ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags30k11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 961 0.0
2emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 783 0.0
3gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 783 0.0
4emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 630 e-177
5emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 555 e-155
6gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 504 e-139
7emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA 396 e-107
8gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid... 389 e-105
9gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi... 389 e-105
10emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 389 e-105
11emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 373 e-100
12emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 373 e-100
13emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 359 7e-96
14gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi... 333 4e-88
15gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 236 7e-59
16emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 236 7e-59
17gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 228 2e-56
18gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 228 2e-56
19gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m... 224 3e-55
20gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) m... 224 3e-55
21gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4)... 216 7e-53
22gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid... 208 2e-50
23emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 204 3e-49
24emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 188 2e-44
25emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 139 1e-29
26gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome... 119 1e-23
27dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
28dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 1e-23
29dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 1e-23
30gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 119 1e-23
31dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 115 2e-22
32emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 115 2e-22
33dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 2e-22
34gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 115 2e-22
35emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 115 2e-22
36gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran... 107 4e-20
37emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein 107 4e-20
38dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
39dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
40emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa... 107 4e-20
41gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m... 107 4e-20
42gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I... 100 1e-17
43gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT I... 100 1e-17
44gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran... 88 4e-14
45emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp... 88 4e-14
46emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA 88 4e-14
47emb|X71667.1|SVLTP1 S.vulgare ltp1 gene 88 4e-14
48emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 88 4e-14
49dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 4e-14
50dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 4e-14
51gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I... 88 4e-14
52gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,... 86 2e-13
53emb|X71668.1|SVLTP2 S.vulgare ltp2 gene 84 6e-13
54dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 84 6e-13
55dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 84 6e-13
56gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA... 80 1e-11
57gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf... 80 1e-11
58gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe... 80 1e-11
59gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf... 80 1e-11
60gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi... 80 1e-11
61gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip... 80 1e-11
62gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf... 80 1e-11
63gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe... 80 1e-11
64gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf... 80 1e-11
65gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe... 80 1e-11
66gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe... 80 1e-11
67gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe... 80 1e-11
68gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf... 80 1e-11
69gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf... 80 1e-11
70gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe... 80 1e-11
71gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf... 80 1e-11
72gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf... 80 1e-11
73gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi... 80 1e-11
74gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi... 80 1e-11
75gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi... 80 1e-11
76gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol... 80 1e-11
77gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi... 80 1e-11
78gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip... 80 1e-11
79gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip... 80 1e-11
80gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi... 80 1e-11
81gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi... 80 1e-11
82gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip... 80 1e-11
83gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip... 80 1e-11
84gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip... 80 1e-11
85dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 4e-11
86dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 2e-10
87dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 2e-10
88dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 2e-10
89dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 2e-10
90gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence 72 2e-09
91gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs... 72 2e-09
92gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe... 72 2e-09
93gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi... 72 2e-09
94gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi... 72 2e-09
95gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi... 72 2e-09
96gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol... 72 2e-09
97gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip... 72 2e-09
98gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip... 72 2e-09
99gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip... 72 2e-09
100gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip... 72 2e-09
101gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip... 72 2e-09
102gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol... 72 2e-09
103gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip... 72 2e-09
104gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3... 72 2e-09
105gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co... 72 2e-09
106gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA,... 68 4e-08
107gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip... 64 6e-07
108gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholip... 64 6e-07
109dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfe... 62 2e-06
110gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid... 58 4e-05
111emb|CT025614.7| Mouse DNA sequence from clone RP23-418B18 on chr... 52 0.002
112gb|AC131676.2| Mus musculus BAC clone RP23-330L3 from chromosome... 50 0.009
113emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chr... 50 0.009
114emb|AL732451.8| Mouse DNA sequence from clone RP23-85G19 on chro... 50 0.009
115gb|AC099975.11| Mus musculus chromosome 5, clone RP23-23A2, comp... 48 0.036
116gb|AC131678.4| Mus musculus BAC clone RP23-333L1 from chromosome... 48 0.036
117gb|AC137691.7| Mus musculus chromosome 13, clone RP23-104G24, co... 48 0.036
118gb|AC116383.11| Mus musculus chromosome 5, clone RP23-15P21, com... 48 0.036
119gb|AC161590.2| Mus musculus BAC clone RP24-300B21 from chromosom... 48 0.036
120gb|AC098971.2| Homo sapiens chromosome 3 clone RP11-118N13, comp... 48 0.036
121gb|AC012450.9| Homo sapiens BAC clone RP11-351J7 from 2, complet... 48 0.036
122gb|AC093927.3| Homo sapiens chromosome 3 clone RP11-81I24, compl... 48 0.036
123gb|AC102367.35| Mus musculus chromosome 3, clone RP23-211J6, com... 48 0.036
124gb|AC164875.14| Mus musculus chromosome 1, clone RP23-59P14, com... 48 0.036
125gb|AC122011.3| Mus musculus chromosome 10 clone RP24-352E6, comp... 46 0.14
126gb|AC131596.10| Mus musculus chromosome 10, clone RP23-476G10, c... 46 0.14
127gb|AC129336.4| Mus musculus BAC clone RP23-113I7 from chromosome... 46 0.14
128gb|AC146296.3| Mus musculus BAC clone RP23-277D1 from chromosome... 46 0.14
129gb|AC122928.4| Mus musculus BAC clone RP23-10G8 from 9, complete... 46 0.14
130gb|AC121605.3| Mus musculus BAC clone RP23-312E16 from 1, comple... 46 0.14
131emb|AL391870.16| Human DNA sequence from clone RP11-491C24 on ch... 46 0.14
132emb|AL390785.15| Human DNA sequence from clone RP11-325N9 on chr... 46 0.14
133gb|AC159096.2| Mus musculus chromosome 1, clone RP24-95N15, comp... 46 0.14
134emb|BX855592.19| Zebrafish DNA sequence from clone CH211-232K3, ... 46 0.14
135gb|AC107028.5| Homo sapiens 3 BAC RP11-547K2 (Roswell Park Cance... 46 0.14
136gb|AC104823.4| Homo sapiens BAC clone RP11-762E8 from 2, complet... 46 0.14
137gb|AC139299.3| Mus musculus BAC clone RP23-335D20 from 1, comple... 46 0.14
138gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein... 46 0.14
139gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome... 46 0.14
140emb|AL772393.11| Mouse DNA sequence from clone RP23-398D18 on ch... 46 0.14
141emb|AL732478.7| Mouse DNA sequence from clone RP23-42N14 on chro... 46 0.14
142gb|AC113493.9| Mus musculus chromosome 15, clone RP23-359H23, co... 44 0.56
143gb|AC130283.8| Mus musculus chromosome 15, clone RP23-136E18, co... 44 0.56
144gb|AC116768.9| Mus musculus chromosome 8, clone RP23-395P10, com... 44 0.56
145gb|AC154520.3| Mus musculus BAC clone RP23-471P16 from chromosom... 44 0.56
146gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 44 0.56
147gb|AC007863.15| Trypanosoma brucei chromosome 6 clone RPCI93-26G... 44 0.56
148gb|AC130666.9| Mus musculus chromosome 5, clone RP24-79O7, compl... 44 0.56
149gb|AC120555.9| Mus musculus chromosome 12, clone RP24-311D18, co... 44 0.56
150gb|BT015295.1| Drosophila melanogaster GH02989 full insert cDNA 44 0.56
151gb|AC129931.19| Mus musculus chromosome 15, clone RP23-136I22, c... 44 0.56
152gb|AC007889.9| Drosophila melanogaster clone BACR48E12, complete... 44 0.56
153gb|AC130649.2| Drosophila melanogaster clone BACR06L03, complete... 44 0.56
154gb|BC070803.1| Xenopus laevis hypothetical protein MGC83869, mRN... 44 0.56
155gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosom... 44 0.56
156gb|AC142111.3| Mus musculus BAC clone RP24-63G9 from chromosome ... 44 0.56
157gb|AC124361.4| Mus musculus BAC clone RP24-528I8 from chromosome... 44 0.56
158gb|AC132844.7| Mus musculus chromosome 17, clone RP24-481P13, co... 44 0.56
159gb|AC157549.4| Mus musculus chromosome 8, clone RP24-374O12, com... 44 0.56
160gb|AC144522.12| Homo sapiens 12 BAC RP11-481J8 (Roswell Park Can... 44 0.56
161gb|AC113970.8| Mus musculus chromosome 1, clone RP23-125E16, com... 44 0.56
162gb|AC124826.8| Mus musculus chromosome 12, clone RP23-455F18, co... 44 0.56
163gb|AC112030.4| Rattus norvegicus 4 BAC CH230-100K8 (Children's H... 44 0.56
164gb|AC147066.2| Pan troglodytes BAC clone RP43-164F2 from 7, comp... 44 0.56
165gb|AC146512.2| Pan troglodytes BAC clone RP43-16E21 from 7, comp... 44 0.56
166gb|AC134331.2| Mus musculus BAC clone RP24-344O12 from chromosom... 44 0.56
167gb|AC116322.5| Mus musculus BAC clone RP23-273O16 from chromosom... 44 0.56
168gb|AC130219.3| Mus musculus BAC clone RP23-126O16 from chromosom... 44 0.56
169gb|AC125108.3| Mus musculus BAC clone RP24-226A8 from chromosome... 44 0.56
170gb|AC124740.4| Mus musculus BAC clone RP23-356M1 from chromosome... 44 0.56
171gb|AC113941.16| Mus musculus chromosome 8, clone RP23-161H3, com... 44 0.56
172gb|AC006332.3| Homo sapiens BAC clone RP11-376O14 from 7, comple... 44 0.56
173gb|AC113275.8| Mus musculus chromosome 8, clone RP23-383K23, com... 44 0.56
174gb|AC102441.6| Mus musculus chromosome 18, clone RP24-160I12, co... 44 0.56
