ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags31b14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|D13472.2|BLYINOPP Hordeum vulgare mRNA for vacuolar membrane... 446 e-122
2gb|AY296911.1| Triticum aestivum vacuolar proton-inorganic pyrop... 113 3e-22
3gb|AC004695.1|AC004695 Homo sapiens BAC clone CTA-317H1 from 3p1... 48 0.017
4gb|AC163640.5| Mus musculus BAC clone RP24-182L3 from chromosome... 46 0.067
5gb|AC160961.3| Mus musculus BAC clone RP24-288N19 from chromosom... 46 0.067
6gb|AC122873.5| Mus musculus BAC clone RP23-110K10 from 8, comple... 46 0.067
7emb|CR956397.19| Pig DNA sequence from clone CH242-259E5 on chro... 46 0.067
8gb|AC127258.4| Mus musculus BAC clone RP24-302G16 from 8, comple... 46 0.067
9ref|NM_001033812.1| Mus musculus RIKEN cDNA F830208F22 gene (F83... 44 0.26
10gb|AF109905.1|MMHC213L3 Mus musculus major histocompatibility lo... 44 0.26
11gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, c... 44 0.26
12gb|BC056354.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (c... 44 0.26
13gb|BC056383.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (c... 44 0.26
14gb|AC132099.3| Mus musculus BAC clone RP24-292F6 from chromosome... 44 0.26
15gb|AC083805.17| Homo sapiens 12 BAC RP11-620J15 (Roswell Park Ca... 44 0.26
16gb|BC056970.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (c... 44 0.26
17gb|AC087117.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, R... 44 0.26
18gb|AC114487.2| Homo sapiens chromosome 1 clone RP4-706L14, compl... 44 0.26
19dbj|AK134191.1| Mus musculus adult male thymus cDNA, RIKEN full-... 44 0.26
20dbj|AK147889.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 44 0.26
21dbj|AK156688.1| Mus musculus activated spleen cDNA, RIKEN full-l... 44 0.26
22dbj|AK155264.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 44 0.26
23dbj|AK163879.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 44 0.26
24dbj|AK166155.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 44 0.26
25gb|AC161147.6| Mus musculus BAC clone RP23-357G12 from chromosom... 44 0.26
26dbj|AK172459.1| Mus musculus activated spleen cDNA, RIKEN full-l... 44 0.26
27dbj|AK046307.1| Mus musculus adult male corpora quadrigemina cDN... 44 0.26
28dbj|AK038543.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 44 0.26
29dbj|AK044839.1| Mus musculus 9.5 days embryo parthenogenote cDNA... 44 0.26
30dbj|AK048581.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 44 0.26
31dbj|AK053863.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 44 0.26
32gb|AC073916.41| Homo sapiens 12 BAC RP11-408I18 (Roswell Park Ca... 44 0.26
33gb|AF318301.1|AF318301 Mus musculus CGI-74-like SR-rich protein ... 44 0.26
34gb|AC124762.4| Mus musculus BAC clone RP23-155A10 from 6, comple... 44 0.26
35emb|CR974444.18| Mouse DNA sequence from clone RP23-115O3 on chr... 44 0.26
36gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic se... 44 0.26
37gb|AC139573.4| Mus musculus BAC clone RP23-472H13 from 16, compl... 44 0.26
38gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, compl... 44 0.26
39ref|NM_138680.1| Mus musculus LUC7-like 2 (S. cerevisiae) (Luc7l... 44 0.26
40emb|AL732613.10| Mouse DNA sequence from clone RP23-193A21 on ch... 44 0.26
41gb|BT017471.1| Zea mays clone EL01N0408D01.c mRNA sequence 42 1.0
42gb|AY773965.1| Homo sapiens glutamate-cysteine ligase, modifier ... 42 1.0
43gb|AY382196.1| Homo sapiens glutamate-cysteine ligase modifier s... 42 1.0
44ref|NM_002061.2| Homo sapiens glutamate-cysteine ligase, modifie... 42 1.0
45gb|AY480047.1| Homo sapiens plectin 6 mRNA, complete cds 42 1.0
46ref|NM_201380.2| Homo sapiens plectin 1, intermediate filament b... 42 1.0
47emb|AL117351.12|HSJ837O21 Human DNA sequence from clone RP5-837O... 42 1.0
48gb|BC041809.1| Homo sapiens glutamate-cysteine ligase, modifier ... 42 1.0
49gb|AC109322.16| Homo sapiens chromosome 8, clone CTD-3065J16, co... 42 1.0
50emb|BX957342.5| Zebrafish DNA sequence from clone CH211-120P12 i... 42 1.0
51dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.0
52emb|BX247887.6| Zebrafish DNA sequence from clone CH211-142L10, ... 42 1.0
53dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.0
54dbj|AK066933.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.0
55dbj|AB012766.1| Oryza sativa gene for ovp2, complete cds 42 1.0
56gb|U72210.1|HSU72210 Human gamma-glutamylcysteine synthetase lig... 42 1.0
57gb|AF028815.1|AF028815 Homo sapiens gamma-glutamylcysteine synth... 42 1.0
58gb|L35546.1|HUMGCSL Homo sapiens gamma-glutamylcysteine syntheta... 42 1.0
59dbj|D45384.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase,... 42 1.0
60gb|AC160538.8| Mus musculus chromosome 15, clone RP24-156D3, com... 40 4.1
61gb|AC114649.9| Mus musculus chromosome 5, clone RP24-150M14, com... 40 4.1
62gb|AC146132.3| Pan troglodytes BAC clone RP43-23H13 from 7, comp... 40 4.1
63ref|XM_001000399.1| PREDICTED: Mus musculus similar to Protein C... 40 4.1
64ref|XM_908936.2| PREDICTED: Mus musculus similar to Protein C1or... 40 4.1
65ref|XM_890379.2| PREDICTED: Mus musculus similar to Protein C1or... 40 4.1
66gb|AC115800.13| Mus musculus chromosome 8, clone RP23-407E22, co... 40 4.1
67gb|AC105947.11| Mus musculus chromosome 18, clone RP24-66N1, com... 40 4.1
68gb|AC132255.3| Mus musculus BAC clone RP24-472I15 from chromosom... 40 4.1
69gb|AC140316.3| Mus musculus BAC clone RP23-419L10 from chromosom... 40 4.1
70gb|BC020058.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (c... 40 4.1
71gb|AC072039.19| Homo sapiens 3 BAC RP11-305O4 (Roswell Park Canc... 40 4.1
72gb|AC084054.12| Mus Musculus Strain C57BL6/J chromosome 5 BAC, R... 40 4.1
73gb|AC124464.3| Mus musculus BAC clone RP24-155I15 from chromosom... 40 4.1
74gb|AC126266.3| Mus musculus BAC clone RP23-402N17 from chromosom... 40 4.1
75gb|AC113976.13| Mus musculus chromosome 15, clone RP23-146F23, c... 40 4.1
76gb|AC142299.1| Pan troglodytes BAC clone RP43-121O18 from 7, com... 40 4.1
77emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on ch... 40 4.1
78emb|AL035692.10|HS329N18 Human DNA sequence from clone RP3-329N1... 40 4.1
79gb|DQ133470.1| Pan paniscus ribosomal RNA intergenic spacer, par... 40 4.1
80gb|AC121765.2| Homo sapiens chromosome 3 clone RP11-767D18, comp... 40 4.1
81emb|CR377210.7| Zebrafish DNA sequence from clone CH211-195C22 i... 40 4.1
82gb|AC107464.5| Homo sapiens BAC clone RP11-1191J2 from 4, comple... 40 4.1
83gb|AC105266.2| Homo sapiens chromosome 3 clone RP11-796K6, compl... 40 4.1
84gb|AC080043.5| Homo sapiens chromosome , clone RP11-45M9, comple... 40 4.1
85gb|AC023566.11| Homo sapiens chromosome 8, clone RP11-660D5, com... 40 4.1
86gb|AC093925.5| Genomic sequence for Mus musculus, clone RP23-304... 40 4.1
87gb|AF005042.1|AF005042 Homo sapiens cGMP-phosphodiesterase beta-... 40 4.1
88gb|AF005041.1|AF005041 Homo sapiens cGMP-phosphodiesterase beta-... 40 4.1
89emb|BX571666.10| Zebrafish DNA sequence from clone DKEY-221F8 in... 40 4.1
90emb|BX005480.12| Mouse DNA sequence from clone RP23-142M12 on ch... 40 4.1
91gb|AC131664.3| Mus musculus BAC clone RP23-274J16 from chromosom... 40 4.1
92gb|AC113484.14| Mus musculus chromosome 8, clone RP23-343H23, co... 40 4.1
93gb|AC009198.8|AC009198 Drosophila melanogaster, chromosome 2L, r... 40 4.1
94gb|DQ164097.1| Callithrix jacchus gamma-glutamylcysteine synthet... 40 4.1
95gb|AC134025.2| Homo sapiens 3 BAC RP11-231I13 (Roswell Park Canc... 40 4.1
96gb|AC016700.8| Homo sapiens BAC clone RP11-175A7 from 2, complet... 40 4.1
97gb|AY148158.1| Mus musculus lamin B receptor gene, partial cds 40 4.1
98gb|AC093540.3| Pan troglodytes clone RP43-84M6, complete sequence 40 4.1
99gb|AE003635.2| Drosophila melanogaster chromosome 2L, section 44... 40 4.1
100emb|X62693.1|HSCGMP2 H.sapiens DNA for cGMP phosphodiesterase ex... 40 4.1
101gb|AC105072.9| Mus musculus chromosome 5, clone RP24-167C6, comp... 40 4.1
102emb|AL844566.8| Mouse DNA sequence from clone RP23-173H17 on chr... 40 4.1
103gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complet... 40 4.1
104emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on ch... 40 4.1
105emb|AL807399.5| Mouse DNA sequence from clone RP23-382O11 on chr... 40 4.1
106emb|AL589870.30| Mouse DNA sequence from clone RP23-118A2 on chr... 40 4.1

