ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags30l13 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_468609.1| Oryza sativa (japonica cultivar-group), mRNA Length = 694 Score = 339 bits (171), Expect = 6e-90 Identities = 266/297 (89%), Gaps = 3/297 (1%) Strand = Plus / Minus Query: 245 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 304 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 452 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 393 Query: 305 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 361 ||||||||| ||| ||| |||||||||||||||||||||||| |||||||||||| Sbjct: 392 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 333 Query: 362 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 421 | |||||||| ||||||||||||| || |||||||||| ||||||||||||| |||||| Sbjct: 332 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 273 Query: 422 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 481 ||||||||||| | |||||||||||||| ||| || |||||||||||||||||||||| Sbjct: 272 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 213 Query: 482 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatc 538 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| |||||| Sbjct: 212 aagtagcgcatgccgaccttgccgaagtagcccgggtggtacttgtcgaacaggatc 156
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 339 bits (171), Expect = 6e-90 Identities = 266/297 (89%), Gaps = 3/297 (1%) Strand = Plus / Minus Query: 245 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 304 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 16599921 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 16599862 Query: 305 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 361 ||||||||| ||| ||| |||||||||||||||||||||||| |||||||||||| Sbjct: 16599861 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 16599802 Query: 362 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 421 | |||||||| ||||||||||||| || |||||||||| ||||||||||||| |||||| Sbjct: 16599801 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 16599742 Query: 422 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 481 ||||||||||| | |||||||||||||| ||| || |||||||||||||||||||||| Sbjct: 16599741 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 16599682 Query: 482 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatc 538 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| |||||| Sbjct: 16599681 aagtagcgcatgccgaccttgccgaagtagcccgggtggtacttgtcgaacaggatc 16599625 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 384 tgtcgccgccggcctccgcg 403 |||||||||||||||||||| Sbjct: 11143411 tgtcgccgccggcctccgcg 11143430 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 387 cgccgccggcctccgcggcc 406 |||||||||||||||||||| Sbjct: 1959636 cgccgccggcctccgcggcc 1959655
>gb|AC135559.4| Oryza sativa chromosome 3 BAC OSJNBa0030J19 genomic sequence, complete sequence Length = 133843 Score = 339 bits (171), Expect = 6e-90 Identities = 266/297 (89%), Gaps = 3/297 (1%) Strand = Plus / Plus Query: 245 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 304 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 54122 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 54181 Query: 305 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 361 ||||||||| ||| ||| |||||||||||||||||||||||| |||||||||||| Sbjct: 54182 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 54241 Query: 362 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 421 | |||||||| ||||||||||||| || |||||||||| ||||||||||||| |||||| Sbjct: 54242 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 54301 Query: 422 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 481 ||||||||||| | |||||||||||||| ||| || |||||||||||||||||||||| Sbjct: 54302 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 54361 Query: 482 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatc 538 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| |||||| Sbjct: 54362 aagtagcgcatgccgaccttgccgaagtagcccgggtggtacttgtcgaacaggatc 54418
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 339 bits (171), Expect = 6e-90 Identities = 266/297 (89%), Gaps = 3/297 (1%) Strand = Plus / Minus Query: 245 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 304 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 16593554 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 16593495 Query: 305 acgatgggcttctccggc---agcatccccttgccgagcaccttgaagtagccgaactgc 361 ||||||||| ||| ||| |||||||||||||||||||||||| |||||||||||| Sbjct: 16593494 acgatgggcctctgcgggggaagcatccccttgccgagcaccttggtgtagccgaactgg 16593435 Query: 362 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 421 | |||||||| ||||||||||||| || |||||||||| ||||||||||||| |||||| Sbjct: 16593434 gtgacgtcgatgacgggggccttgccggcgccggcctcggcggccttgtcggtgggcacc 16593375 Query: 422 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 481 ||||||||||| | |||||||||||||| ||| || |||||||||||||||||||||| Sbjct: 16593374 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcttgtgg 16593315 Query: 482 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggatc 538 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| |||||| Sbjct: 16593314 aagtagcgcatgccgaccttgccgaagtagcccgggtggtacttgtcgaacaggatc 16593258 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 384 tgtcgccgccggcctccgcg 403 |||||||||||||||||||| Sbjct: 11140174 tgtcgccgccggcctccgcg 11140193 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 387 cgccgccggcctccgcggcc 406 |||||||||||||||||||| Sbjct: 1959634 cgccgccggcctccgcggcc 1959653
>gb|BT017787.1| Zea mays clone EL01N0504C04.c mRNA sequence Length = 711 Score = 311 bits (157), Expect = 1e-81 Identities = 274/313 (87%) Strand = Plus / Minus Query: 225 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 284 |||||||| ||||||||| |||||||| || |||||||||||||||||||||| ||||| Sbjct: 497 cctaggcggtgagcacgacggcgccgcctgctgccttgatcttcttctcggcgaccttgg 438 Query: 285 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 344 |||||||||||||||||||||| |||||||| |||||||| |||||| |||||||||| Sbjct: 437 agatgagcttggccttgacgacaatgggctttggcggcagcacccccttcccgagcacct 378 Query: 345 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccggcctccgcgg 404 |||||||||||||||||| |||||||| |||||||||||||||||||||||||| | Sbjct: 377 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgccgccggcctccgccg 318 Query: 405 ccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacc 464 ||||||||| |||||||| |||||||| | ||||| |||||| | ||| ||||||| Sbjct: 317 ccttgtcggtgggcaccatcgaccagaggcgctcgatgttgaccgcggggcagtagaact 258 Query: 465 tgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggatggtact 524 |||||| |||||| |||||||| | ||| || || |||||||||||||| |||||||||| Sbjct: 257 tgttgcggagcttatggaagtaacgcatgccaaccttgccgaagtagcccggatggtact 198 Query: 525 tgtcgaagaggat 537 ||||||||||||| Sbjct: 197 tgtcgaagaggat 185
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 311 bits (157), Expect = 1e-81 Identities = 279/319 (87%), Gaps = 3/319 (0%) Strand = Plus / Plus Query: 222 aaccctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatct 281 ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| || Sbjct: 25183371 aaccctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgacct 25183430 Query: 282 tggagatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagca 341 ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| Sbjct: 25183431 tggagatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagca 25183490 Query: 342 ccttgaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcct 398 ||||||||||||||||||||| ||||| | | ||| ||||| | ||||| |||||| Sbjct: 25183491 ccttgaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcct 25183550 Query: 399 ccgcggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgt 458 |||| |||| |||| |||||||| |||||||||| ||| ||||| || | ||||| || Sbjct: 25183551 ccgccgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagt 25183610 Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||||| |||| |||||||||| | ||| ||||| |||||||||||||| || | Sbjct: 25183611 agaacttgttgcggagcctgtggaagtagcgcatgccgaccttgccgaagtagcccgggt 25183670 Query: 519 ggtacttgtcgaagaggat 537 ||||||||||||||||||| Sbjct: 25183671 ggtacttgtcgaagaggat 25183689
>dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0616D06 Length = 153800 Score = 311 bits (157), Expect = 1e-81 Identities = 279/319 (87%), Gaps = 3/319 (0%) Strand = Plus / Plus Query: 222 aaccctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatct 281 ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| || Sbjct: 42 aaccctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgacct 101 Query: 282 tggagatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagca 341 ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| Sbjct: 102 tggagatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagca 161 Query: 342 ccttgaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcct 398 ||||||||||||||||||||| ||||| | | ||| ||||| | ||||| |||||| Sbjct: 162 ccttgaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcct 221 Query: 399 ccgcggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgt 458 |||| |||| |||| |||||||| |||||||||| ||| ||||| || | ||||| || Sbjct: 222 ccgccgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagt 281 Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||||| |||| |||||||||| | ||| ||||| |||||||||||||| || | Sbjct: 282 agaacttgttgcggagcctgtggaagtagcgcatgccgaccttgccgaagtagcccgggt 341 Query: 519 ggtacttgtcgaagaggat 537 ||||||||||||||||||| Sbjct: 342 ggtacttgtcgaagaggat 360
>dbj|AP003700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1003_H02 Length = 124043 Score = 311 bits (157), Expect = 1e-81 Identities = 279/319 (87%), Gaps = 3/319 (0%) Strand = Plus / Plus Query: 222 aaccctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatct 281 ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| || Sbjct: 103858 aaccctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgacct 103917 Query: 282 tggagatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagca 341 ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| Sbjct: 103918 tggagatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagca 103977 Query: 342 ccttgaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcct 398 ||||||||||||||||||||| ||||| | | ||| ||||| | ||||| |||||| Sbjct: 103978 ccttgaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcct 104037 Query: 399 ccgcggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgt 458 |||| |||| |||| |||||||| |||||||||| ||| ||||| || | ||||| || Sbjct: 104038 ccgccgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagt 104097 Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||||| |||| |||||||||| | ||| ||||| |||||||||||||| || | Sbjct: 104098 agaacttgttgcggagcctgtggaagtagcgcatgccgaccttgccgaagtagcccgggt 104157 Query: 519 ggtacttgtcgaagaggat 537 ||||||||||||||||||| Sbjct: 104158 ggtacttgtcgaagaggat 104176
>ref|XM_479144.1| Oryza sativa (japonica cultivar-group), mRNA Length = 441 Score = 303 bits (153), Expect = 3e-79 Identities = 275/315 (87%), Gaps = 3/315 (0%) Strand = Plus / Minus Query: 226 ctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgga 285 ||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||| Sbjct: 441 ctaggcggtgagcacgacggcgccgccggcggccttgatcttcttctcggcgaccttgga 382 Query: 286 gatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacctt 345 ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 381 gatgagcttggccttgacgacgatgggcttctccggcagcagacccttcccgagcacctt 322 Query: 346 gaagtagccgaactgcgagacgtcgacgacgggggcctt---gtcgccgccggcctccgc 402 ||||||||||||||||| ||||| | | ||| ||||| | ||||| |||||||||| Sbjct: 321 gaagtagccgaactgcgtcacgtccagcaggggcgccttgccggcgccggcggcctccgc 262 Query: 403 ggccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaa 462 |||| |||| |||||||| |||||||||| ||| ||||| || | ||||| |||||| Sbjct: 261 cgcctgctcggcgggcaccatcgaccagagccgctccacgttcaccgccggggagtagaa 202 Query: 463 cctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggatggta 522 | |||||| |||| |||||||||| | ||| ||||| |||||||||||||| || ||||| Sbjct: 201 cttgttgcggagcctgtggaagtagcgcatgccgaccttgccgaagtagcccgggtggta 142 Query: 523 cttgtcgaagaggat 537 ||||||||||||||| Sbjct: 141 cttgtcgaagaggat 127
>gb|BT016384.1| Zea mays clone Contig217 mRNA sequence Length = 696 Score = 295 bits (149), Expect = 8e-77 Identities = 266/305 (87%) Strand = Plus / Minus Query: 225 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 284 |||||||| ||||||||| |||||||| || |||||||||||||||||||||| ||||| Sbjct: 483 cctaggcggtgagcacgacggcgccgcctgctgccttgatcttcttctcggcgaccttgg 424 Query: 285 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 344 |||||||||||||||||||||| |||||||| |||||||| |||||| |||||||||| Sbjct: 423 agatgagcttggccttgacgacaatgggctttggcggcagcacccccttcccgagcacct 364 Query: 345 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccggcctccgcgg 404 |||||||||||||||||| |||||||| |||||||||||||||||||||||||| | Sbjct: 363 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgccgccggcctccgccg 304 Query: 405 ccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacc 464 ||||||||| |||||||| |||||||| | ||||| |||||| | ||| ||||||| Sbjct: 303 ccttgtcggtgggcaccatcgaccagaggcgctcgatgttgaccgcggggcagtagaact 244 Query: 465 tgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggatggtact 524 |||||| |||||| |||||||| | ||| || || |||||||||||||| |||||||||| Sbjct: 243 tgttgcggagcttatggaagtaacgcatgccaaccttgccgaagtagcccggatggtact 184 Query: 525 tgtcg 529 ||||| Sbjct: 183 tgtcg 179
>gb|AY103571.1| Zea mays PCO153825 mRNA sequence Length = 725 Score = 295 bits (149), Expect = 8e-77 Identities = 272/313 (86%) Strand = Plus / Minus Query: 225 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 284 |||||||| ||||||||| || ||||| || |||||||||||||||||||||| ||||| Sbjct: 505 cctaggcggtgagcacgacggccccgcctgctgccttgatcttcttctcggcgaccttgg 446 Query: 285 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 344 |||||||||||||||||||||| |||||||| |||||||| |||||| |||||||||| Sbjct: 445 agatgagcttggccttgacgacaatgggcttgggcggcagcacccccttcccgagcacct 386 Query: 345 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccggcctccgcgg 404 |||||||||||||||||| |||||||| |||||||||||| |||||||||||| | Sbjct: 385 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgaggccggcctccgccg 326 Query: 405 ccttgtcggacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacc 464 |||| |||| |||||||| |||||||| | ||||| |||||| | ||| ||||||| Sbjct: 325 ccttttcggcgggcaccatcgaccagaggcgctcgatgttgaccgcggggcagtagaact 266 Query: 465 tgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggatggtact 524 |||||| ||||||||||||||| | ||| ||||| || |||||||||||||||||||||| Sbjct: 265 tgttgcggagcttgtggaagtagcgcatgccgaccttaccgaagtagccgggatggtact 206 Query: 525 tgtcgaagaggat 537 ||||||||||||| Sbjct: 205 tgtcgaagaggat 193
>gb|AY103771.1| Zea mays PCO152633 mRNA sequence Length = 740 Score = 276 bits (139), Expect = 7e-71 Identities = 264/305 (86%), Gaps = 3/305 (0%) Strand = Plus / Minus Query: 236 agcacgacagcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttg 295 |||| ||| ||||| ||||| |||||||||||||||||||||| |||||||||||||||| Sbjct: 499 agcaggacggcgcctccggcagccttgatcttcttctcggcgaccttggagatgagcttg 440 Query: 296 gccttgacgacgatgggcttctccggcagcatccccttgccgagcaccttgaagtagccg 355 |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 439 gccttgacgacgatgggcctggacggcagcatccccttgccgagcaccttgaagtagccg 380 Query: 356 aactgcgagacgtcgacgacgggggccttgt---cgccgccggcctccgcggccttgtcg 412 ||||||| |||||||||| ||||||| || ||||| | ||||||||||||||| || Sbjct: 379 aactgcgtcacgtcgacgagcggggcctggtccgcgccggccgcctccgcggccttgccg 320 Query: 413 gacggcaccatggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctg 472 | |||||||| |||||||||| ||| |||||||| | |||| || |||| |||||| | Sbjct: 319 gcgggcaccatcgaccagagccgctccacgttgaccgacgggcagtggaacttgttgcgg 260 Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||| |||||||||| | ||| || || |||||||||||||| || |||||||| |||||| Sbjct: 259 agcctgtggaagtagcgcatgcccaccttgccgaagtagcccgggtggtacttatcgaag 200 Query: 533 aggat 537 ||||| Sbjct: 199 aggat 195
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 274 bits (138), Expect = 3e-70 Identities = 258/296 (87%), Gaps = 9/296 (3%) Strand = Plus / Minus Query: 245 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 304 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 4135369 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 4135310 Query: 305 acgatgggcttctc---cggcagcatccccttgccgagcaccttgaagtagccgaactgc 361 ||||||||| |||| || |||||||||||||||||||||||| ||||||||||||| Sbjct: 4135309 acgatgggcctctctggggggagcatccccttgccgagcaccttggtgtagccgaactgc 4135250 Query: 362 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 421 | |||||||| ||||||||||||| || |||||| | ||||| |||| |||||| Sbjct: 4135249 gtgacgtcgatgacgggggccttgccggcgccgg---cgccggcc---tcggcgggcacc 4135196 Query: 422 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 481 ||||||||||| | |||||||||||||| ||| || |||||||||||||||| ||||| Sbjct: 4135195 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcctgtgg 4135136 Query: 482 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggat 537 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| ||||| Sbjct: 4135135 aagtagcgcatcccgaccttgccgaagtagcccgggtggtacttgtcgaacaggat 4135080 Score = 40.1 bits (20), Expect = 7.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 384 tgtcgccgccggcctccgcg 403 |||||||||||||||||||| Sbjct: 8040518 tgtcgccgccggcctccgcg 8040499