175emb|AL513534.17| Human DNA sequence from clone RP11-119F7 on chr... 44 0.56
176emb|AL391427.9| Human DNA sequence from clone RP11-499O7 on chro... 44 0.56
177gb|AC096626.31| Mus musculus strain C57BL/6J clone rp23-423p15 m... 44 0.56
178emb|AL353643.10| Human DNA sequence from clone RP11-359J23 on ch... 44 0.56
179emb|AL136363.4| Human DNA sequence from clone RP6-43L17 on chrom... 44 0.56
180emb|AL596096.7| Mouse DNA sequence from clone RP23-42P20 on chro... 44 0.56
181gb|AC153155.6| Mus musculus BAC clone RP23-25J23 from chromosome... 44 0.56
182emb|AL034559.4|PFMAL3P7 Plasmodium falciparum MAL3P7, complete s... 44 0.56
183emb|BX294164.13| Zebrafish DNA sequence from clone CH211-266D19 ... 44 0.56
184gb|AC158799.8| Mus musculus BAC RP24-430K11 (Roswell Park Cance... 44 0.56
185gb|AC153153.4| Mus musculus BAC clone RP23-79G18 from chromosome... 44 0.56
186emb|AL683843.9| Mouse DNA sequence from clone RP23-217E1 on chro... 44 0.56
187gb|AC104629.10| Homo sapiens 3 BAC RP11-12N13 (Roswell Park Canc... 44 0.56
188gb|AC090506.7| Homo sapiens chromosome 18, clone RP11-675P14, co... 44 0.56
189gb|AC093452.50| Mus musculus strain C57BL/6J clone rp23-458j13 m... 44 0.56
190gb|AC093318.52| Mus musculus strain C57BL/6J clone rp23-252h7 ma... 44 0.56
191gb|AC009990.9| Homo sapiens chromosome 05 clone RP11-94N1, compl... 44 0.56
192ref|NM_176778.1| Drosophila melanogaster lethal (1) G0196 CG1461... 44 0.56
193gb|AC005831.1| Homo sapiens 12p13.3 PAC RPCI5-1180D12 (Roswell P... 44 0.56
194gb|AC092185.3| Homo sapiens 3q BAC RP11-148O7 (Roswell Park Canc... 44 0.56
195gb|AC112031.4| Rattus norvegicus BAC CH230-99K18 (Children's Ho... 44 0.56
196gb|AC104515.1| Drosophila melanogaster, chromosome X, region 20B... 44 0.56
197gb|AC008573.5| Homo sapiens chromosome 5 clone CTC-551I11, compl... 44 0.56
198gb|AC074254.4| Homo sapiens BAC clone RP11-784D7 from 4, complet... 44 0.56
199gb|AC024897.23| Homo sapiens 3 BAC RP11-505J9 (Roswell Park Canc... 44 0.56
200emb|BX511027.20| Zebrafish DNA sequence from clone CH211-281P14 ... 44 0.56
201gb|AC163694.2| Mus musculus BAC clone RP24-80O2 from chromosome ... 44 0.56
202gb|AC010259.7| Homo sapiens chromosome 5 clone CTC-454M9, comple... 44 0.56
203gb|AC020937.6| Homo sapiens chromosome 5 clone CTD-2299I21, comp... 44 0.56
204dbj|AK032932.1| Mus musculus 12 days embryo male wolffian duct i... 44 0.56
205emb|AJ586737.2| Drosophila virilis partial mod(mdg4) gene 44 0.56
206gb|AC010596.8| Homo sapiens chromosome 5 clone CTC-483B24, compl... 44 0.56
207gb|AC008502.8| Homo sapiens chromosome 5 clone CTC-442G11, compl... 44 0.56
208gb|AC019187.3|AC019187 Homo sapiens BAC clone RP11-304J20 from 1... 44 0.56
209gb|AC158635.6| Mus musculus 10 BAC RP23-396A23 (Roswell Park Can... 44 0.56
210dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.56
211gb|AC023274.2|AC023274 Homo sapiens clone RP11-307L15, complete ... 44 0.56
212gb|AC078916.19| Homo sapiens 12 BAC RP11-463C23 (Roswell Park Ca... 44 0.56
213emb|BX817431.1|CNS0ACFH Arabidopsis thaliana Full-length cDNA Co... 44 0.56
214gb|AC106860.6| Homo sapiens BAC clone RP13-488D7 from 4, complet... 44 0.56
215gb|AC007725.5|AC007725 Drosophila melanogaster, chromosome 3R, r... 44 0.56
216gb|AC019195.10| Homo sapiens BAC clone RP11-355K7 from 2, comple... 44 0.56
217gb|AC139530.3| Homo sapiens chromosome 17, clone RP13-1032I1, co... 44 0.56
218gb|AC022464.4|AC022464 Genomic sequence for Arabidopsis thaliana... 44 0.56
219gb|AC007562.4|AC007562 Homo sapiens BAC clone RP11-497C14 from Y... 44 0.56
220ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P... 44 0.56
221gb|AE016753.1| Mus musculus chromosome 10 high-growth region, se... 44 0.56
222gb|AC146595.2| Mus musculus BAC clone RP24-164G18 from chromosom... 44 0.56
223gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 ... 44 0.56
224dbj|AP005836.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.56
225dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.56
226emb|BX649381.5| Mouse DNA sequence from clone RP23-245K23 on chr... 44 0.56
227dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 44 0.56
228emb|AL589623.27| Mouse DNA sequence from clone RP23-111C11 on ch... 44 0.56
229gb|AC153366.7| Mus musculus 10 BAC RP23-243B24 (Roswell Park Can... 44 0.56
230emb|AL954686.9| Mouse DNA sequence from clone RP23-167L6 on chro... 44 0.56
231dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 44 0.56
232gb|AC008056.6|AC008056 Homo sapiens chromosome 14 clone RP11-242... 44 0.56
233gb|AC007058.2|AC007058 Homo sapiens chromosome 14 clone containi... 44 0.56
234emb|AL391158.5|CNS06C83 Human chromosome 14 DNA sequence BAC R-5... 44 0.56
235gb|AE003693.3| Drosophila melanogaster chromosome 3R, section 31... 44 0.56
236emb|AL162311.5|CNS01RHR Human chromosome 14 DNA sequence BAC R-3... 44 0.56
237gb|AE003574.6| Drosophila melanogaster chromosome X, section 73 ... 44 0.56
238dbj|AP001683.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 44 0.56
239gb|AC107808.20| Mus musculus chromosome 9, clone RP23-61B14, com... 44 0.56
240gb|AC102262.9| Mus musculus chromosome 15, clone RP24-216B4, com... 44 0.56
241gb|AC166336.15| Mus musculus chromosome 1, clone RP24-74G12, com... 44 0.56
242gb|AC137896.5| Homo sapiens chromosome 17, clone RP11-765O14, co... 44 0.56
243gb|AC159036.3| Pan troglodytes BAC clone CH251-318E5 from chromo... 44 0.56
244emb|AL808133.17| Mouse DNA sequence from clone RP23-457N24 on ch... 44 0.56
245emb|AL845267.2| Mouse DNA sequence from clone RP23-426D2 on chro... 44 0.56
246emb|AL929540.9| Mouse DNA sequence from clone RP23-132M12 on chr... 44 0.56
247gb|AC148011.3| Mus musculus BAC clone RP23-202I21 from 18, compl... 44 0.56
248gb|AC148007.3| Mus musculus BAC clone RP23-273G4 from 1, complet... 44 0.56
249gb|AC125046.3| Mus musculus BAC clone RP23-349O22 from 6, comple... 44 0.56
250gb|AC112266.6| Mus musculus BAC clone RP23-422B6 from 13, comple... 44 0.56
251emb|CT025725.10| Mouse DNA sequence from clone RP23-477K5 on chr... 44 0.56
252gb|AC131699.4| Mus musculus BAC clone RP23-440F17 from 1, comple... 44 0.56
253emb|CR936841.11| Mouse DNA sequence from clone DN-491F10 on chro... 44 0.56
254emb|CT010583.8| Mouse DNA sequence from clone RP23-203B24 on chr... 44 0.56
255emb|AL772291.9| Mouse DNA sequence from clone RP23-395G1 on chro... 44 0.56
256gb|U11255.1|ATU11255 Arabidopsis thaliana Columbia ecotype metal... 44 0.56
257gb|U11254.1|ATU11254 Arabidopsis thaliana Columbia ecotype metal... 44 0.56
258gb|U11253.1|ATU11253 Arabidopsis thaliana Columbia ecotype metal... 44 0.56
259emb|AL683811.6| Mouse DNA sequence from clone RP23-291K22 on chr... 44 0.56
260emb|AL772408.4| Mouse DNA sequence from clone RP23-339B20 on chr... 44 0.56
261emb|AL583891.15| Mouse DNA sequence from clone RP23-292L2 on chr... 44 0.56
262gb|AC167197.6| Mus musculus chromosome 1, clone RP23-62B14, comp... 44 0.56
263emb|AL731822.31| Mouse DNA sequence from clone RP23-105H6 on chr... 44 0.56
264gb|AC160528.9| Mus musculus chromosome 15, clone RP23-310L8, com... 44 0.56
265dbj|AP000454.2| Homo sapiens genomic DNA, chromosome 21q21.2 clo... 44 0.56
266emb|AL808146.3| Mouse DNA sequence from clone RP23-52L10 on chro... 44 0.56
267emb|AL627252.16| Mouse DNA sequence from clone RP23-272P17 on ch... 44 0.56
268gb|AC108432.14| Mus musculus chromosome 7, clone RP23-170D4, com... 42 2.2
269gb|AC166746.7| Mus musculus chromosome 19, clone RP24-248H10, co... 42 2.2
270gb|AC167537.7| Mus musculus chromosome 8, clone RP23-99B10, comp... 42 2.2
271gb|AC166114.5| Mus musculus BAC clone RP23-63J20 from chromosome... 42 2.2
272gb|AC152957.1| Mus musculus 6 BAC RP23-353I5 (Roswell Park Cance... 42 2.2
273gb|AC166709.9| Mus musculus chromosome 1, clone RP23-406B10, com... 42 2.2
274gb|AC101593.16| Mus musculus chromosome 18, clone RP23-198A7, co... 42 2.2
275gb|AC160552.13| Mus musculus chromosome 3, clone RP23-326D6, com... 42 2.2
276gb|AC139064.13| Mus musculus chromosome 1, clone RP23-76C20, com... 42 2.2
277gb|AC163358.3| Mus musculus BAC clone RP23-11M14 from chromosome... 42 2.2
278gb|AC148001.6| Mus musculus BAC clone RP24-82P9 from chromosome ... 42 2.2
279gb|AC163661.4| Mus musculus BAC clone RP23-288B18 from chromosom... 42 2.2
280gb|AC165236.5| Mus musculus chromosome 5, clone RP23-348C18, com... 42 2.2
281gb|AC007441.9| Drosophila melanogaster clone BACR10E03, complete... 42 2.2
282gb|AC169511.1| Mus musculus BAC clone RP23-81P24 from chromosome... 42 2.2
283gb|AC167185.4| Mus musculus chromosome 3, clone RP23-355G8, comp... 42 2.2
284gb|AC153526.13| Mus musculus 10 BAC RP23-383C2 (Roswell Park Can... 42 2.2
285gb|AC153856.23| Mus musculus 10 BAC RP23-468J15 (Roswell Park Ca... 42 2.2
286gb|AC120871.12| Mus musculus chromosome 16, clone RP23-121E8, co... 42 2.2
287gb|AC160845.1| Homo sapiens chromosome 2 clone fa0885, complete ... 42 2.2
288gb|AC137748.3| Oryza sativa (japonica cultivar-group) chromosome... 42 2.2
289gb|AE014843.1| Plasmodium falciparum 3D7 chromosome 11 section 8... 42 2.2
290gb|DP000014.1| Callithrix jacchus target 1 genomic scaffold 42 2.2
291gb|AC145272.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.2
292gb|AC101933.8| Mus musculus chromosome 7, clone RP24-70M5, compl... 42 2.2
293gb|AC112965.10| Mus musculus chromosome 1, clone RP24-95N17, com... 42 2.2
294gb|AC139025.9| Mus musculus chromosome 8, clone RP23-426K13, com... 42 2.2
295gb|AC158767.3| Mus musculus chromosome 1, clone RP24-128E5, comp... 42 2.2
296gb|AC158148.5| Mus musculus chromosome 1, clone RP24-353B6, comp... 42 2.2
297gb|CP000081.1| Leishmania major chromosome 35, complete sequence 42 2.2
298gb|AY534123.1|SEG_AY534122S2 Aegilops tauschii transposons Caspa... 42 2.2
299gb|AF184173.1|AF184172S2 Sus scrofa leptin receptor (LEPR) gene,... 42 2.2
300gb|AY326644.1| Homo sapiens myotonic dystrophy type 2 CL3N95 rep... 42 2.2
301gb|AY024282.1| Oryza sativa microsatellite MRG6607 containing (T... 42 2.2
302gb|AY024281.1| Oryza sativa microsatellite MRG6606 containing (T... 42 2.2
303gb|AY024222.1| Oryza sativa microsatellite MRG6547 containing (T... 42 2.2
304gb|AY020626.1| Oryza sativa microsatellite MRG2951 containing (T... 42 2.2
305gb|AY019707.1| Oryza sativa microsatellite MRG2032 containing (A... 42 2.2
306gb|AY018357.1| Oryza sativa microsatellite MRG0682 containing (A... 42 2.2
307gb|AC105982.10| Mus musculus chromosome 15, clone RP24-159I1, co... 42 2.2
308gb|AC139231.11| Mus musculus chromosome 1, clone RP24-87I22, com... 42 2.2
309gb|AC147480.13| Mus musculus chromosome 14, clone RP23-429N24, c... 42 2.2
310gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hos... 42 2.2
311gb|AC115061.20| Mus musculus chromosome 1, clone RP24-399G3, com... 42 2.2
312gb|AC164984.2| Mus musculus BAC clone RP23-18I3 from chromosome ... 42 2.2
313gb|AC157570.5| Mus musculus BAC clone RP23-105H5 from chromosome... 42 2.2
314gb|AC165970.3| Mus musculus BAC clone RP23-129J20 from chromosom... 42 2.2
315gb|AC154527.2| Mus musculus BAC clone RP23-221K13 from chromosom... 42 2.2
316gb|AC134443.3| Mus musculus BAC clone RP24-107B13 from chromosom... 42 2.2
317gb|AC166342.3| Mus musculus BAC clone RP24-340A12 from chromosom... 42 2.2
318gb|AC154641.2| Mus musculus BAC clone RP23-276C17 from chromosom... 42 2.2
319gb|AC137612.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.2
320gb|BC077366.1| Xenopus laevis MGC81469 protein, mRNA (cDNA clone... 42 2.2
321gb|AC123736.8| Mus musculus chromosome 3, clone RP23-478I18, com... 42 2.2
322gb|AC166816.2| Mus musculus chromosome 5, clone RP24-321O22, com... 42 2.2
323gb|AC118472.8| Mus musculus chromosome 19, clone RP23-187N14, co... 42 2.2
324gb|AC119876.9| Mus musculus chromosome 3, clone RP24-309A12, com... 42 2.2
325gb|AC122117.10| Mus musculus chromosome 18, clone RP23-61O22, co... 42 2.2
326gb|AC112988.7| Mus musculus chromosome 5, clone RP24-294H5, comp... 42 2.2
327gb|AC110567.10| Mus musculus chromosome 5, clone RP23-304I24, co... 42 2.2
328ref|XM_591311.2| PREDICTED: Bos taurus similar to GTP binding pr... 42 2.2
329ref|XM_876195.1| PREDICTED: Bos taurus similar to GTP binding pr... 42 2.2
330ref|XM_865459.1| PREDICTED: Bos taurus similar to GTP binding pr... 42 2.2
331ref|XM_876074.1| PREDICTED: Bos taurus similar to GTP binding pr... 42 2.2
332gb|AC185523.2| Pan troglodytes chromosome X clone PTB-124O20 map... 42 2.2
333gb|AC125583.3| Rattus norvegicus 4 BAC CH230-1A7 (Children's Hos... 42 2.2
334gb|AC129573.16| Mus musculus chromosome 6, clone RP23-457B5, com... 42 2.2
335gb|AC122006.3| Mus musculus BAC clone RP24-344B12 from chromosom... 42 2.2
336gb|AC115297.7| Mus musculus BAC clone RP23-205H11 from chromosom... 42 2.2
337gb|AC147020.2| Mus musculus BAC clone RP23-267A11 from chromosom... 42 2.2