>dbj|D13472.2|BLYINOPP Hordeum vulgare mRNA for vacuolar membrane proton-translocating
            inorganic pyrophosphatase, complete cds
          Length = 2649

 Score =  446 bits (225), Expect = e-122
 Identities = 300/321 (93%), Gaps = 14/321 (4%)
 Strand = Plus / Minus

                                                                        
Query: 2    atgggacgaggaaaatttgccnggcacataccaacgagggaggacatctggtctctctct 61
            ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||
Sbjct: 2595 atgggacgaggaaaatttgccagacacataccaacgagggaggacatctggtctctctct 2536

                                                                        
Query: 62   tctactacatggagctacaagccggtnatgtaatggtgagacttacataacgccttcaag 121
            ||||||||||||||||||||||| || ||||||| |||||||| |||||||| |||||||
Sbjct: 2535 tctactacatggagctacaagcc-gtaatgtaat-gtgagactaacataacg-cttcaag 2479

                                                                        
Query: 122  aggccaggggaaaggggggtaggtaaccgcggcantcctggaatgacattgacaaccaaa 181
            ||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||||
Sbjct: 2478 aggccaggggaaaggggggtaggtaactgcggcaatcctgg-atgacattgacaaccaaa 2420

                                                                        
Query: 182  aataacagcngcgcacaacgtacgaa-----ggcgggcgggcaggcaggcgggggagtta 236
            ||||||||| ||||||||||||||||     |||||||||||||||||||||||||||||
Sbjct: 2419 aataacagcagcgcacaacgtacgaacggcgggcgggcgggcaggcaggcgggggagtta 2360

                                                                        
Query: 237  ttcgtgacagtgtctgtagatcatcgctcgact-----cgagtcctctagatgtacttga 291
            |||||||||||||||||||||||||||||||||     ||||||||||||||||||||||
Sbjct: 2359 ttcgtgacagtgtctgtagatcatcgctcgactcatcacgagtcctctagatgtacttga 2300

                                 
Query: 292  acagcagacctccgtacgtgg 312
            |||||||||||||||||||||
Sbjct: 2299 acagcagacctccgtacgtgg 2279



to top

>gb|AY296911.1| Triticum aestivum vacuolar proton-inorganic pyrophosphatase mRNA,
            complete cds
          Length = 2671

 Score =  113 bits (57), Expect = 3e-22
 Identities = 187/224 (83%), Gaps = 18/224 (8%)
 Strand = Plus / Minus

                                                                        
Query: 4    gggacgaggaaaatttgccnggcacataccaacgagg---gaggacatctggtctctctc 60
            ||||||||||||||||||| | ||||||||||  | |   ||||||||||||||||||||
Sbjct: 2590 gggacgaggaaaatttgccagacacataccaataatgaccgaggacatctggtctctctc 2531

                                                                        
Query: 61   ttctactacatggagctacaagccggtnatgtaatggtgagacttacataacgccttcaa 120
            |||||||||||||||||||||||||||     |||||||||||| || |||| |   |||
Sbjct: 2530 ttctactacatggagctacaagccggt-----aatggtgagactaacgtaacacacccaa 2476

                                                                        
Query: 121  gaggcc-aggggaaag-gggggtaggtaaccgcggcantcctgg---aatgacattgaca 175
            |||||| | ||||||| |||||||   ||| |||||| ||||||   |||||||   | |
Sbjct: 2475 gaggccaaagggaaagtgggggta---aactgcggcaatcctggaataatgaca-caaga 2420

                                                        
Query: 176  accaaaaataacagcngcgcacaacgtacgaa-ggcgggcgggc 218
            ||||||||||||||| ||||||||| |||||| |||||||||||
Sbjct: 2419 accaaaaataacagcagcgcacaacatacgaacggcgggcgggc 2376



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                       
Query: 270  cgagtcctctagatgtacttgaacagcagacctccgtacgtgg 312
            |||||| ||||||||||||||||||||| ||||||||||||||
Sbjct: 2327 cgagtcttctagatgtacttgaacagcacacctccgtacgtgg 2285



to top

>gb|AC004695.1|AC004695 Homo sapiens BAC clone CTA-317H1 from 3p13-3p14.2, complete sequence
          Length = 149572

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 205    gaaggcgggcgggcaggcaggcgg 228
              ||||||||||||||||||||||||
Sbjct: 102371 gaaggcgggcgggcaggcaggcgg 102394



to top

>gb|AC163640.5| Mus musculus BAC clone RP24-182L3 from chromosome 16, complete sequence
          Length = 168350

 Score = 46.1 bits (23), Expect = 0.067
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 207    aggcgggcgggcaggcaggcggg 229
              |||||||||||||||||||||||
Sbjct: 151434 aggcgggcgggcaggcaggcggg 151412



to top

>gb|AC160961.3| Mus musculus BAC clone RP24-288N19 from chromosome 16, complete
            sequence
          Length = 157144

 Score = 46.1 bits (23), Expect = 0.067
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 207  aggcgggcgggcaggcaggcggg 229
            |||||||||||||||||||||||
Sbjct: 4912 aggcgggcgggcaggcaggcggg 4890



to top

>gb|AC122873.5| Mus musculus BAC clone RP23-110K10 from 8, complete sequence
          Length = 199474

 Score = 46.1 bits (23), Expect = 0.067
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 207   aggcgggcgggcaggcaggcggg 229
             |||||||||||||||||||||||
Sbjct: 91354 aggcgggcgggcaggcaggcggg 91376



to top

>emb|CR956397.19| Pig DNA sequence from clone CH242-259E5 on chromosome 17, complete
             sequence
          Length = 177531

 Score = 46.1 bits (23), Expect = 0.067
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 207   aggcgggcgggcaggcaggcggg 229
             |||||||||||||||||||||||
Sbjct: 41128 aggcgggcgggcaggcaggcggg 41150



to top

>gb|AC127258.4| Mus musculus BAC clone RP24-302G16 from 8, complete sequence
          Length = 163028

 Score = 46.1 bits (23), Expect = 0.067
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 207  aggcgggcgggcaggcaggcggg 229
            |||||||||||||||||||||||
Sbjct: 1135 aggcgggcgggcaggcaggcggg 1113



to top

>ref|NM_001033812.1| Mus musculus RIKEN cDNA F830208F22 gene (F830208F22Rik), mRNA
          Length = 2892

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 209  gcgggcgggcaggcaggcgggg 230
            ||||||||||||||||||||||
Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642



to top

>gb|AF109905.1|MMHC213L3 Mus musculus major histocompatibility locus class III regions Hsc70t
              gene, partial cds; smRNP, G7A, NG23, MutS homolog, CLCP,
              NG24, NG25, and NG26 genes, complete cds; and unknown genes
          Length = 135545

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 208    ggcgggcgggcaggcaggcggg 229
              ||||||||||||||||||||||
Sbjct: 122842 ggcgggcgggcaggcaggcggg 122821



to top

>gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, complete sequence
          Length = 198736

