Clone Name	rbags30l01
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY846828.1| Triticum aestivum ribosomal protein L7 mRNA, comp...	200	2e-48
2	gb|AY103677.1| Zea mays PCO099976 mRNA sequence	192	4e-46
3	ref|XM_480842.1| Oryza sativa (japonica cultivar-group), mRNA	178	6e-42
4	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	178	6e-42
5	dbj|AP005603.3| Oryza sativa (japonica cultivar-group) genomic D...	178	6e-42
6	dbj|AK102873.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	6e-42
7	dbj|AK061680.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	6e-42
8	gb|AY109992.1| Zea mays CL9168_1 mRNA sequence	159	6e-36
9	ref|XM_473801.1| Oryza sativa (japonica cultivar-group), predic...	153	4e-34
10	emb|AL662996.3|OSJN00198 Oryza sativa genomic DNA, chromosome 4,...	153	4e-34
11	emb|AL662968.3|OSJN00168 Oryza sativa genomic DNA, chromosome 4,...	153	4e-34
12	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	153	4e-34
13	dbj|AK073472.1| Oryza sativa (japonica cultivar-group) cDNA clon...	153	4e-34
14	gb|BT017565.1| Zea mays clone EL01N0425H11.c mRNA sequence	151	1e-33
15	gb|BT016468.1| Zea mays clone Contig301 mRNA sequence	143	3e-31
16	gb|AY104655.1| Zea mays PCO101521 mRNA sequence	143	3e-31
17	dbj|D29720.1|RICYK33 Oryza sativa mRNA, partial homologous to ri...	119	5e-24
18	ref|NM_126186.2| Arabidopsis thaliana structural constituent of ...	100	5e-18
19	gb|AY079328.1| Arabidopsis thaliana putative ribosomal protein L...	100	5e-18
20	gb|AY045994.1| Arabidopsis thaliana putative ribosomal protein L...	100	5e-18
21	gb|AC006200.3| Arabidopsis thaliana chromosome 2 clone F10A8 map...	100	5e-18
22	gb|AY081698.1| Arabidopsis thaliana 60S ribosomal protein L7 (At...	100	5e-18
23	gb|AF370484.1|AF370484 Arabidopsis thaliana 60S ribosomal protei...	100	5e-18
24	emb|BX818796.1|CNS0A9X8 Arabidopsis thaliana Full-length cDNA Co...	100	5e-18
25	gb|AY085139.1| Arabidopsis thaliana clone 13298 mRNA, complete s...	100	5e-18
26	ref|NM_180079.1| Arabidopsis thaliana structural constituent of ...	96	7e-17
27	ref|NM_180080.1| Arabidopsis thaliana structural constituent of ...	96	7e-17
28	gb|AC004005.3| Arabidopsis thaliana chromosome 2 clone F6E13 map...	96	7e-17
29	gb|AY081474.1| Arabidopsis thaliana 60S ribosomal protein L7 (At...	96	7e-17
30	gb|AY065196.1| Arabidopsis thaliana 60S ribosomal protein L7 (F6...	96	7e-17
31	gb|AF446884.1|AF446884 Arabidopsis thaliana At2g44120/F6E13.25 m...	96	7e-17
32	gb|AY052724.1| Arabidopsis thaliana At2g44120/F6E13.25 mRNA, com...	96	7e-17
33	gb|AY087583.1| Arabidopsis thaliana clone 36813 mRNA, complete s...	96	7e-17
34	gb|BT002379.1| Arabidopsis thaliana Unknown protein mRNA, comple...	88	2e-14
35	ref|NM_202576.1| Arabidopsis thaliana structural constituent of ...	72	1e-09
36	ref|NM_202575.1| Arabidopsis thaliana structural constituent of ...	72	1e-09
37	ref|NM_112204.2| Arabidopsis thaliana structural constituent of ...	72	1e-09
38	gb|AY077675.1| Arabidopsis thaliana AT3g13580/K20M4_2 mRNA, comp...	72	1e-09
39	gb|AY056112.1| Arabidopsis thaliana AT3g13580/K20M4_2 mRNA, comp...	72	1e-09
40	gb|AY039900.1| Arabidopsis thaliana AT3g13580/K20M4_2 mRNA, comp...	72	1e-09
41	emb|BX822214.1|CNS0A5Y3 Arabidopsis thaliana Full-length cDNA Co...	72	1e-09
42	emb|BX824872.1|CNS0A5RP Arabidopsis thaliana Full-length cDNA Co...	72	1e-09
43	emb|BX824301.1|CNS0A5PN Arabidopsis thaliana Full-length cDNA Co...	72	1e-09
44	dbj|AP002038.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	72	1e-09
45	gb|AY617897.1| Sterkiella histriomuscorum clone UGC1O0006_E04_F ...	68	2e-08
46	gb|AF003139.2| Caenorhabditis elegans cosmid F53G12, complete se...	64	3e-07
47	ref|NM_058275.2| Caenorhabditis elegans Ribosomal Protein, Large...	64	3e-07
48	ref|XM_359540.1| Magnaporthe grisea 70-15 hypothetical protein (...	60	4e-06
49	gb|DQ084481.1| Chaetomium globosum 60S ribosomal protein L7 mRNA...	60	4e-06
50	gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	60	4e-06
51	ref|NM_210820.1| Eremothecium gossypii AFL082Wp (AFL082W), mRNA	60	4e-06
52	emb|AJ245656.1|CPA245656 Cyanophora paradoxa partial mRNA for 60...	58	2e-05
53	gb|DQ228335.1| Solanum tuberosum clone 145F05 thaliana 60S ribos...	54	2e-04
54	gb|AC148819.3| Medicago truncatula chromosome 2 BAC clone mte1-1...	54	2e-04
55	gb|AY433771.1| Aedes aegypti ASAP ID: 34421 cytosolic large ribo...	52	0.001
56	gb|DQ440213.1| Aedes aegypti clone AET-2196 ribosomal protein L7...	52	0.001
57	ref|XM_453218.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D03410g ...	52	0.001
58	emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	52	0.001
59	gb|AY072288.1| Spodoptera frugiperda ribosomal protein L7 mRNA, ...	52	0.001
60	ref|XM_503909.1| Yarrowia lipolytica CLIB122, YALI0E13618g predi...	50	0.004
61	gb|AY130402.1| Branchiostoma lanceolatum ribosomal protein L7 mR...	50	0.004
62	emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ...	50	0.004
63	gb|DQ066291.1| Ixodes scapularis isolate is-all-399 ribosomal pr...	48	0.015
64	emb|BX825759.1|CNS0A4ZI Arabidopsis thaliana Full-length cDNA Co...	48	0.015
65	gb|AY130403.1| Myxine glutinosa ribosomal protein L7-like mRNA, ...	48	0.015
66	gb|AY389939.1| Latimeria chalumnae ribosomal protein L7 mRNA, pa...	46	0.061
67	ref|NM_078807.1| Drosophila melanogaster Ribosomal protein L7 CG...	46	0.061
68	gb|AY089648.1| Drosophila melanogaster RH04903 full insert cDNA	46	0.061
69	gb|AC092233.1|AC092233 Drosophila melanogaster, chromosome 2L, r...	46	0.061
70	gb|AC009849.7|AC009849 Drosophila melanogaster, chromosome 2L, r...	46	0.061
71	emb|BX825608.1|CNS0A7J7 Arabidopsis thaliana Full-length cDNA Co...	46	0.061
72	gb|AY130404.1| Petromyzon marinus ribosomal protein L7 mRNA, par...	46	0.061
73	gb|AE003627.4| Drosophila melanogaster chromosome 2L, section 36...	46	0.061
74	emb|AL115722.1|CNS01CMQ Botrytis cinerea strain T4 cDNA library	44	0.24
75	emb|AL114969.1|CNS01C1T Botrytis cinerea strain T4 cDNA library	44	0.24
76	emb|AL112846.1|CNS01AEU Botrytis cinerea strain T4 cDNA library	44	0.24
77	emb|AL111897.1|CNS019OH Botrytis cinerea strain T4 cDNA library	44	0.24
78	emb|AL111166.1|CNS01947 Botrytis cinerea strain T4 cDNA library	44	0.24
79	dbj|AB180451.1| Plutella xylostella mRNA for Ribosomal protein L...	44	0.24
80	gb|BC085590.1| Danio rerio cDNA clone IMAGE:7264251, partial cds	42	0.95
81	gb|AF098999.2| Caenorhabditis elegans cosmid W04C9, complete seq...	42	0.95
82	gb|DQ118296.2| Oryzias latipes ribosomal protein L7 mRNA, comple...	42	0.95
83	gb|AY561515.1| Danio rerio ribosomal protein L7 (rpl7) mRNA, com...	42	0.95
84	gb|BT013050.1| Lycopersicon esculentum clone 114306R, mRNA sequence	42	0.95
85	ref|NM_213644.1| Danio rerio ribosomal protein L7 (rpl7), mRNA	42	0.95
86	emb|CR735071.2|CNS0GTYM Tetraodon nigroviridis full-length cDNA	42	0.95
87	emb|CR734244.2|CNS0GTBN Tetraodon nigroviridis full-length cDNA	42	0.95
88	emb|CR734522.2|CNS0GTJD Tetraodon nigroviridis full-length cDNA	42	0.95
89	emb|CR733965.2|CNS0GT3W Tetraodon nigroviridis full-length cDNA	42	0.95
90	emb|CR733632.2|CNS0GSUN Tetraodon nigroviridis full-length cDNA	42	0.95
91	emb|CR733687.2|CNS0GSW6 Tetraodon nigroviridis full-length cDNA	42	0.95
92	emb|CR731264.2|CNS0GR6T Tetraodon nigroviridis full-length cDNA	42	0.95
93	emb|CR727947.2|CNS0GOMP Tetraodon nigroviridis full-length cDNA	42	0.95
94	emb|CR720280.2|CNS0GIPQ Tetraodon nigroviridis full-length cDNA	42	0.95
95	emb|CR720053.2|CNS0GIJF Tetraodon nigroviridis full-length cDNA	42	0.95
96	emb|CR723153.2|CNS0GKXJ Tetraodon nigroviridis full-length cDNA	42	0.95
97	emb|CR723125.2|CNS0GKWR Tetraodon nigroviridis full-length cDNA	42	0.95
98	emb|CR722468.2|CNS0GKEI Tetraodon nigroviridis full-length cDNA	42	0.95
99	emb|CR722292.2|CNS0GK9M Tetraodon nigroviridis full-length cDNA	42	0.95
100	emb|CR722107.2|CNS0GK4H Tetraodon nigroviridis full-length cDNA	42	0.95
101	emb|CR722072.2|CNS0GK3I Tetraodon nigroviridis full-length cDNA	42	0.95
102	emb|CR721869.2|CNS0GJXV Tetraodon nigroviridis full-length cDNA	42	0.95
103	emb|CR721467.2|CNS0GJMP Tetraodon nigroviridis full-length cDNA	42	0.95
104	emb|CR721426.2|CNS0GJLK Tetraodon nigroviridis full-length cDNA	42	0.95
105	emb|CR721359.2|CNS0GJJP Tetraodon nigroviridis full-length cDNA	42	0.95
106	emb|CR721235.2|CNS0GJG9 Tetraodon nigroviridis full-length cDNA	42	0.95
107	emb|CR721092.2|CNS0GJCA Tetraodon nigroviridis full-length cDNA	42	0.95
108	emb|CR721030.2|CNS0GJAK Tetraodon nigroviridis full-length cDNA	42	0.95
109	emb|CR720799.2|CNS0GJ45 Tetraodon nigroviridis full-length cDNA	42	0.95
110	emb|CR720623.2|CNS0GIZ9 Tetraodon nigroviridis full-length cDNA	42	0.95
111	emb|CR720322.2|CNS0GIQW Tetraodon nigroviridis full-length cDNA	42	0.95
112	emb|CR720019.2|CNS0GIIH Tetraodon nigroviridis full-length cDNA	42	0.95
113	emb|CR719901.2|CNS0GIF7 Tetraodon nigroviridis full-length cDNA	42	0.95
114	emb|CR719414.2|CNS0GI1O Tetraodon nigroviridis full-length cDNA	42	0.95
115	emb|CR717867.2|CNS0GGUP Tetraodon nigroviridis full-length cDNA	42	0.95
116	emb|CR717180.2|CNS0GGBP Tetraodon nigroviridis full-length cDNA	42	0.95
117	emb|CR716913.2|CNS0GG4A Tetraodon nigroviridis full-length cDNA	42	0.95
118	emb|CR715495.2|CNS0GF0Z Tetraodon nigroviridis full-length cDNA	42	0.95
119	emb|CR714419.2|CNS0GE73 Tetraodon nigroviridis full-length cDNA	42	0.95
120	emb|CR714409.2|CNS0GE6T Tetraodon nigroviridis full-length cDNA	42	0.95
121	emb|CR713663.2|CNS0GDM3 Tetraodon nigroviridis full-length cDNA	42	0.95
122	emb|CR713179.2|CNS0GD8N Tetraodon nigroviridis full-length cDNA	42	0.95
123	emb|CR711113.2|CNS0GBN9 Tetraodon nigroviridis full-length cDNA	42	0.95
124	emb|CR711074.2|CNS0GBM6 Tetraodon nigroviridis full-length cDNA	42	0.95
125	emb|CR710328.2|CNS0GB1G Tetraodon nigroviridis full-length cDNA	42	0.95
126	emb|CR710197.2|CNS0GAXT Tetraodon nigroviridis full-length cDNA	42	0.95
127	emb|CR710165.2|CNS0GAWX Tetraodon nigroviridis full-length cDNA	42	0.95
128	emb|CR709755.2|CNS0GALJ Tetraodon nigroviridis full-length cDNA	42	0.95
129	emb|CR709637.2|CNS0GAI9 Tetraodon nigroviridis full-length cDNA	42	0.95
130	emb|CR708154.2|CNS0G9D2 Tetraodon nigroviridis full-length cDNA	42	0.95
131	emb|CR707639.2|CNS0G8YR Tetraodon nigroviridis full-length cDNA	42	0.95
132	emb|CR707158.2|CNS0G8LE Tetraodon nigroviridis full-length cDNA	42	0.95
133	emb|CR706075.2|CNS0G7RB Tetraodon nigroviridis full-length cDNA	42	0.95
134	emb|CR705816.2|CNS0G7K4 Tetraodon nigroviridis full-length cDNA	42	0.95
135	emb|CR705749.2|CNS0G7I9 Tetraodon nigroviridis full-length cDNA	42	0.95