338gb|AC140408.3| Mus musculus BAC clone RP24-92P14 from chromosome... 42 2.2
339gb|AC147124.2| Mus musculus BAC clone RP24-163K4 from chromosome... 42 2.2
340gb|AC135080.2| Mus musculus BAC clone RP24-369P14 from chromosom... 42 2.2
341gb|AC134908.5| Mus musculus BAC clone RP23-377L13 from chromosom... 42 2.2
342gb|AC158789.4| Mus musculus chromosome 5, clone RP23-192C21, com... 42 2.2
343gb|DQ192033.1|DQ192032S2 Stizostedion vitreum vitreum putative c... 42 2.2
344gb|AC109262.13| Mus musculus chromosome 1, clone RP23-31H15, com... 42 2.2
345gb|AC114573.11| Mus musculus chromosome 13, clone RP23-146M15, c... 42 2.2
346gb|AC135923.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.2
347gb|AC135919.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.2
348gb|AC100208.16| Mus musculus chromosome 7, clone RP23-59J14, com... 42 2.2
349gb|AC115000.7| Mus musculus chromosome 1, clone RP24-103F2, comp... 42 2.2
350gb|AY519500.1| Gallus gallus CNR/Pcdh-alpha gene cluster, comple... 42 2.2
351gb|AC153378.4| Mus musculus 6 BAC RP23-106C18 (Roswell Park Canc... 42 2.2
352gb|AC046160.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 2.2
353gb|AC165092.3| Mus musculus BAC clone RP23-10M2 from chromosome ... 42 2.2
354gb|DP000012.1| Macropus eugenii target 1 genomic scaffold 42 2.2
355gb|AY190953.1| Drosophila virilis clone DVIF01_19_E15 (D1419) ge... 42 2.2
356gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosom... 42 2.2
357gb|AC121279.7| Mus musculus chromosome 3, clone RP23-4F17, compl... 42 2.2
358gb|AC161245.2| Mus musculus BAC clone RP24-394N21 from chromosom... 42 2.2
359gb|AC163285.3| Mus musculus BAC clone RP23-379H2 from chromosome... 42 2.2
360gb|AC107456.9| Mus musculus chromosome 3, clone RP23-273L6, comp... 42 2.2
361gb|AC125082.3| Mus musculus BAC clone RP24-90M24 from chromosome... 42 2.2
362gb|AC073873.7| Homo sapiens BAC clone RP11-575M4 from 7, complet... 42 2.2
363gb|AC117690.10| Mus musculus chromosome 16, clone RP23-446I8, co... 42 2.2
364gb|AC134524.5| Mus musculus BAC clone RP24-496E20 from chromosom... 42 2.2
365gb|AC132101.4| Mus musculus BAC clone RP24-343L14 from chromosom... 42 2.2
366gb|AC122848.3| Mus musculus BAC clone RP23-166K13 from chromosom... 42 2.2
367gb|AC126046.3| Mus musculus BAC clone RP23-176P24 from chromosom... 42 2.2
368gb|AC124168.3| Mus musculus BAC clone RP23-143G9 from chromosome... 42 2.2
369gb|AC134251.3| Mus musculus BAC clone RP23-430D14 from chromosom... 42 2.2
370gb|AC144808.2| Mus musculus BAC clone RP24-434O1 from chromosome... 42 2.2
371gb|AC134434.4| Mus musculus BAC clone RP24-420E8 from chromosome... 42 2.2
372gb|AC140782.4| Mus musculus BAC clone RP24-417N13 from chromosom... 42 2.2
373gb|AC124688.3| Mus musculus BAC clone RP24-484D9 from chromosome... 42 2.2
374emb|CT010512.8| Mouse DNA sequence from clone RP23-283M18 on chr... 42 2.2
375emb|CT010454.8| Mouse DNA sequence from clone RP23-348C22 on chr... 42 2.2
376emb|CR407588.11| Zebrafish DNA sequence from clone DKEY-190L8 in... 42 2.2
377emb|BX842700.35| Zebrafish DNA sequence from clone DKEY-2P18 in ... 42 2.2
378gb|AC112950.9| Mus musculus chromosome 1, clone RP23-288K15, com... 42 2.2
379gb|AC119155.6| Mus musculus chromosome 3, clone RP23-43A4, compl... 42 2.2
380gb|AC138299.14| Mus musculus chromosome 18, clone RP23-296E4, co... 42 2.2
381emb|CR388072.9| Zebrafish DNA sequence from clone DKEY-113P2 in ... 42 2.2
382emb|CR925863.7| Zebrafish DNA sequence from clone DKEY-184N1 in ... 42 2.2
383gb|AC135081.3| Mus musculus BAC clone RP24-131A24 from chromosom... 42 2.2
384gb|AC135806.4| Mus musculus BAC clone RP24-289M10 from chromosom... 42 2.2
385gb|AC125163.5| Mus musculus BAC clone RP24-421J9 from chromosome... 42 2.2
386gb|AC132448.3| Mus musculus BAC clone RP23-180B23 from chromosom... 42 2.2
387gb|AC127414.4| Mus musculus BAC clone RP23-246P24 from chromosom... 42 2.2
388gb|AC069219.17| Homo sapiens 3 BAC RP11-376N7 (Roswell Park Canc... 42 2.2
389gb|AC124450.3| Mus musculus BAC clone RP24-215C4 from chromosome... 42 2.2
390gb|AC127277.2| Mus musculus BAC clone RP24-221P14 from chromosom... 42 2.2
391gb|AC122795.3| Mus musculus BAC clone RP24-226D9 from chromosome... 42 2.2
392gb|AC127235.3| Mus musculus BAC clone RP24-570A23 from chromosom... 42 2.2
393gb|AC122386.3| Mus musculus BAC clone RP24-72H18 from chromosome... 42 2.2
394emb|AL023828.1|CEY17G7B Caenorhabditis elegans YAC Y17G7B, compl... 42 2.2
395gb|AC127282.3| Mus musculus BAC clone RP23-318O24 from chromosom... 42 2.2
396gb|AC023480.7| Homo sapiens chromosome 3 clone RP11-399K19 map 3... 42 2.2
397gb|AC125040.4| Mus musculus BAC clone RP23-335C9 from chromosome... 42 2.2
398gb|AC123857.4| Mus musculus BAC clone RP23-344L21 from chromosom... 42 2.2
399gb|AC133210.3| Mus musculus chromosome UNK clone RP23-27L12, com... 42 2.2
400gb|AC121926.3| Mus musculus BAC clone RP24-202B3 from chromosome... 42 2.2
401gb|AC125234.4| Mus musculus BAC clone RP23-14K16 from 13, comple... 42 2.2
402gb|AC112257.5| Mus musculus BAC clone RP23-43A18 from 16, comple... 42 2.2
403gb|AC123869.4| Mus musculus BAC clone RP23-245M16 from 12, compl... 42 2.2
404gb|AC125206.3| Mus musculus BAC clone RP23-240G3 from 10, comple... 42 2.2
405gb|AC123955.5| Mus musculus BAC clone RP23-274C16 from 1, comple... 42 2.2
406gb|AC124198.2| Mus musculus BAC clone RP23-306E4 from 8, complet... 42 2.2
407gb|AC130817.4| Mus musculus BAC clone RP23-68J13 from 16, comple... 42 2.2
408gb|AC122187.3| Mus musculus BAC clone RP23-21P2 from 1, complete... 42 2.2
409gb|AC098887.4| Mus musculus BAC clone RP23-122N6 from 10, comple... 42 2.2
410gb|AC121837.2| Mus musculus BAC clone RP24-74E24 from 5, complet... 42 2.2
411gb|AC117218.3| Mus musculus BAC clone RP23-344B4 from 15, comple... 42 2.2
412gb|AC122054.2| Mus musculus BAC clone RP24-465D10 from 5, comple... 42 2.2
413gb|AC122037.2| Mus musculus BAC clone RP24-426D9 from 3, complet... 42 2.2
414gb|AC112261.4| Mus musculus BAC clone RP23-204O17 from 3, comple... 42 2.2
415gb|AC115295.4| Mus musculus BAC clone RP23-188O19 from 3, comple... 42 2.2
416emb|CR405694.7| Zebrafish DNA sequence from clone DKEY-21A6 in l... 42 2.2
417gb|AC146195.3| Pan troglodytes BAC clone RP43-25F5 from 7, compl... 42 2.2
418gb|AC100506.17| Mus musculus chromosome 9, clone RP23-144D3, com... 42 2.2
419emb|CR695648.1|CNS0FZPO Tetraodon nigroviridis full-length cDNA 42 2.2
420gb|AF403735.1| Lupinus albus extensin peroxidase mRNA, complete cds 42 2.2
421emb|CR692447.2|CNS0FX8R Tetraodon nigroviridis full-length cDNA 42 2.2
422emb|CR691712.2|CNS0FWOC Tetraodon nigroviridis full-length cDNA 42 2.2
423gb|AC002069.2| Homo sapiens BAC clone CTA-326K9 from 7, complete... 42 2.2
424emb|CR683623.2|CNS0FQFN Tetraodon nigroviridis full-length cDNA 42 2.2
425gb|AC099798.4| Homo sapiens BAC clone RP11-559E21 from 7, comple... 42 2.2
426gb|AC092108.4| Homo sapiens BAC clone RP11-1263I10 from 7, compl... 42 2.2
427emb|CR681376.2|CNS0FOP8 Tetraodon nigroviridis full-length cDNA 42 2.2
428emb|CR678828.2|CNS0FMQG Tetraodon nigroviridis full-length cDNA 42 2.2
429emb|CR675215.2|CNS0FJYT Tetraodon nigroviridis full-length cDNA 42 2.2
430emb|CR675000.2|CNS0FJSU Tetraodon nigroviridis full-length cDNA 42 2.2
431gb|AC112711.3| Homo sapiens BAC clone RP13-968A2 from 7, complet... 42 2.2
432emb|CR669102.2|CNS0FF90 Tetraodon nigroviridis full-length cDNA 42 2.2
433gb|AC100263.9| Mus musculus chromosome 19, clone RP23-66K19, com... 42 2.2
434emb|CR662543.2|CNS0FA6T Tetraodon nigroviridis full-length cDNA 42 2.2
435emb|CR662776.2|CNS0FADA Tetraodon nigroviridis full-length cDNA 42 2.2
436emb|CR658057.2|CNS0F6Q7 Tetraodon nigroviridis full-length cDNA 42 2.2
437gb|AC107769.7| Mus musculus chromosome 16, clone RP23-130N20, co... 42 2.2
438gb|AC101679.8| Mus musculus chromosome 17, clone RP23-173O19, co... 42 2.2
439gb|AC023248.20| Mus musculus chromosome 7, clone RP23-124B2, com... 42 2.2
440gb|AC119848.8| Mus musculus chromosome 7, clone RP23-73B20, comp... 42 2.2
441gb|AC163650.2| Mus musculus BAC clone RP24-383A20 from chromosom... 42 2.2
442gb|AC102781.5| Mus musculus chromosome 1, clone RP23-271G2, comp... 42 2.2
443gb|AC102375.8| Mus musculus chromosome 3, clone RP23-281M6, comp... 42 2.2
444gb|AC165338.3| Mus musculus BAC clone RP24-456K15 from chromosom... 42 2.2
445gb|AC006404.25| Mus musculus strain 129/Sv clone ct7-141k23 map ... 42 2.2
446gb|AC006447.24| Mus musculus strain 129/Sv clone ct7-67d14 map 6... 42 2.2
447gb|AC163496.4| Mus musculus chromosome 1, clone RP24-325M15, com... 42 2.2
448gb|AC161049.2| Mus musculus BAC clone RP24-94D6 from chromosome ... 42 2.2
449gb|AC109253.9| Mus musculus, clone RP23-351D8, complete sequence 42 2.2
450gb|AC094253.7| Rattus norvegicus 4 BAC CH230-3E12 (Children's Ho... 42 2.2
451emb|BX530056.17| Zebrafish DNA sequence from clone CH211-208I16 ... 42 2.2
452emb|Z82900.1|HS293E14 Human DNA sequence from clone RP1-293E14 o... 42 2.2
453emb|AL390248.10| Human DNA sequence from clone RP11-492M23 on ch... 42 2.2
454emb|AL807736.6| Human DNA sequence from clone RP1-248F5 on chrom... 42 2.2
455emb|AL606517.14| Human DNA sequence from clone RP11-182I10 on ch... 42 2.2
456emb|AL596326.5| Human DNA sequence from clone RP11-373J16 on chr... 42 2.2
457emb|AL592067.4| Human DNA sequence from clone RP11-361H7 on chro... 42 2.2
458emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on ch... 42 2.2
459emb|AL590439.12| Human DNA sequence from clone RP11-394I23 on ch... 42 2.2
460emb|AL590784.9| Human DNA sequence from clone RP11-260I7 on chro... 42 2.2
461emb|AL450427.11| Human DNA sequence from clone RP11-372H19 on ch... 42 2.2
462emb|AL589727.4| Human DNA sequence from clone RP11-104N13 on chr... 42 2.2
463emb|AL512655.17| Human DNA sequence from clone RP11-536C2 on chr... 42 2.2
464emb|AL513189.13| Human DNA sequence from clone RP11-339I11 on ch... 42 2.2
465emb|AL583830.7| Human DNA sequence from clone RP11-172L10 on chr... 42 2.2
466emb|AL445213.11| Human DNA sequence from clone RP13-52K8 on chro... 42 2.2
467emb|AL360015.25| Human DNA sequence from clone RP11-344F20 on ch... 42 2.2
468emb|AL360220.12| Human DNA sequence from clone RP11-173B15 on ch... 42 2.2
469emb|AL390055.14| Human DNA sequence from clone RP11-140A24 on ch... 42 2.2
470emb|AL357078.35| Human DNA sequence from clone RP4-535B20 on chr... 42 2.2
471gb|AE014837.1| Plasmodium falciparum 3D7 chromosome 11 section 2... 42 2.2
472gb|AC021032.9| Homo sapiens chromosome 10 clone RP11-180I22, com... 42 2.2
473emb|AL357129.11| Human DNA sequence from clone RP11-114A21 on ch... 42 2.2
474emb|AL359091.10| Human DNA sequence from clone RP11-339B21 on ch... 42 2.2
475gb|AC093578.3| Homo sapiens chromosome 1 clone RP11-76N22, compl... 42 2.2
476emb|AL353611.19| Human DNA sequence from clone RP11-447M12 on ch... 42 2.2
477emb|AL162734.15| Human DNA sequence from clone RP11-243J18 on ch... 42 2.2
478gb|AC112406.5| Rattus norvegicus 11 BAC CH230-329D3 (Children's ... 42 2.2
479gb|AC127173.17| Mus musculus strain C57BL/6J clone rp23-39k4 map... 42 2.2
480gb|AC095402.7| Rattus norvegicus 2 BAC CH230-7A22 (Children's Ho... 42 2.2
481gb|AC115802.10| Mus musculus, clone RP23-408J7, complete sequence 42 2.2
482emb|AL162418.17| Human DNA sequence from clone RP11-335H2 on chr... 42 2.2
483emb|AL162399.12| Human DNA sequence from clone RP11-545I10 on ch... 42 2.2
484emb|AL158163.11| Human DNA sequence from clone RP11-348N5 on chr... 42 2.2
485emb|AL161724.10| Human DNA sequence from clone RP11-114E4 on chr... 42 2.2
486emb|AL139081.21| Human DNA sequence from clone RP11-179A7 on chr... 42 2.2
487emb|AL139826.15| Human DNA sequence from clone RP11-60H7 on chro... 42 2.2
488emb|AL157881.14| Human DNA sequence from clone RP11-104M22 on ch... 42 2.2
489emb|AL157895.8| Human DNA sequence from clone RP11-354E11 on chr... 42 2.2
490emb|AL137001.23| Human DNA sequence from clone RP11-301J16 on ch... 42 2.2
491gb|AC091153.10| Homo sapiens chromosome 17, clone RP11-314A20, c... 42 2.2
492gb|AC163990.2| Mus musculus chromosome 5, clone RP24-166G8, comp... 42 2.2
493emb|AL031054.1|HS48G12 Human DNA sequence from clone RP1-48G12 o... 42 2.2
494gb|AC128768.4| Rattus norvegicus 1 BAC CH230-445L3 (Children's H... 42 2.2
495gb|AC099563.3| Homo sapiens chromosome 1 clone RP11-323K10, comp... 42 2.2
496emb|BX323463.24| Zebrafish DNA sequence from clone DKEY-169J7 in... 42 2.2
497gb|AC142122.2| Homo sapiens fosmid clone XXFOS-8870E5 from 2, co... 42 2.2
498gb|AC083905.20| Homo sapiens 3 BAC RP11-124N24 (Roswell Park Can... 42 2.2
499gb|AC163635.5| Mus musculus BAC clone RP23-183F13 from chromosom... 42 2.2
500emb|CR382400.1| Plasmodium falciparum chromosome 6, complete seq... 42 2.2