>dbj|AP003992.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1077_E05 Length = 116305 Score = 274 bits (138), Expect = 3e-70 Identities = 258/296 (87%), Gaps = 9/296 (3%) Strand = Plus / Minus Query: 245 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 304 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 45383 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 45324 Query: 305 acgatgggcttctc---cggcagcatccccttgccgagcaccttgaagtagccgaactgc 361 ||||||||| |||| || |||||||||||||||||||||||| ||||||||||||| Sbjct: 45323 acgatgggcctctctggggggagcatccccttgccgagcaccttggtgtagccgaactgc 45264 Query: 362 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 421 | |||||||| ||||||||||||| || |||||| | ||||| |||| |||||| Sbjct: 45263 gtgacgtcgatgacgggggccttgccggcgccgg---cgccggcc---tcggcgggcacc 45210 Query: 422 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 481 ||||||||||| | |||||||||||||| ||| || |||||||||||||||| ||||| Sbjct: 45209 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcctgtgg 45150 Query: 482 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggat 537 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| ||||| Sbjct: 45149 aagtagcgcatcccgaccttgccgaagtagcccgggtggtacttgtcgaacaggat 45094
>dbj|AK121069.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061G23, full insert sequence Length = 727 Score = 274 bits (138), Expect = 3e-70 Identities = 258/296 (87%), Gaps = 9/296 (3%) Strand = Plus / Minus Query: 245 gcgccgccggcggccttgatcttcttctcggcgatcttggagatgagcttggccttgacg 304 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 471 gcgccgccggcggccttgatcttcttctcggcgaccttggagatgagcttggccttgacg 412 Query: 305 acgatgggcttctc---cggcagcatccccttgccgagcaccttgaagtagccgaactgc 361 ||||||||| |||| || |||||||||||||||||||||||| ||||||||||||| Sbjct: 411 acgatgggcctctctggggggagcatccccttgccgagcaccttggtgtagccgaactgc 352 Query: 362 gagacgtcgacgacgggggccttgtcgccgccggcctccgcggccttgtcggacggcacc 421 | |||||||| ||||||||||||| || |||||| | ||||| |||| |||||| Sbjct: 351 gtgacgtcgatgacgggggccttgccggcgccgg---cgccggcc---tcggcgggcacc 298 Query: 422 atggaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtgg 481 ||||||||||| | |||||||||||||| ||| || |||||||||||||||| ||||| Sbjct: 297 atggaccagaggcgctcgacgttgacggcggggcagtggaacctgttgctgagcctgtgg 238 Query: 482 aagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggat 537 ||||| | ||| ||||| |||||||||||||| || |||||||||||||| ||||| Sbjct: 237 aagtagcgcatcccgaccttgccgaagtagcccgggtggtacttgtcgaacaggat 182
>gb|BT016406.1| Zea mays clone Contig239 mRNA sequence Length = 1257 Score = 194 bits (98), Expect = 2e-46 Identities = 152/170 (89%) Strand = Plus / Plus Query: 225 cctaggcgacgagcacgacagcgccgccggcggccttgatcttcttctcggcgatcttgg 284 |||||||| ||||||||| |||||||| || |||||||||||||||||||||| ||||| Sbjct: 199 cctaggcggtgagcacgacggcgccgcctgctgccttgatcttcttctcggcgaccttgg 258 Query: 285 agatgagcttggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct 344 |||||||||||||||||||||| |||||||| |||||||| |||||| |||||||||| Sbjct: 259 agatgagcttggccttgacgacaatgggctttggcggcagcacccccttcccgagcacct 318 Query: 345 tgaagtagccgaactgcgagacgtcgacgacgggggccttgtcgccgccg 394 |||||||||||||||||| |||||||| |||||||||||||||||| Sbjct: 319 tgaagtagccgaactgcgtgacgtcgatctgcggggccttgtcgccgccg 368
>dbj|AB077113.1| Prunus persica mRNA, microsatellite marker M9a Length = 630 Score = 97.6 bits (49), Expect = 4e-17 Identities = 97/113 (85%) Strand = Plus / Minus Query: 425 gaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtggaag 484 ||||||||| | |||||||||||| | ||| ||||||| |||||| ||||||||||||| Sbjct: 289 gaccagagcttgtcgacgttgacgatggggcagtagaacttgttgcggagcttgtggaag 230 Query: 485 tacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggat 537 || | |||||| ||||| || || || || ||||||||||||||||||||||| Sbjct: 229 tagcgcataccaactttaccaaaataccccggatggtacttgtcgaagaggat 177 Score = 67.9 bits (34), Expect = 3e-08 Identities = 43/46 (93%) Strand = Plus / Minus Query: 258 ccttgatcttcttctcggcgatcttggagatgagcttggccttgac 303 |||||||||||||||| || ||||||||||||||||||||||||| Sbjct: 459 ccttgatcttcttctcagctgtcttggagatgagcttggccttgac 414
>dbj|AP006094.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT39H01, TM0172, complete sequence Length = 127731 Score = 97.6 bits (49), Expect = 4e-17 Identities = 97/113 (85%) Strand = Plus / Plus Query: 425 gaccagagcctctcgacgttgacggtcggggtgtagaacctgttgctgagcttgtggaag 484 ||||||||| | |||| ||||||||| ||| ||||| ||||| ||||||||||||| Sbjct: 97486 gaccagagcttgtcgatgttgacggtggggcaaaagaactggttgcggagcttgtggaag 97545 Query: 485 tacctcataccgactttgccgaagtagccgggatggtacttgtcgaagaggat 537 || | |||||| || ||||||||||| |||||||||||||||||||||||||| Sbjct: 97546 tagcgcataccaaccttgccgaagtaaccgggatggtacttgtcgaagaggat 97598 Score = 46.1 bits (23), Expect = 0.12 Identities = 38/43 (88%) Strand = Plus / Plus Query: 258 ccttgatcttcttctcggcgatcttggagatgagcttggcctt 300 |||||||||||||||| || ||||| || |||||||| ||||| Sbjct: 97310 ccttgatcttcttctcagcaatcttcgaaatgagcttcgcctt 97352
>ref|NM_105728.2| Arabidopsis thaliana structural constituent of ribosome AT1G70600 mRNA, complete cds Length = 737 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 256 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 197 Query: 519 ggtacttgtcgaagaggatc 538 |||||||||||||||||||| Sbjct: 196 ggtacttgtcgaagaggatc 177
>gb|AY091706.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds Length = 441 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 205 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 146 Query: 519 ggtacttgtcgaagaggatc 538 |||||||||||||||||||| Sbjct: 145 ggtacttgtcgaagaggatc 126
>gb|AY048228.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds Length = 665 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 254 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 195 Query: 519 ggtacttgtcgaagaggatc 538 |||||||||||||||||||| Sbjct: 194 ggtacttgtcgaagaggatc 175
>gb|AY039519.1| Arabidopsis thaliana At1g70600/F5A18_22 mRNA, complete cds Length = 644 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 254 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 195 Query: 519 ggtacttgtcgaagaggatc 538 |||||||||||||||||||| Sbjct: 194 ggtacttgtcgaagaggatc 175
>emb|BX817859.1|CNS0AEEA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL45ZD07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 646 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 243 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 184 Query: 519 ggtacttgtcgaagaggatc 538 |||||||||||||||||||| Sbjct: 183 ggtacttgtcgaagaggatc 164
>emb|BX813428.1|CNS0AARB Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB17ZA01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 682 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 248 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 189 Query: 519 ggtacttgtcgaagaggatc 538 |||||||||||||||||||| Sbjct: 188 ggtacttgtcgaagaggatc 169
>emb|BX827775.1|CNS0A4FW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH20ZA08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 633 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Plus Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 394 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 453 Query: 519 ggtacttgtcgaagaggatc 538 |||||||||||||||||||| Sbjct: 454 ggtacttgtcgaagaggatc 473
>gb|AC010796.7|AC010796 Arabidopsis thaliana chromosome 1 BAC F24J13 genomic sequence, complete sequence Length = 87400 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Plus Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 71317 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 71376 Query: 519 ggtacttgtcgaagaggatc 538 |||||||||||||||||||| Sbjct: 71377 ggtacttgtcgaagaggatc 71396
>gb|AC011663.7|AC011663 Arabidopsis thaliana chromosome 1 BAC F5A18 genomic sequence, complete sequence Length = 108582 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 83185 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 83126 Query: 519 ggtacttgtcgaagaggatc 538 |||||||||||||||||||| Sbjct: 83125 ggtacttgtcgaagaggatc 83106
>gb|AY085573.1| Arabidopsis thaliana clone 15789 mRNA, complete sequence Length = 628 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 256 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 197 Query: 519 ggtacttgtcgaagaggatc 538 |||||||||||||||||||| Sbjct: 196 ggtacttgtcgaagaggatc 177
>emb|X91959.1|AT60SRL27 A.thaliana mRNA for 60S ribosomal protein L27a Length = 641 Score = 95.6 bits (48), Expect = 1e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 459 agaacctgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggat 518 ||||| |||| || ||||||||||| ||||||||||| ||||| |||||||| || |||| Sbjct: 237 agaacttgttcctcagcttgtggaaatacctcataccaactttaccgaagtaacctggat 178 Query: 519 ggtacttgtcgaagaggatc 538 |||||||||||||||||||| Sbjct: 177 ggtacttgtcgaagaggatc 158
