259/301 (86%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 392 ccgaatccgtagagcgtacggccctgccgcttcagagcgtacaccacatccatcgccgtg 333

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 332 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 274

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 273 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 214

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 213 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 154

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 153 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 94

            
Query: 531 g 531
           |
Sbjct: 93  g 93

to top

>emb|BX039313.1|CNS092HX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score =  256 bits (129), Expect = 7e-65
 Identities = 259/301 (86%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 408 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 349

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 348 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 290

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 289 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 230

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 229 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 170

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 169 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 110

            
Query: 531 g 531
           |
Sbjct: 109 g 109

to top

>emb|BX032921.1|CNS08XKD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score =  256 bits (129), Expect = 7e-65
 Identities = 258/301 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||| | || ||||| || || ||||| || |||
Sbjct: 404 ccgaatccgtagagcgtacggccctggcgcctcagagcgtacaccacatccatcgccgtg 345

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 344 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 285

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 284 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 225

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 224 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 165

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 164 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 105

            
Query: 531 g 531
           |
Sbjct: 104 g 104

to top

>dbj|AK045187.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length
           enriched library, clone:B130044J01 product:H4 HISTONE
           homolog [Homo sapiens], full insert sequence
          Length = 2875

 Score =  256 bits (129), Expect = 7e-65
 Identities = 235/269 (87%), Gaps = 1/269 (0%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| ||||| || ||||| ||||| |||||||||||||| || |||||||| |
Sbjct: 357 agccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccatag 298

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | || || ||||||||   ||||||||||||||||||||||||||||||||| || ||||
Sbjct: 297 ccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattct 238

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | |||||| |||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 237 caaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttca 178

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgat-gccctggatgttgtcg 464
           ||||||||||||  ||||  |||||||| || |||||||| || ||||||||||||||||
Sbjct: 177 cgccgccacgccgagccaaccgccggatagcgggcttggtaatggccctggatgttgtcg 118

                                        
Query: 465 cgcagcaccttccggtgacgcttggcgcc 493
           || || ||||| ||||| |||||||||||
Sbjct: 117 cggagaaccttgcggtgtcgcttggcgcc 89

to top

>ref|XM_311439.2| Anopheles gambiae str. PEST ENSANGP00000018626
           (ENSANGG00000016137), partial mRNA
          Length = 312

 Score =  256 bits (129), Expect = 7e-65
 Identities = 258/301 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 305 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 246

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||| ||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 245 accgtcttacgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 186

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 185 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 126

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 125 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 66

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 65  accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 6

            
Query: 531 g 531
           |
Sbjct: 5   g 5

to top

>gb|AF457966.1| Zea mays clone cho1c.pk003.e4, mRNA sequence
          Length = 248

 Score =  254 bits (128), Expect = 3e-64
 Identities = 152/160 (95%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||
Sbjct: 160 agccgccgaagccgtagagggtgcggccctggcgcttaagcgcgtagacgacgtccatgg 101

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 100 cggtgacggtcttacggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 41

                                                   
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagat 385
           | ||||||||||||||||| ||||||||||||||||||||
Sbjct: 40  ccaggaagatcttgagcacgccgcgggtctcctcgtagat 1

to top

>emb|CR657322.2|CNS0F65S Tetraodon nigroviridis full-length cDNA
          Length = 586

 Score =  252 bits (127), Expect = 1e-63
 Identities = 253/295 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| ||||| |||||||| ||||| | ||| || ||||| || ||||||||||
Sbjct: 317 agccgccgaagccgtacagggtgcggccctgcctcttcagggcgtacaccacgtccatgg 258

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | || || ||||| |    ||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 257 ccgtcaccgtcttcctcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttct 198

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||| |||||||||||||||||||| || || |||||||||||||
Sbjct: 197 ccaggaacaccttcagcaccccgcgggtctcctcgtagatcaggccggagatgcgcttca 138

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||| ||||  ||||| || |||||||| ||||||||||||||||||||||||||||
Sbjct: 137 cgccgccgcgccgcgccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 78

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           | || ||||| ||||| |||||||||||||| ||||| || || || ||||||||
Sbjct: 77  ggaggaccttgcggtggcgcttggcgccgcctttgcccagacctttgcctccctt 23

to top

>gb|BC057955.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:5359141), with
           apparent retained intron
          Length = 1631

 Score =  252 bits (127), Expect = 1e-63
 Identities = 253/295 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| |||||||||||||| ||||| |||||||| ||||| || || ||||| |
Sbjct: 317 agcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccatag 258

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||||
Sbjct: 257 cggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgttct 198

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| |||||||| |||||||||||||||||||| || ||||||||||| |
Sbjct: 197 ccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttga 138

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || ||||  ||||| || |||||||| ||||||||||| |||||||||||||| |
Sbjct: 137 ccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtcac 78

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||  || || || || ||||||||||| |||||||| || ||||| || |||||
Sbjct: 77  gcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 23

to top

>emb|V00753.1|MMHI01 Mouse gene encoding the mouse histone H4
          Length = 968

 Score =  252 bits (127), Expect = 1e-63
 Identities = 253/295 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| |||||||||||||| ||||| |||||||| ||||| || || ||||| |
Sbjct: 567 agcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccatag 508

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||||
Sbjct: 507 cggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgttct 448

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| |||||||| |||||||||||||||||||| || ||||||||||| |
Sbjct: 447 ccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttga 388

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || ||||  ||||| || |||||||| ||||||||||| |||||||||||||| |
Sbjct: 387 ccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtcac 328