>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  961 bits (485), Expect = 0.0
 Identities = 491/493 (99%)
 Strand = Plus / Minus

                                                                       
Query: 146 atatatatcccacatgaagataatatgagagcatttattcatatatatgtatgtatgtgt 205
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 520 atatatatcccacatgaagataatatgagagcatttattcatatatatgtatgtatgtgt 461

                                                                       
Query: 206 aacctcaacgtactcagcgtcgattgctggggctataggcagcaagtggttgatcagcga 265
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 460 gacctcaacgtactcagcgtcgattgctggggctataggcagcaagtggttgatcagcga 401

                                                                       
Query: 266 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 325
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 400 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 341

                                                                       
Query: 326 gggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcac 385
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 340 gggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcac 281

                                                                       
Query: 386 gccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcag 445
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280 gccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcag 221

                                                                       
Query: 446 caggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 505
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 220 caggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 161

                                                                       
Query: 506 gagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggcggccacc 565
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 160 gagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggcggccacc 101

                                                                       
Query: 566 agggcgaccagcacgagctgactagctgcagcgcgagccatccctaatgagtttggaata 625
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 100 agggcgaccagcacgagctgactagctgcagcgcgagccatccctaatgagtttggaata 41

                        
Query: 626 gtagcgcagccga 638
           |||||||| ||||
Sbjct: 40  gtagcgcaaccga 28



 Score =  244 bits (123), Expect = 3e-61
 Identities = 123/123 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   agtgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaaca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 665 agtgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaaca 606

                                                                       
Query: 61  accaaacatggatagaacagtatggccggccatgcagaactggctcaacatagatactcc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 605 accaaacatggatagaacagtatggccggccatgcagaactggctcaacatagatactcc 546

              
Query: 121 gtc 123
           |||
Sbjct: 545 gtc 543



to top

>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score =  783 bits (395), Expect = 0.0
 Identities = 459/479 (95%), Gaps = 1/479 (0%)
 Strand = Plus / Minus

                                                                        
Query: 149  tatatcccacatgaagataatatgagagcatttattcatatatatgtatgtatgtgtaac 208
            |||||||||||||||||||||||  | |||||||||||||||||||||||||||||| ||
Sbjct: 1121 tatatcccacatgaagataatatt-gtgcatttattcatatatatgtatgtatgtgtgac 1063

                                                                        
Query: 209  ctcaacgtactcagcgtcgattgctggggctataggcagcaagtggttgatcagcgaatc 268
            ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1062 ctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttgatcagcgaatc 1003

                                                                        
Query: 269  ttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggg 328
            ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1002 ttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggg 943

                                                                        
Query: 329  atgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcacgcc 388
            || ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 942  attccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcacgcc 883

                                                                        
Query: 389  gcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcagcag 448
            ||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||
Sbjct: 882  gcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgcagcag 823

                                                                        
Query: 449  gccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggcagag 508
            ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 822  gccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggcagag 763

                                                                        
Query: 509  ctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggcggccaccagg 568
            |||||||||||||||||||||||||||||||  ||||||| ||||||||||||||||| |
Sbjct: 762  ctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatggcggccaccatg 703

                                                                       
Query: 569  gcgaccagcacgagctgactagctgcagcgcgagccatccctaatgagtttggaatagt 627
            |||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||
Sbjct: 702  gcgaccagcacgagctgagtagctgcagcgcgagccatccctaaggagtttgcaatagt 644



 Score =  174 bits (88), Expect = 2e-40
 Identities = 106/112 (94%)
 Strand = Plus / Minus

                                                                        
Query: 1    agtgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaaca 60
            |||||||||| |||||| |||||||||||| | |||||||||||||||||||||||||||
Sbjct: 1251 agtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaaca 1192

                                                                
Query: 61   accaaacatggatagaacagtatggccggccatgcagaactggctcaacata 112
            ||||||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1191 accaaacatcgatagtacagtatggccggccatgcagaactggctcaacata 1140



to top

>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score =  783 bits (395), Expect = 0.0
 Identities = 459/479 (95%), Gaps = 1/479 (0%)
 Strand = Plus / Minus

                                                                        
Query: 149  tatatcccacatgaagataatatgagagcatttattcatatatatgtatgtatgtgtaac 208
            |||||||||||||||||||||||  | |||||||||||||||||||||||||||||| ||
Sbjct: 2517 tatatcccacatgaagataatatt-gtgcatttattcatatatatgtatgtatgtgtgac 2459

                                                                        
Query: 209  ctcaacgtactcagcgtcgattgctggggctataggcagcaagtggttgatcagcgaatc 268
            ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 2458 ctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttgatcagcgaatc 2399

                                                                        
Query: 269  ttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggg 328
            ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 2398 ttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggg 2339

                                                                        
Query: 329  atgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcacgcc 388
            || ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 2338 attccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcacgcc 2279

                                                                        
Query: 389  gcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcagcag 448
            ||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||
Sbjct: 2278 gcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgcagcag 2219

                                                                        
Query: 449  gccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggcagag 508
            ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2218 gccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggcagag 2159

                                                                        
Query: 509  ctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggcggccaccagg 568
            |||||||||||||||||||||||||||||||  ||||||| ||||||||||||||||| |
Sbjct: 2158 ctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatggcggccaccatg 2099

                                                                       
Query: 569  gcgaccagcacgagctgactagctgcagcgcgagccatccctaatgagtttggaatagt 627
            |||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||
Sbjct: 2098 gcgaccagcacgagctgagtagctgcagcgcgagccatccctaaggagtttgcaatagt 2040



 Score =  174 bits (88), Expect = 2e-40
 Identities = 106/112 (94%)
 Strand = Plus / Minus

                                                                        
Query: 1    agtgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaaca 60
            |||||||||| |||||| |||||||||||| | |||||||||||||||||||||||||||
Sbjct: 2647 agtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaaca 2588

                                                                
Query: 61   accaaacatggatagaacagtatggccggccatgcagaactggctcaacata 112
            ||||||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 2587 accaaacatcgatagtacagtatggccggccatgcagaactggctcaacata 2536



to top

>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score =  630 bits (318), Expect = e-177
 Identities = 351/362 (96%)
 Strand = Plus / Minus

                                                                        
Query: 245  cagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 304
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1391 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 1332

                                                                        
Query: 305  acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagca 364
            |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 1331 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 1272

                                                                        
Query: 365  gcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggcc 424
            ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 1271 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 1212

                                                                        
Query: 425  agtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcatag 484
            ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1211 agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 1152

                                                                        
Query: 485  gagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggct 544
            |||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1151 gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggct 1092

                                                                        
Query: 545  acgaggagcatggcggccaccagggcgaccagcacgagctgactagctgcagcgcgagcc 604
            ||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||
Sbjct: 1091 acgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcc 1032

              
Query: 605  at 606
            ||
Sbjct: 1031 at 1030



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/55 (90%), Gaps = 2/55 (3%)
 Strand = Plus / Minus

                                                                   
Query: 153  tcccacatgaagataatat--gagagcatttattcatatatatgtatgtatgtgt 205
            ||||||||| |||||||||  |||||||||||||||||||||||| ||| |||||
Sbjct: 1514 tcccacatggagataatatatgagagcatttattcatatatatgtgtgtgtgtgt 1460



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 1    agtgcacatggtacaaaatacaataaactc 30
            ||||||||||||||||| ||||| ||||||
Sbjct: 1649 agtgcacatggtacaaagtacaacaaactc 1620



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 85   gccggccatgcagaactggctcaac 109
            |||||||||||||| ||||||||||
Sbjct: 1566 gccggccatgcagagctggctcaac 1542



to top

>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score =  555 bits (280), Expect = e-155
 Identities = 334/352 (94%)
 Strand = Plus / Minus

                                                                       
Query: 245 cagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 304
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 376 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 317

                                                                       
Query: 305 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagca 364
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 316 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccacccgca 257

                                                                       
Query: 365 gcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggcc 424
           ||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||
Sbjct: 256 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccggcc 197

                                                                       
Query: 425 agtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcatag 484
           | |||||||||||||||||||||||||| |||| |  || |||||||||||| |||||||
Sbjct: 196 aatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggcatag 137

                                                                       
Query: 485 gagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggct 544
           || |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 136 gaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggct 77

                                                               
Query: 545 acgaggagcatggcggccaccagggcgaccagcacgagctgactagctgcag 596
           ||||||||||| |||||||||| ||||||||||||||||||| |||||||||
Sbjct: 76  acgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcag 25



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/55 (90%), Gaps = 2/55 (3%)
 Strand = Plus / Minus

                                                                  
Query: 153 tcccacatgaagataatat--gagagcatttattcatatatatgtatgtatgtgt 205
           ||||||||| |||||||||  |||||||||||||||||||||||| ||| |||||
Sbjct: 512 tcccacatggagataatatatgagagcatttattcatatatatgtgtgtgtgtgt 458



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 1   agtgcacatggtacaaaatacaataaactc 30
           ||||||||||||||||| ||||| ||||||
Sbjct: 647 agtgcacatggtacaaagtacaacaaactc 618



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 205 taacctcaacgtactcagcgtc 226
           ||||||||||||||||||||||
Sbjct: 436 taacctcaacgtactcagcgtc 415



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 218 ctcagcgtcgattgctggggctataggcagcaag 251
           |||||| ||||| ||||| |||||||||||||||
Sbjct: 415 ctcagcatcgatagctggagctataggcagcaag 382



to top

>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score =  504 bits (254), Expect = e-139
 Identities = 329/354 (92%)
 Strand = Plus / Minus

                                                                       
Query: 243 ggcagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagg 302
           ||||||||||||| |||||| |||||||||||||||||||||||| |||||||| |||||
Sbjct: 449 ggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtagg 390

                                                                       
Query: 303 ggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccag 362
           ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| | |
Sbjct: 389 ggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcgg 330

                                                                       
Query: 363 cagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccgg 422
           ||||||||||||||||||||||| ||||||| ||||||||||||||||| || |||||||
Sbjct: 329 cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccgg 270

                                                                       
Query: 423 ccagtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcat 482
           ||| |||||||||||||||||||||||||| |||| |  || |||||||||||| |||||
Sbjct: 269 ccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggcat 210

                                                                       
Query: 483 aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcgg 542
           |||| |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 209 aggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcgg 150

                                                                 
Query: 543 ctacgaggagcatggcggccaccagggcgaccagcacgagctgactagctgcag 596
           ||||||||||||| |||||||||| ||||||||||||||||||| |||||||||
Sbjct: 149 ctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcag 96



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 168 atatgagagcatttattcatatatatgtatgtatgtgt 205
           |||||||| ||||||||||||||||||| ||| |||||
Sbjct: 564 atatgagatcatttattcatatatatgtgtgtgtgtgt 527



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 205 taacctcaacgtactcagcgtc 226
           ||||||||||||||||||||||
Sbjct: 507 taacctcaacgtactcagcgtc 486



to top

>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA
          Length = 660

 Score =  396 bits (200), Expect = e-107
 Identities = 230/240 (95%)
 Strand = Plus / Minus

                                                                       
Query: 367 gctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccag 426
           |||||||| |||| ||||||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226

                                                                       
Query: 427 tctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcatagga 486
           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166

                                                                       
Query: 487 gatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggctac 546
           |||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 165 gatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctac 106

                                                                       
Query: 547 gaggagcatggcggccaccagggcgaccagcacgagctgactagctgcagcgcgagccat 606
           ||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||
Sbjct: 105 gaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 46



to top

>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  389 bits (196), Expect = e-105
 Identities = 295/328 (89%)
 Strand = Plus / Minus

                                                                       
Query: 259 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 318
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 319 catggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgca 378
           | | | ||||||||| ||||||||||||||||| |||||| |||||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 379 cttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgcc 438
           ||||||||||||||| ||||||||||||||| |||| | || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 439 gctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 498
           ||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 499 caaggcagagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggc 558
           |||||||||||||||||||||||| || | |||||| || | |||| |||||||||| ||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49

                                       
Query: 559 ggccaccagggcgaccagcacgagctga 586
           |||||||| |||||| ||||||| ||||
Sbjct: 48  ggccaccacggcgacgagcacgacctga 21



to top

>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  389 bits (196), Expect = e-105
 Identities = 295/328 (89%)
 Strand = Plus / Minus