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 209   gcgggcgggcaggcaggcgggg 230
             ||||||||||||||||||||||
Sbjct: 77888 gcgggcgggcaggcaggcgggg 77867



to top

>gb|BC056354.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone
           MGC:73491 IMAGE:6811460), complete cds
          Length = 2691

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 377 cgggcgggcaggcaggcggggg 356



to top

>gb|BC056383.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone
           MGC:73932 IMAGE:6853955), complete cds
          Length = 4252

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 358 cgggcgggcaggcaggcggggg 337



to top

>gb|AC132099.3| Mus musculus BAC clone RP24-292F6 from chromosome 16, complete
            sequence
          Length = 160650

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 208  ggcgggcgggcaggcaggcggg 229
            ||||||||||||||||||||||
Sbjct: 7840 ggcgggcgggcaggcaggcggg 7819



to top

>gb|AC083805.17| Homo sapiens 12 BAC RP11-620J15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 104816

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 208   ggcgggcgggcaggcaggcgggggag 233
             ||||||||||||||| ||||||||||
Sbjct: 85751 ggcgggcgggcaggctggcgggggag 85726



to top

>gb|BC056970.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone
           MGC:66790 IMAGE:6811460), complete cds
          Length = 2691

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 377 cgggcgggcaggcaggcggggg 356



to top

>gb|AC087117.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, RP23-349B4, Complete
              Sequence, complete sequence
          Length = 221899

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 208    ggcgggcgggcaggcaggcggg 229
              ||||||||||||||||||||||
Sbjct: 208704 ggcgggcgggcaggcaggcggg 208683



to top

>gb|AC114487.2| Homo sapiens chromosome 1 clone RP4-706L14, complete sequence
          Length = 160957

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 205    gaaggcgggcgggcaggcaggc 226
              ||||||||||||||||||||||
Sbjct: 135833 gaaggcgggcgggcaggcaggc 135854



to top

>dbj|AK134191.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched
           library, clone:5830469J19 product:LUC7-like 2 (S.
           cerevisiae), full insert sequence
          Length = 2071

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 293 cgggcgggcaggcaggcggggg 272



to top

>dbj|AK147889.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
           clone:G270081I19 product:LUC7-like 2 (S. cerevisiae),
           full insert sequence
          Length = 2861

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 310 cgggcgggcaggcaggcggggg 289



to top

>dbj|AK156688.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830037L18 product:unclassifiable, full
            insert sequence
          Length = 2892

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 209  gcgggcgggcaggcaggcgggg 230
            ||||||||||||||||||||||
Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642



to top

>dbj|AK155264.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630212I17
           product:LUC7-like 2 (S. cerevisiae), full insert
           sequence
          Length = 3394

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 369 cgggcgggcaggcaggcggggg 348



to top

>dbj|AK163879.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230006F22
            product:unclassifiable, full insert sequence
          Length = 2357

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 209  gcgggcgggcaggcaggcgggg 230
            ||||||||||||||||||||||
Sbjct: 1128 gcgggcgggcaggcaggcgggg 1107



to top

>dbj|AK166155.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
           library, clone:G730048C18 product:LUC7-like 2 (S.
           cerevisiae), full insert sequence
          Length = 3491

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 335 cgggcgggcaggcaggcggggg 314



to top

>gb|AC161147.6| Mus musculus BAC clone RP23-357G12 from chromosome 6, complete sequence
          Length = 225957

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 210    cgggcgggcaggcaggcggggg 231
              ||||||||||||||||||||||
Sbjct: 204291 cgggcgggcaggcaggcggggg 204312



to top

>dbj|AK172459.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830208F22 product:hypothetical protein,
            full insert sequence
          Length = 2892

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 209  gcgggcgggcaggcaggcgggg 230
            ||||||||||||||||||||||
Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642



to top

>dbj|AK046307.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
           full-length enriched library, clone:B230368A09
           product:similar to CDNA FLJ10657 FIS, CLONE
           NT2RP2006043, WEAKLY SIMILAR TO SPLICING FACTOR,
           ARGININE/SERINE-RICH 4 [Homo sapiens], full insert
           sequence
          Length = 3145

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 490 cgggcgggcaggcaggcggggg 469



to top

>dbj|AK038543.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230031O05 product:RIKEN cDNA
           4930471C18 gene, full insert sequence
          Length = 2299

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 293 cgggcgggcaggcaggcggggg 272



to top

>dbj|AK044839.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length
           enriched library, clone:B130007I01
           product:unclassifiable, full insert sequence
          Length = 2934

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 380 cgggcgggcaggcaggcggggg 359



to top

>dbj|AK048581.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130080B05 product:unclassifiable, full
           insert sequence
          Length = 2815

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 293 cgggcgggcaggcaggcggggg 272



to top

>dbj|AK053863.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130315L24 product:unclassifiable, full
           insert sequence
          Length = 2816

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 293 cgggcgggcaggcaggcggggg 272



to top

>gb|AC073916.41| Homo sapiens 12 BAC RP11-408I18 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 205283

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 208    ggcgggcgggcaggcaggcgggggag 233
              ||||||||||||||| ||||||||||
Sbjct: 104610 ggcgggcgggcaggcgggcgggggag 104635



to top

>gb|AF318301.1|AF318301 Mus musculus CGI-74-like SR-rich protein mRNA, complete cds
          Length = 2622

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 304 cgggcgggcaggcaggcggggg 283



to top

>gb|AC124762.4| Mus musculus BAC clone RP23-155A10 from 6, complete sequence
          Length = 199207