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||  || || || || ||||||||||| |||||||| || ||||| || |||||
Sbjct: 327 gcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 273

to top

>ref|NM_033596.1| Mus musculus histone 2, H4 (Hist2h4), mRNA
          Length = 400

 Score =  252 bits (127), Expect = 1e-63
 Identities = 253/295 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| |||||||||||||| ||||| |||||||| ||||| || || ||||| |
Sbjct: 339 agcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccatag 280

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||||
Sbjct: 279 cggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgttct 220

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| |||||||| |||||||||||||||||||| || ||||||||||| |
Sbjct: 219 ccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttga 160

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || ||||  ||||| || |||||||| ||||||||||| |||||||||||||| |
Sbjct: 159 ccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtcac 100

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||  || || || || ||||||||||| |||||||| || ||||| || |||||
Sbjct: 99  gcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 45

to top

>gb|AY158966.1| Mus musculus histone protein Hist2h4 gene, complete cds
          Length = 1309

 Score =  252 bits (127), Expect = 1e-63
 Identities = 253/295 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| |||||||||||||| ||||| |||||||| ||||| || || ||||| |
Sbjct: 810 agcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccatag 751

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||||
Sbjct: 750 cggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgttct 691

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| |||||||| |||||||||||||||||||| || ||||||||||| |
Sbjct: 690 ccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttga 631

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || ||||  ||||| || |||||||| ||||||||||| |||||||||||||| |
Sbjct: 630 ccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtcac 571

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||  || || || || ||||||||||| |||||||| || ||||| || |||||
Sbjct: 570 gcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 516

to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  252 bits (127), Expect = 1e-63
 Identities = 253/295 (85%)
 Strand = Plus / Plus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             |||| ||||| |||||||||||||| ||||| |||||||| ||||| || || ||||| |
Sbjct: 87634 agcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccatag 87693

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             ||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||||
Sbjct: 87694 cggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgttct 87753

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             | ||||| | ||| |||||||| |||||||||||||||||||| || ||||||||||| |
Sbjct: 87754 ccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttga 87813

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             | || || ||||  ||||| || |||||||| ||||||||||| |||||||||||||| |
Sbjct: 87814 ccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtcac 87873

                                                                    
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
             |||  || || || || ||||||||||| |||||||| || ||||| || |||||
Sbjct: 87874 gcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 87928

to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  252 bits (127), Expect = 1e-63
 Identities = 253/295 (85%)
 Strand = Plus / Minus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             |||| ||||| |||||||||||||| ||||| |||||||| ||||| || || ||||| |
Sbjct: 13059 agcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccatag 13000

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             ||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||||
Sbjct: 12999 cggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgttct 12940

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             | ||||| | ||| |||||||| |||||||||||||||||||| || ||||||||||| |
Sbjct: 12939 ccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttga 12880

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             | || || ||||  ||||| || |||||||| ||||||||||| |||||||||||||| |
Sbjct: 12879 ccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtcac 12820

                                                                    
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
             |||  || || || || ||||||||||| |||||||| || ||||| || |||||
Sbjct: 12819 gcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 12765

to top

>gb|BC051566.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:1446370)
          Length = 358

 Score =  252 bits (127), Expect = 1e-63
 Identities = 253/295 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| |||||||||||||| ||||| |||||||| ||||| || || ||||| |
Sbjct: 331 agcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccatag 272

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||||
Sbjct: 271 cggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgttct 212

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| |||||||| |||||||||||||||||||| || ||||||||||| |
Sbjct: 211 ccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttga 152

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || || ||||  ||||| || |||||||| ||||||||||| |||||||||||||| |
Sbjct: 151 ccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtcac 92

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||  || || || || ||||||||||| |||||||| || ||||| || |||||
Sbjct: 91  gcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 37

to top

>gb|AY389612.1| Hyacinthus orientalis unknown mRNA
          Length = 436

 Score =  250 bits (126), Expect = 4e-63
 Identities = 210/238 (88%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||| |
Sbjct: 263 agccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagacgacgtccatcg 204

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | || || ||||| ||||| |||||||||||||||||||||||||| |||||||||||||
Sbjct: 203 ccgtcaccgtcttccggcgcgcgtgctcggtgtaggtgacggcgtcacggatgacgttct 144

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           |||||||||||||||| || ||||| ||||||||||||||||||||    || | |||||
Sbjct: 143 cgaggaagatcttgaggaccccgcgcgtctcctcgtagatgagcccgcttatcctcttca 84

                                                                     
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
           | || ||||| |  ||||| || ||||| |||||||| ||||||||||||||||||||
Sbjct: 83  ctcctccacggcgagccaggcggcggatcgccggcttcgtgatgccctggatgttgtc 26

to top

>emb|AJ249812.1|MAL249812 Mortierella alpina H3.1 and H4.1 genes for histone H3 and histone H4
          Length = 1630

 Score =  250 bits (126), Expect = 4e-63
 Identities = 261/306 (85%)
 Strand = Plus / Minus

                                                                        
Query: 231  ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
            ||||| |||||||||||||||||||| |||||||| ||||||||||| || |  | ||||
Sbjct: 1394 ccgaaaccgtagagggtgcgtccctggcgcttgagggcgtagacgacatcgagcgaggtg 1335

                                                                        
Query: 291  acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
            |||||||||||   ||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 1334 acggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcacggatgacgttctcgagg 1275

                                                                        
Query: 351  aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
            |||| |||||| ||   ||||||||||||||||||||| || ||||| ||||| || || 
Sbjct: 1274 aagaccttgaggacggagcgggtctcctcgtagatgaggccggagatacgcttgacacca 1215