>ref|NM_102178.2| Arabidopsis thaliana RPL27A (RIBOSOMAL PROTEIN L27A); structural constituent of ribosome AT1G23290 (RPL27A) mRNA, complete cds Length = 604 Score = 91.7 bits (46), Expect = 2e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 214 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 155 Query: 533 aggatc 538 |||||| Sbjct: 154 aggatc 149
>gb|BT000542.1| Arabidopsis thaliana 60s ribosomal protein l27a. (At1g23290/F26F24_23) mRNA, complete cds Length = 441 Score = 91.7 bits (46), Expect = 2e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 191 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 132 Query: 533 aggatc 538 |||||| Sbjct: 131 aggatc 126
>gb|AF349525.1| Arabidopsis thaliana putative 60s ribosomal protein l27a (At1g23290) mRNA, complete cds Length = 491 Score = 91.7 bits (46), Expect = 2e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 191 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 132 Query: 533 aggatc 538 |||||| Sbjct: 131 aggatc 126
>gb|AF324716.2| Arabidopsis thaliana At1g23290 (At1g23290/F26F24_23) mRNA, complete cds Length = 572 Score = 91.7 bits (46), Expect = 2e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 215 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 156 Query: 533 aggatc 538 |||||| Sbjct: 155 aggatc 150
>gb|AF410280.1|AF410280 Arabidopsis thaliana At1g23290/F26F24_23 mRNA, complete cds Length = 571 Score = 91.7 bits (46), Expect = 2e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 215 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 156 Query: 533 aggatc 538 |||||| Sbjct: 155 aggatc 150
>emb|BX814201.1|CNS0AC9G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB60ZF02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 568 Score = 91.7 bits (46), Expect = 2e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 196 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 137 Query: 533 aggatc 538 |||||| Sbjct: 136 aggatc 131
>emb|BX814197.1|CNS0AC79 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB60ZD12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 568 Score = 91.7 bits (46), Expect = 2e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 196 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 137 Query: 533 aggatc 538 |||||| Sbjct: 136 aggatc 131
>emb|BX814930.1|CNS0ABGE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS19ZG02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 545 Score = 91.7 bits (46), Expect = 2e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 203 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 144 Query: 533 aggatc 538 |||||| Sbjct: 143 aggatc 138
>gb|AY086256.1| Arabidopsis thaliana clone 23092 mRNA, complete sequence Length = 570 Score = 91.7 bits (46), Expect = 2e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 216 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 157 Query: 533 aggatc 538 |||||| Sbjct: 156 aggatc 151
>gb|AC005292.4|AC005292 Genomic sequence for Arabidopsis thaliana BAC F26F24 from chromosome I, complete sequence Length = 99053 Score = 91.7 bits (46), Expect = 2e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||||||| Sbjct: 39553 agcttgtggaaatacctcataccaactttcccgaagtaacctggatggtacttgtcgaag 39494 Query: 533 aggatc 538 |||||| Sbjct: 39493 aggatc 39488
>gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete sequence Length = 117437 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 472 gagcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaa 531 ||||||||| ||||| | |||||| ||||| |||||||| || ||||||||||||||||| Sbjct: 7081 gagcttgtgaaagtaacgcataccaactttaccgaagtaacctggatggtacttgtcgaa 7022 Query: 532 gaggat 537 |||||| Sbjct: 7021 gaggat 7016
>ref|XM_655956.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3444.2), mRNA Length = 2985 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Minus Query: 475 cttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcga 530 |||||||||||||||||||||||| || |||||||| || || ||||||||||||| Sbjct: 2724 cttgtggaagtacctcataccgaccttaccgaagtaaccagggtggtacttgtcga 2669
>gb|AY826145.1| Aedes albopictus clone AL_181 60S ribosomal protein L27a mRNA, complete cds Length = 450 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| || |||||||| || |||||||||||||||||| Sbjct: 191 tggaagttcctcataccgacctttccgaagtatccaggatggtacttgtcgaag 138
>gb|AY804547.1| Drosophila yakuba strain Tai18 ribosomal protein L27A (RpL27A) gene, partial cds Length = 866 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 407 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 354
>gb|AY804546.1| Drosophila santomea strain STO.4 ribosomal protein L27A (RpL27A) gene, partial cds Length = 862 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 403 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 350
>gb|AY804956.1| Drosophila yakuba isolate 1250_4 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804955.1| Drosophila yakuba isolate 1250_3 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804953.1| Drosophila yakuba isolate 1250_1 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804952.1| Drosophila santomea isolate 1250_3 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804951.1| Drosophila santomea isolate 1250_2 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804950.1| Drosophila santomea isolate 1250_1 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804949.1| Drosophila santomea isolate 1566_4 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804948.1| Drosophila santomea isolate 1566_3 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804947.1| Drosophila santomea isolate 1566_2 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804946.1| Drosophila santomea isolate 1566_1 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804945.1| Drosophila yakuba isolate SaoT_3 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804944.1| Drosophila yakuba isolate SaoT_2 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|AY804943.1| Drosophila yakuba isolate SaoT_1 RpL27A gene, partial sequence Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 356
>gb|DQ191661.1| Solanum tuberosum ribosomal protein L27a-like protein mRNA, complete cds Length = 665 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| || | |||||| ||||| |||||||| || ||||||||||||||||| Sbjct: 240 agcttgtggaaataacgcatacctactttaccgaagtaaccaggatggtacttgtcgaaa 181 Query: 533 aggatc 538 |||||| Sbjct: 180 aggatc 175
>gb|DQ191629.1| Solanum tuberosum ribosomal protein L27a-like protein mRNA, complete cds Length = 649 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||||| || | |||||| ||||| |||||||| || ||||||||||||||||| Sbjct: 243 agcttgtggaaataacgcatacctactttaccgaagtaaccaggatggtacttgtcgaaa 184 Query: 533 aggatc 538 |||||| Sbjct: 183 aggatc 178
>gb|AY232080.1| Drosophila yakuba clone yak-ad_RpL27A mRNA sequence Length = 432 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 173 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 120
>gb|AY231794.1| Drosophila yakuba clone yak-em_RpL27A mRNA sequence Length = 444 Score = 67.9 bits (34), Expect = 3e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 185 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcgaag 132
>gb|AC012187.3|F13K23 Sequence of BAC F13K23 from Arabidopsis thaliana chromosome 1, complete sequence Length = 74328 Score = 65.9 bits (33), Expect = 1e-07 Identities = 63/73 (86%) Strand = Plus / Plus Query: 465 tgttgctgagcttgtggaagtacctcataccgactttgccgaagtagccgggatggtact 524 |||| |||||||||||||| ||||||||||| ||||| | || || || ||||| |||| Sbjct: 69776 tgttcctgagcttgtggaaatacctcataccaactttaacaaaatatccaggatgatact 69835 Query: 525 tgtcgaagaggat 537 ||||||||||||| Sbjct: 69836 tgtcgaagaggat 69848
>gb|AY804954.1| Drosophila yakuba isolate 1250_2 RpL27A gene, partial sequence Length = 822 Score = 63.9 bits (32), Expect = 5e-07 Identities = 48/54 (88%) Strand = Plus / Minus Query: 479 tggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| |||||||||||| ||||||||||| || |||||||| ||||| ||| Sbjct: 409 tggaagttcctcataccgaccttgccgaagtaaccaggatggtatttgtcraag 356
>gb|AF493565.1| Kluyveromyces lactis hypothetical protein, YGL104C, YGL102C-like protein, and RPL28 genes, complete cds Length = 5201 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 4789 gcttgtggaagtatctcataccgaccttaccgaagtaacctggatggtactt 4738
>ref|XM_455390.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F06831g predicted mRNA Length = 450 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 190 gcttgtggaagtatctcataccgaccttaccgaagtaacctggatggtactt 139
>ref|XM_455389.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F06820g predicted mRNA Length = 459 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Plus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 288 gcttgtggaagtatctcataccgaccttaccgaagtaacctggatggtactt 339
>emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y-1140 of Kluyveromyces lactis Length = 2602197 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Plus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 654916 gcttgtggaagtatctcataccgaccttaccgaagtaacctggatggtactt 654967
>dbj|AB226252.1| Aspergillus oryzae cDNA, contig sequence: AoEST3111 Length = 956 Score = 63.9 bits (32), Expect = 5e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 475 cttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcga 530 ||||||||||||||||||||| || || ||||| || ||||| ||||||||||||| Sbjct: 414 cttgtggaagtacctcataccaaccttaccgaaataaccggggtggtacttgtcga 359
>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 Length = 1824958 Score = 63.9 bits (32), Expect = 5e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 475 cttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcga 530 ||||||||||||||||||||| || || ||||| || ||||| ||||||||||||| Sbjct: 84617 cttgtggaagtacctcataccaaccttaccgaaataaccggggtggtacttgtcga 84562
>emb|AL116198.1|CNS01CZY Botrytis cinerea strain T4 cDNA library Length = 516 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 204 gcttgtggaagtatctcataccgacctttccgaagtaacctggatggtactt 153
>emb|AL115817.1|CNS01CPD Botrytis cinerea strain T4 cDNA library Length = 660 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 197 gcttgtggaagtatctcataccgacctttccgaagtaacctggatggtactt 146
>emb|AL115727.1|CNS01CMV Botrytis cinerea strain T4 cDNA library Length = 480 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 222 gcttgtggaagtatctcataccgacctttccgaagtaacctggatggtactt 171
>emb|AL115713.1|CNS01CMH Botrytis cinerea strain T4 cDNA library Length = 480 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 197 gcttgtggaagtatctcataccgacctttccgaagtaacctggatggtactt 146
>emb|AL115709.1|CNS01CMD Botrytis cinerea strain T4 cDNA library Length = 660 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 223 gcttgtggaagtatctcataccgacctttccgaagtaacctggatggtactt 172
>emb|AL113985.1|CNS01BAH Botrytis cinerea strain T4 cDNA library Length = 480 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 216 gcttgtggaagtatctcataccgacctttccgaagtaacctggatggtactt 165
>emb|AL112475.1|CNS01A4J Botrytis cinerea strain T4 cDNA library Length = 540 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 181 gcttgtggaagtatctcataccgacctttccgaagtaacctggatggtactt 130
>emb|AL111246.1|CNS0196E Botrytis cinerea strain T4 cDNA library Length = 540 Score = 63.9 bits (32), Expect = 5e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| ||||||||||| || |||||||| || ||||||||||| Sbjct: 185 gcttgtggaagtatctcataccgacctttccgaagtaacctggatggtactt 134
>gb|AY432710.1| Aedes aegypti ASAP ID: 34035 cytosolic large ribosomal subunit L27A mRNA sequence Length = 658 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 478 gtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 |||||||| |||||||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 273 gtggaagttcctcataccgaccttgccgaagtatccagggtggtatttgtcgaag 219
>gb|DQ440054.1| Aedes aegypti clone AE-306 60S ribosomal protein L15/L27 mRNA, complete cds Length = 450 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 478 gtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 |||||||| |||||||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 192 gtggaagttcctcataccgaccttgccgaagtatccagggtggtatttgtcgaag 138
>ref|XM_388032.1| Gibberella zeae PH-1 chromosome 4 RL2A_ERYGR 60S ribosomal protein L27a (L29) (FG07856.1) partial mRNA Length = 450 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtc 528 ||||||||||||| | |||||| || || |||||||| ||||||||||||||||| Sbjct: 190 gcttgtggaagtatcgcataccaacctttccgaagtaaccgggatggtacttgtc 136
>emb|AM049100.1| Georissus sp. APV-2005 mRNA for ribosomal protein L27Ae (rpL27Ae gene) Length = 441 Score = 60.0 bits (30), Expect = 8e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 475 cttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||| ||| ||||||||| | ||| |||||||| ||||||||||| ||||||||| Sbjct: 189 cttgtggtagttcctcataccaagtttaccgaagtacccgggatggtatttgtcgaag 132
>gb|AC147877.10| Medicago truncatula clone mth2-9b13, complete sequence Length = 122251 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 |||||||| ||||| | |||||| || || |||||||| || ||||| |||||||||||| Sbjct: 105837 agcttgtgaaagtagcgcataccaaccttaccgaagtaacctggatgatacttgtcgaag 105896 Query: 533 aggat 537 ||||| Sbjct: 105897 aggat 105901
>ref|XM_626938.1| Cryptosporidium parvum Iowa II 60S ribosomal protein L27A or L27a (cgd3_3930), partial mRNA Length = 474 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 476 ttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtc 528 |||||||| || |||||||| ||||| || |||||||| |||||||||||||| Sbjct: 212 ttgtggaaatatctcataccaactttaccaaagtagcctggatggtacttgtc 160
>emb|CT573365.4| M.truncatula DNA sequence from clone MTH2-89E15 on chromosome 3, complete sequence Length = 123679 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 473 agcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtcgaag 532 |||||||| ||||| | |||||| || || |||||||| || ||||| |||||||||||| Sbjct: 18919 agcttgtgaaagtagcgcataccaaccttaccgaagtaacctggatgatacttgtcgaag 18978 Query: 533 aggat 537 ||||| Sbjct: 18979 aggat 18983
>ref|XM_501165.1| Yarrowia lipolytica CLIB122, YALI0B21076g predicted mRNA Length = 450 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| | ||||||||| || |||||||| || ||||||||||| Sbjct: 190 gcttgtggaagtatcgcataccgaccttaccgaagtaaccaggatggtactt 139 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 254 gcggccttgatcttcttctcggcgatcttggaga 287 |||||||||||||||||||| ||||||| ||||| Sbjct: 422 gcggccttgatcttcttctcagcgatctcggaga 389
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica Length = 3066374 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtactt 525 ||||||||||||| | ||||||||| || |||||||| || ||||||||||| Sbjct: 2770518 gcttgtggaagtatcgcataccgaccttaccgaagtaaccaggatggtactt 2770467 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 254 gcggccttgatcttcttctcggcgatcttggaga 287 |||||||||||||||||||| ||||||| ||||| Sbjct: 2770750 gcggccttgatcttcttctcagcgatctcggaga 2770717
>ref|XM_448163.1| Candida glabrata CBS138, CAGL0J10384g partial mRNA Length = 450 Score = 54.0 bits (27), Expect = 5e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 474 gcttgtggaagtacctcataccgactttgccgaagtagccgggatggtacttgtc 528 ||||||||||||| |||||||| || || |||||||| || || ||||||||||| Sbjct: 190 gcttgtggaagtatctcataccaaccttaccgaagtaacctgggtggtacttgtc 136
>emb|BX071844.1|CNS09RLK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 615 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 657
>emb|BX071843.1|CNS09RLJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 261 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 219
>emb|BX071644.1|CNS09RG0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 870 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 265 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 223
>emb|BX071615.1|CNS09RF7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 625 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 667
>emb|BX071614.1|CNS09RF6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 249 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 207
>emb|BX071464.1|CNS09RB0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 635 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 677
>emb|BX071463.1|CNS09RAZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 260 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 218
>emb|BX071150.1|CNS09R2A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 763 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 631 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 673
>emb|BX071149.1|CNS09R29 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 238 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 196
>emb|BX071048.1|CNS09QZG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 616 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 658
>emb|BX071047.1|CNS09QZF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 271 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 229
>emb|BX071369.1|CNS09R8D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 542 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 240 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 198
>emb|BX071325.1|CNS09R75 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8DC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 608 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 650
>emb|BX071324.1|CNS09R74 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 243 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 201