136	emb|CR705576.2|CNS0G7DG Tetraodon nigroviridis full-length cDNA	42	0.95
137	emb|CR705447.2|CNS0G79V Tetraodon nigroviridis full-length cDNA	42	0.95
138	emb|CR705159.2|CNS0G71V Tetraodon nigroviridis full-length cDNA	42	0.95
139	emb|CR703372.2|CNS0G5O8 Tetraodon nigroviridis full-length cDNA	42	0.95
140	emb|CR703049.2|CNS0G5F9 Tetraodon nigroviridis full-length cDNA	42	0.95
141	emb|CR702705.2|CNS0G55P Tetraodon nigroviridis full-length cDNA	42	0.95
142	emb|CR701243.2|CNS0G413 Tetraodon nigroviridis full-length cDNA	42	0.95
143	emb|CR701137.2|CNS0G3Y5 Tetraodon nigroviridis full-length cDNA	42	0.95
144	emb|CR700155.2|CNS0G36V Tetraodon nigroviridis full-length cDNA	42	0.95
145	emb|CR699988.2|CNS0G328 Tetraodon nigroviridis full-length cDNA	42	0.95
146	emb|CR699071.2|CNS0G2CR Tetraodon nigroviridis full-length cDNA	42	0.95
147	emb|CR698906.2|CNS0G286 Tetraodon nigroviridis full-length cDNA	42	0.95
148	emb|CR698811.2|CNS0G25J Tetraodon nigroviridis full-length cDNA	42	0.95
149	emb|CR698131.2|CNS0G1MN Tetraodon nigroviridis full-length cDNA	42	0.95
150	emb|CR697519.2|CNS0G15N Tetraodon nigroviridis full-length cDNA	42	0.95
151	emb|CR697678.2|CNS0G1A2 Tetraodon nigroviridis full-length cDNA	42	0.95
152	emb|CR697078.2|CNS0G0TE Tetraodon nigroviridis full-length cDNA	42	0.95
153	emb|CR696465.2|CNS0G0CD Tetraodon nigroviridis full-length cDNA	42	0.95
154	emb|CR695696.2|CNS0FZR0 Tetraodon nigroviridis full-length cDNA	42	0.95
155	emb|CR695158.2|CNS0FZC2 Tetraodon nigroviridis full-length cDNA	42	0.95
156	emb|CR694919.2|CNS0FZ5F Tetraodon nigroviridis full-length cDNA	42	0.95
157	emb|CR694817.2|CNS0FZ2L Tetraodon nigroviridis full-length cDNA	42	0.95
158	emb|CR694401.2|CNS0FYR1 Tetraodon nigroviridis full-length cDNA	42	0.95
159	emb|CR694394.2|CNS0FYQU Tetraodon nigroviridis full-length cDNA	42	0.95
160	emb|CR693496.2|CNS0FY1W Tetraodon nigroviridis full-length cDNA	42	0.95
161	emb|CR692707.2|CNS0FXFZ Tetraodon nigroviridis full-length cDNA	42	0.95
162	emb|CR690835.2|CNS0FVZZ Tetraodon nigroviridis full-length cDNA	42	0.95
163	emb|CR690523.2|CNS0FVRB Tetraodon nigroviridis full-length cDNA	42	0.95
164	emb|CR690410.2|CNS0FVO6 Tetraodon nigroviridis full-length cDNA	42	0.95
165	emb|CR690209.2|CNS0FVIL Tetraodon nigroviridis full-length cDNA	42	0.95
166	emb|CR690153.2|CNS0FVH1 Tetraodon nigroviridis full-length cDNA	42	0.95
167	emb|CR689667.2|CNS0FV3J Tetraodon nigroviridis full-length cDNA	42	0.95
168	emb|CR689556.2|CNS0FV0G Tetraodon nigroviridis full-length cDNA	42	0.95
169	emb|CR688595.2|CNS0FU9R Tetraodon nigroviridis full-length cDNA	42	0.95
170	emb|CR688085.2|CNS0FTVL Tetraodon nigroviridis full-length cDNA	42	0.95
171	emb|CR687197.2|CNS0FT6X Tetraodon nigroviridis full-length cDNA	42	0.95
172	emb|CR687158.2|CNS0FT5U Tetraodon nigroviridis full-length cDNA	42	0.95
173	emb|CR687062.2|CNS0FT36 Tetraodon nigroviridis full-length cDNA	42	0.95
174	emb|CR686995.2|CNS0FT1B Tetraodon nigroviridis full-length cDNA	42	0.95
175	emb|CR686123.2|CNS0FSD3 Tetraodon nigroviridis full-length cDNA	42	0.95
176	emb|CR685444.2|CNS0FRU8 Tetraodon nigroviridis full-length cDNA	42	0.95
177	emb|CR684092.2|CNS0FQSO Tetraodon nigroviridis full-length cDNA	42	0.95
178	emb|CR683582.2|CNS0FQEI Tetraodon nigroviridis full-length cDNA	42	0.95
179	emb|CR682167.2|CNS0FPB7 Tetraodon nigroviridis full-length cDNA	42	0.95
180	emb|CR681765.2|CNS0FP01 Tetraodon nigroviridis full-length cDNA	42	0.95
181	emb|CR681001.2|CNS0FOET Tetraodon nigroviridis full-length cDNA	42	0.95
182	emb|CR680447.2|CNS0FNZF Tetraodon nigroviridis full-length cDNA	42	0.95
183	emb|CR680257.2|CNS0FNU5 Tetraodon nigroviridis full-length cDNA	42	0.95
184	emb|CR680229.2|CNS0FNTD Tetraodon nigroviridis full-length cDNA	42	0.95
185	emb|CR680029.2|CNS0FNNT Tetraodon nigroviridis full-length cDNA	42	0.95
186	emb|CR680002.2|CNS0FNN2 Tetraodon nigroviridis full-length cDNA	42	0.95
187	emb|CR679345.2|CNS0FN4T Tetraodon nigroviridis full-length cDNA	42	0.95
188	emb|CR679485.2|CNS0FN8P Tetraodon nigroviridis full-length cDNA	42	0.95
189	emb|CR678807.2|CNS0FMPV Tetraodon nigroviridis full-length cDNA	42	0.95
190	emb|CR678806.2|CNS0FMPU Tetraodon nigroviridis full-length cDNA	42	0.95
191	emb|CR677485.2|CNS0FLPL Tetraodon nigroviridis full-length cDNA	42	0.95
192	emb|CR677349.2|CNS0FLLT Tetraodon nigroviridis full-length cDNA	42	0.95
193	emb|CR677233.2|CNS0FLIL Tetraodon nigroviridis full-length cDNA	42	0.95
194	emb|CR677134.2|CNS0FLFU Tetraodon nigroviridis full-length cDNA	42	0.95
195	emb|CR676498.2|CNS0FKY6 Tetraodon nigroviridis full-length cDNA	42	0.95
196	emb|CR676452.2|CNS0FKWW Tetraodon nigroviridis full-length cDNA	42	0.95
197	emb|CR676335.2|CNS0FKTN Tetraodon nigroviridis full-length cDNA	42	0.95
198	emb|CR676204.2|CNS0FKQ0 Tetraodon nigroviridis full-length cDNA	42	0.95
199	emb|CR676066.2|CNS0FKMG Tetraodon nigroviridis full-length cDNA	42	0.95
200	emb|CR675695.2|CNS0FKC5 Tetraodon nigroviridis full-length cDNA	42	0.95
201	emb|CR675346.2|CNS0FK2G Tetraodon nigroviridis full-length cDNA	42	0.95
202	emb|CR675343.2|CNS0FK2D Tetraodon nigroviridis full-length cDNA	42	0.95
203	emb|CR675169.2|CNS0FJXJ Tetraodon nigroviridis full-length cDNA	42	0.95
204	emb|CR675495.2|CNS0FK6L Tetraodon nigroviridis full-length cDNA	42	0.95
205	emb|CR675401.2|CNS0FK3Z Tetraodon nigroviridis full-length cDNA	42	0.95
206	emb|CR674719.2|CNS0FJL1 Tetraodon nigroviridis full-length cDNA	42	0.95
207	emb|CR674663.2|CNS0FJJH Tetraodon nigroviridis full-length cDNA	42	0.95
208	emb|CR674602.2|CNS0FJHS Tetraodon nigroviridis full-length cDNA	42	0.95
209	emb|CR673831.2|CNS0FIWD Tetraodon nigroviridis full-length cDNA	42	0.95
210	emb|CR673802.2|CNS0FIVK Tetraodon nigroviridis full-length cDNA	42	0.95
211	emb|CR673176.2|CNS0FIE6 Tetraodon nigroviridis full-length cDNA	42	0.95
212	emb|CR672844.2|CNS0FI4Y Tetraodon nigroviridis full-length cDNA	42	0.95
213	emb|CR672753.2|CNS0FI2F Tetraodon nigroviridis full-length cDNA	42	0.95
214	emb|CR672663.2|CNS0FHZX Tetraodon nigroviridis full-length cDNA	42	0.95
215	emb|CR672176.2|CNS0FHME Tetraodon nigroviridis full-length cDNA	42	0.95
216	emb|CR672248.2|CNS0FHOE Tetraodon nigroviridis full-length cDNA	42	0.95
217	emb|CR671591.2|CNS0FH65 Tetraodon nigroviridis full-length cDNA	42	0.95
218	emb|CR671897.2|CNS0FHEN Tetraodon nigroviridis full-length cDNA	42	0.95
219	emb|CR671079.2|CNS0FGRX Tetraodon nigroviridis full-length cDNA	42	0.95
220	emb|CR671508.2|CNS0FH3U Tetraodon nigroviridis full-length cDNA	42	0.95
221	emb|CR671422.2|CNS0FH1G Tetraodon nigroviridis full-length cDNA	42	0.95
222	emb|CR671362.2|CNS0FGZS Tetraodon nigroviridis full-length cDNA	42	0.95
223	emb|CR671274.2|CNS0FGXC Tetraodon nigroviridis full-length cDNA	42	0.95
224	emb|CR670789.2|CNS0FGJV Tetraodon nigroviridis full-length cDNA	42	0.95
225	emb|CR670891.1|CNS0FGMP Tetraodon nigroviridis full-length cDNA	42	0.95
226	emb|CR670277.2|CNS0FG5N Tetraodon nigroviridis full-length cDNA	42	0.95
227	emb|CR670098.2|CNS0FG0O Tetraodon nigroviridis full-length cDNA	42	0.95
228	emb|CR670040.2|CNS0FFZ2 Tetraodon nigroviridis full-length cDNA	42	0.95
229	emb|CR669953.2|CNS0FFWN Tetraodon nigroviridis full-length cDNA	42	0.95
230	emb|CR669839.2|CNS0FFTH Tetraodon nigroviridis full-length cDNA	42	0.95
231	emb|CR669837.2|CNS0FFTF Tetraodon nigroviridis full-length cDNA	42	0.95
232	emb|CR669733.2|CNS0FFQJ Tetraodon nigroviridis full-length cDNA	42	0.95
233	emb|CR669429.2|CNS0FFI3 Tetraodon nigroviridis full-length cDNA	42	0.95
234	emb|CR669106.2|CNS0FF94 Tetraodon nigroviridis full-length cDNA	42	0.95
235	emb|CR669069.2|CNS0FF83 Tetraodon nigroviridis full-length cDNA	42	0.95
236	emb|CR668997.2|CNS0FF63 Tetraodon nigroviridis full-length cDNA	42	0.95
237	emb|CR668957.2|CNS0FF4Z Tetraodon nigroviridis full-length cDNA	42	0.95
238	emb|CR668563.2|CNS0FEU1 Tetraodon nigroviridis full-length cDNA	42	0.95
239	emb|CR668271.2|CNS0FELX Tetraodon nigroviridis full-length cDNA	42	0.95
240	emb|CR668260.2|CNS0FELM Tetraodon nigroviridis full-length cDNA	42	0.95
241	emb|CR668169.2|CNS0FEJ3 Tetraodon nigroviridis full-length cDNA	42	0.95
242	emb|CR668093.2|CNS0FEGZ Tetraodon nigroviridis full-length cDNA	42	0.95
243	emb|CR667940.2|CNS0FECQ Tetraodon nigroviridis full-length cDNA	42	0.95
244	emb|CR668199.1|CNS0FEJX Tetraodon nigroviridis full-length cDNA	42	0.95
245	emb|CR667497.2|CNS0FE0F Tetraodon nigroviridis full-length cDNA	42	0.95
246	emb|CR667461.2|CNS0FDZF Tetraodon nigroviridis full-length cDNA	42	0.95
247	emb|CR667328.2|CNS0FDVQ Tetraodon nigroviridis full-length cDNA	42	0.95
248	emb|CR667777.1|CNS0FE87 Tetraodon nigroviridis full-length cDNA	42	0.95
249	emb|CR666842.2|CNS0FDI8 Tetraodon nigroviridis full-length cDNA	42	0.95
250	emb|CR667060.2|CNS0FDOA Tetraodon nigroviridis full-length cDNA	42	0.95
251	emb|CR666791.2|CNS0FDGT Tetraodon nigroviridis full-length cDNA	42	0.95
252	emb|CR664669.2|CNS0FBTV Tetraodon nigroviridis full-length cDNA	42	0.95
253	emb|CR666563.2|CNS0FDAH Tetraodon nigroviridis full-length cDNA	42	0.95
254	emb|CR666171.2|CNS0FCZL Tetraodon nigroviridis full-length cDNA	42	0.95
255	emb|CR666164.2|CNS0FCZE Tetraodon nigroviridis full-length cDNA	42	0.95
256	emb|CR666078.2|CNS0FCX0 Tetraodon nigroviridis full-length cDNA	42	0.95
257	emb|CR666023.2|CNS0FCVH Tetraodon nigroviridis full-length cDNA	42	0.95
258	emb|CR665923.2|CNS0FCSP Tetraodon nigroviridis full-length cDNA	42	0.95
259	emb|CR665918.2|CNS0FCSK Tetraodon nigroviridis full-length cDNA	42	0.95
260	emb|CR665611.2|CNS0FCK1 Tetraodon nigroviridis full-length cDNA	42	0.95
261	emb|CR665502.2|CNS0FCH0 Tetraodon nigroviridis full-length cDNA	42	0.95
262	emb|CR665489.2|CNS0FCGN Tetraodon nigroviridis full-length cDNA	42	0.95
263	emb|CR665370.2|CNS0FCDC Tetraodon nigroviridis full-length cDNA	42	0.95
264	emb|CR665361.2|CNS0FCD3 Tetraodon nigroviridis full-length cDNA	42	0.95
265	emb|CR665316.2|CNS0FCBU Tetraodon nigroviridis full-length cDNA	42	0.95
266	emb|CR665004.2|CNS0FC36 Tetraodon nigroviridis full-length cDNA	42	0.95
267	emb|CR664817.2|CNS0FBXZ Tetraodon nigroviridis full-length cDNA	42	0.95
268	emb|CR664279.2|CNS0FBJ1 Tetraodon nigroviridis full-length cDNA	42	0.95
269	emb|CR663724.2|CNS0FB3M Tetraodon nigroviridis full-length cDNA	42	0.95
270	emb|CR663301.2|CNS0FARV Tetraodon nigroviridis full-length cDNA	42	0.95
271	emb|CR663512.2|CNS0FAXQ Tetraodon nigroviridis full-length cDNA	42	0.95
272	emb|CR663223.2|CNS0FAPP Tetraodon nigroviridis full-length cDNA	42	0.95
273	emb|CR663193.2|CNS0FAOV Tetraodon nigroviridis full-length cDNA	42	0.95