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 210   cgggcgggcaggcaggcggggg 231
             ||||||||||||||||||||||
Sbjct: 23344 cgggcgggcaggcaggcggggg 23365



to top

>emb|CR974444.18| Mouse DNA sequence from clone RP23-115O3 on chromosome 17, complete
             sequence
          Length = 190041

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 208   ggcgggcgggcaggcaggcggg 229
             ||||||||||||||||||||||
Sbjct: 36082 ggcgggcgggcaggcaggcggg 36061



to top

>gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic sequence
          Length = 230278

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 208   ggcgggcgggcaggcaggcggg 229
             ||||||||||||||||||||||
Sbjct: 23591 ggcgggcgggcaggcaggcggg 23612



to top

>gb|AC139573.4| Mus musculus BAC clone RP23-472H13 from 16, complete sequence
          Length = 189632

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 208   ggcgggcgggcaggcaggcggg 229
             ||||||||||||||||||||||
Sbjct: 10235 ggcgggcgggcaggcaggcggg 10256



to top

>gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, complete sequence
          Length = 159173

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 208    ggcgggcgggcaggcaggcgggggag 233
              ||||||||||||||| ||||||||||
Sbjct: 106316 ggcgggcgggcaggctggcgggggag 106341



to top

>ref|NM_138680.1| Mus musculus LUC7-like 2 (S. cerevisiae) (Luc7l2), mRNA
          Length = 2622

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 210 cgggcgggcaggcaggcggggg 231
           ||||||||||||||||||||||
Sbjct: 304 cgggcgggcaggcaggcggggg 283



to top

>emb|AL732613.10| Mouse DNA sequence from clone RP23-193A21 on chromosome 4, complete
              sequence
          Length = 204012

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 208    ggcgggcgggcaggcaggcggg 229
              ||||||||||||||||||||||
Sbjct: 162541 ggcgggcgggcaggcaggcggg 162520



to top

>gb|BT017471.1| Zea mays clone EL01N0408D01.c mRNA sequence
          Length = 1159

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 209 gcgggcgggcaggcaggcggg 229
           |||||||||||||||||||||
Sbjct: 875 gcgggcgggcaggcaggcggg 855



to top

>gb|AY773965.1| Homo sapiens glutamate-cysteine ligase, modifier subunit (GCLM) gene,
            complete cds
          Length = 24112

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 208  ggcgggcgggcaggcaggcgg 228
            |||||||||||||||||||||
Sbjct: 2179 ggcgggcgggcaggcaggcgg 2159



to top

>gb|AY382196.1| Homo sapiens glutamate-cysteine ligase modifier subunit gene,
            promoter region and partial cds
          Length = 3319

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 208  ggcgggcgggcaggcaggcgg 228
            |||||||||||||||||||||
Sbjct: 3221 ggcgggcgggcaggcaggcgg 3201



to top

>ref|NM_002061.2| Homo sapiens glutamate-cysteine ligase, modifier subunit (GCLM),
           mRNA
          Length = 3074

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 208 ggcgggcgggcaggcaggcgg 228
           |||||||||||||||||||||
Sbjct: 253 ggcgggcgggcaggcaggcgg 233



to top

>gb|AY480047.1| Homo sapiens plectin 6 mRNA, complete cds
          Length = 15249

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 207 aggcgggcgggcaggcaggcggggg 231
           |||||||||||||||||||| ||||
Sbjct: 49  aggcgggcgggcaggcaggctgggg 25



to top

>ref|NM_201380.2| Homo sapiens plectin 1, intermediate filament binding protein
           500kDa (PLEC1), transcript variant 6, mRNA
          Length = 15249

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 207 aggcgggcgggcaggcaggcggggg 231
           |||||||||||||||||||| ||||
Sbjct: 49  aggcgggcgggcaggcaggctgggg 25



to top

>emb|AL117351.12|HSJ837O21 Human DNA sequence from clone RP5-837O21 on chromosome 1p22 Contains
             the 5' end of the GCLM gene for glutamate-cysteine ligase
             modifier subunit, a pseudogene similar to part of NADH
             dehydrogenase 4 (MTND4), a NADH dehydrogenase 3 (MTND3)
             pseudogene, a cytochrome c oxidase III (MTCO3) pseudogene,
             a ATP synthase 6 (MTATP6) pseudogene, a cytochrome c
             oxidase II (MTCO2) pseudogene, a pseudogene similar to
             part of cytochrome c oxidase I (MTCO1), a pseudogene
             similar to part of NADH dehydrogenase 2 (MTND2), a
             coiled-coil-helix-coiled-coil-helix domain containing 2
             (CHCHD2) pseudogene and a CpG island, complete sequence
          Length = 93800

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 208   ggcgggcgggcaggcaggcgg 228
             |||||||||||||||||||||
Sbjct: 74262 ggcgggcgggcaggcaggcgg 74242



to top

>gb|BC041809.1| Homo sapiens glutamate-cysteine ligase, modifier subunit, mRNA
           (cDNA clone MGC:41886 IMAGE:5311598), complete cds
          Length = 1613

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 208 ggcgggcgggcaggcaggcgg 228
           |||||||||||||||||||||
Sbjct: 196 ggcgggcgggcaggcaggcgg 176



to top

>gb|AC109322.16| Homo sapiens chromosome 8, clone CTD-3065J16, complete sequence
          Length = 215342

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 207    aggcgggcgggcaggcaggcggggg 231
              |||||||||||||||||||| ||||
Sbjct: 121067 aggcgggcgggcaggcaggctgggg 121043



to top

>emb|BX957342.5| Zebrafish DNA sequence from clone CH211-120P12 in linkage group 13,
              complete sequence
          Length = 182888