                                                                        
Query: 411  ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
            ||||| | ||| ||||| ||||| || ||||||||||| |||||||||||||| || || 
Sbjct: 1214 ccacgacgggcgagacggcggatagcgggcttggtgattccctggatgttgtcacgaaga 1155

                                                                        
Query: 471  accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
            | ||| ||||| |||||||| || ||||| ||||| ||||| ||||| || ||||| || 
Sbjct: 1154 atcttgcggtggcgcttggcaccaccctttccgagaccctttcctcctttaccgcggcca 1095

                  
Query: 531  gacatg 536
            ||||||
Sbjct: 1094 gacatg 1089

to top

>emb|BX052400.1|CNS09CLG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score =  250 bits (126), Expect = 4e-63
 Identities = 259/302 (85%), Gaps = 1/302 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 398 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 339

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 338 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 279

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 278 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 219

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 218 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 159

                                                                       
Query: 471 accttccggtgacgcttggcgccgcc-cttgccgaggcccttccctcccttgccgcgacc 529
           ||||| || ||||||||||| || || ||| || || ||||| |||||||||||||||||
Sbjct: 158 accttgcgatgacgcttggctcctccgctttcccagtcccttgcctcccttgccgcgacc 99

             
Query: 530 gg 531
           ||
Sbjct: 98  gg 97

to top

>emb|X60481.1|HSH4AHIS H.sapiens H4/a gene for H4 histone
          Length = 672

 Score =  250 bits (126), Expect = 4e-63
 Identities = 240/278 (86%)
 Strand = Plus / Minus

                                                                       
Query: 243 agggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 302
           |||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 473 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 414

                                                                       
Query: 303 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 362
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 413 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 354

                                                                       
Query: 363 acaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctggcc 422
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||||| ||||
Sbjct: 353 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 294

                                                                       
Query: 423 agacgccggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtga 482
           |||||||||||||| |||||||||||||||||||||||||| |||| |||||| ||||| 
Sbjct: 293 agacgccggatggctggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 234

                                                 
Query: 483 cgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||||||| || ||||| || |  |||||||| |||||
Sbjct: 233 cgcttggcaccccccttacccaaacccttcccgccctt 196

to top

>emb|BX066856.1|CNS09NR0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score =  248 bits (125), Expect = 2e-62
 Identities = 258/301 (85%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 407 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 348

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||| ||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 347 accgtcttacgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 289

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 288 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 229

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 228 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 169

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 168 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 109

            
Query: 531 g 531
           |
Sbjct: 108 g 108

to top

>emb|BX060419.1|CNS09IS7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score =  248 bits (125), Expect = 2e-62
 Identities = 255/297 (85%), Gaps = 1/297 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 388 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 329

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 328 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 270

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 269 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 210

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 209 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 150

                                                                    
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           ||||| || ||||||||||| || ||||| || || ||||| |||||||||||||||
Sbjct: 149 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcga 93

to top

>emb|BX053099.1|CNS09D4V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 434

 Score =  248 bits (125), Expect = 2e-62
 Identities = 257/301 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 347 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 288

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || || || ||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 287 accgttttacgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 228

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 227 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 168

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 167 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 108

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 107 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 48

            
Query: 531 g 531
           |
Sbjct: 47  g 47

to top

>emb|BX036322.1|CNS0906U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score =  248 bits (125), Expect = 2e-62
 Identities = 258/301 (85%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 401 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 342

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||| ||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 341 accgtcttacgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 283

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 282 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 223

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 222 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 163

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 162 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 103

            
Query: 531 g 531
           |
Sbjct: 102 g 102

to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score =  248 bits (125), Expect = 2e-62
 Identities = 254/297 (85%)
 Strand = Plus / Plus

                                                                          
Query: 224    tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
              |||||||||||| ||||| | |||||| ||||| |||||||||||||| |||||||| | 
Sbjct: 656513 tcagccgccgaagccgtacaaggtgcggccctggcgcttgagcgcgtacacgacgtcgag 656572

                                                                          
Query: 284    ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
               | |||||||||||||||   |||||||||||||||||||||||||||||||||||||  
Sbjct: 656573 cgaggtgacggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgga 656632

                                                                          
Query: 344    ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
              ||| ||||    |||||||||  ||||    |||||||| ||||| || |||||||||||
Sbjct: 656633 ctccaggaccgacttgagcaccgcgcgcacgtcctcgtaaatgaggccggagatgcgctt 656692

                                                                          
Query: 404    cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
               ||||||||||| | |||||| ||| ||||||| ||||||||||||||||||||||||||
Sbjct: 656693 gacgccgccacgacgggccaggcgcaggatggcgggcttggtgatgccctggatgttgtc 656752

                                                                       
Query: 464    gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
              ||| || | ||| ||||| ||||| ||||||||||||||||||||||| || |||||
Sbjct: 656753 gcggaggatcttgcggtggcgcttcgcgccgcccttgccgaggcccttgcccccctt 656809

to top

>ref|NM_210226.1| Eremothecium gossypii AER012Cp (AER012C), mRNA
          Length = 312

 Score =  248 bits (125), Expect = 2e-62
 Identities = 254/297 (85%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| ||||| | |||||| ||||| |||||||||||||| |||||||| | 
Sbjct: 312 tcagccgccgaagccgtacaaggtgcggccctggcgcttgagcgcgtacacgacgtcgag 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
            | |||||||||||||||   |||||||||||||||||||||||||||||||||||||  
Sbjct: 252 cgaggtgacggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgga 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||    |||||||||  ||||    |||||||| ||||| || |||||||||||
Sbjct: 192 ctccaggaccgacttgagcaccgcgcgcacgtcctcgtaaatgaggccggagatgcgctt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            ||||||||||| | |||||| ||| ||||||| ||||||||||||||||||||||||||
Sbjct: 132 gacgccgccacgacgggccaggcgcaggatggcgggcttggtgatgccctggatgttgtc 73