                                                                       
Query: 259 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 318
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 319 catggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgca 378
           | | | ||||||||| ||||||||||||||||| |||||| |||||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 379 cttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgcc 438
           ||||||||||||||| ||||||||||||||| |||| | || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 439 gctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 498
           ||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 499 caaggcagagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggc 558
           |||||||||||||||||||||||| || | |||||| || | |||| |||||||||| ||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49

                                       
Query: 559 ggccaccagggcgaccagcacgagctga 586
           |||||||| |||||| ||||||| ||||
Sbjct: 48  ggccaccacggcgacgagcacgacctga 21



to top

>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score =  389 bits (196), Expect = e-105
 Identities = 307/344 (89%)
 Strand = Plus / Minus

                                                                        
Query: 243  ggcagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagg 302
            ||||||||||| | |||||||||||||||||||||||||| |||| ||||||||||||||
Sbjct: 1633 ggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtagg 1574

                                                                        
Query: 303  ggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccag 362
            ||||||| ||||||||| | | ||||||||||||||||||||||||||| |||||| |||
Sbjct: 1573 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 1514

                                                                        
Query: 363  cagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccgg 422
            ||||||||||||||||||||||||||||||| ||||||||||||||| |||| | || ||
Sbjct: 1513 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 1454

                                                                        
Query: 423  ccagtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcat 482
            | || ||| | ||||||||||||||||||||||  ||  |||||||||||||||| ||||
Sbjct: 1453 ctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcat 1394

                                                                        
Query: 483  aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcgg 542
            |||||||||||||||||||||||||||||||||||||||| || |  ||||| || | | 
Sbjct: 1393 aggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccgtga 1334

                                                        
Query: 543  ctacgaggagcatggcggccaccagggcgaccagcacgagctga 586
            || |||||||||| |||||||||| |||||| ||||||| ||||
Sbjct: 1333 ctgcgaggagcatagcggccaccacggcgacgagcacgacctga 1290



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 46   gggagtgaaggaacaaccaaacatggatagaacagtatggccggccatgcaga 98
            ||||||| |||||||||||||||| |||| |||||| ||||||||||||||||
Sbjct: 1838 gggagtggaggaacaaccaaacatcgatacaacagtgtggccggccatgcaga 1786



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 163  agataatatgagagcatttattcatatatat 193
            |||||||||||||||||||||||||| ||||
Sbjct: 1750 agataatatgagagcatttattcataaatat 1720



to top

>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score =  373 bits (188), Expect = e-100
 Identities = 305/344 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 ggcagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagg 302
           ||||||| ||| | |||||||||||||||||||||||||| |||| ||||||||||||||
Sbjct: 430 ggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtagg 371

                                                                       
Query: 303 ggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccag 362
           ||| ||| ||||||||| | | ||||||||||||||||||||||||||| |||||| |||
Sbjct: 370 ggatgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 311

                                                                       
Query: 363 cagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccgg 422
           ||||||||||||| ||||||||||||||||| ||||||||||||||| |||| | || ||
Sbjct: 310 cagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 251

                                                                       
Query: 423 ccagtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcat 482
           | || ||| | |||||||||||||||||||||| |||  |||||||||||||||| ||||
Sbjct: 250 ctagactcctaacgccgctgcagcaggccgcagacgggctggcgccgttgccgcgtgcat 191

                                                                       
Query: 483 aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcgg 542
           |||||||||||||||||||||||||||||||||||||||| || |  ||||| || | | 
Sbjct: 190 aggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccgtga 131

                                                       
Query: 543 ctacgaggagcatggcggccaccagggcgaccagcacgagctga 586
           || |||||||||| |||||||||| |||||| ||||||| ||||
Sbjct: 130 ctgcgaggagcatagcggccaccacggcgacgagcacgacctga 87



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 46  gggagtgaaggaacaaccaaacatggatagaacagtatggccggccatgcaga 98
           ||||||| | |||||||||||||| |||| |||||| ||||||||||||||||
Sbjct: 638 gggagtggaagaacaaccaaacatcgatacaacagtgtggccggccatgcaga 586



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 168 atatgagagcatttattcatatatat 193
           ||||||||||||||||||||||||||
Sbjct: 540 atatgagagcatttattcatatatat 515



to top

>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score =  373 bits (188), Expect = e-100
 Identities = 305/344 (88%)
 Strand = Plus / Minus

                                                                        
Query: 243  ggcagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagg 302
            ||||||||||| | |||||| ||||||||||||||||||| |||| ||||||||||||||
Sbjct: 1621 ggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgtagg 1562

                                                                        
Query: 303  ggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccag 362
            ||||||| ||||||||| | | |||||||||||||||||||||||| || |||||| |||
Sbjct: 1561 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcccagcag 1502

                                                                        
Query: 363  cagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccgg 422
            ||||||||||||||||||||||| ||||||| ||||||||||||||| |||| | || ||
Sbjct: 1501 cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctgagctgg 1442

                                                                        
Query: 423  ccagtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcat 482
            | || ||| | ||||||||||||||||||||||  ||  |||||||||||||||| ||||
Sbjct: 1441 ctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcat 1382

                                                                        
Query: 483  aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcgg 542
            |||||||||||||||||||||||||||||||||||||||| || | |||||| || | | 
Sbjct: 1381 aggagatgcaggggctcaaggcagagctcacctgaccgcacgatacggccgcctccgtga 1322

                                                        
Query: 543  ctacgaggagcatggcggccaccagggcgaccagcacgagctga 586
            || |||||||||| |||||||||| |||||| ||||||| ||||
Sbjct: 1321 ctgcgaggagcatagcggccaccacggcgacgagcacgacctga 1278



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                 
Query: 46   gggagtgaaggaacaaccaaacatggatagaacagtatggccggccatgcaga 98
            ||||||| |||||||||||||||| |||| |||||| ||||||||||||||||
Sbjct: 1826 gggagtggaggaacaaccaaacatcgatataacagtgtggccggccatgcaga 1774



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 163  agataatatgagagcatttattcatatatatgtatgtatgtg 204
            ||||||||||||||||||||||||||||||||| ||| ||||
Sbjct: 1738 agataatatgagagcatttattcatatatatgtgtgtgtgtg 1697



to top

>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score =  359 bits (181), Expect = 7e-96
 Identities = 292/329 (88%)
 Strand = Plus / Minus

                                                                       
Query: 243 ggcagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagg 302
           ||||||||||| | |||||||||||||||||||||||||| |||| |||||||||||| |
Sbjct: 329 ggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaag 270

                                                                       
Query: 303 ggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccag 362
           ||||||| ||||||||| | | ||||||||||||||||||||||||||| |||||| |||
Sbjct: 269 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 210

                                                                       
Query: 363 cagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccgg 422
           ||||||||||||||||||||||||||||||| ||||||||||||||| |||| | || ||
Sbjct: 209 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 150

                                                                       
Query: 423 ccagtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcat 482
           | || ||| | ||||||||||||||||||||||  ||  |||||||||||||||| ||||
Sbjct: 149 ctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcat 90

                                                                       
Query: 483 aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcgg 542
           |||||||||||||||||||||||||||||||||||||||| || |  ||||| || | | 
Sbjct: 89  aggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccgtga 30

                                        
Query: 543 ctacgaggagcatggcggccaccagggcg 571
           || |||||||||| || ||||||| ||||
Sbjct: 29  ctgcgaggagcatagcagccaccacggcg 1



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 46  gggagtgaaggaacaaccaaacatggatagaacagtatggccggccatgcaga 98
           ||||||| | |||||||||||||| |||| |||||| ||||||||||||||||
Sbjct: 535 gggagtggaagaacaaccaaacatcgatacaacagtgtggccggccatgcaga 483



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 163 agataatatgagagcatttattcatatatat 193
           |||||||||||||||||||||||||||||||
Sbjct: 442 agataatatgagagcatttattcatatatat 412



to top

>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  333 bits (168), Expect = 4e-88
 Identities = 303/348 (87%)
 Strand = Plus / Minus

                                                                       
Query: 259 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 318
           ||||||||||||||||||||| ||||| | ||| ||||||||||||| ||||||||||||
Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289

                                                                       
Query: 319 catggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgca 378
           | ||||||||||||| |||||||| |||||||| |||||||||||||| ||||| |||||
Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229

                                                                       
Query: 379 cttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgcc 438
           ||||||||||||||| ||||||||||||||| | || ||||||||||| ||| |||| ||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169

                                                                       
Query: 439 gctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 498
            ||||||||||||||||| ||  ||| |||| ||||||| ||||||||||||||||||||
Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 499 caaggcagagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggc 558
           |||||||||||||||||| || |||||||| || ||||| | ||||  ||||| ||| ||
Sbjct: 108 caaggcagagctcacctggccacaggagattgcagcgtctgtggctgtgaggaccattgc 49

                                                           
Query: 559 ggccaccagggcgaccagcacgagctgactagctgcagcgcgagccat 606
            ||||| |||| || || |||||| |||  ||||||||| || |||||
Sbjct: 48  tgccacgagggtgaacaacacgagttgagcagctgcagcacgggccat 1



to top

>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  236 bits (119), Expect = 7e-59
 Identities = 293/351 (83%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 316
           |||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||||
Sbjct: 429 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 370

                                                                       
Query: 317 cacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatg 376
           ||| ||||||| ||||| |||||||||   | ||| ||||| || ||| | ||||||| |
Sbjct: 369 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 310

                                                                       
Query: 377 cacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacg 436
           ||| |||| |  ||||| ||||| ||||||||| | ||   |||||||| | || |||||
Sbjct: 309 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 250

                                                                       
Query: 437 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 496
           ||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || |||||||
Sbjct: 249 ccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggg 190

                                                                       
Query: 497 ctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatg 556
            ||||||||||||||||||| ||||||  |||||||||||||| |||| |||||| ||| 
Sbjct: 189 gtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcatt 130

                                                              
Query: 557 gcggccaccagggcgaccagcacgagctgactagctgcagcgcgagccatc 607
           || ||||||||||||||||||||||||| | ||||||||| ||||||||||
Sbjct: 129 gccgccaccagggcgaccagcacgagcttagtagctgcagtgcgagccatc 79



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 156 cacatgaagataatatgagagcatttattcatatatatgtatgtatgtgt 205
           |||||| |||| |||| ||||||||||||||| ||||||||| |||||||
Sbjct: 548 cacatggagatcatatcagagcatttattcatgtatatgtatatatgtgt 499



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 40  ctcaaagggagtgaaggaacaaccaaac 67
           ||||||||||||||| |||||| |||||
Sbjct: 645 ctcaaagggagtgaacgaacaatcaaac 618



to top

>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score =  236 bits (119), Expect = 7e-59
 Identities = 293/351 (83%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 316
           |||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||||
Sbjct: 370 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 311

                                                                       
Query: 317 cacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatg 376
           ||| ||||||| ||||| |||||||||   | ||| ||||| || ||| | ||||||| |
Sbjct: 310 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 251

                                                                       
Query: 377 cacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacg 436
           ||| |||| |  ||||| ||||| ||||||||| | ||   |||||||| | || |||||
Sbjct: 250 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 191

                                                                       
Query: 437 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 496
           ||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || |||||||
Sbjct: 190 ccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggg 131

                                                                       
Query: 497 ctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatg 556
            ||||||||||||||||||| ||||||  |||||||||||||| |||| |||||| ||| 
Sbjct: 130 gtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcatt 71

                                                              
Query: 557 gcggccaccagggcgaccagcacgagctgactagctgcagcgcgagccatc 607
           || ||||||||||||||||||||||||| | ||||||||| ||||||||||
Sbjct: 70  gccgccaccagggcgaccagcacgagcttagtagctgcagtgcgagccatc 20



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 156 cacatgaagataatatgagagcatttattcatatatatgtatgtatgtgt 205
           |||||| |||| |||| ||||||||||||||| ||||||||| |||||||
Sbjct: 489 cacatggagatcatatcagagcatttattcatgtatatgtatatatgtgt 440



to top

>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  228 bits (115), Expect = 2e-56
 Identities = 292/351 (83%)
 Strand = Plus / Minus

                                                                        
Query: 257  gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 316
            |||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||||
Sbjct: 3206 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 3147

                                                                        
Query: 317  cacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatg 376
            ||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||||
Sbjct: 3146 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 3087

                                                                        
Query: 377  cacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacg 436
            ||| |||| |||||||| ||||| ||||||||| | ||   |||||||| |||| | || 
Sbjct: 3086 cacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaact 3027

                                                                        
Query: 437  ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 496
            |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||||| |
Sbjct: 3026 ccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggag 2967

                                                                        
Query: 497  ctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatg 556
              || ||||||| ||||||||||||||||||| |||||||||| |||||| |||||||| 
Sbjct: 2966 gccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcatt 2907

                                                               
Query: 557  gcggccaccagggcgaccagcacgagctgactagctgcagcgcgagccatc 607
            || |||||||||||||||||||||||||   | ||||||| ||||||||||
Sbjct: 2906 gccgccaccagggcgaccagcacgagctttgttgctgcagtgcgagccatc 2856



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 156  cacatgaagataatatgagagcatttattcatatatatgt 195
            |||||| |||| |||| ||||||||||||||| |||||||
Sbjct: 3339 cacatggagatcatatcagagcatttattcatgtatatgt 3300



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                     
Query: 186  atatatatgtatgtatgtgtaacctcaacgtactcagcgtcgattgctggggctata 242
            |||||||| | ||| ||||| |||||||||||||| || || || ||||| ||||||
Sbjct: 3289 atatatatatgtgtgtgtgtgacctcaacgtactcggcatctatcgctggagctata 3233



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 40   ctcaaagggagtgaaggaacaaccaaac 67
            ||||||||||||||| |||||| |||||
Sbjct: 3436 ctcaaagggagtgaacgaacaatcaaac 3409



to top

>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  228 bits (115), Expect = 2e-56
 Identities = 292/351 (83%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 316
           |||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||||
Sbjct: 410 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 351