274	emb|CR663019.2|CNS0FAK1 Tetraodon nigroviridis full-length cDNA	42	0.95
275	emb|CR662961.2|CNS0FAIF Tetraodon nigroviridis full-length cDNA	42	0.95
276	emb|CR662321.2|CNS0FA0N Tetraodon nigroviridis full-length cDNA	42	0.95
277	emb|CR662286.2|CNS0F9ZO Tetraodon nigroviridis full-length cDNA	42	0.95
278	emb|CR662097.2|CNS0F9UF Tetraodon nigroviridis full-length cDNA	42	0.95
279	emb|CR662093.2|CNS0F9UB Tetraodon nigroviridis full-length cDNA	42	0.95
280	emb|CR661909.2|CNS0F9P7 Tetraodon nigroviridis full-length cDNA	42	0.95
281	emb|CR661030.2|CNS0F90S Tetraodon nigroviridis full-length cDNA	42	0.95
282	emb|CR660684.2|CNS0F8R6 Tetraodon nigroviridis full-length cDNA	42	0.95
283	emb|CR660572.2|CNS0F8O2 Tetraodon nigroviridis full-length cDNA	42	0.95
284	emb|CR660538.2|CNS0F8N4 Tetraodon nigroviridis full-length cDNA	42	0.95
285	emb|CR660019.2|CNS0F88P Tetraodon nigroviridis full-length cDNA	42	0.95
286	emb|CR659910.2|CNS0F85O Tetraodon nigroviridis full-length cDNA	42	0.95
287	emb|CR659267.2|CNS0F7NT Tetraodon nigroviridis full-length cDNA	42	0.95
288	emb|CR659146.2|CNS0F7KG Tetraodon nigroviridis full-length cDNA	42	0.95
289	emb|CR659518.2|CNS0F7US Tetraodon nigroviridis full-length cDNA	42	0.95
290	emb|CR658974.2|CNS0F7FO Tetraodon nigroviridis full-length cDNA	42	0.95
291	emb|CR658435.2|CNS0F70P Tetraodon nigroviridis full-length cDNA	42	0.95
292	emb|CR658273.2|CNS0F6W7 Tetraodon nigroviridis full-length cDNA	42	0.95
293	emb|CR657199.2|CNS0F62D Tetraodon nigroviridis full-length cDNA	42	0.95
294	emb|CR657591.2|CNS0F6D9 Tetraodon nigroviridis full-length cDNA	42	0.95
295	emb|CR657547.2|CNS0F6C1 Tetraodon nigroviridis full-length cDNA	42	0.95
296	emb|CR657462.2|CNS0F69O Tetraodon nigroviridis full-length cDNA	42	0.95
297	emb|CR657273.2|CNS0F64F Tetraodon nigroviridis full-length cDNA	42	0.95
298	emb|CR656782.2|CNS0F5QS Tetraodon nigroviridis full-length cDNA	42	0.95
299	emb|CR656777.2|CNS0F5QN Tetraodon nigroviridis full-length cDNA	42	0.95
300	emb|CR656710.2|CNS0F5OS Tetraodon nigroviridis full-length cDNA	42	0.95
301	emb|CR656673.2|CNS0F5NR Tetraodon nigroviridis full-length cDNA	42	0.95
302	emb|CR656555.2|CNS0F5KH Tetraodon nigroviridis full-length cDNA	42	0.95
303	emb|CR655798.2|CNS0F4ZG Tetraodon nigroviridis full-length cDNA	42	0.95
304	emb|CR655381.2|CNS0F4NV Tetraodon nigroviridis full-length cDNA	42	0.95
305	emb|CR655053.2|CNS0F4ER Tetraodon nigroviridis full-length cDNA	42	0.95
306	emb|CR653142.2|CNS0F2XO Tetraodon nigroviridis full-length cDNA	42	0.95
307	emb|CR654744.2|CNS0F466 Tetraodon nigroviridis full-length cDNA	42	0.95
308	emb|CR654004.2|CNS0F3LM Tetraodon nigroviridis full-length cDNA	42	0.95
309	emb|CR653905.2|CNS0F3IV Tetraodon nigroviridis full-length cDNA	42	0.95
310	emb|CR653852.2|CNS0F3HE Tetraodon nigroviridis full-length cDNA	42	0.95
311	emb|CR653645.2|CNS0F3BN Tetraodon nigroviridis full-length cDNA	42	0.95
312	emb|CR653566.2|CNS0F39G Tetraodon nigroviridis full-length cDNA	42	0.95
313	emb|CR652961.2|CNS0F2SN Tetraodon nigroviridis full-length cDNA	42	0.95
314	emb|CR652941.2|CNS0F2S3 Tetraodon nigroviridis full-length cDNA	42	0.95
315	emb|CR652354.2|CNS0F2BS Tetraodon nigroviridis full-length cDNA	42	0.95
316	emb|CR652870.2|CNS0F2Q4 Tetraodon nigroviridis full-length cDNA	42	0.95
317	emb|CR652819.2|CNS0F2OP Tetraodon nigroviridis full-length cDNA	42	0.95
318	emb|CR652241.2|CNS0F28N Tetraodon nigroviridis full-length cDNA	42	0.95
319	emb|CR651859.2|CNS0F1Y1 Tetraodon nigroviridis full-length cDNA	42	0.95
320	emb|CR651541.2|CNS0F1P7 Tetraodon nigroviridis full-length cDNA	42	0.95
321	emb|CR651307.2|CNS0F1IP Tetraodon nigroviridis full-length cDNA	42	0.95
322	emb|CR650800.2|CNS0F14M Tetraodon nigroviridis full-length cDNA	42	0.95
323	emb|CR650707.2|CNS0F121 Tetraodon nigroviridis full-length cDNA	42	0.95
324	emb|CR651047.2|CNS0F1BH Tetraodon nigroviridis full-length cDNA	42	0.95
325	emb|CR650647.2|CNS0F10D Tetraodon nigroviridis full-length cDNA	42	0.95
326	emb|CR650521.2|CNS0F0WV Tetraodon nigroviridis full-length cDNA	42	0.95
327	emb|CR649977.2|CNS0F0HR Tetraodon nigroviridis full-length cDNA	42	0.95
328	emb|CR650188.2|CNS0F0NM Tetraodon nigroviridis full-length cDNA	42	0.95
329	emb|CR650068.2|CNS0F0KA Tetraodon nigroviridis full-length cDNA	42	0.95
330	emb|CR649392.2|CNS0F01I Tetraodon nigroviridis full-length cDNA	42	0.95
331	emb|CR649352.2|CNS0F00E Tetraodon nigroviridis full-length cDNA	42	0.95
332	emb|CR649011.2|CNS0EZQX Tetraodon nigroviridis full-length cDNA	42	0.95
333	emb|CR648370.2|CNS0EZ94 Tetraodon nigroviridis full-length cDNA	42	0.95
334	emb|CR648324.2|CNS0EZ7U Tetraodon nigroviridis full-length cDNA	42	0.95
335	emb|CR647879.2|CNS0EYVH Tetraodon nigroviridis full-length cDNA	42	0.95
336	emb|CR647776.2|CNS0EYSM Tetraodon nigroviridis full-length cDNA	42	0.95
337	emb|CR647613.2|CNS0EYO3 Tetraodon nigroviridis full-length cDNA	42	0.95
338	emb|CR643192.2|CNS0EV9A Tetraodon nigroviridis full-length cDNA	42	0.95
339	emb|CR643110.2|CNS0EV70 Tetraodon nigroviridis full-length cDNA	42	0.95
340	emb|CR643103.2|CNS0EV6T Tetraodon nigroviridis full-length cDNA	42	0.95
341	emb|CR646362.2|CNS0EXPC Tetraodon nigroviridis full-length cDNA	42	0.95
342	emb|CR646291.2|CNS0EXND Tetraodon nigroviridis full-length cDNA	42	0.95
343	emb|CR645521.2|CNS0EX1Z Tetraodon nigroviridis full-length cDNA	42	0.95
344	emb|CR644605.2|CNS0EWCJ Tetraodon nigroviridis full-length cDNA	42	0.95
345	emb|CR644028.2|CNS0EVWI Tetraodon nigroviridis full-length cDNA	42	0.95
346	emb|CR643849.2|CNS0EVRJ Tetraodon nigroviridis full-length cDNA	42	0.95
347	emb|CR641568.2|CNS0EU06 Tetraodon nigroviridis full-length cDNA	42	0.95
348	emb|CR641877.2|CNS0EU8R Tetraodon nigroviridis full-length cDNA	42	0.95
349	emb|CR641748.2|CNS0EU56 Tetraodon nigroviridis full-length cDNA	42	0.95
350	emb|CR641656.2|CNS0EU2M Tetraodon nigroviridis full-length cDNA	42	0.95
351	emb|CR641071.2|CNS0ETMD Tetraodon nigroviridis full-length cDNA	42	0.95
352	emb|CR641003.2|CNS0ETKH Tetraodon nigroviridis full-length cDNA	42	0.95
353	emb|CR640182.2|CNS0ESXO Tetraodon nigroviridis full-length cDNA	42	0.95
354	emb|CR640114.2|CNS0ESVS Tetraodon nigroviridis full-length cDNA	42	0.95
355	emb|CR639769.2|CNS0ESM7 Tetraodon nigroviridis full-length cDNA	42	0.95
356	emb|CR639221.2|CNS0ES6Z Tetraodon nigroviridis full-length cDNA	42	0.95
357	emb|CR638492.2|CNS0ERMQ Tetraodon nigroviridis full-length cDNA	42	0.95
358	emb|CR638363.2|CNS0ERJ5 Tetraodon nigroviridis full-length cDNA	42	0.95
359	emb|CR638901.2|CNS0ERY3 Tetraodon nigroviridis full-length cDNA	42	0.95
360	emb|CR638882.2|CNS0ERXK Tetraodon nigroviridis full-length cDNA	42	0.95
361	emb|CR638713.2|CNS0ERSV Tetraodon nigroviridis full-length cDNA	42	0.95
362	emb|CR638258.2|CNS0ERG8 Tetraodon nigroviridis full-length cDNA	42	0.95
363	emb|CR638133.2|CNS0ERCR Tetraodon nigroviridis full-length cDNA	42	0.95
364	emb|CR638038.2|CNS0ERA4 Tetraodon nigroviridis full-length cDNA	42	0.95
365	emb|CR637933.2|CNS0ER77 Tetraodon nigroviridis full-length cDNA	42	0.95
366	emb|CR637286.2|CNS0EQP8 Tetraodon nigroviridis full-length cDNA	42	0.95
367	emb|CR637268.2|CNS0EQOQ Tetraodon nigroviridis full-length cDNA	42	0.95
368	emb|CR637208.2|CNS0EQN2 Tetraodon nigroviridis full-length cDNA	42	0.95
369	emb|CR637135.2|CNS0EQL1 Tetraodon nigroviridis full-length cDNA	42	0.95
370	emb|CR637097.2|CNS0EQJZ Tetraodon nigroviridis full-length cDNA	42	0.95
371	emb|CR637610.2|CNS0EQY8 Tetraodon nigroviridis full-length cDNA	42	0.95
372	emb|CR637465.2|CNS0EQU7 Tetraodon nigroviridis full-length cDNA	42	0.95
373	emb|CR637069.2|CNS0EQJ7 Tetraodon nigroviridis full-length cDNA	42	0.95
374	emb|CR636783.2|CNS0EQB9 Tetraodon nigroviridis full-length cDNA	42	0.95
375	emb|CR636711.2|CNS0EQ99 Tetraodon nigroviridis full-length cDNA	42	0.95
376	emb|CR635948.2|CNS0EPO2 Tetraodon nigroviridis full-length cDNA	42	0.95
377	emb|CR635813.2|CNS0EPKB Tetraodon nigroviridis full-length cDNA	42	0.95
378	emb|CR635788.2|CNS0EPJM Tetraodon nigroviridis full-length cDNA	42	0.95
379	emb|CR635682.2|CNS0EPGO Tetraodon nigroviridis full-length cDNA	42	0.95
380	emb|CR634870.2|CNS0EOU4 Tetraodon nigroviridis full-length cDNA	42	0.95
381	emb|CR634780.2|CNS0EORM Tetraodon nigroviridis full-length cDNA	42	0.95
382	emb|CR634607.2|CNS0EOMT Tetraodon nigroviridis full-length cDNA	42	0.95
383	emb|CR634551.2|CNS0EOL9 Tetraodon nigroviridis full-length cDNA	42	0.95
384	emb|CR634499.2|CNS0EOJT Tetraodon nigroviridis full-length cDNA	42	0.95
385	emb|CR632759.2|CNS0EN7H Tetraodon nigroviridis full-length cDNA	42	0.95
386	emb|CR632745.2|CNS0EN73 Tetraodon nigroviridis full-length cDNA	42	0.95
387	emb|CR632742.2|CNS0EN70 Tetraodon nigroviridis full-length cDNA	42	0.95
388	emb|CR633640.2|CNS0ENVY Tetraodon nigroviridis full-length cDNA	42	0.95
389	emb|CR633041.2|CNS0ENFB Tetraodon nigroviridis full-length cDNA	42	0.95
390	emb|CR632347.2|CNS0EMW1 Tetraodon nigroviridis full-length cDNA	42	0.95
391	emb|CR632067.2|CNS0EMO9 Tetraodon nigroviridis full-length cDNA	42	0.95
392	emb|CR631313.2|CNS0EM3A Tetraodon nigroviridis full-length cDNA	42	0.95
393	emb|CR631726.2|CNS0EMES Tetraodon nigroviridis full-length cDNA	42	0.95
394	emb|CR631717.2|CNS0EMEJ Tetraodon nigroviridis full-length cDNA	42	0.95
395	emb|CR631604.2|CNS0EMBE Tetraodon nigroviridis full-length cDNA	42	0.95
396	dbj|AB084669.1| Nicotiana tabacum NtWAF mRNA for hypothetical pr...	42	0.95
397	gb|AC093757.3| Homo sapiens BAC clone RP11-62B7 from 4, complete...	42	0.95
398	gb|AC079150.3| Homo sapiens BAC clone RP11-155F11 from 2, comple...	42	0.95
399	gb|AY909398.1| Siniperca chuatsi clone C123 ribosomal protein L7...	42	0.95
400	gb|BC107515.1| Danio rerio ribosomal protein L7, mRNA (cDNA clon...	42	0.95
401	emb|AL691419.10| Mouse DNA sequence from clone RP23-95I4 on chro...	42	0.95
402	ref|XM_517693.1| PREDICTED: Pan troglodytes similar to ribosomal...	40	3.8
403	emb|CR723216.2|CNS0GKZA Tetraodon nigroviridis full-length cDNA	40	3.8
404	gb|AC061999.6| Homo sapiens chromosome 11, clone RP11-545D22, co...	40	3.8
405	gb|AC069144.9|AC069144 Arabidopsis thaliana chromosome 1 BAC F14...	40	3.8
406	ref|XM_574483.1| PREDICTED: Rattus norvegicus similar to 60S rib...	40	3.8
407	gb|AC064840.2|AC064840 Arabidopsis thaliana chromosome I BAC T24...	40	3.8
408	gb|AY961554.1| Lysiphlebus testaceipes ribosomal protein L7 isof...	40	3.8
409	dbj|AB025634.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	40	3.8
410	emb|X15109.1|DMRPHOM D.melanogaster mRNA fragment for ribosomal ...	40	3.8