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 50     tggtctctctcttctactaca 70
              |||||||||||||||||||||
Sbjct: 109831 tggtctctctcttctactaca 109851



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 2       atgggacgaggaaaatttgcc 22
               |||||||||||||||||||||
Sbjct: 3935048 atgggacgaggaaaatttgcc 3935028



to top

>emb|BX247887.6| Zebrafish DNA sequence from clone CH211-142L10, complete sequence
          Length = 143903

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 209   gcgggcgggcaggcaggcggg 229
             |||||||||||||||||||||
Sbjct: 54645 gcgggcgggcaggcaggcggg 54625



to top

>dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0035I03
          Length = 153749

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 2     atgggacgaggaaaatttgcc 22
             |||||||||||||||||||||
Sbjct: 40924 atgggacgaggaaaatttgcc 40904



to top

>dbj|AK066933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091F19, full
            insert sequence
          Length = 2738

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 2    atgggacgaggaaaatttgcc 22
            |||||||||||||||||||||
Sbjct: 2669 atgggacgaggaaaatttgcc 2649



to top

>dbj|AB012766.1| Oryza sativa gene for ovp2, complete cds
          Length = 5985

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 2    atgggacgaggaaaatttgcc 22
            |||||||||||||||||||||
Sbjct: 5928 atgggacgaggaaaatttgcc 5908



to top

>gb|U72210.1|HSU72210 Human gamma-glutamylcysteine synthetase light subunit gene,
            5'flanking sequence and partial cds
          Length = 3314

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 208  ggcgggcgggcaggcaggcgg 228
            |||||||||||||||||||||
Sbjct: 3217 ggcgggcgggcaggcaggcgg 3197



to top

>gb|AF028815.1|AF028815 Homo sapiens gamma-glutamylcysteine synthetase regulatory subunit
            (GLCLR) gene, 5' flanking region
          Length = 1930

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 208  ggcgggcgggcaggcaggcgg 228
            |||||||||||||||||||||
Sbjct: 1887 ggcgggcgggcaggcaggcgg 1867



to top

>gb|L35546.1|HUMGCSL Homo sapiens gamma-glutamylcysteine synthetase light subunit mRNA,
           complete cds
          Length = 1610

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 208 ggcgggcgggcaggcaggcgg 228
           |||||||||||||||||||||
Sbjct: 214 ggcgggcgggcaggcaggcgg 194



to top

>dbj|D45384.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase, complete cds
          Length = 2710

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 2    atgggacgaggaaaatttgcc 22
            |||||||||||||||||||||
Sbjct: 2654 atgggacgaggaaaatttgcc 2634



to top

>gb|AC160538.8| Mus musculus chromosome 15, clone RP24-156D3, complete sequence
          Length = 158943

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 167   acattgacaaccaaaaataa 186
             ||||||||||||||||||||
Sbjct: 66522 acattgacaaccaaaaataa 66503



to top

>gb|AC114649.9| Mus musculus chromosome 5, clone RP24-150M14, complete sequence
          Length = 154765

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 53     tctctctcttctactacatg 72
              ||||||||||||||||||||
Sbjct: 137646 tctctctcttctactacatg 137627



to top

>gb|AC146132.3| Pan troglodytes BAC clone RP43-23H13 from 7, complete sequence
          Length = 164355

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   ttcaagaggccaggggaaag 135
             ||||||||||||||||||||
Sbjct: 84354 ttcaagaggccaggggaaag 84335



to top

>ref|XM_001000399.1| PREDICTED: Mus musculus similar to Protein C1orf77 homolog
            (LOC622845), mRNA
          Length = 2049

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  aggcgggcgggcaggcaggc 226
            ||||||||||||||||||||
Sbjct: 1259 aggcgggcgggcaggcaggc 1240



to top

>ref|XM_908936.2| PREDICTED: Mus musculus similar to Protein C1orf77 homolog
            (LOC634257), mRNA
          Length = 2053

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  aggcgggcgggcaggcaggc 226
            ||||||||||||||||||||
Sbjct: 1263 aggcgggcgggcaggcaggc 1244



to top

>ref|XM_890379.2| PREDICTED: Mus musculus similar to Protein C1orf77 homolog,
            transcript variant 1 (LOC622845), mRNA
          Length = 2049

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  aggcgggcgggcaggcaggc 226
            ||||||||||||||||||||
Sbjct: 1259 aggcgggcgggcaggcaggc 1240



to top

>gb|AC115800.13| Mus musculus chromosome 8, clone RP23-407E22, complete sequence
          Length = 228513

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   aggcgggcgggcaggcaggc 226
             ||||||||||||||||||||
Sbjct: 31686 aggcgggcgggcaggcaggc 31667



to top

>gb|AC105947.11| Mus musculus chromosome 18, clone RP24-66N1, complete sequence
          Length = 207139

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 54     ctctctcttctactacatgg 73
              ||||||||||||||||||||
Sbjct: 166627 ctctctcttctactacatgg 166608



to top

>gb|AC132255.3| Mus musculus BAC clone RP24-472I15 from chromosome 5, complete sequence
          Length = 168528

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   aggcgggcgggcaggcaggc 226
             ||||||||||||||||||||
Sbjct: 23756 aggcgggcgggcaggcaggc 23775



to top

>gb|AC140316.3| Mus musculus BAC clone RP23-419L10 from chromosome 18, complete sequence
          Length = 195911

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 54     ctctctcttctactacatgg 73
              ||||||||||||||||||||
Sbjct: 178571 ctctctcttctactacatgg 178590



to top

>gb|BC020058.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone
           IMAGE:4009362), containing frame-shift errors
          Length = 2411