                                                                    
Query: 464 gcgcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           ||| || | ||| ||||| ||||| ||||||||||||||||||||||| || |||||
Sbjct: 72  gcggaggatcttgcggtggcgcttcgcgccgcccttgccgaggcccttgcccccctt 16

to top

>ref|XM_545396.2| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488274), mRNA
          Length = 366

 Score =  246 bits (124), Expect = 7e-62
 Identities = 163/176 (92%)
 Strand = Plus / Minus

                                                                       
Query: 359 gagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcct 418
           |||||| ||||||||||||||||||||||| |||||||||||||| |||||||| |||| 
Sbjct: 240 gagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccgccgcgccg 181

                                                                       
Query: 419 ggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagcaccttccg 478
           |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||
Sbjct: 180 ggccagccgccggatggcgggcttggtgatgccctggatgttgtcgcgcagcaccttgcg 121

                                                                   
Query: 479 gtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccggaca 534
           ||| |||||||||||||||||||| || |||||||| |||||||||||||| ||||
Sbjct: 120 gtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgcgaccagaca 65

to top

>emb|BX061529.1|CNS09JN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score =  246 bits (124), Expect = 7e-62
 Identities = 254/296 (85%), Gaps = 1/296 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 357 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 298

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 297 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 239

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 238 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 179

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 178 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 119

                                                                   
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcg 526
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||
Sbjct: 118 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 63

to top

>emb|BX047203.1|CNS098L3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score =  246 bits (124), Expect = 7e-62
 Identities = 241/280 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 ccctgtcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcggcgggcgtgc 311
           ||||| ||||| || ||||| || || ||||| || ||||| ||||||||   |||||||
Sbjct: 310 ccctggcgcttcagagcgtacaccacatccatcgccgtgaccgtcttgcgcttggcgtgc 251

                                                                       
Query: 312 tcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagcacaccgcgg 371
           |||||||||||||| || |||||||| |||||||| ||||| | ||| ||||||||||| 
Sbjct: 250 tcggtgtaggtgaccgcatcgcggatcacgttctccaggaacaccttcagcacaccgcgc 191

                                                                       
Query: 372 gtctcctcgtagatgagccccgagatgcgcttcacgccgccacgcctggccagacgccgg 431
           ||||| |||||||| || || ||||| ||||||||||||||||| |  |||||||| |||
Sbjct: 190 gtctcttcgtagatcaggccggagatacgcttcacgccgccacggcgagccagacggcgg 131

                                                                       
Query: 432 atggccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgacgcttggcg 491
           ||||| ||||||||||||||||||||||| |||||||||||||| || ||||||||||| 
Sbjct: 130 atggcgggcttggtgatgccctggatgttatcgcgcagcaccttgcgatgacgcttggct 71

                                                   
Query: 492 ccgcccttgccgaggcccttccctcccttgccgcgaccgg 531
           || ||||| || || ||||| |||||||||||||||||||
Sbjct: 70  cctccctttcccagtcccttgcctcccttgccgcgaccgg 31

to top

>emb|BX053377.1|CNS09DCL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score =  242 bits (122), Expect = 1e-60
 Identities = 259/302 (85%), Gaps = 2/302 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 398 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 339

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 338 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 280

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 279 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 220

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 219 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 160

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccct-cccttgccgcgacc 529
           ||||| || ||||||||||| || ||||| || || ||||| ||| ||||||||||||||
Sbjct: 159 accttgcgatgacgcttggctcctccctttcccagtcccttgcctccccttgccgcgacc 100

             
Query: 530 gg 531
           ||
Sbjct: 99  gg 98

to top

>emb|BX053210.1|CNS09D7Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score =  242 bits (122), Expect = 1e-60
 Identities = 258/302 (85%), Gaps = 1/302 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 395 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 336

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 335 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 276

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| || |||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 275 aacaccttcagtacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 216

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 215 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 156

                                                                       
Query: 471 accttccggtgacgcttggc-gccgcccttgccgaggcccttccctcccttgccgcgacc 529
           ||||| || |||||||||||  || ||||| || || ||||| |||||||||||||||||
Sbjct: 155 accttgcgatgacgcttggctccctccctttcccagtcccttgcctcccttgccgcgacc 96

             
Query: 530 gg 531
           ||
Sbjct: 95  gg 94

to top

>emb|X00091.1|HSHISH4 Human histone H4 gene
          Length = 709

 Score =  242 bits (122), Expect = 1e-60
 Identities = 261/306 (85%), Gaps = 1/306 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 424 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 365

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| | |
Sbjct: 364 accgtcttgcgcttggcgtgctctgtataggttacggcgtcccggattacgttctccaag 305

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 304 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 245

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           || || | ||| || || || ||||| || ||||||||||| ||||| ||||||||||| 
Sbjct: 244 ccgcggc-ggcaaggcgtcgaatggctggtttggtgatgccatggatattgtcgcgcagt 186

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           || || ||||| ||||| |||||||| ||||| ||||||||||| || |||||||| || 
Sbjct: 185 actttacggtggcgcttagcgccgcctttgccaaggcccttcccgcctttgccgcggcca 126