---

>gb|AY846828.1| Triticum aestivum ribosomal protein L7 mRNA, complete cds
          Length = 787

 Score =  200 bits (101), Expect = 2e-48
 Identities = 170/195 (87%)
 Strand = Plus / Minus

                                                                       
Query: 93  tcaacctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtca 152
           ||||||||||||||||| || || ||||||||||||| |  ||||||||| || ||||||
Sbjct: 784 tcaacctagttcatccttctaacaagctggttgatgtagttctcacggttcccagcgtca 725

                                                                       
Query: 153 ccaccctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttg 212
           |||||||| ||||| ||||||||||| ||||| ||||| || ||||| ||||||||||||
Sbjct: 724 ccaccctcgacgtagtggttcctcttcttcttcaggccaccgagcggagccttgagcttg 665

                                                                       
Query: 213 aatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgg 272
           |||||||||||||||||| | |||||||| ||||| ||||| || ||||||||||| || 
Sbjct: 664 aatggccacaggaagttgttcgcctccttaaagtgtgggccgacggtcaagatctcgtgc 605

                          
Query: 273 acaacgtcttcaatg 287
           |||| ||| ||||||
Sbjct: 604 acaaggtcctcaatg 590

---

>gb|AY103677.1| Zea mays PCO099976 mRNA sequence
          Length = 1103

 Score =  192 bits (97), Expect = 4e-46
 Identities = 166/191 (86%)
 Strand = Plus / Minus

                                                                       
Query: 97  cctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccac 156
           |||||||||||||| ||| ||||| |||||||| |  ||||||||| ||||||||||| |
Sbjct: 849 cctagttcatcctcttgatgagctcgttgatgtagttctcacggtttccggcgtcaccgc 790

                                                                       
Query: 157 cctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatg 216
           |||| ||||| ||||||||||| ||||||||||| || || || ||||| |||||||| |
Sbjct: 789 cctccacgtagtggttcctcttcttcttgaggccgccgaggggtgccttcagcttgaacg 730

                                                                       
Query: 217 gccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaa 276
           |||| ||||||||| |||||||||||||||| ||||| ||||||| |||||| |||||||
Sbjct: 729 gccagaggaagttgttggcctccttgaagtgcgggccgaccgtcatgatctcgtggacaa 670

                      
Query: 277 cgtcttcaatg 287
            ||| ||||||
Sbjct: 669 ggtcctcaatg 659

---

>ref|XM_480842.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1084

 Score =  178 bits (90), Expect = 6e-42
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                       
Query: 97  cctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccac 156
           ||||||||||||||| || ||||| |||||||| | |||||||||||||||| |||||||
Sbjct: 794 cctagttcatcctccggatgagctcgttgatgtagtcctcacggttgccggcatcaccac 735

                                                                       
Query: 157 cctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatg 216
           |||| || || ||||||||||| ||||||||||| || || || ||||| | |||||| |
Sbjct: 734 cctcgacatagtggttcctcttcttcttgaggccaccgagtggtgccttcaacttgaagg 675

                                                                       
Query: 217 gccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaa 276
           |||||||||||||| |||||||||||||||| || || || |||| |||||| |||||||
Sbjct: 674 gccacaggaagttgttggcctccttgaagtgtggaccgacagtcatgatctcgtggacaa 615

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  178 bits (90), Expect = 6e-42
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                           
Query: 97      cctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccac 156
               ||||||||||||||| || ||||| |||||||| | |||||||||||||||| |||||||
Sbjct: 8149182 cctagttcatcctccggatgagctcgttgatgtagtcctcacggttgccggcatcaccac 8149123

                                                                           
Query: 157     cctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatg 216
               |||| || || ||||||||||| ||||||||||| || || || ||||| | |||||| |
Sbjct: 8149122 cctcgacatagtggttcctcttcttcttgaggccaccgagtggtgccttcaacttgaagg 8149063

                                                                           
Query: 217     gccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaa 276
               |||||||||||||| |||||||||||||||| || || || |||| |||||| |||||||
Sbjct: 8149062 gccacaggaagttgttggcctccttgaagtgtggaccgacagtcatgatctcgtggacaa 8149003

---

>dbj|AP005603.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:B1047A05
          Length = 157517

 Score =  178 bits (90), Expect = 6e-42
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                          
Query: 97     cctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccac 156
              ||||||||||||||| || ||||| |||||||| | |||||||||||||||| |||||||
Sbjct: 117493 cctagttcatcctccggatgagctcgttgatgtagtcctcacggttgccggcatcaccac 117434

                                                                          
Query: 157    cctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatg 216
              |||| || || ||||||||||| ||||||||||| || || || ||||| | |||||| |
Sbjct: 117433 cctcgacatagtggttcctcttcttcttgaggccaccgagtggtgccttcaacttgaagg 117374

                                                                          
Query: 217    gccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaa 276
              |||||||||||||| |||||||||||||||| || || || |||| |||||| |||||||
Sbjct: 117373 gccacaggaagttgttggcctccttgaagtgtggaccgacagtcatgatctcgtggacaa 117314

---

>dbj|AK102873.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033112B19, full
           insert sequence
          Length = 1084

 Score =  178 bits (90), Expect = 6e-42
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                       
Query: 97  cctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccac 156
           ||||||||||||||| || ||||| |||||||| | |||||||||||||||| |||||||
Sbjct: 794 cctagttcatcctccggatgagctcgttgatgtagtcctcacggttgccggcatcaccac 735

                                                                       
Query: 157 cctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatg 216
           |||| || || ||||||||||| ||||||||||| || || || ||||| | |||||| |
Sbjct: 734 cctcgacatagtggttcctcttcttcttgaggccaccgagtggtgccttcaacttgaagg 675

                                                                       
Query: 217 gccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaa 276
           |||||||||||||| |||||||||||||||| || || || |||| |||||| |||||||
Sbjct: 674 gccacaggaagttgttggcctccttgaagtgtggaccgacagtcatgatctcgtggacaa 615

---

>dbj|AK061680.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-A02, full
           insert sequence
          Length = 594

 Score =  178 bits (90), Expect = 6e-42
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                       
Query: 97  cctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccac 156
           ||||||||||||||| || ||||| |||||||| | |||||||||||||||| |||||||
Sbjct: 355 cctagttcatcctccggatgagctcgttgatgtagtcctcacggttgccggcatcaccac 296

                                                                       
Query: 157 cctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatg 216
           |||| || || ||||||||||| ||||||||||| || || || ||||| | |||||| |
Sbjct: 295 cctcgacatagtggttcctcttcttcttgaggccaccgagtggtgccttcaacttgaagg 236

                                                                       
Query: 217 gccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaa 276
           |||||||||||||| |||||||||||||||| || || || |||| |||||| |||||||
Sbjct: 235 gccacaggaagttgttggcctccttgaagtgtggaccgacagtcatgatctcgtggacaa 176

---

>gb|AY109992.1| Zea mays CL9168_1 mRNA sequence
          Length = 1226

 Score =  159 bits (80), Expect = 6e-36
 Identities = 155/182 (85%)
 Strand = Plus / Plus

                                                                       
Query: 95  aacctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcacc 154
           |||||| ||||||||  ||| |||||  ||||||| |  ||| ||||| ||||| |||||
Sbjct: 453 aacctaattcatccttttgatgagctcattgatgtagttctcgcggttaccggcatcacc 512

                                                                       
Query: 155 accctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaa 214
            ||||| || || ||||||||||| ||||| |||||||||||||||||||| | ||||||
Sbjct: 513 gccctccacatagtggttcctcttcttcttcaggcctcccagcggcgccttcaacttgaa 572

                                                                       
Query: 215 tggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggac 274
           |||||| ||||||||| |||||||||||||||| |||||||| |||| |||||| || ||
Sbjct: 573 tggccagaggaagttgttggcctccttgaagtgtgggccaacagtcatgatctcgtgaac 632

             
Query: 275 aa 276
           ||
Sbjct: 633 aa 634

---

>ref|XM_473801.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  153 bits (77), Expect = 4e-34
 Identities = 152/179 (84%)
 Strand = Plus / Minus

                                                                       
Query: 98  ctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccacc 157
           |||||||||||| |||| ||| | |||||||| |  ||||||||| || || ||||||||
Sbjct: 753 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 694

                                                                       
Query: 158 ctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatgg 217
           ||| ||||| ||||||||||| ||||| || || ||||| || ||||| |||||||||||
Sbjct: 693 ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 634

                                                                      
Query: 218 ccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaa 276
           ||| ||||||||| ||||||||||||| || |||||||| |||| |||||| || ||||
Sbjct: 633 ccagaggaagttgttggcctccttgaaatgtgggccaacagtcatgatctcatgaacaa 575

---

>emb|AL662996.3|OSJN00198 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0015N08,
              complete sequence
          Length = 129037

 Score =  153 bits (77), Expect = 4e-34
 Identities = 152/179 (84%)
 Strand = Plus / Minus

                                                                          
Query: 98     ctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccacc 157
              |||||||||||| |||| ||| | |||||||| |  ||||||||| || || ||||||||
Sbjct: 111788 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 111729

                                                                          
Query: 158    ctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatgg 217
              ||| ||||| ||||||||||| ||||| || || ||||| || ||||| |||||||||||
Sbjct: 111728 ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 111669

                                                                         
Query: 218    ccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaa 276
              ||| ||||||||| ||||||||||||| || |||||||| |||| |||||| || ||||
Sbjct: 111668 ccagaggaagttgttggcctccttgaaatgtgggccaacagtcatgatctcatgaacaa 111610

---

>emb|AL662968.3|OSJN00168 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0035M09,
             complete sequence
          Length = 152732

 Score =  153 bits (77), Expect = 4e-34
 Identities = 152/179 (84%)
 Strand = Plus / Minus

                                                                         
Query: 98    ctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccacc 157
             |||||||||||| |||| ||| | |||||||| |  ||||||||| || || ||||||||
Sbjct: 39811 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 39752

                                                                         
Query: 158   ctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatgg 217
             ||| ||||| ||||||||||| ||||| || || ||||| || ||||| |||||||||||
Sbjct: 39751 ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 39692

                                                                        
Query: 218   ccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaa 276
             ||| ||||||||| ||||||||||||| || |||||||| |||| |||||| || ||||
Sbjct: 39691 ccagaggaagttgttggcctccttgaaatgtgggccaacagtcatgatctcatgaacaa 39633

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  153 bits (77), Expect = 4e-34
 Identities = 152/179 (84%)
 Strand = Plus / Minus

                                                                            
Query: 98       ctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccacc 157
                |||||||||||| |||| ||| | |||||||| |  ||||||||| || || ||||||||
Sbjct: 30636080 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 30636021

                                                                            
Query: 158      ctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatgg 217
                ||| ||||| ||||||||||| ||||| || || ||||| || ||||| |||||||||||
Sbjct: 30636020 ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 30635961

                                                                           
Query: 218      ccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaa 276
                ||| ||||||||| ||||||||||||| || |||||||| |||| |||||| || ||||
Sbjct: 30635960 ccagaggaagttgttggcctccttgaaatgtgggccaacagtcatgatctcatgaacaa 30635902

---

>dbj|AK073472.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044G24, full
           insert sequence
          Length = 1040

 Score =  153 bits (77), Expect = 4e-34
 Identities = 152/179 (84%)
 Strand = Plus / Minus

                                                                       
Query: 98  ctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccacc 157
           |||||||||||| |||| ||| | |||||||| |  ||||||||| || || ||||||||
Sbjct: 850 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 791

                                                                       
Query: 158 ctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatgg 217
           ||| ||||| ||||||||||| ||||| || || ||||| || ||||| |||||||||||
Sbjct: 790 ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 731

                                                                      
Query: 218 ccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaa 276
           ||| ||||||||| ||||||||||||| || |||||||| |||| |||||| || ||||
Sbjct: 730 ccagaggaagttgttggcctccttgaaatgtgggccaacagtcatgatctcatgaacaa 672

---

>gb|BT017565.1| Zea mays clone EL01N0425H11.c mRNA sequence
          Length = 922

 Score =  151 bits (76), Expect = 1e-33
 Identities = 154/182 (84%)
 Strand = Plus / Minus