>emb|BX071281.1|CNS09R5X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 760 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 613 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 655
>emb|BX070860.1|CNS09QU8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8AF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 864 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 577 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 619
>emb|BX070859.1|CNS09QU7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 264 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 222
>emb|BX070688.1|CNS09QPG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 907 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 604 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 646
>emb|BX070687.1|CNS09QPF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 246 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 204
>emb|BX070670.1|CNS09QOY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7DE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 733 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 626 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 668
>emb|BX070669.1|CNS09QOX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 205
>emb|BX070196.1|CNS09QBS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7AG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 774 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 635 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 677
>emb|BX070195.1|CNS09QBR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7AG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 252 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 210
>emb|BX070000.1|CNS09Q6C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 868 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 637 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 679
>emb|BX069999.1|CNS09Q6B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 936 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 246 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 204
>emb|BX069998.1|CNS09Q6A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 618 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 660
>emb|BX069997.1|CNS09Q69 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 282 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 240
>emb|BX069926.1|CNS09Q4A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 634 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 260 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 218
>emb|BX069764.1|CNS09PZS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 874 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 649 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 691
>emb|BX069763.1|CNS09PZR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 245 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 203
>emb|BX069694.1|CNS09PXU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 442 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 257 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 215
>emb|BX069346.1|CNS09PO6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 277 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 235
>emb|BX069225.1|CNS09PKT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 765 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 554 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 596
>emb|BX069224.1|CNS09PKS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 220 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 178
>emb|BX069119.1|CNS09PHV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 616 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 658
>emb|BX069118.1|CNS09PHU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 246 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 204
>emb|BX069067.1|CNS09PGF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 625 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 667
>emb|BX069066.1|CNS09PGE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 259 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 217
>emb|BX068787.1|CNS09P8N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 640 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 682
>emb|BX068786.1|CNS09P8M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 261 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 219
>emb|BX068730.1|CNS09P72 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 633 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 675
>emb|BX068729.1|CNS09P71 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 252 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 210
>emb|BX068402.1|CNS09OXY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52CD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 639 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 681
>emb|BX068401.1|CNS09OXX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 331 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 289
>emb|BX068341.1|CNS09OW9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 642 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 684
>emb|BX068159.1|CNS09OR7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 613 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 655
>emb|BX068158.1|CNS09OR6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 253 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 211
>emb|BX067963.1|CNS09OLR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 849 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 559 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 601
>emb|BX067962.1|CNS09OLQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 241 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 199
>emb|BX067750.1|CNS09OFU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 383 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 267 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 225
>emb|BX067375.1|CNS09O5F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 864 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 618 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 660
>emb|BX067374.1|CNS09O5E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 245 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 203
>emb|BX067204.1|CNS09O0O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 617 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 659
>emb|BX067203.1|CNS09O0N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 250 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 208
>emb|BX066718.1|CNS09NN6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 626 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 668
>emb|BX066717.1|CNS09NN5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 246 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 204
>emb|BX066486.1|CNS09NGQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 610 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 652
>emb|BX066485.1|CNS09NGP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 251 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 209
>emb|BX066475.1|CNS09NGF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 610 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 652
>emb|BX066474.1|CNS09NGE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 248 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 206
>emb|BX066450.1|CNS09NFQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 621 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 663
>emb|BX066389.1|CNS09NE1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 628 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 670
>emb|BX066388.1|CNS09NE0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 263 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 221
>emb|BX065859.1|CNS09MZB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 577 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 256 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 214
>emb|BX065781.1|CNS09MX5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 936 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 261 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 219
>emb|BX065577.1|CNS09MRH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49CB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 792 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 620 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 662
>emb|BX065576.1|CNS09MRG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 807 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 127 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 85