                 
Query: 531 gacatg 536
           ||||||
Sbjct: 125 gacatg 120

to top

>emb|BX061455.1|CNS09JKZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score =  240 bits (121), Expect = 4e-60
 Identities = 257/301 (85%), Gaps = 1/301 (0%)
 Strand = Plus / Plus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 578 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 637

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 638 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 697

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 698 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 757

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||| | |||||||| ||||||||||||||||||||||| ||||||| |
Sbjct: 758 ccacggcgagccagaaggcggatggcgggcttggtgatgccctggatgttatcgcgca-c 816

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 817 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 876

            
Query: 531 g 531
           |
Sbjct: 877 g 877

to top

>emb|BX043671.1|CNS095UZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16BG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 645

 Score =  240 bits (121), Expect = 4e-60
 Identities = 251/293 (85%), Gaps = 1/293 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 379 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 320

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 319 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 261

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 260 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 201

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 200 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 141

                                                                
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgcc 523
           ||||| || ||||||||||| || ||||| || || ||||| |||||||||||
Sbjct: 140 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgcc 88

to top

>emb|BX054530.1|CNS09E8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score =  238 bits (120), Expect = 2e-59
 Identities = 246/288 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 398 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 339

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 338 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 279

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 278 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 219

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 218 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 159

                                                           
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctccc 518
           ||||| || ||||||||||| || ||||| || || ||||| ||||||
Sbjct: 158 accttgcgatgacgcttggctcctccctttcccagtcccttgcctccc 111

to top

>ref|XM_227462.3| PREDICTED: Rattus norvegicus histone 2, H4 (predicted)
           (Hist2h4_predicted), mRNA
          Length = 312

 Score =  236 bits (119), Expect = 7e-59
 Identities = 251/295 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| ||||| || ||||| |||||||| ||||| || || |||||||
Sbjct: 310 agcctccgaagccgtacagggttcggccctggcgcttgagagcgtacaccacatccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||||||   ||||||||| ||||||||||| ||||||||||| |||||||
Sbjct: 250 cggtgacggtcttgcgcttggcgtgctcagtgtaggtgactgcgtcgcggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| || ||||| ||||||||||| |||||||| || ||||||||||| |
Sbjct: 190 ccaggaacaccttcagtacaccacgggtctcctcatagatgaggccggagatgcgcttga 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | ||||||||||  || || || |||||||| ||||||||||| ||||||||||| || |
Sbjct: 130 caccgccacgccgagctaggcgacggatggcgggcttggtgatcccctggatgttatccc 71

                                                                  
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctccctt 520
           |||  ||||| ||||||||||||||||| |||||||| | |||||| || |||||
Sbjct: 70  gcaagaccttgcggtgacgcttggcgccacccttgcctaagcccttaccaccctt 16

to top

>emb|BX041120.1|CNS093W4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score =  234 bits (118), Expect = 3e-58
 Identities = 258/302 (85%), Gaps = 2/302 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 359 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 300

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   |||||||||||| ||||||||| | |||||||| |||||||| |||
Sbjct: 299 accgtcttgcgcttggcgtgctcggtttaggtgacg-catcgcggatcacgttctccagg 241

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 240 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 181

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| |||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 180 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 121

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgc-cgcgacc 529
           ||||| || ||||||||||| || ||||| || || ||||| |||||||||| |||||||
Sbjct: 120 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgcgcgcgacc 61

             
Query: 530 gg 531
           ||
Sbjct: 60  gg 59

to top

>emb|BX061530.1|CNS09JN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score =  232 bits (117), Expect = 1e-57
 Identities = 255/301 (84%)
 Strand = Plus / Plus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 460 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 519

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 520 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 579

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 580 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 639

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           |||||    |||||||| |||||||| ||||||||||||||||||||||| |||||||  
Sbjct: 640 ccacgggaagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcaca 699

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
            |||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 700 cccttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 759

            
Query: 531 g 531
           |
Sbjct: 760 g 760

to top

>emb|CR542172.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0824D for
           gene HIST2H4, histone 2, H4; complete cds, incl.
           stopcodon
          Length = 312

 Score =  232 bits (117), Expect = 1e-57
 Identities = 237/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| |||||||||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 310 agcctccgaagccgtagagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 250 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 190 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 130 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 71

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 70  tcaagaccttgcggtggcgcttagcgccccctttgcc 34

to top

>dbj|AK133404.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4933413O14 product:histone 1, H4b, full
           insert sequence
          Length = 1459

 Score =  232 bits (117), Expect = 1e-57
 Identities = 192/217 (88%)
 Strand = Plus / Plus

                                                                       
Query: 319 aggtgacggcgtcgcggatgacgttctcgaggaagatcttgagcacaccgcgggtctcct 378
           ||||||||||||||||||| |||||||| ||||| | ||| |||||||||||||||||||
Sbjct: 44  aggtgacggcgtcgcggatcacgttctccaggaacaccttcagcacaccgcgggtctcct 103

                                                                       
Query: 379 cgtagatgagccccgagatgcgcttcacgccgccacgcctggccagacgccggatggccg 438
           |||||||||| || |||||||||||||| || || |||| |||||| || |||||||| |
Sbjct: 104 cgtagatgaggccggagatgcgcttcactcccccgcgccgggccaggcggcggatggcgg 163

                                                                       
Query: 439 gcttggtgatgccctggatgttgtcgcgcagcaccttccggtgacgcttggcgccgccct 498
           |||||||||||||||||||||||||||||||||| || || || ||||| ||||| || |
Sbjct: 164 gcttggtgatgccctggatgttgtcgcgcagcactttgcgatggcgcttagcgccacctt 223