                                                                       
Query: 95  aacctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcacc 154
           |||||| ||||||||  ||| |||||  ||||||| |  ||| ||||| ||||| || ||
Sbjct: 733 aacctaattcatccttttgatgagctcattgatgtagttctcgcggttaccggcatcgcc 674

                                                                       
Query: 155 accctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaa 214
            ||||| || || ||||||||||| ||||| |||||||||||||||||||| | ||||||
Sbjct: 673 gccctccacatagtggttcctcttcttcttcaggcctcccagcggcgccttcaacttgaa 614

                                                                       
Query: 215 tggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggac 274
           |||||| ||||||||| |||||||||||||||| |||||||| |||| |||||| || ||
Sbjct: 613 tggccagaggaagttgttggcctccttgaagtgtgggccaacagtcatgatctcgtgaac 554

             
Query: 275 aa 276
           ||
Sbjct: 553 aa 552

---

>gb|BT016468.1| Zea mays clone Contig301 mRNA sequence
          Length = 1198

 Score =  143 bits (72), Expect = 3e-31
 Identities = 153/182 (84%)
 Strand = Plus / Minus

                                                                       
Query: 95  aacctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcacc 154
           |||||| ||||||||  ||| ||||| ||||||||    ||||||||| ||||| |||||
Sbjct: 785 aacctaattcatccttttgatgagctcgttgatgtaattctcacggttaccggcatcacc 726

                                                                       
Query: 155 accctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaa 214
           |||||| || || ||||||||||| ||||| || ||||||||||| ||||| ||||| ||
Sbjct: 725 accctccacatagtggttcctcttcttcttcagacctcccagcggggccttcagcttaaa 666

                                                                       
Query: 215 tggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggac 274
            ||||| ||||||||| | |||||||||||||| |||||||| |||| |||||| || ||
Sbjct: 665 aggccaaaggaagttgttcgcctccttgaagtgtgggccaacagtcatgatctcgtgaac 606

             
Query: 275 aa 276
           ||
Sbjct: 605 aa 604

---

>gb|AY104655.1| Zea mays PCO101521 mRNA sequence
          Length = 1155

 Score =  143 bits (72), Expect = 3e-31
 Identities = 153/182 (84%)
 Strand = Plus / Minus

                                                                       
Query: 95  aacctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcacc 154
           |||||| ||||||||  ||| ||||| ||||||||    ||||||||| ||||| |||||
Sbjct: 798 aacctaattcatccttttgatgagctcgttgatgtaattctcacggttaccggcatcacc 739

                                                                       
Query: 155 accctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaa 214
           |||||| || || ||||||||||| ||||| || ||||||||||| ||||| ||||| ||
Sbjct: 738 accctccacatagtggttcctcttcttcttcagacctcccagcggtgccttcagcttaaa 679

                                                                       
Query: 215 tggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggac 274
           |||||| ||||||||| | |||||||||||||| ||||| || |||| |||||| || ||
Sbjct: 678 tggccaaaggaagttgttcgcctccttgaagtgtgggccgacagtcatgatctcatgaac 619

             
Query: 275 aa 276
           ||
Sbjct: 618 aa 617

---

>dbj|D29720.1|RICYK33 Oryza sativa mRNA, partial homologous to ribosomal protein L7 gene
          Length = 297

 Score =  119 bits (60), Expect = 5e-24
 Identities = 118/139 (84%)
 Strand = Plus / Minus

                                                                       
Query: 98  ctagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccacc 157
           |||||||||||| |||| ||| | |||||||| |  ||||||||| || || ||||||||
Sbjct: 139 ctagttcatccttctgatgagttcgttgatgtagttctcacggttaccagcatcaccacc 80

                                                                       
Query: 158 ctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatgg 217
           ||| ||||| ||||||||||| ||||| || || ||||| || ||||| |||||||||||
Sbjct: 79  ctcaacgtagtggttcctcttcttcttcagcccacccagtggtgccttcagcttgaatgg 20

                              
Query: 218 ccacaggaagttgctggcc 236
           ||| ||||||||| |||||
Sbjct: 19  ccagaggaagttgttggcc 1

---

>ref|NM_126186.2| Arabidopsis thaliana structural constituent of ribosome /
           transcription regulator AT2G01250 mRNA, complete cds
          Length = 1051

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                       
Query: 102 ttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccctcn 161
           |||||||||||||  ||||  ||||||  |  ||||||||| ||||| |||||||| || 
Sbjct: 801 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 742

                                                                       
Query: 162 acgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggccac 221
           ||||| || || ||||| ||||||||||| || || || ||||| |||| ||||||||| 
Sbjct: 741 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 682

                                        
Query: 222 aggaagttgctggcctccttgaagtgagg 250
           ||||||||| |||| |||||||| |||||
Sbjct: 681 aggaagttgttggcttccttgaaatgagg 653

---

>gb|AY079328.1| Arabidopsis thaliana putative ribosomal protein L7 (At2g01250)
           mRNA, complete cds
          Length = 760

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                       
Query: 102 ttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccctcn 161
           |||||||||||||  ||||  ||||||  |  ||||||||| ||||| |||||||| || 
Sbjct: 725 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 666

                                                                       
Query: 162 acgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggccac 221
           ||||| || || ||||| ||||||||||| || || || ||||| |||| ||||||||| 
Sbjct: 665 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 606

                                        
Query: 222 aggaagttgctggcctccttgaagtgagg 250
           ||||||||| |||| |||||||| |||||
Sbjct: 605 aggaagttgttggcttccttgaaatgagg 577

---

>gb|AY045994.1| Arabidopsis thaliana putative ribosomal protein L7 (At2g01250)
           mRNA, complete cds
          Length = 960

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                       
Query: 102 ttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccctcn 161
           |||||||||||||  ||||  ||||||  |  ||||||||| ||||| |||||||| || 
Sbjct: 774 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 715

                                                                       
Query: 162 acgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggccac 221
           ||||| || || ||||| ||||||||||| || || || ||||| |||| ||||||||| 
Sbjct: 714 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 655

                                        
Query: 222 aggaagttgctggcctccttgaagtgagg 250
           ||||||||| |||| |||||||| |||||
Sbjct: 654 aggaagttgttggcttccttgaaatgagg 626

---

>gb|AC006200.3| Arabidopsis thaliana chromosome 2 clone F10A8 map rga, complete
             sequence
          Length = 94029

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 123/149 (82%)
 Strand = Plus / Plus

                                                                         
Query: 102   ttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccctcn 161
             |||||||||||||  ||||  ||||||  |  ||||||||| ||||| |||||||| || 
Sbjct: 42543 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 42602

                                                                         
Query: 162   acgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggccac 221
             ||||| || || ||||| ||||||||||| || || || ||||| |||| ||||||||| 
Sbjct: 42603 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 42662

                                          
Query: 222   aggaagttgctggcctccttgaagtgagg 250
             ||||||||| |||| |||||||| |||||
Sbjct: 42663 aggaagttgttggcttccttgaaatgagg 42691

---

>gb|AY081698.1| Arabidopsis thaliana 60S ribosomal protein L7 (At2g01250) mRNA,
           complete cds
          Length = 751

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                       
Query: 102 ttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccctcn 161
           |||||||||||||  ||||  ||||||  |  ||||||||| ||||| |||||||| || 
Sbjct: 725 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 666

                                                                       
Query: 162 acgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggccac 221
           ||||| || || ||||| ||||||||||| || || || ||||| |||| ||||||||| 
Sbjct: 665 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 606

                                        
Query: 222 aggaagttgctggcctccttgaagtgagg 250
           ||||||||| |||| |||||||| |||||
Sbjct: 605 aggaagttgttggcttccttgaaatgagg 577

---

>gb|AF370484.1|AF370484 Arabidopsis thaliana 60S ribosomal protein L7 (At2g01250; F10A8.13)
           mRNA, complete cds
          Length = 915

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                       
Query: 102 ttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccctcn 161
           |||||||||||||  ||||  ||||||  |  ||||||||| ||||| |||||||| || 
Sbjct: 772 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 713

                                                                       
Query: 162 acgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggccac 221
           ||||| || || ||||| ||||||||||| || || || ||||| |||| ||||||||| 
Sbjct: 712 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 653

                                        
Query: 222 aggaagttgctggcctccttgaagtgagg 250
           ||||||||| |||| |||||||| |||||
Sbjct: 652 aggaagttgttggcttccttgaaatgagg 624

---

>emb|BX818796.1|CNS0A9X8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB14ZB01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 889

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                       
Query: 102 ttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccctcn 161
           |||||||||||||  ||||  ||||||  |  ||||||||| ||||| |||||||| || 
Sbjct: 760 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 701

                                                                       
Query: 162 acgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggccac 221
           ||||| || || ||||| ||||||||||| || || || ||||| |||| ||||||||| 
Sbjct: 700 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 641

                                        
Query: 222 aggaagttgctggcctccttgaagtgagg 250
           ||||||||| |||| |||||||| |||||
Sbjct: 640 aggaagttgttggcttccttgaaatgagg 612

---

>gb|AY085139.1| Arabidopsis thaliana clone 13298 mRNA, complete sequence
          Length = 996

 Score = 99.6 bits (50), Expect = 5e-18
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                       
Query: 102 ttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccctcn 161
           |||||||||||||  ||||  ||||||  |  ||||||||| ||||| |||||||| || 
Sbjct: 801 ttcatcctcctgataagctcattgatgaagttctcacggtttccggcatcaccaccttcc 742

                                                                       
Query: 162 acgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggccac 221
           ||||| || || ||||| ||||||||||| || || || ||||| |||| ||||||||| 
Sbjct: 741 acgtagtgatttctcttcttcttgaggccacctagtggtgccttaagctggaatggccaa 682

                                        
Query: 222 aggaagttgctggcctccttgaagtgagg 250
           ||||||||| |||| |||||||| |||||
Sbjct: 681 aggaagttgttggcttccttgaaatgagg 653

---

>ref|NM_180079.1| Arabidopsis thaliana structural constituent of ribosome /
           transcription regulator AT2G44120 transcript variant
           AT2G44120.1 mRNA, complete cds
          Length = 981

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 104/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 tcaccaccctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagc 209
           |||||||| || ||||| ||||| ||||| ||||| ||||| || || || ||||| |  
Sbjct: 756 tcaccaccttcgacgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaat 697

                                                                       
Query: 210 ttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcn 269
           | ||||||||||||||||||| |||| |||||||||||||| ||||| |||| |||||| 
Sbjct: 696 tggaatggccacaggaagttgttggcttccttgaagtgaggtccaacagtcatgatctcg 637

               
Query: 270 tgga 273
           ||||
Sbjct: 636 tgga 633

---

>ref|NM_180080.1| Arabidopsis thaliana structural constituent of ribosome /
           transcription regulator AT2G44120 transcript variant
           AT2G44120.2 mRNA, complete cds
          Length = 1220

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 104/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 tcaccaccctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagc 209
           |||||||| || ||||| ||||| ||||| ||||| ||||| || || || ||||| |  
Sbjct: 983 tcaccaccttcgacgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaat 924

                                                                       
Query: 210 ttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcn 269
           | ||||||||||||||||||| |||| |||||||||||||| ||||| |||| |||||| 
Sbjct: 923 tggaatggccacaggaagttgttggcttccttgaagtgaggtccaacagtcatgatctcg 864

               
Query: 270 tgga 273
           ||||
Sbjct: 863 tgga 860

---

>gb|AC004005.3| Arabidopsis thaliana chromosome 2 clone F6E13 map CIC10F02, CIC02E07,
             complete sequence
          Length = 109741

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 104/124 (83%)
 Strand = Plus / Plus

                                                                         
Query: 150   tcaccaccctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagc 209
             |||||||| || ||||| ||||| ||||| ||||| ||||| || || || ||||| |  
Sbjct: 79546 tcaccaccttcgacgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaat 79605

                                                                         
Query: 210   ttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcn 269
             | ||||||||||||||||||| |||| |||||||||||||| ||||| |||| |||||| 
Sbjct: 79606 tggaatggccacaggaagttgttggcttccttgaagtgaggtccaacagtcatgatctcg 79665

                 
Query: 270   tgga 273
             ||||
Sbjct: 79666 tgga 79669

---

>gb|AY081474.1| Arabidopsis thaliana 60S ribosomal protein L7 (At2g44120) mRNA,
           complete cds
          Length = 782

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 104/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 tcaccaccctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagc 209
           |||||||| || ||||| ||||| ||||| ||||| ||||| || || || ||||| |  
Sbjct: 677 tcaccaccttcgacgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaat 618

                                                                       
Query: 210 ttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcn 269
           | ||||||||||||||||||| |||| |||||||||||||| ||||| |||| |||||| 
Sbjct: 617 tggaatggccacaggaagttgttggcttccttgaagtgaggtccaacagtcatgatctcg 558

               
Query: 270 tgga 273
           ||||
Sbjct: 557 tgga 554

---

>gb|AY065196.1| Arabidopsis thaliana 60S ribosomal protein L7 (F6E13.25; At2g44120)
           mRNA, complete cds
          Length = 888

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 104/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 tcaccaccctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagc 209
           |||||||| || ||||| ||||| ||||| ||||| ||||| || || || ||||| |  
Sbjct: 719 tcaccaccttcgacgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaat 660

                                                                       
Query: 210 ttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcn 269
           | ||||||||||||||||||| |||| |||||||||||||| ||||| |||| |||||| 
Sbjct: 659 tggaatggccacaggaagttgttggcttccttgaagtgaggtccaacagtcatgatctcg 600

               
Query: 270 tgga 273
           ||||
Sbjct: 599 tgga 596

---

>gb|AF446884.1|AF446884 Arabidopsis thaliana At2g44120/F6E13.25 mRNA, complete cds
          Length = 729

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 104/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 tcaccaccctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagc 209
           |||||||| || ||||| ||||| ||||| ||||| ||||| || || || ||||| |  
Sbjct: 677 tcaccaccttcgacgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaat 618

                                                                       
Query: 210 ttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcn 269
           | ||||||||||||||||||| |||| |||||||||||||| ||||| |||| |||||| 
Sbjct: 617 tggaatggccacaggaagttgttggcttccttgaagtgaggtccaacagtcatgatctcg 558

               
Query: 270 tgga 273
           ||||
Sbjct: 557 tgga 554

---

>gb|AY052724.1| Arabidopsis thaliana At2g44120/F6E13.25 mRNA, complete cds
          Length = 905