>emb|BX065498.1|CNS09MPA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 655 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 697
>emb|BX065497.1|CNS09MP9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 252 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 210
>emb|BX065069.1|CNS09MDD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 285 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 233 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 191
>emb|BX065054.1|CNS09MCY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 888 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 636 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 678
>emb|BX064997.1|CNS09MBD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 643 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 53 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 11
>emb|BX064955.1|CNS09MA7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 615 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 657
>emb|BX064954.1|CNS09MA6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 278 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 236
>emb|BX064810.1|CNS09M66 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 229 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 127 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 85
>emb|BX064806.1|CNS09M62 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 857 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 253 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 211
>emb|BX064779.1|CNS09M5B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 607 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 649
>emb|BX064778.1|CNS09M5A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 215 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 173
>emb|BX064710.1|CNS09M3E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 762 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 229 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 187
>emb|BX064612.1|CNS09M0O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46DH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 731 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 618 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 660
>emb|BX064611.1|CNS09M0N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 205
>emb|BX064509.1|CNS09LXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46DC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 633 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 675
>emb|BX064050.1|CNS09LL2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 628 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 670
>emb|BX064049.1|CNS09LL1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 205
>emb|BX063943.1|CNS09LI3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 643 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 685
>emb|BX063942.1|CNS09LI2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 288 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 246
>emb|BX063825.1|CNS09LET Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 594 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 412 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 454
>emb|BX063824.1|CNS09LES Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 192 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 102 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 60
>emb|BX063744.1|CNS09LCK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 724 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 267 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 225
>emb|BX063730.1|CNS09LC6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45DA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 736 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 654 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 696
>emb|BX063729.1|CNS09LC5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 255 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 213
>emb|BX063617.1|CNS09L91 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 813 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 627 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 669
>emb|BX063616.1|CNS09L90 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 248 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 206
>emb|BX063582.1|CNS09L82 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45CA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 867 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 615 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 657
>emb|BX063581.1|CNS09L81 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 892 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 245 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 203
>emb|BX063323.1|CNS09L0V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 634 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 676
>emb|BX062744.1|CNS09KKS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 803 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 616 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 658
>emb|BX062743.1|CNS09KKR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 840 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 380 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 338
>emb|BX062646.1|CNS09KI2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 480 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 350 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 392
>emb|BX062645.1|CNS09KI1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 870 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 238 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 196
>emb|BX062417.1|CNS09KBP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 870 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 628 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 670
>emb|BX062386.1|CNS09KAU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 636 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 678
>emb|BX062032.1|CNS09K10 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 889 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 634 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 676
>emb|BX061846.1|CNS09JVU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 251 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 209
>emb|BX061653.1|CNS09JQH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 906 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 606 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 648
>emb|BX061652.1|CNS09JQG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 244 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 202
>emb|BX061533.1|CNS09JN5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 243 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 201
>emb|BX061500.1|CNS09JM8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 250 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 208
>emb|BX061418.1|CNS09JJY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 241 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 199
>emb|BX061372.1|CNS09JIO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42AF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 871 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 586 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 628
>emb|BX061371.1|CNS09JIN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 225 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 183
>emb|BX060850.1|CNS09J46 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41BF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 629 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 258 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 216
>emb|BX060763.1|CNS09J1R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 889 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 615 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 657
>emb|BX060762.1|CNS09J1Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 257 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 215
>emb|BX060639.1|CNS09IYB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41AD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 698 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 618 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 660
>emb|BX060638.1|CNS09IYA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 846 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 242 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 200