                                                
Query: 499 tgccgaggcccttccctcccttgccgcgaccggacat 535
           |||| ||||| || ||||||||||||||||| |||||
Sbjct: 224 tgcccaggccttttcctcccttgccgcgaccagacat 260

to top

>ref|XM_601250.2| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC522961), mRNA
          Length = 312

 Score =  230 bits (116), Expect = 4e-57
 Identities = 236/276 (85%)
 Strand = Plus / Minus

                                                                       
Query: 224 tcagccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccat 283
           |||||||||||| || |||||||||||||| || || |||||||||||||| ||||||||
Sbjct: 312 tcagccgccgaagccatagagggtgcgtccttggcgtttgagcgcgtagaccacgtccat 253

                                                                       
Query: 284 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 343
           ||||||||| ||||||||   ||||||||||||||||||||| || || ||||| || ||
Sbjct: 252 ggcggtgacagtcttgcgcttggcgtgctcggtgtaggtgactgcatcccggatcacatt 193

                                                                       
Query: 344 ctcgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgctt 403
           ||| ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||| ||
Sbjct: 192 ctccaggaacaccttcagcaccccgcgggtctcctcgtagatgaggccggagatgcgttt 133

                                                                       
Query: 404 cacgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtc 463
            || || |||||||  || || || ||||| || ||||| ||||||||||||||||||||
Sbjct: 132 gactcctccacgccgagctaggcggcggatagcgggcttagtgatgccctggatgttgtc 73

                                               
Query: 464 gcgcagcaccttccggtgacgcttggcgccgccctt 499
            ||||  || || ||||||||||||||||| |||||
Sbjct: 72  tcgcaaaactttgcggtgacgcttggcgcccccctt 37

to top

>emb|BX047204.1|CNS098L4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 554

 Score =  226 bits (114), Expect = 6e-56
 Identities = 257/302 (85%), Gaps = 2/302 (0%)
 Strand = Plus / Plus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 140 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 199

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 200 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 259

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 260 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 319

                                                                       
Query: 411 ccacgcctggcc-agacgccggatggccggcttggtgatgccctggatgttgtcgcgcag 469
           ||||| |  ||| ||| | |||||||| ||||||||||||||||||||||| ||||||| 
Sbjct: 320 ccacggcgagccaagaaggcggatggcgggcttggtgatgccctggatgttatcgcgca- 378

                                                                       
Query: 470 caccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgacc 529
           |||||| || ||||||||||| || ||||| || || ||||| |||||||||||||||||
Sbjct: 379 caccttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgacc 438

             
Query: 530 gg 531
           ||
Sbjct: 439 gg 440

to top

>gb|DQ066258.1| Ixodes scapularis isolate ISN-L-157 hist1h4i protein mRNA, complete
           cds
          Length = 312

 Score =  226 bits (114), Expect = 6e-56
 Identities = 243/286 (84%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||||||||| ||||| ||||| ||||| |||| ||| ||||||||||||||||||||||
Sbjct: 310 agccgccgaacccgtacagggtacgtccttgtctcttcagcgcgtagacgacgtccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||| || || |    |||||| || ||||||||||||||||||||||| |||||||
Sbjct: 250 cggtgaccgtttttctcttggcgtgttccgtgtaggtgacggcgtcgcggatcacgttct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | |||||||  |||||||| || ||||||||||||||||| || || ||||| ||||| |
Sbjct: 190 ccaggaagactttgagcacgcctcgggtctcctcgtagatcagaccggagatacgcttga 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           |||| ||||| |  |||||||| || ||||| ||||| ||||| |||||||||||||| |
Sbjct: 130 cgccaccacggcgagccagacgacgaatggcgggctttgtgatcccctggatgttgtctc 71

                                                         
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggccctt 511
           | |||||||| || |||||||||||||| || || ||||| |||||
Sbjct: 70  ggagcaccttgcgatgacgcttggcgcctccttttccgagcccctt 25

to top

>gb|BC019846.1| Homo sapiens cDNA clone IMAGE:5113140
          Length = 946

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 317 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 258

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 257 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 198

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 197 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 138

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 137 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 78

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 77  tcaagaccttgcggtggcgcttagcgccccctttgcc 41

to top

>ref|NM_003548.2| Homo sapiens histone 2, H4 (HIST2H4), mRNA
          Length = 396

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 338 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 279

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 278 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 219

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 218 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 159

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 158 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 99

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 98  tcaagaccttgcggtggcgcttagcgccccctttgcc 62

to top

>ref|XM_513765.1| PREDICTED: Pan troglodytes LOC457262 (LOC457262), mRNA
          Length = 1963

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 612 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 553

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 552 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 493

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 492 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 433

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 432 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 373

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 372 tcaagaccttgcggtggcgcttagcgccccctttgcc 336

to top

>ref|NM_001034077.3| Homo sapiens histone H4/o (H4/o), mRNA
          Length = 373

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 332 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 273

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 272 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 213

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 212 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 153

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 152 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 93

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 92  tcaagaccttgcggtggcgcttagcgccccctttgcc 56

to top

>gb|AF525682.1| Homo sapiens histone H4 (HIST2H4) gene, complete cds
          Length = 864

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 621 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 562

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 561 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 502

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 501 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 442

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 441 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 382

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 381 tcaagaccttgcggtggcgcttagcgccccctttgcc 345

to top

>gb|BC112193.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:138398
           IMAGE:8327661), complete cds
          Length = 373

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 332 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 273

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 272 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 213

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 212 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 153

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 152 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 93

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 92  tcaagaccttgcggtggcgcttagcgccccctttgcc 56

to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Plus

                                                                          
Query: 226    agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
              |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 122548 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 122607