                                                                       
Query: 317 cacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatg 376
           ||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||||
Sbjct: 350 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 291

                                                                       
Query: 377 cacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacg 436
           ||| |||| |||||||| ||||| ||||||||| | ||   |||||||| |||| | || 
Sbjct: 290 cacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaact 231

                                                                       
Query: 437 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 496
           |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||||| |
Sbjct: 230 ccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggag 171

                                                                       
Query: 497 ctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatg 556
             || ||||||| ||||||||||||||||||| |||||||||| |||||| |||||||| 
Sbjct: 170 gccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcatt 111

                                                              
Query: 557 gcggccaccagggcgaccagcacgagctgactagctgcagcgcgagccatc 607
           || |||||||||||||||||||||||||   | ||||||| ||||||||||
Sbjct: 110 gccgccaccagggcgaccagcacgagctttgttgctgcagtgcgagccatc 60



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                       
Query: 1   agtgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaaca 60
           ||||||||||||||||| ||||| ||||||  |  ||  ||||||||||||||| |||||
Sbjct: 679 agtgcacatggtacaaagtacaacaaactcccgtctctgctcaaagggagtgaacgaaca 620

                  
Query: 61  accaaac 67
           | |||||
Sbjct: 619 atcaaac 613



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 156 cacatgaagataatatgagagcatttattcatatatatgt 195
           |||||| |||| |||| ||||||||||||||| |||||||
Sbjct: 543 cacatggagatcatatcagagcatttattcatgtatatgt 504



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 186 atatatatgtatgtatgtgtaacctcaacgtactcagcgtcgattgctggggctata 242
           |||||||| | ||| ||||| |||||||||||||| || || || ||||| ||||||
Sbjct: 493 atatatatatgtgtgtgtgtgacctcaacgtactcggcatctatcgctggagctata 437



to top

>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score =  224 bits (113), Expect = 3e-55
 Identities = 284/341 (83%)
 Strand = Plus / Minus

                                                                       
Query: 266 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 325
           |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 326 gggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcac 385
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 386 gccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcag 445
           |||||||| ||||| ||||||||| | ||   |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 446 caggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 505
           |||||| |||||||  |||| ||| ||||    || ||||||| ||||| |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 506 gagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggcggccacc 565
           ||| ||||||||||||||||||| |||||||||| |||||| |||||||| || ||||||
Sbjct: 101 gagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcattgccgccacc 42

                                                    
Query: 566 agggcgaccagcacgagctgactagctgcagcgcgagccat 606
           |||||||||||||||||||   | ||||||| |||||||||
Sbjct: 41  agggcgaccagcacgagctttgttgctgcagtgcgagccat 1



to top

>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds
          Length = 348

 Score =  224 bits (113), Expect = 3e-55
 Identities = 284/341 (83%)
 Strand = Plus / Minus

                                                                       
Query: 266 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 325
           |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282

                                                                       
Query: 326 gggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcac 385
           || ||||| |||||||||   | ||| ||||| || ||| | ||||||| |||| |||| 
Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222

                                                                       
Query: 386 gccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcag 445
           |  ||||| ||||| ||||||||| | ||   |||||||| | || ||||||||||||||
Sbjct: 221 gtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgccgctgcag 162

                                                                       
Query: 446 caggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 505
           |||||| ||| |||  |||  ||| ||||    ||||||| || ||||||| ||||||||
Sbjct: 161 caggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggggtcaaggca 102

                                                                       
Query: 506 gagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggcggccacc 565
           ||||||||||| ||||||  |||||||||||||| |||| |||||| ||| || ||||||
Sbjct: 101 gagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcattgccgccacc 42

                                                    
Query: 566 agggcgaccagcacgagctgactagctgcagcgcgagccat 606
           ||||||||||||||||| | | ||||||||| |||||||||
Sbjct: 41  agggcgaccagcacgagtttagtagctgcagtgcgagccat 1



to top

>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete
           cds
          Length = 345

 Score =  216 bits (109), Expect = 7e-53
 Identities = 259/309 (83%)
 Strand = Plus / Minus

                                                                       
Query: 298 gtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagccc 357
           ||||||||||||||||| |||| ||||||||||  | |||||| ||||  | || | |||
Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250

                                                                       
Query: 358 accagcagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagc 417
           ||| ||||| ||||||||||||  |||||||||||  ||||||||||   ||||  |   
Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190

                                                                       
Query: 418 gccggccagtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcg 477
           |||||||| |||| |||||||||||||||||||||||| |||  ||||||||||||||||
Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130

                                                                       
Query: 478 ggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtc 537
            |||||||| | ||| ||||  | ||| ||||||||||| ||||||||||| ||||||||
Sbjct: 129 tgcataggaaaggcacgggccaagggcggagctcacctggccgcaggagattgccgcgtc 70

                                                                       
Query: 538 ggcggctacgaggagcatggcggccaccagggcgaccagcacgagctgactagctgcagc 597
           || |||||| ||||| |  || ||||||||||||||||||||||||| | |||||| || 
Sbjct: 69  ggaggctacaaggaggagtgccgccaccagggcgaccagcacgagcttagtagctgtagt 10

                    
Query: 598 gcgagccat 606
           |||||||||
Sbjct: 9   gcgagccat 1



to top

>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  208 bits (105), Expect = 2e-50
 Identities = 282/341 (82%)
 Strand = Plus / Minus

                                                                       
Query: 266 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 325
           ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 326 gggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcac 385
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 386 gccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcag 445
           |||||||| ||||| ||||||||| | ||   |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 446 caggccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 505
           |||||| |||||||  |||| ||| ||||    || ||||||| ||||| |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 506 gagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggcggccacc 565
           ||| ||||||||||||||| ||| |||||||||| |||||| |||||||| || ||||||
Sbjct: 101 gagttcacctgaccgcaggggatcgccgcgtcggaggctaccaggagcattgccgccacc 42

                                                    
Query: 566 agggcgaccagcacgagctgactagctgcagcgcgagccat 606
           |||||||||||||||||||   | ||||||| |||||||||
Sbjct: 41  agggcgaccagcacgagctttgttgctgcagtgcgagccat 1



to top

>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score =  204 bits (103), Expect = 3e-49
 Identities = 289/351 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 316
           |||||| | ||||| |||||||||||    |||||||| | |||||||||||||||||||
Sbjct: 352 gatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgccg 293

                                                                       
Query: 317 cacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatg 376
           ||| ||||||||||||| |||||| |||| |||||   | | || ||  | ||||||| |
Sbjct: 292 cacctggaggggatgcctgcggccctgccggcgttgtacgcgccggcgacactcttgagg 233

                                                                       
Query: 377 cacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacg 436
           ||| ||||||  ||||| ||||| ||||||||| | ||   |||||||| ||||||||| 
Sbjct: 232 cacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttgact 173

                                                                       
Query: 437 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 496
           ||||| |||||| ||||||  ||  ||| |||| ||||    || |||| |  |||||||
Sbjct: 172 ccgctacagcagcccgcagaagggctggtgccgctgccttttgcgtaggcggcgcagggg 113

                                                                       
Query: 497 ctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatg 556
           | |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| 
Sbjct: 112 cccaaggcagagctcacctggccgcaggtgatggccgcgtcggcggctacgaggagcatt 53

                                                              
Query: 557 gcggccaccagggcgaccagcacgagctgactagctgcagcgcgagccatc 607
           || |||||||||||||||||| ||||||   | ||||||| ||||||||||
Sbjct: 52  gccgccaccagggcgaccagcgcgagcttggttgctgcagtgcgagccatc 2



to top

>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score =  188 bits (95), Expect = 2e-44
 Identities = 287/351 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 316
           |||||| | ||||| |||||||||||    |||||||| | ||||||||||||||| |||
Sbjct: 423 gatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccccg 364

                                                                       
Query: 317 cacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgctcttgatg 376
           ||| ||||||||||||| |||||| | || |||||   | | || ||  | ||||||| |
Sbjct: 363 cacctggaggggatgcctgcggcccttccggcgttgtacgcgccggcgacactcttgagg 304

                                                                       
Query: 377 cacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacg 436
           ||| ||||||  ||||| ||||| ||||||||| | ||   |||||||| ||||||||| 
Sbjct: 303 cacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttgact 244

                                                                       
Query: 437 ccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcagggg 496
           ||||| |||||| ||||||  ||  ||| |||| ||||    || |||| |  |||||||
Sbjct: 243 ccgctacagcagcccgcagaagggctggtgccgctgccttttgcgtaggcggcgcagggg 184

                                                                       
Query: 497 ctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatg 556
           | |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| 
Sbjct: 183 cccaaggcagagctcacctggccgcaggtgatggccgcgtcggcggctacgaggagcatt 124

                                                              
Query: 557 gcggccaccagggcgaccagcacgagctgactagctgcagcgcgagccatc 607
           || |||||||||||||||||| ||||||   | ||||||| ||||||||||
Sbjct: 123 gccgccaccagggcgaccagcgcgagcttggttgctgcagtgcgagccatc 73



to top

>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score =  139 bits (70), Expect = 1e-29
 Identities = 234/287 (81%), Gaps = 5/287 (1%)
 Strand = Plus / Minus

                                                                       
Query: 173 agagcatttattcatatatatgtatgtatgtgta----acctcaacgtactcagcgtcga 228
           |||| |||||||||| ||||||||| ||||||||    |||||||| |||  ||||||||
Sbjct: 508 agaggatttattcatgtatatgtatatatgtgtatgtgacctcaacctaccaagcgtcga 449

                                                                       
Query: 229 ttgctggggctataggcagcaagtggttgatcagcgaatcttagagcagtcgacggaagc 288
           | ||||| | ||| || |||| ||| | |||||| | |||||||||||||||||    ||
Sbjct: 448 tcgctggagatatggggagcacgtgttcgatcagtggatcttagagcagtcgacactggc 389

                                                                       
Query: 289 gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagc 348
           |||||| | |||||||||||||||||||||| ||||||||||||| |||||| |||| ||
Sbjct: 388 gctgatcgtgtaggggacgctgacgccgcacctggaggggatgcctgcggccctgccggc 329

                                                                       
Query: 349 gtttagcccaccagcagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgct 408
           |||   | | || ||| | ||||||| |||| ||||||  ||||| ||||| ||||||||
Sbjct: 328 gttgtacgcgccggca-cactcttgaggcacctgcacgtagcttgcttgtcggcggtgct 270

                                                          
Query: 409 ctgggcagcgccggccagtctcttgacgccgctgcagcaggccgcag 455
           | | ||   |||||||| ||||||||| ||||| |||||| ||||||
Sbjct: 269 ccgcgctaagccggccaatctcttgactccgctacagcagcccgcag 223



 Score =  109 bits (55), Expect = 1e-20
 Identities = 103/118 (87%), Gaps = 2/118 (1%)
 Strand = Plus / Minus

                                                                       
Query: 490 gcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggctacgag 549
           |||||||| |||||||||||||||||| ||||||| ||||  ||||||||||||||||||
Sbjct: 189 gcaggggcccaaggcagagctcacctggccgcaggtgatg--cgcgtcggcggctacgag 132

                                                                     
Query: 550 gagcatggcggccaccagggcgaccagcacgagctgactagctgcagcgcgagccatc 607
           |||||| || ||||||||||  |||||| ||||||   | ||||||| ||||||||||
Sbjct: 131 gagcattgccgccaccaggggcaccagcgcgagcttggttgctgcagtgcgagccatc 74



to top

>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Plus

                                                                         
Query: 270   tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 329
             |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080

                                         
Query: 330   tgccggcggccttgccagcgtttagccc 357
             ||| |||||| ||||| ||||| |||||
Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 87/108 (80%)
 Strand = Plus / Plus

                                                                         
Query: 434   acgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcag 493
             |||||| ||||||||||||| |  ||   |||||||  ||||||||| |||| || ||||
Sbjct: 94194 acgccgttgcagcaggccgcggaagggccggcgccgccgccgcgggcgtaggtgaggcag 94253

                                                             
Query: 494   gggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcg 541
             ||||  | ||| ||| ||||||| ||||||| ||||||| || |||||
Sbjct: 94254 gggccaacggctgagttcacctggccgcaggtgatggccacggcggcg 94301



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                            
Query: 270      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 329
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000

                                            
Query: 330      tgccggcggccttgccagcgtttagccc 357
                ||| |||||| ||||| ||||| |||||
Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972



 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 332    ccggcggccttgccagcgtttagccc 357
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 332    ccggcggccttgccagcgtt 351
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 332    ccggcg 337
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 87/108 (80%)
 Strand = Plus / Minus

                                                                            
Query: 434      acgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcag 493
                |||||| ||||||||||||| |  ||   |||||||  ||||||||| |||| || ||||
Sbjct: 13089886 acgccgttgcagcaggccgcggaagggccggcgccgccgccgcgggcgtaggtgaggcag 13089827

                                                                
Query: 494      gggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcg 541
                ||||  | ||| ||| ||||||| ||||||| ||||||| || |||||
Sbjct: 13089826 gggccaacggctgagttcacctggccgcaggtgatggccacggcggcg 13089779



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 432    tgacgccgctgcagcaggccgc 453
              ||||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggccgc 692574



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 186     atatatatgtatgtatgtgt 205
               ||||||||||||||||||||
Sbjct: 2482379 atatatatgtatgtatgtgt 2482398



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 304    gacgctgacgccgcacatggaggggatgccggcggc 339
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 434    acgccgctgcagcaggccgc 453
              ||||||||||||||||||||
Sbjct: 702270 acgccgctgcagcaggccgc 702251



to top

>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                       
Query: 270 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 329
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400

                                       
Query: 330 tgccggcggccttgccagcgtttagccc 357
           ||| |||||| ||||| ||||| |||||
Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 87/108 (80%)
 Strand = Plus / Minus

                                                                       
Query: 434 acgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcag 493
           |||||| ||||||||||||| |  ||   |||||||  ||||||||| |||| || ||||
Sbjct: 286 acgccgttgcagcaggccgcggaagggccggcgccgccgccgcgggcgtaggtgaggcag 227