>emb|BX060485.1|CNS09IU1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 611 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 653
>emb|BX060484.1|CNS09IU0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 239 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 197
>emb|BX060483.1|CNS09ITZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 768 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 617 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 659
>emb|BX060482.1|CNS09ITY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 244 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 202
>emb|BX060104.1|CNS09IJG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 906 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 617 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 659
>emb|BX060103.1|CNS09IJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 258 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 216
>emb|BX060039.1|CNS09IHN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 620 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 662
>emb|BX060038.1|CNS09IHM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 205
>emb|BX059961.1|CNS09IFH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 256 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 214
>emb|BX059617.1|CNS09I5X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 294 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 251 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 209
>emb|BX059596.1|CNS09I5C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 633 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 675
>emb|BX059595.1|CNS09I5B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 269 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 227
>emb|BX059581.1|CNS09I4X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 625 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 667
>emb|BX059580.1|CNS09I4W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 264 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 222
>emb|BX059462.1|CNS09I1M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 617 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 659
>emb|BX059461.1|CNS09I1L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 256 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 214
>emb|BX059340.1|CNS09HY8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 265 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 223
>emb|BX059233.1|CNS09HV9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 838 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 615 cataccgaccttgccgaagtatcccggatggtatttgtcgaag 657
>emb|BX059232.1|CNS09HV8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 243 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 201
>emb|BX059085.1|CNS09HR5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 247 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 205
>emb|BX058666.1|CNS09HFI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 239 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 197
>emb|BX058616.1|CNS09HE4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 889 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 597 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 639
>emb|BX058615.1|CNS09HE3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 239 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 197
>emb|BX058582.1|CNS09HD6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 268 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 226
>emb|BX058544.1|CNS09HC4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39AA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 631 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 673
>emb|BX058454.1|CNS09H9M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 600 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 263 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 221
>emb|BX058452.1|CNS09H9K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38DE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 834 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 618 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 660
>emb|BX058451.1|CNS09H9J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38DE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 257 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 215
>emb|BX058329.1|CNS09H65 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 520 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 246 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 204
>emb|BX058255.1|CNS09H43 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 598 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 251 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 209
>emb|BX058230.1|CNS09H3E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 936 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 639 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 681
>emb|BX058229.1|CNS09H3D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 269 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 227
>emb|BX056621.1|CNS09FUP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 836 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 581 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 623
>emb|BX056620.1|CNS09FUO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 230 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 188
>emb|BX056605.1|CNS09FU9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36AB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 850 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 608 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 650
>emb|BX056604.1|CNS09FU8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 903 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 249 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 207
>emb|BX057878.1|CNS09GTM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 609 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 651
>emb|BX057784.1|CNS09GR0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 593 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 266 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 224
>emb|BX057633.1|CNS09GMT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 618 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 253 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 211
>emb|BX057505.1|CNS09GJ9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 537 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 257 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 215
>emb|BX057495.1|CNS09GIZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 469 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 248 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 206
>emb|BX057313.1|CNS09GDX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 250 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 126 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 84
>emb|BX057272.1|CNS09GCS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 367 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 179 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 137
>emb|BX057100.1|CNS09G80 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 616 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 246 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 204
>emb|BX056824.1|CNS09G0C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 273 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 231
>emb|BX056459.1|CNS09FQ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 248 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 206
>emb|BX055894.1|CNS09FAI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34CG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 373 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 490 cataccgactttgccgaagtagccgggatggtacttgtcgaag 532 ||||||||| ||||||||||| || |||||||| ||||||||| Sbjct: 263 cataccgaccttgccgaagtaacccggatggtatttgtcgaag 221 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,764,012 Number of Sequences: 3902068 Number of extensions: 3764012 Number of successful extensions: 76885 Number of sequences better than 10.0: 600 Number of HSP's better than 10.0 without gapping: 605 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 73651 Number of HSP's gapped (non-prelim): 3221 length of query: 538 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 515 effective length of database: 17,143,297,704 effective search space: 8828798317560 effective search space used: 8828798317560 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