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 104/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 tcaccaccctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagc 209
           |||||||| || ||||| ||||| ||||| ||||| ||||| || || || ||||| |  
Sbjct: 719 tcaccaccttcgacgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaat 660

                                                                       
Query: 210 ttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcn 269
           | ||||||||||||||||||| |||| |||||||||||||| ||||| |||| |||||| 
Sbjct: 659 tggaatggccacaggaagttgttggcttccttgaagtgaggtccaacagtcatgatctcg 600

               
Query: 270 tgga 273
           ||||
Sbjct: 599 tgga 596

---

>gb|AY087583.1| Arabidopsis thaliana clone 36813 mRNA, complete sequence
          Length = 1221

 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 104/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 tcaccaccctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagc 209
           |||||||| || ||||| ||||| ||||| ||||| ||||| || || || ||||| |  
Sbjct: 983 tcaccaccttcgacgtagtggtttctcttcttcttaaggccaccgagtggtgccttcaat 924

                                                                       
Query: 210 ttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcn 269
           | ||||||||||||||||||| |||| |||||||||||||| ||||| |||| |||||| 
Sbjct: 923 tggaatggccacaggaagttgttggcttccttgaagtgaggtccaacagtcatgatctcg 864

               
Query: 270 tgga 273
           ||||
Sbjct: 863 tgga 860

---

>gb|BT002379.1| Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 955

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 tcaccaccctcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagc 209
           |||||||| || ||||| | ||| ||||| ||||| ||||| || || || ||||| |  
Sbjct: 752 tcaccaccttcgacgtagttgtttctcttcttcttaaggccaccgagtggtgccttcaat 693

                                                                       
Query: 210 ttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcn 269
           | ||||||||||||||||||| |||| |||||||||||||| ||||| |||| |||||| 
Sbjct: 692 tggaatggccacaggaagttgttggcttccttgaagtgaggtccaacagtcatgatctcg 633

               
Query: 270 tgga 273
           ||||
Sbjct: 632 tgga 629

---

>ref|NM_202576.1| Arabidopsis thaliana structural constituent of ribosome /
            transcription regulator AT3G13580 transcript variant
            AT3G13580.3 mRNA, complete cds
          Length = 1569

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 138/174 (79%)
 Strand = Plus / Minus

                                                                        
Query: 100  agttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccct 159
            ||||||| ||||| ||||||| |||||||  |  ||| ||||| || || || || || |
Sbjct: 1371 agttcattctcctaacgagctcgttgatgaagttctcgcggtttccagcatctcctcctt 1312

                                                                        
Query: 160  cnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggcc 219
            | ||||| ||||||||||| ||||| |  |||||||  || ||||| | || ||||||||
Sbjct: 1311 ccacgtaatggttcctcttcttcttcatccctcccaatggagccttcaactggaatggcc 1252

                                                                  
Query: 220  acaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
            |||  |||||  |||| |||||||| || || |||||||||| |||||| ||||
Sbjct: 1251 acaaaaagttattggcttccttgaaatgtggcccaaccgtcatgatctcatgga 1198

---

>ref|NM_202575.1| Arabidopsis thaliana structural constituent of ribosome /
            transcription regulator AT3G13580 transcript variant
            AT3G13580.2 mRNA, complete cds
          Length = 1225

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 138/174 (79%)
 Strand = Plus / Minus

                                                                        
Query: 100  agttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccct 159
            ||||||| ||||| ||||||| |||||||  |  ||| ||||| || || || || || |
Sbjct: 1027 agttcattctcctaacgagctcgttgatgaagttctcgcggtttccagcatctcctcctt 968

                                                                        
Query: 160  cnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggcc 219
            | ||||| ||||||||||| ||||| |  |||||||  || ||||| | || ||||||||
Sbjct: 967  ccacgtaatggttcctcttcttcttcatccctcccaatggagccttcaactggaatggcc 908

                                                                  
Query: 220  acaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
            |||  |||||  |||| |||||||| || || |||||||||| |||||| ||||
Sbjct: 907  acaaaaagttattggcttccttgaaatgtggcccaaccgtcatgatctcatgga 854

---

>ref|NM_112204.2| Arabidopsis thaliana structural constituent of ribosome /
           transcription regulator AT3G13580 transcript variant
           AT3G13580.1 mRNA, complete cds
          Length = 995

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 138/174 (79%)
 Strand = Plus / Minus

                                                                       
Query: 100 agttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccct 159
           ||||||| ||||| ||||||| |||||||  |  ||| ||||| || || || || || |
Sbjct: 797 agttcattctcctaacgagctcgttgatgaagttctcgcggtttccagcatctcctcctt 738

                                                                       
Query: 160 cnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggcc 219
           | ||||| ||||||||||| ||||| |  |||||||  || ||||| | || ||||||||
Sbjct: 737 ccacgtaatggttcctcttcttcttcatccctcccaatggagccttcaactggaatggcc 678

                                                                 
Query: 220 acaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
           |||  |||||  |||| |||||||| || || |||||||||| |||||| ||||
Sbjct: 677 acaaaaagttattggcttccttgaaatgtggcccaaccgtcatgatctcatgga 624

---

>gb|AY077675.1| Arabidopsis thaliana AT3g13580/K20M4_2 mRNA, complete cds
          Length = 735

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 138/174 (79%)
 Strand = Plus / Minus

                                                                       
Query: 100 agttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccct 159
           ||||||| ||||| ||||||| |||||||  |  ||| ||||| || || || || || |
Sbjct: 733 agttcattctcctaacgagctcgttgatgaagttctcgcggtttccagcatctcctcctt 674

                                                                       
Query: 160 cnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggcc 219
           | ||||| ||||||||||| ||||| |  |||||||  || ||||| | || ||||||||
Sbjct: 673 ccacgtaatggttcctcttcttcttcatccctcccaatggagccttcaactggaatggcc 614

                                                                 
Query: 220 acaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
           |||  |||||  |||| |||||||| || || |||||||||| |||||| ||||
Sbjct: 613 acaaaaagttattggcttccttgaaatgtggcccaaccgtcatgatctcatgga 560

---

>gb|AY056112.1| Arabidopsis thaliana AT3g13580/K20M4_2 mRNA, complete cds
          Length = 971

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 138/174 (79%)
 Strand = Plus / Minus

                                                                       
Query: 100 agttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccct 159
           ||||||| ||||| ||||||| |||||||  |  ||| ||||| || || || || || |
Sbjct: 797 agttcattctcctaacgagctcgttgatgaagttctcgcggtttccagcatctcctcctt 738

                                                                       
Query: 160 cnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggcc 219
           | ||||| ||||||||||| ||||| |  |||||||  || ||||| | || ||||||||
Sbjct: 737 ccacgtaatggttcctcttcttcttcatccctcccaatggagccttcaactggaatggcc 678

                                                                 
Query: 220 acaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
           |||  |||||  |||| |||||||| || || |||||||||| |||||| ||||
Sbjct: 677 acaaaaagttattggcttccttgaaatgtggcccaaccgtcatgatctcatgga 624

---

>gb|AY039900.1| Arabidopsis thaliana AT3g13580/K20M4_2 mRNA, complete cds
          Length = 966

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 138/174 (79%)
 Strand = Plus / Minus

                                                                       
Query: 100 agttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccct 159
           ||||||| ||||| ||||||| |||||||  |  ||| ||||| || || || || || |
Sbjct: 797 agttcattctcctaacgagctcgttgatgaagttctcgcggtttccagcatctcctcctt 738

                                                                       
Query: 160 cnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggcc 219
           | ||||| ||||||||||| ||||| |  |||||||  || ||||| | || ||||||||
Sbjct: 737 ccacgtaatggttcctcttcttcttcatccctcccaatggagccttcaactggaatggcc 678

                                                                 
Query: 220 acaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
           |||  |||||  |||| |||||||| || || |||||||||| |||||| ||||
Sbjct: 677 acaaaaagttattggcttccttgaaatgtggcccaaccgtcatgatctcatgga 624

---

>emb|BX822214.1|CNS0A5Y3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB1ZG01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 943

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 138/174 (79%)
 Strand = Plus / Minus

                                                                       
Query: 100 agttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccct 159
           ||||||| ||||| ||||||| |||||||  |  ||| ||||| || || || || || |
Sbjct: 779 agttcattctcctaacgagctcgttgatgaagttctcgcggtttccagcatctcctcctt 720

                                                                       
Query: 160 cnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggcc 219
           | ||||| ||||||||||| ||||| |  |||||||  || ||||| | || ||||||||
Sbjct: 719 ccacgtaatggttcctcttcttcttcatccctcccaatggagccttcaactggaatggcc 660

                                                                 
Query: 220 acaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
           |||  |||||  |||| |||||||| || || |||||||||| |||||| ||||
Sbjct: 659 acaaaaagttattggcttccttgaaatgtggcccaaccgtcatgatctcatgga 606

---

>emb|BX824872.1|CNS0A5RP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH79ZF10 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1504

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 138/174 (79%)
 Strand = Plus / Minus

                                                                        
Query: 100  agttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccct 159
            ||||||| ||||| ||||||| |||||||  |  ||| ||||| || || || || || |
Sbjct: 1371 agttcattctcctaacgagctcgttgatgaagttctcgcggtttccagcatctcctcctt 1312

                                                                        
Query: 160  cnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggcc 219
            | ||||| ||||||||||| ||||| |  |||||||  || ||||| | || ||||||||
Sbjct: 1311 ccacgtaatggttcctcttcttcttcatccctcccaatggagccttcaactggaatggcc 1252

                                                                  
Query: 220  acaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
            |||  |||||  |||| |||||||| || || |||||||||| |||||| ||||
Sbjct: 1251 acaaaaagttattggcttccttgaaatgtggcccaaccgtcatgatctcatgga 1198

---

>emb|BX824301.1|CNS0A5PN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH38ZB04 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1136

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 138/174 (79%)
 Strand = Plus / Minus

                                                                        
Query: 100  agttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccct 159
            ||||||| ||||| ||||||| |||||||  |  ||| ||||| || || || || || |
Sbjct: 1023 agttcattctcctaacgagctcgttgatgaagttctcgcggtttccagcatctcctcctt 964

                                                                        
Query: 160  cnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggcc 219
            | ||||| ||||||||||| ||||| |  |||||||  || ||||| | || ||||||||
Sbjct: 963  ccacgtaatggttcctcttcttcttcatccctcccaatggagccttcaactggaatggcc 904

                                                                  
Query: 220  acaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
            |||  |||||  |||| |||||||| || || |||||||||| |||||| ||||
Sbjct: 903  acaaaaagttattggcttccttgaaatgtggcccaaccgtcatgatctcatgga 850

---

>dbj|AP002038.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone: K20M4
          Length = 25790

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 138/174 (79%)
 Strand = Plus / Minus

                                                                        
Query: 100  agttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccct 159
            ||||||| ||||| ||||||| |||||||  |  ||| ||||| || || || || || |
Sbjct: 5750 agttcattctcctaacgagctcgttgatgaagttctcgcggtttccagcatctcctcctt 5691

                                                                        
Query: 160  cnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggcc 219
            | ||||| ||||||||||| ||||| |  |||||||  || ||||| | || ||||||||
Sbjct: 5690 ccacgtaatggttcctcttcttcttcatccctcccaatggagccttcaactggaatggcc 5631

                                                                  
Query: 220  acaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
            |||  |||||  |||| |||||||| || || |||||||||| |||||| ||||
Sbjct: 5630 acaaaaagttattggcttccttgaaatgtggcccaaccgtcatgatctcatgga 5577

---

>gb|AY617897.1| Sterkiella histriomuscorum clone UGC1O0006_E04_F genomic sequence
          Length = 674

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 204 ttgagcttgaatggccacaggaagttgctggcctccttgaagtgagggcc 253
           ||||||||||||||||| ||||||||| | || |||||||||||||||||
Sbjct: 274 ttgagcttgaatggccagaggaagttgttagcttccttgaagtgagggcc 323

---

>gb|AF003139.2| Caenorhabditis elegans cosmid F53G12, complete sequence
          Length = 41553

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 204  ttgagcttgaatggccacaggaagttgctggcctccttgaagtg 247
            ||||||||||| ||||||| ||||||| ||||||||||||||||
Sbjct: 4441 ttgagcttgaagggccacaagaagttggtggcctccttgaagtg 4398

---

>ref|NM_058275.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-7) (rpl-7) mRNA, complete cds
          Length = 822

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 204 ttgagcttgaatggccacaggaagttgctggcctccttgaagtg 247
           ||||||||||| ||||||| ||||||| ||||||||||||||||
Sbjct: 648 ttgagcttgaagggccacaagaagttggtggcctccttgaagtg 605

---

>ref|XM_359540.1| Magnaporthe grisea 70-15 hypothetical protein (MG05237.4) partial
           mRNA
          Length = 741

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 205 tgagcttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaaga 264
           |||||||||| |||||||||||||||  ||||| ||||||||  ||||| || || ||||
Sbjct: 631 tgagcttgaagggccacaggaagttggaggcctgcttgaagttggggccgacagtgaaga 572

                    
Query: 265 tctcntgga 273
           |||| ||||
Sbjct: 571 tctcgtgga 563

---

>gb|DQ084481.1| Chaetomium globosum 60S ribosomal protein L7 mRNA, complete cds
          Length = 812

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 207 agcttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatc 266
           |||||||| ||||| |||||||||  ||||| ||||||||  ||||| || |||||||||
Sbjct: 694 agcttgaagggccagaggaagttggaggcctgcttgaagttggggccgacagtcaagatc 635

                                
Query: 267 tcntggacaacgtcttcaatg 287
           || ||||| | ||| ||||||
Sbjct: 634 tcgtggaccaggtcctcaatg 614

---

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
              complete sequence
          Length = 1813164

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                          
Query: 209    cttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctc 268
              |||||||||||||| ||||||| |||||| ||||||||| ||||| || || | ||||||
Sbjct: 285770 cttgaatggccacaagaagttgttggcctgcttgaagtgtgggccgacagtgatgatctc 285711

                   
Query: 269    ntgga 273
               ||||
Sbjct: 285710 gtgga 285706

---

>ref|NM_210820.1| Eremothecium gossypii AFL082Wp (AFL082W), mRNA
          Length = 732

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 209 cttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctc 268
           |||||||||||||| ||||||| |||||| ||||||||| ||||| || || | ||||||
Sbjct: 615 cttgaatggccacaagaagttgttggcctgcttgaagtgtgggccgacagtgatgatctc 556