                                                                          
Query: 286    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
              | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 122608 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 122667

                                                                          
Query: 346    cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
              | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 122668 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 122727

                                                                          
Query: 406    cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
              ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 122728 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 122787

                                                   
Query: 466    gcagcaccttccggtgacgcttggcgccgcccttgcc 502
               ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 122788 tcaagaccttgcggtggcgcttagcgccccctttgcc 122824



 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                         
Query: 226   agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
             |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 94718 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 94659

                                                                         
Query: 286   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
             | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 94658 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 94599

                                                                         
Query: 346   cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
             | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 94598 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 94539

                                                                         
Query: 406   cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
             ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 94538 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 94479

                                                  
Query: 466   gcagcaccttccggtgacgcttggcgccgcccttgcc 502
              ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 94478 tcaagaccttgcggtggcgcttagcgccccctttgcc 94442

to top

>emb|BX057868.1|CNS09GTC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 906

 Score =  224 bits (113), Expect = 3e-55
 Identities = 254/301 (84%)
 Strand = Plus / Plus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           |||||||||||||| || || ||||| ||||| || ||||| || || ||||| || |||
Sbjct: 524 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 583

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||   ||||||||||||||||||||| || ||||| || |||||||| |||
Sbjct: 584 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcgaatcacgttctccagg 643

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| ||||||||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 644 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 703

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||| | |||||||| ||||||||||||||||||||||| |||||||  
Sbjct: 704 ccacggcgagccagaaggcggatggcgggcttggtgatgccctggatgttatcgcgcaca 763

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
            |||| || ||||||||||| || ||||| || || ||||| ||||||||||||||||||
Sbjct: 764 cccttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 823

            
Query: 531 g 531
           |
Sbjct: 824 g 824

to top

>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4
          Length = 1898

 Score =  224 bits (113), Expect = 3e-55
 Identities = 260/309 (84%)
 Strand = Plus / Plus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||| |||||||||||||| ||||| ||||| || || || ||||||||||||||||| 
Sbjct: 286 ccgaagccgtagagggtgcggccctggcgcttcagagcatacacgacgtccatggcggtc 345

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           || ||||||||||| |||||||||||||| ||||| | ||| |||||||| ||||| |||
Sbjct: 346 acagtcttgcggcgagcgtgctcggtgtacgtgaccgagtcacggatgacattctcaagg 405

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           ||| |||| ||||||  ||||||||||||||||||||| ||   ||| |||||||| |||
Sbjct: 406 aagttcttcagcacagtgcgggtctcctcgtagatgaggccgctgatacgcttcacaccg 465

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| ||||| || ||||| ||||| ||||| ||||||||||| |||
Sbjct: 466 ccacgacgtgccagacgacggatagcaggcttcgtgataccctgaatgttgtcgcgaagc 525

                                                                       
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcgaccg 530
           ||||| || || ||||| || || |||||||| | |||||| || |||||||| || || 
Sbjct: 526 accttgcgatggcgcttagctcctcccttgcccaagccctttccgcccttgccacgtccc 585

                    
Query: 531 gacatggtt 539
           |||||||||
Sbjct: 586 gacatggtt 594

to top

>ref|XM_942850.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 4 (LOC648164), mRNA
          Length = 622

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 335 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 276

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 275 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 216

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 215 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 156

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 155 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 96

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 95  tcaagaccttgcggtggcgcttagcgccccctttgcc 59

to top

>ref|XM_942844.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 3 (LOC648164), mRNA
          Length = 1878

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 335 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 276

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 275 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 216

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 215 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 156

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 155 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 96

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 95  tcaagaccttgcggtggcgcttagcgccccctttgcc 59

to top

>ref|XM_942841.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 2 (LOC648164), mRNA
          Length = 1128

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 335 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 276

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 275 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 216

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 215 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 156

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 155 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 96

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 95  tcaagaccttgcggtggcgcttagcgccccctttgcc 59

to top

>ref|XM_936503.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 1 (LOC648164), mRNA
          Length = 2148

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 335 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 276

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 275 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 216

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 215 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 156

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 155 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 96

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 95  tcaagaccttgcggtggcgcttagcgccccctttgcc 59

to top

>gb|BC093969.1| Homo sapiens histone 2, H4, mRNA (cDNA clone MGC:121004
           IMAGE:7939814), complete cds
          Length = 373

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 332 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 273

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 272 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 213

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 212 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 153

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 152 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 93

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 92  tcaagaccttgcggtggcgcttagcgccccctttgcc 56

to top

>gb|AY893103.1| Synthetic construct Homo sapiens clone FLH141156.01L histone 2 H4
           (H4FN) mRNA, partial cds
          Length = 312

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 310 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 250 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 190 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 130 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 71

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 70  tcaagaccttgcggtggcgcttagcgccccctttgcc 34

to top

>gb|AY890621.1| Synthetic construct Homo sapiens clone FLH141160.01X histone 2 H4
           (H4FN) mRNA, complete cds
          Length = 312

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 310 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 251

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 250 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 191

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 190 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 131

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 130 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 71

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 70  tcaagaccttgcggtggcgcttagcgccccctttgcc 34

to top

>gb|BC108260.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:102836
           IMAGE:6011519), complete cds
          Length = 1712

 Score =  224 bits (113), Expect = 3e-55
 Identities = 236/277 (85%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 327 agcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccatgg 268

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           | ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||||
Sbjct: 267 ctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacattct 208

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| ||||||||||||||||||||||| ||||| || ||||| ||||| |
Sbjct: 207 ccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgcttaa 148