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 210 cgggcgggcaggcaggcggg 229
           ||||||||||||||||||||
Sbjct: 20  cgggcgggcaggcaggcggg 1



to top

>gb|AC072039.19| Homo sapiens 3 BAC RP11-305O4 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 154964

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     tctggtctctctcttctact 67
              ||||||||||||||||||||
Sbjct: 108378 tctggtctctctcttctact 108359



to top

>gb|AC084054.12| Mus Musculus Strain C57BL6/J chromosome 5 BAC, RP23-137N6, complete
           sequence
          Length = 231589

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 208 ggcgggcgggcaggcaggcg 227
           ||||||||||||||||||||
Sbjct: 146 ggcgggcgggcaggcaggcg 127



to top

>gb|AC124464.3| Mus musculus BAC clone RP24-155I15 from chromosome 19, complete
            sequence
          Length = 188587

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 207  aggcgggcgggcaggcaggc 226
            ||||||||||||||||||||
Sbjct: 2722 aggcgggcgggcaggcaggc 2741



to top

>gb|AC126266.3| Mus musculus BAC clone RP23-402N17 from chromosome 19, complete sequence
          Length = 205037

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 207    aggcgggcgggcaggcaggc 226
              ||||||||||||||||||||
Sbjct: 147742 aggcgggcgggcaggcaggc 147761



to top

>gb|AC113976.13| Mus musculus chromosome 15, clone RP23-146F23, complete sequence
          Length = 184010

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 167   acattgacaaccaaaaataa 186
             ||||||||||||||||||||
Sbjct: 38446 acattgacaaccaaaaataa 38465



to top

>gb|AC142299.1| Pan troglodytes BAC clone RP43-121O18 from 7, complete sequence
          Length = 146878

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 116    ttcaagaggccaggggaaag 135
              ||||||||||||||||||||
Sbjct: 105556 ttcaagaggccaggggaaag 105575



to top

>emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on chromosome 9 Contains a
             novel pseudogene, the MRPL50 gene for mitochondrial
             ribosomal protein L50, the ZNF189 gene for zinc finger
             protein 189, the ALDOB gene for aldolase B,
             fructose-bisphosphate, a NADH dehydrogenase (ubiquinone) 1
             alpha subcomplex (NDUFA4) pseudogene, three novel genes,
             the 5' end of the RNF20 gene for ring finger protein 20
             and three CpG islands, complete sequence
          Length = 164115

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   ggcgggcgggcaggcaggcg 227
             ||||||||||||||||||||
Sbjct: 72831 ggcgggcgggcaggcaggcg 72850



to top

>emb|AL035692.10|HS329N18 Human DNA sequence from clone RP3-329N18 on chromosome 6q22.1-22.33,
             complete sequence
          Length = 84764

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    tctggtctctctcttctact 67
             ||||||||||||||||||||
Sbjct: 50835 tctggtctctctcttctact 50816



to top

>gb|DQ133470.1| Pan paniscus ribosomal RNA intergenic spacer, partial sequence
          Length = 4544

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 207 aggcgggcgggcaggcaggc 226
           ||||||||||||||||||||
Sbjct: 110 aggcgggcgggcaggcaggc 129



to top

>gb|AC121765.2| Homo sapiens chromosome 3 clone RP11-767D18, complete sequence
          Length = 194455

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 167   acattgacaaccaaaaataa 186
             ||||||||||||||||||||
Sbjct: 77255 acattgacaaccaaaaataa 77274



to top

>emb|CR377210.7| Zebrafish DNA sequence from clone CH211-195C22 in linkage group 5,
             complete sequence
          Length = 170134

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   aggcgggcgggcaggcaggc 226
             ||||||||||||||||||||
Sbjct: 77535 aggcgggcgggcaggcaggc 77516



to top

>gb|AC107464.5| Homo sapiens BAC clone RP11-1191J2 from 4, complete sequence
          Length = 219357

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   aggcgggcgggcaggcaggc 226
             ||||||||||||||||||||
Sbjct: 26460 aggcgggcgggcaggcaggc 26441



to top

>gb|AC105266.2| Homo sapiens chromosome 3 clone RP11-796K6, complete sequence
          Length = 181462

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 167   acattgacaaccaaaaataa 186
             ||||||||||||||||||||
Sbjct: 33181 acattgacaaccaaaaataa 33200



to top

>gb|AC080043.5| Homo sapiens chromosome , clone RP11-45M9, complete sequence
          Length = 161443

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   aggcgggcgggcaggcaggc 226
             ||||||||||||||||||||
Sbjct: 44687 aggcgggcgggcaggcaggc 44668



to top

>gb|AC023566.11| Homo sapiens chromosome 8, clone RP11-660D5, complete sequence
          Length = 184543

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   aggcgggcgggcaggcaggc 226
             ||||||||||||||||||||
Sbjct: 94243 aggcgggcgggcaggcaggc 94224



to top

>gb|AC093925.5| Genomic sequence for Mus musculus, clone RP23-304H5, complete sequence
          Length = 227242

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 207    aggcgggcgggcaggcaggc 226
              ||||||||||||||||||||
Sbjct: 132663 aggcgggcgggcaggcaggc 132644



to top

>gb|AF005042.1|AF005042 Homo sapiens cGMP-phosphodiesterase beta-subunit (PDE6E) gene,
           complete intron 2 sequence
          Length = 952

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 207 aggcgggcgggcaggcaggc 226
           ||||||||||||||||||||
Sbjct: 63  aggcgggcgggcaggcaggc 44



to top

>gb|AF005041.1|AF005041 Homo sapiens cGMP-phosphodiesterase beta-subunit (PDE6E) gene,
           complete intron 2 sequence
          Length = 906