                
Query: 269 ntgga 273
            ||||
Sbjct: 555 gtgga 551

---

>emb|AJ245656.1|CPA245656 Cyanophora paradoxa partial mRNA for 60S ribosomal protein L7
          Length = 447

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 207 agcttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatc 266
           |||| ||| ||||||||||||||| | |||||||||||||| ||||| || ||  |||||
Sbjct: 338 agctggaagggccacaggaagttgttcgcctccttgaagtgggggccgacagtgtagatc 279

                   
Query: 267 tcntggac 274
           || |||||
Sbjct: 278 tcgtggac 271

---

>gb|DQ228335.1| Solanum tuberosum clone 145F05 thaliana 60S ribosomal protein L7
           (At2g44120) mRNA, complete cds
          Length = 915

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 147/189 (77%)
 Strand = Plus / Minus

                                                                       
Query: 99  tagttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccc 158
           |||||||||||||||| |||||  ||||||     ||| || || || || |||||||| 
Sbjct: 774 tagttcatcctcctgatgagctcattgatgaaattctcgcgatttccagcatcaccacct 715

                                                                       
Query: 159 tcnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggc 218
           || || || ||||| ||||| || || || || || || || |||||||| | ||| |||
Sbjct: 714 tcaacatagtggtttctcttcttttttagtccaccaagaggtgccttgagttggaaaggc 655

                                                                       
Query: 219 cacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntggacaacg 278
           || ||||||||| | |||||||||||||| || || || || | |||||| ||||| |  
Sbjct: 654 cataggaagttgttagcctccttgaagtgtggtcccacagtgatgatctcgtggacgaga 595

                    
Query: 279 tcttcaatg 287
           |||||||||
Sbjct: 594 tcttcaatg 586

---

>gb|AC148819.3| Medicago truncatula chromosome 2 BAC clone mte1-11g7, complete
            sequence
          Length = 105682

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 106/134 (79%)
 Strand = Plus / Minus

                                                                        
Query: 123  ttgatgtngncctcacggttgccggcgtcaccaccctcnacgtantggttcctcttnttc 182
            ||||||| | |||| | ||| || || |||||||| || || || || || ||||| |||
Sbjct: 3589 ttgatgtagtcctccctgttaccagcatcaccaccttcaacatagtgatttctcttcttc 3530

                                                                        
Query: 183  ttgaggcctcccagcggcgccttgagcttgaatggccacaggaagttgctggcctccttg 242
            || | ||| ||||  || || ||||||||||| ||||| ||||||||| | |||||  ||
Sbjct: 3529 ttcatgccacccaaaggagctttgagcttgaaaggccataggaagttgtttgcctctctg 3470

                          
Query: 243  aagtgagggccaac 256
            |||||||| |||||
Sbjct: 3469 aagtgaggtccaac 3456

---

>gb|AY433771.1| Aedes aegypti ASAP ID: 34421 cytosolic large ribosomal subunit L7
           mRNA sequence
          Length = 453

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 204 ttgagcttgaatggccacaggaagttgctggcct 237
           ||||||||||| ||||||||||||||| ||||||
Sbjct: 252 ttgagcttgaacggccacaggaagttgttggcct 219

---

>gb|DQ440213.1| Aedes aegypti clone AET-2196 ribosomal protein L7 mRNA, complete
           cds
          Length = 792

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 204 ttgagcttgaatggccacaggaagttgctggcct 237
           ||||||||||| ||||||||||||||| ||||||
Sbjct: 686 ttgagcttgaacggccacaggaagttgttggcct 653

---

>ref|XM_453218.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D03410g predicted mRNA
          Length = 768

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 209 cttgaatggccacaggaagttgctggcctccttgaagtgagg 250
           |||||||||||||| ||||||| |||| | ||||||||||||
Sbjct: 651 cttgaatggccacaagaagttgttggcttgcttgaagtgagg 610

---

>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1715506

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 209    cttgaatggccacaggaagttgctggcctccttgaagtgagg 250
              |||||||||||||| ||||||| |||| | ||||||||||||
Sbjct: 286228 cttgaatggccacaagaagttgttggcttgcttgaagtgagg 286187

---

>gb|AY072288.1| Spodoptera frugiperda ribosomal protein L7 mRNA, complete cds
          Length = 876

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 207 agcttgaatggccacaggaagttgctggcctccttgaa 244
           |||||||||||||| |||||||||||||| | ||||||
Sbjct: 716 agcttgaatggccagaggaagttgctggcgtacttgaa 679

---

>ref|XM_503909.1| Yarrowia lipolytica CLIB122, YALI0E13618g predicted mRNA
          Length = 753

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 206 gagcttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagat 265
           ||||||||| |||||||||||||||   |||| |||||||  ||||||||| ||  ||||
Sbjct: 639 gagcttgaagggccacaggaagttggaagcctgcttgaaggcagggccaacagtgtagat 580

                   
Query: 266 ctcntgga 273
           ||| ||||
Sbjct: 579 ctcgtgga 572

---

>gb|AY130402.1| Branchiostoma lanceolatum ribosomal protein L7 mRNA, partial cds
          Length = 718

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||||||||||||||||||| ||||
Sbjct: 614 agcttgaatggccacaggaagttgttggc 586

---

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                           
Query: 206     gagcttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagat 265
               ||||||||| |||||||||||||||   |||| |||||||  ||||||||| ||  ||||
Sbjct: 1650574 gagcttgaagggccacaggaagttggaagcctgcttgaaggcagggccaacagtgtagat 1650515

                       
Query: 266     ctcntgga 273
               ||| ||||
Sbjct: 1650514 ctcgtgga 1650507

---

>gb|DQ066291.1| Ixodes scapularis isolate is-all-399 ribosomal protein L7-like
           mRNA, complete cds
          Length = 756

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 207 agcttgaatggccacaggaagttgctggcctccttgaagt 246
           ||||||||  |||||||||||||| |||||| ||||||||
Sbjct: 647 agcttgaagtgccacaggaagttgttggccttcttgaagt 608

---

>emb|BX825759.1|CNS0A4ZI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL60ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 895

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 136/174 (78%), Gaps = 1/174 (0%)
 Strand = Plus / Minus

                                                                       
Query: 100 agttcatcctcctgacgagctggttgatgtngncctcacggttgccggcgtcaccaccct 159
           ||||||| ||||| ||||||| |||||||  |  ||| ||||| || || || || || |
Sbjct: 765 agttcattctcctaacgagctcgttgatgaagttctcgcggtttccagcatctcctcctt 706

                                                                       
Query: 160 cnacgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggcc 219
           | ||||| ||||||||||| ||||| |  |||||||  || ||||| | || |||| |||
Sbjct: 705 ccacgtaatggttcctcttcttcttcatccctcccaatggagccttcaactggaat-gcc 647

                                                                 
Query: 220 acaggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
           |||  |||||  |||| | |||||| || || |||||||||| |||||| ||||
Sbjct: 646 acaaaaagttattggctttcttgaaatgtggcccaaccgtcatgatctcatgga 593

---

>gb|AY130403.1| Myxine glutinosa ribosomal protein L7-like mRNA, partial sequence
          Length = 621

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 209 cttgaatggccacaggaagttgctggcctccttgaa 244
           |||||||||||||||||||||| ||||  |||||||
Sbjct: 515 cttgaatggccacaggaagttgttggcagccttgaa 480

---

>gb|AY389939.1| Latimeria chalumnae ribosomal protein L7 mRNA, partial cds
          Length = 664

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 207 agcttgaatggccacaggaagtt 229
           |||||||||||||||||||||||
Sbjct: 591 agcttgaatggccacaggaagtt 569

---

>ref|NM_078807.1| Drosophila melanogaster Ribosomal protein L7 CG4897-RA (RpL7), mRNA
          Length = 982

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 207 agcttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatc 266
           |||||||| |||||||||||||||  ||| | ||||||||  || || || || ||||||
Sbjct: 698 agcttgaagggccacaggaagttggaggcgtacttgaagttgggccccacggtgaagatc 639

                     
Query: 267 tcntggacaa 276
           || |||||||
Sbjct: 638 tcatggacaa 629

---

>gb|AY089648.1| Drosophila melanogaster RH04903 full insert cDNA
          Length = 909

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                       
Query: 207 agcttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatc 266
           |||||||| |||||||||||||||  ||| | ||||||||  || || || || ||||||
Sbjct: 697 agcttgaagggccacaggaagttggaggcgtacttgaagttgggccccacggtgaagatc 638

                     
Query: 267 tcntggacaa 276
           || |||||||
Sbjct: 637 tcatggacaa 628

---

>gb|AC092233.1|AC092233 Drosophila melanogaster, chromosome 2L, region 30F-31B, BAC clone
             BACR29P12, complete sequence
          Length = 161446

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 58/70 (82%)
 Strand = Plus / Plus

                                                                         
Query: 207   agcttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatc 266
             |||||||| |||||||||||||||  ||| | ||||||||  || || || || ||||||
Sbjct: 20139 agcttgaagggccacaggaagttggaggcgtacttgaagttgggccccacggtgaagatc 20198

                       
Query: 267   tcntggacaa 276
             || |||||||
Sbjct: 20199 tcatggacaa 20208

---

>gb|AC009849.7|AC009849 Drosophila melanogaster, chromosome 2L, region 31B-31C, BAC clone
             BACR07H08, complete sequence
          Length = 153505

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                         
Query: 207   agcttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatc 266
             |||||||| |||||||||||||||  ||| | ||||||||  || || || || ||||||
Sbjct: 29846 agcttgaagggccacaggaagttggaggcgtacttgaagttgggccccacggtgaagatc 29787

                       
Query: 267   tcntggacaa 276
             || |||||||
Sbjct: 29786 tcatggacaa 29777

---

>emb|BX825608.1|CNS0A7J7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL48ZB10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 350

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 89/112 (79%)
 Strand = Plus / Minus

                                                                       
Query: 162 acgtantggttcctcttnttcttgaggcctcccagcggcgccttgagcttgaatggccac 221
           ||||| ||||||||||| ||||| |  |||||||  || |||||   || ||||||||||
Sbjct: 119 acgtaatggttcctcttcttcttcatccctcccaatggagccttctactggaatggccac 60

                                                               
Query: 222 aggaagttgctggcctccttgaagtgagggccaaccgtcaagatctcntgga 273
           |  |||||  |||| ||||||||  | || |||||||||| |||||| ||||
Sbjct: 59  aaaaagttattggcttccttgaaaagtggcccaaccgtcatgatctcatgga 8

---

>gb|AY130404.1| Petromyzon marinus ribosomal protein L7 mRNA, partial cds
          Length = 652

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 207 agcttgaatggccacaggaagttgctggcctccttgaag 245
           |||||||| ||||||||||||||| |||||  |||||||
Sbjct: 579 agcttgaagggccacaggaagttgttggccaacttgaag 541

---

>gb|AE003627.4| Drosophila melanogaster chromosome 2L, section 36 of 83 of the complete
              sequence
          Length = 264225

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 58/70 (82%)
 Strand = Plus / Minus

                                                                          
Query: 207    agcttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaagatc 266
              |||||||| |||||||||||||||  ||| | ||||||||  || || || || ||||||
Sbjct: 228229 agcttgaagggccacaggaagttggaggcgtacttgaagttgggccccacggtgaagatc 228170

                        
Query: 267    tcntggacaa 276
              || |||||||
Sbjct: 228169 tcatggacaa 228160

---

>emb|AL115722.1|CNS01CMQ Botrytis cinerea strain T4 cDNA library
          Length = 540

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 205 tgagcttgaatggccacaggaagttg 230
           |||||||||||||||| |||||||||
Sbjct: 333 tgagcttgaatggccagaggaagttg 308

---

>emb|AL114969.1|CNS01C1T Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 205 tgagcttgaatggccacaggaagttg 230
           |||||||||||||||| |||||||||
Sbjct: 638 tgagcttgaatggccagaggaagttg 613

---

>emb|AL112846.1|CNS01AEU Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 205 tgagcttgaatggccacaggaagttg 230
           |||||||||||||||| |||||||||
Sbjct: 658 tgagcttgaatggccagaggaagttg 633

---

>emb|AL111897.1|CNS019OH Botrytis cinerea strain T4 cDNA library
          Length = 540

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 205 tgagcttgaatggccacaggaagttg 230
           |||||||||||||||| |||||||||
Sbjct: 337 tgagcttgaatggccagaggaagttg 312

---

>emb|AL111166.1|CNS01947 Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 205 tgagcttgaatggccacaggaagttg 230
           |||||||||||||||| |||||||||
Sbjct: 650 tgagcttgaatggccagaggaagttg 625

---

>dbj|AB180451.1| Plutella xylostella mRNA for Ribosomal protein L7, complete cds
          Length = 856

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 207 agcttgaatggccacaggaagttgctggcctccttgaa 244
           |||||||| |||||||||||||| ||||| | ||||||
Sbjct: 734 agcttgaacggccacaggaagttactggcgtacttgaa 697

---

>gb|BC085590.1| Danio rerio cDNA clone IMAGE:7264251, partial cds
          Length = 877

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 98  ctagttcatcctcctgacgag 118
           |||||||||||||||||||||
Sbjct: 760 ctagttcatcctcctgacgag 740

---

>gb|AF098999.2| Caenorhabditis elegans cosmid W04C9, complete sequence
          Length = 34643

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 170   gttcctcttnttcttgaggcctcc 193
             ||||||||| ||||||||||||||
Sbjct: 19870 gttcctctttttcttgaggcctcc 19893

---

>gb|DQ118296.2| Oryzias latipes ribosomal protein L7 mRNA, complete cds
          Length = 841

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 667 agcttgaagggccacaggaagttgttggc 639

---

>gb|AY561515.1| Danio rerio ribosomal protein L7 (rpl7) mRNA, complete cds
          Length = 829

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 98  ctagttcatcctcctgacgag 118
           |||||||||||||||||||||
Sbjct: 762 ctagttcatcctcctgacgag 742

---

>gb|BT013050.1| Lycopersicon esculentum clone 114306R, mRNA sequence
          Length = 790

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 204 ttgagcttgaatggccacaggaagttgctggcctccttgaagtgagggccaaccgtcaag 263
           ||||||||||| ||||| ||||||  ||| || | ||||||||  |||||||| || |||
Sbjct: 654 ttgagcttgaacggccagaggaagcggctcgcgtacttgaagttcgggccaacggtgaag 595