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           ||||||||||||  || |||||||| ||||| ||||||||||||||||| |||||||| |
Sbjct: 147 cgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtctc 88

                                                
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgcc 502
            ||  ||||| ||||| ||||| ||||| || |||||
Sbjct: 87  tcaagaccttgcggtggcgcttagcgccccctttgcc 51

to top

>dbj|AB197150.1| Fragaria x ananassa mRNA for histone H4, partial cds
          Length = 308

 Score =  222 bits (112), Expect = 1e-54
 Identities = 259/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 228 ccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcg 287
           |||||||| |||||||| || | |||||| | |||||| || |||||||| |||||||||
Sbjct: 308 ccgccgaagccgtagagtgtccttccctgcctcttgagagcatagacgacatccatggcg 249

                                                                       
Query: 288 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 347
           ||||| ||||| |  ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 248 gtgacagtcttcctccgggcgtgctcggtgtaggtgacggcgtcacggatgacgttctcg 189

                                                                       
Query: 348 aggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 407
           |||||||||||||| || || | |||||| || |||||||| || ||||| ||||| |||
Sbjct: 188 aggaagatcttgaggacgcctctggtctcttcatagatgagaccggagatacgcttgacg 129

                                                                       
Query: 408 ccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgc 467
           || || |  |  |||| ||| |||||||| ||||||||||||||||||||||| || |  
Sbjct: 128 ccacctctgcgagccaaacggcggatggcgggcttggtgatgccctggatgttatccctg 69

                                                                       
Query: 468 agcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcccttgccgcga 527
           || ||||||| |||||||||||| || ||||| || |  ||||| |||||||| || |||
Sbjct: 68  aggaccttcctgtgacgcttggctcctccctttcccaaacccttgcctccctttccacga 9

                   
Query: 528 ccggacat 535
           || |||||
Sbjct: 8   cccgacat 1

to top

>emb|Z46226.1|HTHISH4 H.tubulosa gene encoding histone H4
          Length = 1042

 Score =  222 bits (112), Expect = 1e-54
 Identities = 247/292 (84%)
 Strand = Plus / Minus

                                                                       
Query: 226 agccgccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatgg 285
           |||| ||||||||||||||||| |||||||| || || |  ||||| |||||||||||||
Sbjct: 730 agcccccgaatccgtagagggtacgtccctggcgtttcaaggcgtacacgacgtccatgg 671

                                                                       
Query: 286 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 345
           ||||||||||||| |    ||||||||||  |||||||||||| || |||||||||||||
Sbjct: 670 cggtgacggtcttcctcttggcgtgctcgcagtaggtgacggcatcacggatgacgttct 611

                                                                       
Query: 346 cgaggaagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttca 405
           | ||||| | ||| || ||||| |||||||| |||||||||||||| ||||| || || |
Sbjct: 610 ccaggaacaccttcagtacaccacgggtctcttcgtagatgagccctgagatacgtttaa 551

                                                                       
Query: 406 cgccgccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgc 465
           | || ||||| | ||||||||| |||||||| ||||||||||| ||||||||||| || |
Sbjct: 550 ctccaccacgtcgggccagacgacggatggctggcttggtgataccctggatgttatcac 491

                                                               
Query: 466 gcagcaccttccggtgacgcttggcgccgcccttgccgaggcccttccctcc 517
           | || ||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 490 gaagaacctttcggtgacgcttggcgcctccctttcccagtccctttcctcc 439

to top

>ref|XM_703205.1| PREDICTED: Danio rerio similar to germinal histone H4 gene,
           transcript variant 2 (LOC560314), mRNA
          Length = 312

 Score =  220 bits (111), Expect = 4e-54
 Identities = 243/287 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccgaatccgtagagggtgcgtccctgtcgcttgagcgcgtagacgacgtccatggcggtg 290
           ||||||||||| || ||||||||||||| ||| |||||||| || || ||||||||||||
Sbjct: 305 ccgaatccgtacagagtgcgtccctgtctcttcagcgcgtacaccacatccatggcggtg 246

                                                                       
Query: 291 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 350
           |||||||| |    |||||||||||||||||||||||| |||||||| |||||||| |||
Sbjct: 245 acggtcttcctcttggcgtgctcggtgtaggtgacggcatcgcggatcacgttctcaagg 186

                                                                       
Query: 351 aagatcttgagcacaccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 410
           || | ||| | ||| ||||||||||||||||||||||| || ||||| ||||| || || 
Sbjct: 185 aacaccttcaacaccccgcgggtctcctcgtagatgagaccagagatacgcttaacacca 126

                                                                       
Query: 411 ccacgcctggccagacgccggatggccggcttggtgatgccctggatgttgtcgcgcagc 470
           ||||| |  |||||||| || ||||| || |||||||| ||||||||||| |||||||| 
Sbjct: 125 ccacgacgagccagacggcgaatggcgggtttggtgattccctggatgttatcgcgcaga 66

                                                          
Query: 471 accttccggtgacgcttggcgccgcccttgccgaggcccttccctcc 517
           || || ||||||||||| ||||| || || ||||| ||||| |||||
Sbjct: 65  actttacggtgacgcttcgcgcctcctttaccgagtccctttcctcc 19


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,010,075
Number of Sequences: 3902068
Number of extensions: 4010075
Number of successful extensions: 122303
Number of sequences better than 10.0: 942
Number of HSP's better than 10.0 without gapping: 943
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 119363
Number of HSP's gapped (non-prelim): 2504
length of query: 585
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 562
effective length of database: 17,143,297,704
effective search space: 9634533309648
effective search space used: 9634533309648
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result