>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence
          Length = 439641

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 82     tcaccagccccaggactactgttagctggtggacactcacttgataca 129
              ||||||||||||||| ||||||| ||| |||||||||  |||||||||
Sbjct: 399621 tcaccagccccaggattactgtttgctagtggacacttccttgataca 399574



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                               
Query: 248    ctccattcccagaggaacatctgacttggataa 280
              ||||||||||||||||||  |||||||||||||
Sbjct: 247955 ctccattcccagaggaacggctgacttggataa 247923

>gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete sequence
          Length = 285506

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                    
Query: 56     taatttccaaaaaatggcctttgtattcaccagccccaggactactgttagctg 109
              ||||||| | ||||||||| ||||  ||| ||||||||||| ||||||||||||
Sbjct: 266132 taatttcgagaaaatggcccttgtgctcatcagccccaggattactgttagctg 266079

>emb|AL138539.7|CNS01DWV Human chromosome 14 DNA sequence BAC C-2588C21 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 150350

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 237   tgcccatggaactccattcccagagg 262
             |||||| |||||||||||||||||||
Sbjct: 65880 tgcccagggaactccattcccagagg 65905

>emb|AL731547.9| Human DNA sequence from clone RP11-565H13 on chromosome 10 Contains the
              5' end of a variant of the NEBL gene for the nebulette
              protein (actin-binding Z-disc protein), a novel gene, a
              ribosomal protein L15 (RPL15)(EC45, RPL10, RPLY10, RPYL10)
              pseudogene, a pseudogene similar to part of HOM-TES-85
              (tumour antigen HOM-TES-85) and a CpG island, complete
              sequence
          Length = 175842

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 27     tttttgtagagaccggttctt 47
              |||||||||||||||||||||
Sbjct: 138284 tttttgtagagaccggttctt 138264

>gb|AC026318.23| Homo sapiens 3 BAC RP11-59D2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 83181

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 27    tttttgtagagaccggttctt 47
             |||||||||||||||||||||
Sbjct: 15553 tttttgtagagaccggttctt 15533

>gb|AC159266.3| Mus musculus BAC clone RP24-64D24 from chromosome 8, complete sequence
          Length = 212727

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    ttatgtgggtttttgtagag 37
             ||||||||||||||||||||
Sbjct: 38642 ttatgtgggtttttgtagag 38661

>gb|AY297941.1| Panthera leo persica isolate 17 mitochondrial cytochrome b (cytb)
           gene, partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297940.1| Panthera leo persica isolate 16 mitochondrial cytochrome b (cytb)
           gene, partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297939.1| Panthera leo persica isolate 15 mitochondrial cytochrome b (cytb)
           gene, partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297938.1| Panthera tigris isolate 14 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297937.1| Panthera tigris isolate 13 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297936.1| Panthera tigris isolate 12 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297935.1| Panthera tigris isolate 11 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297934.1| Panthera tigris isolate 10 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297933.1| Panthera tigris isolate 9 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297932.1| Panthera tigris isolate 8 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297931.1| Panthera tigris isolate 7 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297930.1| Panthera tigris isolate 6 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297929.1| Panthera tigris isolate 5 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297928.1| Panthera pardus isolate 4 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297927.1| Panthera pardus isolate 3 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297926.1| Panthera pardus isolate 2 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AY297925.1| Panthera pardus isolate 1 mitochondrial cytochrome b (cytb) gene,
           partial sequence
          Length = 412

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 266 atctgacttggataaaatcc 285
           ||||||||||||||||||||
Sbjct: 214 atctgacttggataaaatcc 233

>gb|AC164555.2| Mus musculus BAC clone RP23-346G13 from chromosome 17, complete sequence
          Length = 211631

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 133    aatcctaagaaaaatgcaaa 152
              ||||||||||||||||||||
Sbjct: 191756 aatcctaagaaaaatgcaaa 191737

>gb|AC007818.8| Drosophila melanogaster clone BACR02M05, complete sequence
          Length = 188549

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 505    tacccactcaccatttgcat 524
              ||||||||||||||||||||
Sbjct: 124225 tacccactcaccatttgcat 124206

>emb|AL583850.5| Human DNA sequence from clone RP11-430G6 on chromosome 1 Contains the
             RGS4 gene for regulator of G-protein signalling 4 and the
             3' end of the RGS5 gene for regulator of G-protein
             signalling 5, complete sequence
          Length = 165329

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 248   ctccattcccagaggaacat 267
             ||||||||||||||||||||
Sbjct: 52886 ctccattcccagaggaacat 52867

>gb|AC008217.5|AC008217 Drosophila melanogaster, chromosome 3R, region 98B-98B, BAC clone
             BACR10J03, complete sequence
          Length = 193245

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 505   tacccactcaccatttgcat 524
             ||||||||||||||||||||
Sbjct: 66948 tacccactcaccatttgcat 66929

>gb|AC008253.8|AC008253 Drosophila melanogaster, chromosome 3R, region 98B1-98B2, BAC clone
             BACR48A16, complete sequence
          Length = 180887

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 505   tacccactcaccatttgcat 524
             ||||||||||||||||||||
Sbjct: 35686 tacccactcaccatttgcat 35667

>gb|AC007839.4|AC007839 Drosophila melanogaster, chromosome 2R, region 56B1-56C4, BAC clone
              BACR01N09, complete sequence
          Length = 161172

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    accaccatcacaccccaaca 387
              ||||||||||||||||||||
Sbjct: 105685 accaccatcacaccccaaca 105704

>gb|AC116957.2| Dictyostelium discoideum chromosome 2 map 1685067-2090751 strain AX4,
             complete sequence
          Length = 405682

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    aaagaataatttccaaaaaa 69
             ||||||||||||||||||||
Sbjct: 18231 aaagaataatttccaaaaaa 18250

>gb|AC154260.2| Mus musculus BAC clone RP24-225C5 from 17, complete sequence
          Length = 187652

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 133    aatcctaagaaaaatgcaaa 152
              ||||||||||||||||||||
Sbjct: 144255 aatcctaagaaaaatgcaaa 144274

>emb|BX537128.6| Mouse DNA sequence from clone RP23-12K23 on chromosome X, complete
             sequence
          Length = 173195

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 286   gatctcacaagtcttctatc 305
             ||||||||||||||||||||
Sbjct: 27394 gatctcacaagtcttctatc 27375

>gb|AC123027.4| Mus musculus BAC clone RP24-550H11 from 3, complete sequence
          Length = 191211

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 527   cataatctttgaagtttgag 546
             ||||||||||||||||||||
Sbjct: 69333 cataatctttgaagtttgag 69352

>gb|AE003762.4| Drosophila melanogaster chromosome 3R, section 100 of 118 of the
             complete sequence
          Length = 231486

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 505   tacccactcaccatttgcat 524
             ||||||||||||||||||||
Sbjct: 96626 tacccactcaccatttgcat 96607

>gb|AE003797.3| Drosophila melanogaster chromosome 2R, section 53 of 73 of the complete
              sequence
          Length = 306854

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    accaccatcacaccccaaca 387
              ||||||||||||||||||||
Sbjct: 288521 accaccatcacaccccaaca 288540


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,218,709
Number of Sequences: 3902068
Number of extensions: 5218709
Number of successful extensions: 100137
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 100070
Number of HSP's gapped (non-prelim): 67
length of query: 579
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 556
effective length of database: 17,143,297,704
effective search space: 9531673523424
effective search space used: 9531673523424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)