                                                           
Query: 494 gggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcg 541
           ||||  | ||| ||| ||||||| ||||||| ||||||| || |||||
Sbjct: 226 gggccaacggctgagttcacctggccgcaggtgatggccacggcggcg 179



to top

>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                       
Query: 270 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 329
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399

                                       
Query: 330 tgccggcggccttgccagcgtttagccc 357
           ||| |||||| ||||| ||||| |||||
Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 87/108 (80%)
 Strand = Plus / Minus

                                                                       
Query: 434 acgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcag 493
           |||||| ||||||||||||| |  ||   |||||||  ||||||||| |||| || ||||
Sbjct: 285 acgccgttgcagcaggccgcggaagggccggcgccgccgccgcgggcgtaggtgaggcag 226

                                                           
Query: 494 gggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcg 541
           ||||  | ||| ||| ||||||| ||||||| ||||||| || |||||
Sbjct: 225 gggccaacggctgagttcacctggccgcaggtgatggccacggcggcg 178



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                            
Query: 270      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 329
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179

                                            
Query: 330      tgccggcggccttgccagcgtttagccc 357
                ||| |||||| ||||| ||||| |||||
Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151



 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 332    ccggcggccttgccagcgtttagccc 357
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 332    ccggcggccttgccagcgtt 351
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 332    ccggcg 337
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 87/108 (80%)
 Strand = Plus / Minus

                                                                            
Query: 434      acgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagatgcag 493
                |||||| ||||||||||||| |  ||   |||||||  ||||||||| |||| || ||||
Sbjct: 13170065 acgccgttgcagcaggccgcggaagggccggcgccgccgccgcgggcgtaggtgaggcag 13170006

                                                                
Query: 494      gggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcg 541
                ||||  | ||| ||| ||||||| ||||||| ||||||| || |||||
Sbjct: 13170005 gggccaacggctgagttcacctggccgcaggtgatggccacggcggcg 13169958



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 432    tgacgccgctgcagcaggccgc 453
              ||||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggccgc 692574



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 186     atatatatgtatgtatgtgt 205
               ||||||||||||||||||||
Sbjct: 2491453 atatatatgtatgtatgtgt 2491472



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 304    gacgctgacgccgcacatggaggggatgccggcggc 339
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 434    acgccgctgcagcaggccgc 453
              ||||||||||||||||||||
Sbjct: 702270 acgccgctgcagcaggccgc 702251



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 332    ccggcggccttgccagcgtttagccc 357
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 332    ccggcggccttgccagcgtt 351
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 332    ccggcg 337
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 432    tgacgccgctgcagcaggccgc 453
              ||||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggccgc 732426



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 304    gacgctgacgccgcacatggaggggatgccggcggc 339
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 434    acgccgctgcagcaggccgc 453
              ||||||||||||||||||||
Sbjct: 736572 acgccgctgcagcaggccgc 736553



to top

>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354

                                     
Query: 332 ccggcggccttgccagcgtttagccc 357
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328



to top

>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611

                                     
Query: 332 ccggcggccttgccagcgtttagccc 357
           | |||||| ||||| ||||| |||||
Sbjct: 610 ctggcggcgttgccggcgttgagccc 585



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 434 acgccgctgcagcaggccgc 453
           ||||||||||||||||||||
Sbjct: 499 acgccgctgcagcaggccgc 480



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 332    ccggcggccttgccagcgtttagccc 357
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 332    ccggcggccttgccagcgtt 351
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 272    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 332    ccggcg 337
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 432    tgacgccgctgcagcaggccgc 453
              ||||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggccgc 732426



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 304    gacgctgacgccgcacatggaggggatgccggcggc 339
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 434    acgccgctgcagcaggccgc 453
              ||||||||||||||||||||
Sbjct: 736572 acgccgctgcagcaggccgc 736553



to top

>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score =  115 bits (58), Expect = 2e-22
 Identities = 79/86 (91%)
 Strand = Plus / Plus

                                                                         
Query: 272   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
             |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450

                                       
Query: 332   ccggcggccttgccagcgtttagccc 357
             | |||||| ||||| ||||| |||||
Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                         
Query: 272   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577

                                 
Query: 332   ccggcggccttgccagcgtt 351
             | |||||| ||||| |||||
Sbjct: 46578 ctggcggcattgccggcgtt 46597



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 272   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
             |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466

                   
Query: 332   ccggcg 337
             ||||||
Sbjct: 56467 ccggcg 56472



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 432   tgacgccgctgcagcaggccgc 453
             ||||||||||||||||||||||
Sbjct: 46687 tgacgccgctgcagcaggccgc 46708



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 434   acgccgctgcagcaggccgc 453
             ||||||||||||||||||||
Sbjct: 42562 acgccgctgcagcaggccgc 42581



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 304   gacgctgacgccgcacatggaggggatgccggcggc 339
             |||| ||||||||||| ||  |||||||||||||||
Sbjct: 33579 gacgttgacgccgcacttgccggggatgccggcggc 33614



to top

>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367

                                     
Query: 332 ccggcggccttgccagcgtttagccc 357
           | |||||| ||||| ||||| |||||
Sbjct: 366 ctggcggcgttgccggcgttgagccc 341



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 434 acgccgctgcagcaggccgc 453
           ||||||||||||||||||||
Sbjct: 255 acgccgctgcagcaggccgc 236



to top

>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 332 ccggcggccttgccagcgtttagccc 357
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 434 acgccgctgcagcaggccgc 453
           ||||||||||||||||||||
Sbjct: 267 acgccgctgcagcaggccgc 248



to top

>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                        
Query: 272  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
            |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386

                                      
Query: 332  ccggcggccttgccagcgtttagccc 357
            | |||||| ||||| ||||| |||||
Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 434  acgccgctgcagcaggccgc 453
            ||||||||||||||||||||
Sbjct: 2274 acgccgctgcagcaggccgc 2255



to top

>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263

                                     
Query: 332 ccggcggccttgccagcgtttagccc 357
           | |||||| ||||| ||||| |||||
Sbjct: 262 ctggcggcgttgccggcgttgagccc 237



to top

>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Plus

                                                                         
Query: 272   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
             |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590

                                       
Query: 332   ccggcggccttgccagcgtttagccc 357
             | |||||| ||||| ||||| |||||
Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                         
Query: 272   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267

                                 
Query: 332   ccggcggccttgccagcgtt 351
             | |||||| ||||| |||||
Sbjct: 50268 ctggcggcattgccggcgtt 50287



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 272   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
             |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562

                   
Query: 332   ccggcg 337
             ||||||
Sbjct: 63563 ccggcg 63568



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 432   tgacgccgctgcagcaggccgc 453
             ||||||||||||||||||||||
Sbjct: 50377 tgacgccgctgcagcaggccgc 50398



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 434   acgccgctgcagcaggccgc 453
             ||||||||||||||||||||
Sbjct: 40702 acgccgctgcagcaggccgc 40721



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 304   gacgctgacgccgcacatggaggggatgccggcggc 339
             |||| ||||||||||| ||  |||||||||||||||
Sbjct: 28127 gacgttgacgccgcacttgccggggatgccggcggc 28162



to top

>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 332 ccggcggccttgccagcgtttagccc 357
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 434 acgccgctgcagcaggccgc 453
           ||||||||||||||||||||
Sbjct: 267 acgccgctgcagcaggccgc 248



to top

>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           ||||||| || |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314

                                     
Query: 332 ccggcggccttgccagcgtttagccc 357
           | |||||| ||||| ||||| |||||
Sbjct: 313 ctggcggcgttgccggcgttgagccc 288



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 434 acgccgctgcagcaggccgc 453
           ||||||||||||||||||||
Sbjct: 202 acgccgctgcagcaggccgc 183



to top

>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds
          Length = 805

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 78/86 (90%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| |||||||||||||| |||||| ||||||||||||||| |||||||||||
Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354

                                     
Query: 332 ccggcggccttgccagcgtttagccc 357
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328



to top

>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 409 ctggcggcattgccggcgtt 390



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 432 tgacgccgctgcagcaggccgc 453
           ||||||||||||||||||||||
Sbjct: 300 tgacgccgctgcagcaggccgc 279



to top

>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 641 ctggcggcattgccggcgtt 622



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 432 tgacgccgctgcagcaggccgc 453
           ||||||||||||||||||||||
Sbjct: 532 tgacgccgctgcagcaggccgc 511



to top

>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 234 ctggcggcgttgccggcgtt 215



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 506 gagctcacctgaccgcaggagatggccgc 534
           ||||||||||| |||||||||||||||||
Sbjct: 54  gagctcacctgcccgcaggagatggccgc 26



to top

>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 937 ctggcggcgttgccggcgtt 918



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 506 gagctcacctgaccgcaggagatggccgc 534
           ||||||||||| |||||||||||||||||
Sbjct: 754 gagctcacctgcccgcaggagatggccgc 726



to top

>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 271 ctggcggcattgccggcgtt 252



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 432 tgacgccgctgcagcaggccgc 453
           ||||||||||||||||||||||
Sbjct: 162 tgacgccgctgcagcaggccgc 141



to top

>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 594 ctggcggcattgccggcgtt 575



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 432 tgacgccgctgcagcaggccgc 453
           ||||||||||||||||||||||
Sbjct: 485 tgacgccgctgcagcaggccgc 464



to top

>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 377 ctggcggcattgccggcgtt 358



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 432 tgacgccgctgcagcaggccgc 453
           ||||||||||||||||||||||
Sbjct: 268 tgacgccgctgcagcaggccgc 247



to top

>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 359 ctggcggcattgccggcgtt 340



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 432 tgacgccgctgcagcaggccgc 453
           ||||||||||||||||||||||
Sbjct: 250 tgacgccgctgcagcaggccgc 229



to top

>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                       
Query: 284 gaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttg 343
           |||| |||||||| |||||||| ||||||||||||| |||||||||||| |||||| |||
Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266

                      
Query: 344 ccagcgtttag 354
           || ||||||||
Sbjct: 265 ccggcgtttag 255



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 432 tgacgccgctgcagcaggccgc 453
           ||||||||||||||||||||||
Sbjct: 168 tgacgccgctgcagcaggccgc 147



to top

>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906

                         
Query: 332 ccggcggccttgcc 345
           | ||||||||||||
Sbjct: 905 ctggcggccttgcc 892



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                            
Query: 272      gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
                |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||||
Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005

                      
Query: 332      ccggcg 337
                ||||||
Sbjct: 14437004 ccggcg 14436999



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 187      tatatatgtatgtatgtgta 206
                ||||||||||||||||||||
Sbjct: 18544005 tatatatgtatgtatgtgta 18544024



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 180      ttattcatatatatgtatgtatgt 203
                |||| |||||||||||||||||||
Sbjct: 13185988 ttatacatatatatgtatgtatgt 13186011



to top

>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                         
Query: 272   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
             |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||||
Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503

                   
Query: 332   ccggcg 337
             ||||||
Sbjct: 45502 ccggcg 45497



to top

>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 363 ctggcggcgttgccggcgtt 344



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 215 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 156

            
Query: 531 c 531
           |
Sbjct: 155 c 155



to top

>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 273 ctggcggcgttgccggcgtt 254



to top

>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 428 ctcttgacgccgctgcagcag 448
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140



to top

>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 428 ctcttgacgccgctgcagcag 448
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140



to top

>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 374 ctggcggcgttgccggcgtt 355



to top

>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 391 ctggcggcgttgccggcgtt 372



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 428 ctcttgacgccgctgcagcag 448
           |||||||||||||||||||||
Sbjct: 286 ctcttgacgccgctgcagcag 266



to top

>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 531 c 531
           |
Sbjct: 76  c 76



to top

>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 531 c 531
           |
Sbjct: 76  c 76



to top

>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 531 c 531
           |
Sbjct: 76  c 76



to top

>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 531 c 531
           |
Sbjct: 76  c 76



to top

>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 531 c 531
           |
Sbjct: 76  c 76



to top

>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 531 c 531
           |
Sbjct: 76  c 76



to top

>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 531 c 531
           |
Sbjct: 76  c 76



to top

>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 531 c 531
           |
Sbjct: 76  c 76



to top

>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 136 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 77

            
Query: 531 c 531
           |
Sbjct: 76  c 76



to top

>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 110 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 51

            
Query: 531 c 531
           |
Sbjct: 50  c 50



to top

>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 110 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 51

            
Query: 531 c 531
           |
Sbjct: 50  c 50



to top

>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcgttgccggcgtt 335



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 206 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 147

            
Query: 531 c 531
           |
Sbjct: 146 c 146



to top

>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Plus

                                                                       
Query: 289 gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagc 348
           |||||||| |||||||| ||||||||||||| |||||||||||| |||||| ||||| ||
Sbjct: 97  gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156

              
Query: 349 gtt 351
           |||
Sbjct: 157 gtt 159



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 432 tgacgccgctgcagcaggccgc 453
           ||||||||||||||||||||||
Sbjct: 249 tgacgccgctgcagcaggccgc 270



to top

>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371

                 
Query: 332 ccggcg 337
           ||||||
Sbjct: 370 ccggcg 365



to top

>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                        
Query: 272  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
            |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457

                  
Query: 332  ccggcg 337
            ||||||
Sbjct: 3456 ccggcg 3451



to top

>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373

                 
Query: 332 ccggcg 337
           ||||||
Sbjct: 372 ccggcg 367



to top

>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375

                 
Query: 332 ccggcg 337
           ||||||
Sbjct: 374 ccggcg 369



to top

>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 374 ctggcggc 367



to top

>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||| ||| | |||||||| ||||||||   ||||||||||| |||||||||||
Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcattgccggcgtt 335