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 207 aggcgggcgggcaggcaggc 226
           ||||||||||||||||||||
Sbjct: 63  aggcgggcgggcaggcaggc 44



to top

>emb|BX571666.10| Zebrafish DNA sequence from clone DKEY-221F8 in linkage group 5,
            complete sequence
          Length = 115940

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  aggcgggcgggcaggcaggc 226
            ||||||||||||||||||||
Sbjct: 6671 aggcgggcgggcaggcaggc 6652



to top

>emb|BX005480.12| Mouse DNA sequence from clone RP23-142M12 on chromosome X, complete
              sequence
          Length = 196326

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 207    aggcgggcgggcaggcaggc 226
              ||||||||||||||||||||
Sbjct: 135612 aggcgggcgggcaggcaggc 135593



to top

>gb|AC131664.3| Mus musculus BAC clone RP23-274J16 from chromosome 5, complete sequence
          Length = 189996

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   aggcgggcgggcaggcaggc 226
             ||||||||||||||||||||
Sbjct: 79800 aggcgggcgggcaggcaggc 79781



to top

>gb|AC113484.14| Mus musculus chromosome 8, clone RP23-343H23, complete sequence
          Length = 176303

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 207    aggcgggcgggcaggcaggc 226
              ||||||||||||||||||||
Sbjct: 158826 aggcgggcgggcaggcaggc 158807



to top

>gb|AC009198.8|AC009198 Drosophila melanogaster, chromosome 2L, region 33B-33C, BAC clone
             BACR19C12, complete sequence
          Length = 171134

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   tctagatgtacttgaacagc 296
             ||||||||||||||||||||
Sbjct: 76960 tctagatgtacttgaacagc 76941



to top

>gb|DQ164097.1| Callithrix jacchus gamma-glutamylcysteine synthetase regulatory
           subunit mRNA, complete cds
          Length = 1202

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 209 gcgggcgggcaggcaggcgg 228
           ||||||||||||||||||||
Sbjct: 257 gcgggcgggcaggcaggcgg 238



to top

>gb|AC134025.2| Homo sapiens 3 BAC RP11-231I13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 183111

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 167   acattgacaaccaaaaataa 186
             ||||||||||||||||||||
Sbjct: 80094 acattgacaaccaaaaataa 80075



to top

>gb|AC016700.8| Homo sapiens BAC clone RP11-175A7 from 2, complete sequence
          Length = 177995

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 208    ggcgggcgggcaggcaggcg 227
              ||||||||||||||||||||
Sbjct: 174868 ggcgggcgggcaggcaggcg 174887



to top

>gb|AY148158.1| Mus musculus lamin B receptor gene, partial cds
          Length = 29007

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   aggcgggcgggcaggcaggc 226
             ||||||||||||||||||||
Sbjct: 15874 aggcgggcgggcaggcaggc 15855



to top

>gb|AC093540.3| Pan troglodytes clone RP43-84M6, complete sequence
          Length = 171092

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 210    cgggcgggcaggcaggcggg 229
              ||||||||||||||||||||
Sbjct: 114785 cgggcgggcaggcaggcggg 114766



to top

>gb|AE003635.2| Drosophila melanogaster chromosome 2L, section 44 of 83 of the complete
              sequence
          Length = 308012

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 277    tctagatgtacttgaacagc 296
              ||||||||||||||||||||
Sbjct: 137931 tctagatgtacttgaacagc 137912



to top

>emb|X62693.1|HSCGMP2 H.sapiens DNA for cGMP phosphodiesterase exon 2
          Length = 556

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 207 aggcgggcgggcaggcaggc 226
           ||||||||||||||||||||
Sbjct: 417 aggcgggcgggcaggcaggc 398



to top

>gb|AC105072.9| Mus musculus chromosome 5, clone RP24-167C6, complete sequence
          Length = 173710

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   ggcgggcgggcaggcaggcg 227
             ||||||||||||||||||||
Sbjct: 17283 ggcgggcgggcaggcaggcg 17302



to top

>emb|AL844566.8| Mouse DNA sequence from clone RP23-173H17 on chromosome 2, complete
              sequence
          Length = 229583

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 207    aggcgggcgggcaggcaggc 226
              ||||||||||||||||||||
Sbjct: 113280 aggcgggcgggcaggcaggc 113299



to top

>gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complete sequence
          Length = 201762

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 207    aggcgggcgggcaggcaggc 226
              ||||||||||||||||||||
Sbjct: 139401 aggcgggcgggcaggcaggc 139382



to top

>emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on chromosome 11, complete
             sequence
          Length = 220242

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   aggcgggcgggcaggcaggc 226
             ||||||||||||||||||||
Sbjct: 43459 aggcgggcgggcaggcaggc 43478



to top

>emb|AL807399.5| Mouse DNA sequence from clone RP23-382O11 on chromosome 4, complete
              sequence
          Length = 181004

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 207    aggcgggcgggcaggcaggc 226
              ||||||||||||||||||||
Sbjct: 160196 aggcgggcgggcaggcaggc 160177



to top

>emb|AL589870.30| Mouse DNA sequence from clone RP23-118A2 on chromosome 2, complete
              sequence
          Length = 202686

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 208    ggcgggcgggcaggcaggcg 227
              ||||||||||||||||||||
Sbjct: 135217 ggcgggcgggcaggcaggcg 135236


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,089,617
Number of Sequences: 3902068
Number of extensions: 2089617
Number of successful extensions: 39247
Number of sequences better than 10.0: 106
Number of HSP's better than 10.0 without gapping: 106
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38899
Number of HSP's gapped (non-prelim): 329
length of query: 312
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 290
effective length of database: 17,147,199,772
effective search space: 4972687933880
effective search space used: 4972687933880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top