                
Query: 264 atctc 268
           |||||
Sbjct: 594 atctc 590

---

>ref|NM_213644.1| Danio rerio ribosomal protein L7 (rpl7), mRNA
          Length = 829

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 98  ctagttcatcctcctgacgag 118
           |||||||||||||||||||||
Sbjct: 762 ctagttcatcctcctgacgag 742

---

>emb|CR735071.2|CNS0GTYM Tetraodon nigroviridis full-length cDNA
          Length = 762

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 611 agcttgaagggccacaggaagttgttggc 583

---

>emb|CR734244.2|CNS0GTBN Tetraodon nigroviridis full-length cDNA
          Length = 796

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR734522.2|CNS0GTJD Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR733965.2|CNS0GT3W Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR733632.2|CNS0GSUN Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR733687.2|CNS0GSW6 Tetraodon nigroviridis full-length cDNA
          Length = 666

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 510 agcttgaagggccacaggaagttgttggc 482

---

>emb|CR731264.2|CNS0GR6T Tetraodon nigroviridis full-length cDNA
          Length = 762

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR727947.2|CNS0GOMP Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR720280.2|CNS0GIPQ Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 646 agcttgaagggccacaggaagttgttggc 618

---

>emb|CR720053.2|CNS0GIJF Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR723153.2|CNS0GKXJ Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR723125.2|CNS0GKWR Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR722468.2|CNS0GKEI Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR722292.2|CNS0GK9M Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 646 agcttgaagggccacaggaagttgttggc 618

---

>emb|CR722107.2|CNS0GK4H Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR722072.2|CNS0GK3I Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR721869.2|CNS0GJXV Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR721467.2|CNS0GJMP Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR721426.2|CNS0GJLK Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR721359.2|CNS0GJJP Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR721235.2|CNS0GJG9 Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR721092.2|CNS0GJCA Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR721030.2|CNS0GJAK Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR720799.2|CNS0GJ45 Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR720623.2|CNS0GIZ9 Tetraodon nigroviridis full-length cDNA
          Length = 804

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR720322.2|CNS0GIQW Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR720019.2|CNS0GIIH Tetraodon nigroviridis full-length cDNA
          Length = 798

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR719901.2|CNS0GIF7 Tetraodon nigroviridis full-length cDNA
          Length = 773

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 619 agcttgaagggccacaggaagttgttggc 591

---

>emb|CR719414.2|CNS0GI1O Tetraodon nigroviridis full-length cDNA
          Length = 804

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 650 agcttgaagggccacaggaagttgttggc 622

---

>emb|CR717867.2|CNS0GGUP Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR717180.2|CNS0GGBP Tetraodon nigroviridis full-length cDNA
          Length = 797

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 644 agcttgaagggccacaggaagttgttggc 616

---

>emb|CR716913.2|CNS0GG4A Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR715495.2|CNS0GF0Z Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR714419.2|CNS0GE73 Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR714409.2|CNS0GE6T Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR713663.2|CNS0GDM3 Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR713179.2|CNS0GD8N Tetraodon nigroviridis full-length cDNA
          Length = 529

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 375 agcttgaagggccacaggaagttgttggc 347

---

>emb|CR711113.2|CNS0GBN9 Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR711074.2|CNS0GBM6 Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR710328.2|CNS0GB1G Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR710197.2|CNS0GAXT Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR710165.2|CNS0GAWX Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR709755.2|CNS0GALJ Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR709637.2|CNS0GAI9 Tetraodon nigroviridis full-length cDNA
          Length = 804

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR708154.2|CNS0G9D2 Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR707639.2|CNS0G8YR Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR707158.2|CNS0G8LE Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR706075.2|CNS0G7RB Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR705816.2|CNS0G7K4 Tetraodon nigroviridis full-length cDNA
          Length = 692

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 537 agcttgaagggccacaggaagttgttggc 509

---

>emb|CR705749.2|CNS0G7I9 Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR705576.2|CNS0G7DG Tetraodon nigroviridis full-length cDNA
          Length = 673

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 518 agcttgaagggccacaggaagttgttggc 490

---

>emb|CR705447.2|CNS0G79V Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR705159.2|CNS0G71V Tetraodon nigroviridis full-length cDNA
          Length = 798

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR703372.2|CNS0G5O8 Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR703049.2|CNS0G5F9 Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR702705.2|CNS0G55P Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR701243.2|CNS0G413 Tetraodon nigroviridis full-length cDNA
          Length = 1552

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 207  agcttgaatggccacaggaagttgctggc 235
            |||||||| ||||||||||||||| ||||
Sbjct: 1400 agcttgaagggccacaggaagttgttggc 1372

---

>emb|CR701137.2|CNS0G3Y5 Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR700155.2|CNS0G36V Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR699988.2|CNS0G328 Tetraodon nigroviridis full-length cDNA
          Length = 804

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR699071.2|CNS0G2CR Tetraodon nigroviridis full-length cDNA
          Length = 771

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 617 agcttgaagggccacaggaagttgttggc 589

---

>emb|CR698906.2|CNS0G286 Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 354 agcttgaagggccacaggaagttgttggc 326

---

>emb|CR698811.2|CNS0G25J Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR698131.2|CNS0G1MN Tetraodon nigroviridis full-length cDNA
          Length = 798

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR697519.2|CNS0G15N Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR697678.2|CNS0G1A2 Tetraodon nigroviridis full-length cDNA
          Length = 804

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR697078.2|CNS0G0TE Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR696465.2|CNS0G0CD Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR695696.2|CNS0FZR0 Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR695158.2|CNS0FZC2 Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR694919.2|CNS0FZ5F Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR694817.2|CNS0FZ2L Tetraodon nigroviridis full-length cDNA
          Length = 770

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 617 agcttgaagggccacaggaagttgttggc 589

---

>emb|CR694401.2|CNS0FYR1 Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR694394.2|CNS0FYQU Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR693496.2|CNS0FY1W Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR692707.2|CNS0FXFZ Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR690835.2|CNS0FVZZ Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 646 agcttgaagggccacaggaagttgttggc 618

---

>emb|CR690523.2|CNS0FVRB Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR690410.2|CNS0FVO6 Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR690209.2|CNS0FVIL Tetraodon nigroviridis full-length cDNA
          Length = 1320

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 207  agcttgaatggccacaggaagttgctggc 235
            |||||||| ||||||||||||||| ||||
Sbjct: 1172 agcttgaagggccacaggaagttgttggc 1144

---

>emb|CR690153.2|CNS0FVH1 Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR689667.2|CNS0FV3J Tetraodon nigroviridis full-length cDNA
          Length = 796

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR689556.2|CNS0FV0G Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR688595.2|CNS0FU9R Tetraodon nigroviridis full-length cDNA
          Length = 807

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR688085.2|CNS0FTVL Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 644 agcttgaagggccacaggaagttgttggc 616

---

>emb|CR687197.2|CNS0FT6X Tetraodon nigroviridis full-length cDNA
          Length = 558

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 406 agcttgaagggccacaggaagttgttggc 378

---

>emb|CR687158.2|CNS0FT5U Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR687062.2|CNS0FT36 Tetraodon nigroviridis full-length cDNA
          Length = 797

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR686995.2|CNS0FT1B Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR686123.2|CNS0FSD3 Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR685444.2|CNS0FRU8 Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR684092.2|CNS0FQSO Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR683582.2|CNS0FQEI Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR682167.2|CNS0FPB7 Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR681765.2|CNS0FP01 Tetraodon nigroviridis full-length cDNA
          Length = 807

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR681001.2|CNS0FOET Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR680447.2|CNS0FNZF Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR680257.2|CNS0FNU5 Tetraodon nigroviridis full-length cDNA
          Length = 759

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 615 agcttgaagggccacaggaagttgttggc 587

---

>emb|CR680229.2|CNS0FNTD Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR680029.2|CNS0FNNT Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR680002.2|CNS0FNN2 Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 646 agcttgaagggccacaggaagttgttggc 618

---

>emb|CR679345.2|CNS0FN4T Tetraodon nigroviridis full-length cDNA
          Length = 820

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 667 agcttgaagggccacaggaagttgttggc 639

---

>emb|CR679485.2|CNS0FN8P Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR678807.2|CNS0FMPV Tetraodon nigroviridis full-length cDNA
          Length = 796

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR678806.2|CNS0FMPU Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR677485.2|CNS0FLPL Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR677349.2|CNS0FLLT Tetraodon nigroviridis full-length cDNA
          Length = 729

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 616 agcttgaagggccacaggaagttgttggc 588

---

>emb|CR677233.2|CNS0FLIL Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR677134.2|CNS0FLFU Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR676498.2|CNS0FKY6 Tetraodon nigroviridis full-length cDNA
          Length = 776

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 615 agcttgaagggccacaggaagttgttggc 587

---

>emb|CR676452.2|CNS0FKWW Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR676335.2|CNS0FKTN Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR676204.2|CNS0FKQ0 Tetraodon nigroviridis full-length cDNA
          Length = 810

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 652 agcttgaagggccacaggaagttgttggc 624

---

>emb|CR676066.2|CNS0FKMG Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR675695.2|CNS0FKC5 Tetraodon nigroviridis full-length cDNA
          Length = 837

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 683 agcttgaagggccacaggaagttgttggc 655

---

>emb|CR675346.2|CNS0FK2G Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 651 agcttgaagggccacaggaagttgttggc 623

---

>emb|CR675343.2|CNS0FK2D Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR675169.2|CNS0FJXJ Tetraodon nigroviridis full-length cDNA
          Length = 762

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR675495.2|CNS0FK6L Tetraodon nigroviridis full-length cDNA
          Length = 770

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 615 agcttgaagggccacaggaagttgttggc 587

---

>emb|CR675401.2|CNS0FK3Z Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR674719.2|CNS0FJL1 Tetraodon nigroviridis full-length cDNA
          Length = 673

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 518 agcttgaagggccacaggaagttgttggc 490

---

>emb|CR674663.2|CNS0FJJH Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR674602.2|CNS0FJHS Tetraodon nigroviridis full-length cDNA
          Length = 804

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR673831.2|CNS0FIWD Tetraodon nigroviridis full-length cDNA
          Length = 791

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 639 agcttgaagggccacaggaagttgttggc 611

---

>emb|CR673802.2|CNS0FIVK Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR673176.2|CNS0FIE6 Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR672844.2|CNS0FI4Y Tetraodon nigroviridis full-length cDNA
          Length = 728

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 615 agcttgaagggccacaggaagttgttggc 587

---

>emb|CR672753.2|CNS0FI2F Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR672663.2|CNS0FHZX Tetraodon nigroviridis full-length cDNA
          Length = 807

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR672176.2|CNS0FHME Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR672248.2|CNS0FHOE Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR671591.2|CNS0FH65 Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR671897.2|CNS0FHEN Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR671079.2|CNS0FGRX Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR671508.2|CNS0FH3U Tetraodon nigroviridis full-length cDNA
          Length = 810

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR671422.2|CNS0FH1G Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR671362.2|CNS0FGZS Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR671274.2|CNS0FGXC Tetraodon nigroviridis full-length cDNA
          Length = 797

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR670789.2|CNS0FGJV Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR670891.1|CNS0FGMP Tetraodon nigroviridis full-length cDNA
          Length = 788

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 643 agcttgaagggccacaggaagttgttggc 615

---

>emb|CR670277.2|CNS0FG5N Tetraodon nigroviridis full-length cDNA
          Length = 801

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR670098.2|CNS0FG0O Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR670040.2|CNS0FFZ2 Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR669953.2|CNS0FFWN Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 646 agcttgaagggccacaggaagttgttggc 618

---

>emb|CR669839.2|CNS0FFTH Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR669837.2|CNS0FFTF Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR669733.2|CNS0FFQJ Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR669429.2|CNS0FFI3 Tetraodon nigroviridis full-length cDNA
          Length = 806

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 645 agcttgaagggccacaggaagttgttggc 617

---

>emb|CR669106.2|CNS0FF94 Tetraodon nigroviridis full-length cDNA
          Length = 673

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 518 agcttgaagggccacaggaagttgttggc 490

---

>emb|CR669069.2|CNS0FF83 Tetraodon nigroviridis full-length cDNA
          Length = 805

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR668997.2|CNS0FF63 Tetraodon nigroviridis full-length cDNA
          Length = 800

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR668957.2|CNS0FF4Z Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR668563.2|CNS0FEU1 Tetraodon nigroviridis full-length cDNA
          Length = 767

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 615 agcttgaagggccacaggaagttgttggc 587

---

>emb|CR668271.2|CNS0FELX Tetraodon nigroviridis full-length cDNA
          Length = 798

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 644 agcttgaagggccacaggaagttgttggc 616

---

>emb|CR668260.2|CNS0FELM Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR668169.2|CNS0FEJ3 Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR668093.2|CNS0FEGZ Tetraodon nigroviridis full-length cDNA
          Length = 803

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620

---

>emb|CR667940.2|CNS0FECQ Tetraodon nigroviridis full-length cDNA
          Length = 807

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 649 agcttgaagggccacaggaagttgttggc 621

---

>emb|CR668199.1|CNS0FEJX Tetraodon nigroviridis full-length cDNA
          Length = 1093

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 951 agcttgaagggccacaggaagttgttggc 923

---

>emb|CR667497.2|CNS0FE0F Tetraodon nigroviridis full-length cDNA
          Length = 770

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 615 agcttgaagggccacaggaagttgttggc 587

---

>emb|CR667461.2|CNS0FDZF Tetraodon nigroviridis full-length cDNA
          Length = 798

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 646 agcttgaagggccacaggaagttgttggc 618

---

>emb|CR667328.2|CNS0FDVQ Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 647 agcttgaagggccacaggaagttgttggc 619

---

>emb|CR667777.1|CNS0FE87 Tetraodon nigroviridis full-length cDNA
          Length = 792

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 640 agcttgaagggccacaggaagttgttggc 612

---

>emb|CR666842.2|CNS0FDI8 Tetraodon nigroviridis full-length cDNA
          Length = 761

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 615 agcttgaagggccacaggaagttgttggc 587

---

>emb|CR667060.2|CNS0FDOA Tetraodon nigroviridis full-length cDNA
          Length = 802

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 agcttgaatggccacaggaagttgctggc 235
           |||||||| ||||||||||||||| ||||
Sbjct: 648 agcttgaagggccacaggaagttgttggc 620


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,173,385
Number of Sequences: 3902068
Number of extensions: 2173385
Number of successful extensions: 40787
Number of sequences better than 10.0: 410
Number of HSP's better than 10.0 without gapping: 408
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 40009
Number of HSP's gapped (non-prelim): 779
length of query: 287
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 265
effective length of database: 17,147,199,772
effective search space: 4544007939580
effective search space used: 4544007939580
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---