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 432 tgacgccgctgcagcaggccgc 453
           ||||||||||||||||||||||
Sbjct: 245 tgacgccgctgcagcaggccgc 224



to top

>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| ||||||| |||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



to top

>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 356 ctggcggc 349



to top

>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 281 ctggcggc 274



to top

>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 380 ctggcggc 373



to top

>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 393 ctggcggc 386



to top

>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 395 ctggcggc 388



to top

>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 393 ctggcggc 386



to top

>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 332 ccggcggccttgccagcgtt 351
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 471 tgccgcgggcataggagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg 530
           |||||||||| ||||||| ||||||    | ||| ||||||||||| ||||||| |||||
Sbjct: 207 tgccgcgggcgtaggagaggcagggcgcgatggcggagctcacctgcccgcaggtgatgg 148

            
Query: 531 c 531
           |
Sbjct: 147 c 147



to top

>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 204 ctggcggc 197



to top

>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 391 ctggcggc 384



to top

>gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 766

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||||| |||||| |||||||||| | |||| |||||| |||||||||||
Sbjct: 384 gagcagtcggtggaagggctgatagcgtaggggatgttgaccccgcacttggaggggatg 325

                 
Query: 332 ccggcg 337
           ||||||
Sbjct: 324 ccggcg 319



to top

>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | ||||||||  ||||||| ||||||||||||| |||||||||||
Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 259 ctggcggc 252



to top

>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 686

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||| | |||||||| |||||||| ||||||||| ||| |||||||||||
Sbjct: 320 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccacacttggaggggatg 261

                   
Query: 332 ccggcggc 339
           | ||||||
Sbjct: 260 ctggcggc 253



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 428 ctcttgacgccgctgcagcag 448
           |||||||||||||||||||||
Sbjct: 155 ctcttgacgccgctgcagcag 135



to top

>dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfer protein
          Length = 372

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 272 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 331
           |||||||||  ||||| ||||||| ||||||||| | ||||| ||||| |||||||||||
Sbjct: 141 gagcagtcggtggaagggctgatgccgtaggggatgttgacgtcgcacttggaggggatg 82

              
Query: 332 ccg 334
           |||
Sbjct: 81  ccg 79



to top

>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 289  gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 337
            ||||||||||||||||| | ||||||||||| ||  |||||||||||||
Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722



to top

>emb|CT025614.7| Mouse DNA sequence from clone RP23-418B18 on chromosome 13, complete
              sequence
          Length = 183907

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 179    tttattcatatatatgtatgtatgtg 204
              ||||||||||||||||||||||||||
Sbjct: 118142 tttattcatatatatgtatgtatgtg 118117



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   atatatatgtatgtatgtgt 205
             ||||||||||||||||||||
Sbjct: 84210 atatatatgtatgtatgtgt 84229



to top

>gb|AC131676.2| Mus musculus BAC clone RP23-330L3 from chromosome 6, complete sequence
          Length = 200673

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 181    tattcatatatatgtatgtatgtgt 205
              |||||||||||||||||||||||||
Sbjct: 131928 tattcatatatatgtatgtatgtgt 131904



to top

>emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chromosome X, complete
              sequence
          Length = 203581

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 178    atttattcatatatatgtatgtatgtgta 206
              |||||||||||| ||||||||||||||||
Sbjct: 198854 atttattcatatgtatgtatgtatgtgta 198826



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 187    tatatatgtatgtatgtgta 206
              ||||||||||||||||||||
Sbjct: 123103 tatatatgtatgtatgtgta 123122



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 187    tatatatgtatgtatgtgta 206
              ||||||||||||||||||||
Sbjct: 116271 tatatatgtatgtatgtgta 116290



to top

>emb|AL732451.8| Mouse DNA sequence from clone RP23-85G19 on chromosome X, complete
             sequence
          Length = 213822

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 182   attcatatatatgtatgtatgtgta 206
             |||||||||||||||||||||||||
Sbjct: 14549 attcatatatatgtatgtatgtgta 14525



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   atatatatgtatgtatgtgt 205
             ||||||||||||||||||||
Sbjct: 14408 atatatatgtatgtatgtgt 14427



to top

>gb|AC099975.11| Mus musculus chromosome 5, clone RP23-23A2, complete sequence
          Length = 213359

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 179    tttattcatatatatgtatgtatg 202
              ||||||||||||||||||||||||
Sbjct: 201655 tttattcatatatatgtatgtatg 201632



to top

>gb|AC131678.4| Mus musculus BAC clone RP23-333L1 from chromosome 3, complete sequence
          Length = 203750

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 178   atttattcatatatatgtatgtatgtgt 205
             |||||||||||| |||||||||||||||
Sbjct: 29729 atttattcatatgtatgtatgtatgtgt 29702



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 177    catttattcatatatatgtatgtatgtgt 205
              |||| |||||||||||||||||| |||||
Sbjct: 123704 cattcattcatatatatgtatgtgtgtgt 123732



to top

>gb|AC137691.7| Mus musculus chromosome 13, clone RP23-104G24, complete sequence
          Length = 204418

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 185    catatatatgtatgtatgtgtaac 208
              ||||||||||||||||||||||||
Sbjct: 163936 catatatatgtatgtatgtgtaac 163959



to top

>gb|AC116383.11| Mus musculus chromosome 5, clone RP23-15P21, complete sequence
          Length = 259299

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 179    tttattcatatatatgtatgtatg 202
              ||||||||||||||||||||||||
Sbjct: 103346 tttattcatatatatgtatgtatg 103323



to top

>gb|AC161590.2| Mus musculus BAC clone RP24-300B21 from chromosome 9, complete sequence
          Length = 162840

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 178    atttattcatatatatgtatgtat 201
              ||||||||||||||||||||||||
Sbjct: 121866 atttattcatatatatgtatgtat 121889



to top

>gb|AC098971.2| Homo sapiens chromosome 3 clone RP11-118N13, complete sequence
          Length = 175409

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 183    ttcatatatatgtatgtatgtgta 206
              ||||||||||||||||||||||||
Sbjct: 155851 ttcatatatatgtatgtatgtgta 155874



to top

>gb|AC012450.9| Homo sapiens BAC clone RP11-351J7 from 2, complete sequence
          Length = 183695

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 179    tttattcatatatatgtatgtatgtgta 206
              |||||||||||||||||||| |||||||
Sbjct: 146967 tttattcatatatatgtatgaatgtgta 146940



to top

>gb|AC093927.3| Homo sapiens chromosome 3 clone RP11-81I24, complete sequence
          Length = 183190

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 183    ttcatatatatgtatgtatgtgta 206
              ||||||||||||||||||||||||
Sbjct: 168554 ttcatatatatgtatgtatgtgta 168531



to top

>gb|AC102367.35| Mus musculus chromosome 3, clone RP23-211J6, complete sequence
          Length = 185452

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 178   atttattcatatatatgtatgtatgtgt 205
             |||||||||||| |||||||||||||||
Sbjct: 59063 atttattcatatgtatgtatgtatgtgt 59090



to top

>gb|AC164875.14| Mus musculus chromosome 1, clone RP23-59P14, complete sequence
          Length = 250957

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 177    catttattcatatatatgtatgtatgtg 204
              |||| |||||||||||||||||||||||
Sbjct: 140060 cattcattcatatatatgtatgtatgtg 140087



to top

>gb|AC122011.3| Mus musculus chromosome 10 clone RP24-352E6, complete sequence
          Length = 181468

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 183   ttcatatatatgtatgtatgtgt 205
             |||||||||||||||||||||||
Sbjct: 91974 ttcatatatatgtatgtatgtgt 91952



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 187    tatatatgtatgtatgtgta 206
              ||||||||||||||||||||
Sbjct: 156920 tatatatgtatgtatgtgta 156901



to top

>gb|AC131596.10| Mus musculus chromosome 10, clone RP23-476G10, complete sequence
          Length = 178668

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 181    tattcatatatatgtatgtatgt 203
              |||||||||||||||||||||||
Sbjct: 109912 tattcatatatatgtatgtatgt 109934



to top

>gb|AC129336.4| Mus musculus BAC clone RP23-113I7 from chromosome 10, complete
           sequence
          Length = 215437

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 183 ttcatatatatgtatgtatgtgt 205
           |||||||||||||||||||||||
Sbjct: 230 ttcatatatatgtatgtatgtgt 208



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 187   tatatatgtatgtatgtgta 206
             ||||||||||||||||||||
Sbjct: 65175 tatatatgtatgtatgtgta 65156



to top

>gb|AC146296.3| Mus musculus BAC clone RP23-277D1 from chromosome 9, complete sequence
          Length = 177641

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 181   tattcatatatatgtatgtatgt 203
             |||||||||||||||||||||||
Sbjct: 91375 tattcatatatatgtatgtatgt 91353



to top

>gb|AC122928.4| Mus musculus BAC clone RP23-10G8 from 9, complete sequence
          Length = 205725

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 181   tattcatatatatgtatgtatgt 203
             |||||||||||||||||||||||
Sbjct: 32985 tattcatatatatgtatgtatgt 33007



to top

>gb|AC121605.3| Mus musculus BAC clone RP23-312E16 from 1, complete sequence
          Length = 196494

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 181   tattcatatatatgtatgtatgt 203
             |||||||||||||||||||||||
Sbjct: 39306 tattcatatatatgtatgtatgt 39328



to top

>emb|AL391870.16| Human DNA sequence from clone RP11-491C24 on chromosome 9 Contains part
             of the CDK5RAP2 gene for CDK5 regulatory subunit
             associated protein 2 (C48) and a CpG island, complete
             sequence
          Length = 46372

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 181   tattcatatatatgtatgtatgt 203
             |||||||||||||||||||||||
Sbjct: 13639 tattcatatatatgtatgtatgt 13617



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 181   tattcatatatatgtatgtatgtgtaac 208
             |||| |||||||||||||||||| ||||
Sbjct: 13569 tatttatatatatgtatgtatgtataac 13542



to top

>emb|AL390785.15| Human DNA sequence from clone RP11-325N9 on chromosome 10, complete
              sequence
          Length = 203169

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 181    tattcatatatatgtatgtatgt 203
              |||||||||||||||||||||||
Sbjct: 119047 tattcatatatatgtatgtatgt 119025



to top

>gb|AC159096.2| Mus musculus chromosome 1, clone RP24-95N15, complete sequence
          Length = 189668

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 181    tattcatatatatgtatgtatgt 203
              |||||||||||||||||||||||
Sbjct: 139373 tattcatatatatgtatgtatgt 139351



to top

>emb|BX855592.19| Zebrafish DNA sequence from clone CH211-232K3, complete sequence
          Length = 159646

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 179    tttattcatatatatgtatgtat 201
              |||||||||||||||||||||||
Sbjct: 141945 tttattcatatatatgtatgtat 141967



to top

>gb|AC107028.5| Homo sapiens 3 BAC RP11-547K2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 126716

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 178    atttattcatatatatgtatgtatgtg 204
              |||||||||||||||||||||| ||||
Sbjct: 109602 atttattcatatatatgtatgtgtgtg 109628



to top

>gb|AC104823.4| Homo sapiens BAC clone RP11-762E8 from 2, complete sequence
          Length = 46638

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 180  ttattcatatatatgtatgtatg 202
            |||||||||||||||||||||||
Sbjct: 8434 ttattcatatatatgtatgtatg 8456



to top

>gb|AC139299.3| Mus musculus BAC clone RP23-335D20 from 1, complete sequence
          Length = 204848

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 179    tttattcatatatatgtatgtatgtgt 205
              |||||| ||||||||||||||||||||
Sbjct: 167582 tttatttatatatatgtatgtatgtgt 167556



to top

>gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein (BG14) mRNA,
           complete cds
          Length = 841

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 291 tgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 337
           |||||||||||||||   ||||||||||| ||  |||||||||||||
Sbjct: 401 tgatggcgtaggggatattgacgccgcacttgctggggatgccggcg 355



to top

>gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome 1, complete sequence
          Length = 149232

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 179   tttattcatatatatgtatgtatgtgt 205
             |||||| ||||||||||||||||||||
Sbjct: 17539 tttatttatatatatgtatgtatgtgt 17513



to top

>emb|AL772393.11| Mouse DNA sequence from clone RP23-398D18 on chromosome 4, complete
              sequence
          Length = 207495

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 181    tattcatatatatgtatgtatgt 203
              |||||||||||||||||||||||
Sbjct: 138493 tattcatatatatgtatgtatgt 138515



to top

>emb|AL732478.7| Mouse DNA sequence from clone RP23-42N14 on chromosome 2, complete
              sequence
          Length = 203434

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 184    tcatatatatgtatgtatgtgta 206
              |||||||||||||||||||||||
Sbjct: 149888 tcatatatatgtatgtatgtgta 149910



to top

>gb|AC113493.9| Mus musculus chromosome 15, clone RP23-359H23, complete sequence
          Length = 207687

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 64134 catatatatgtatgtatgtgta 64155



to top

>gb|AC130283.8| Mus musculus chromosome 15, clone RP23-136E18, complete sequence
          Length = 180660

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 170174 catatatatgtatgtatgtgta 170153



to top

>gb|AC116768.9| Mus musculus chromosome 8, clone RP23-395P10, complete sequence
          Length = 191757

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 187   tatatatgtatgtatgtgtaac 208
             ||||||||||||||||||||||
Sbjct: 17196 tatatatgtatgtatgtgtaac 17175



to top

>gb|AC154520.3| Mus musculus BAC clone RP23-471P16 from chromosome 14, complete sequence
          Length = 199186

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 141743 catatatatgtatgtatgtgta 141722



to top

>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence
          Length = 1618915

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 185     catatatatgtatgtatgtgta 206
               ||||||||||||||||||||||
Sbjct: 1332995 catatatatgtatgtatgtgta 1332974



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 186    atatatatgtatgtatgtgt 205
              ||||||||||||||||||||
Sbjct: 769752 atatatatgtatgtatgtgt 769771



to top

>gb|AC007863.15| Trypanosoma brucei chromosome 6 clone RPCI93-26G9, complete sequence
          Length = 140056

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 185  catatatatgtatgtatgtgta 206
            ||||||||||||||||||||||
Sbjct: 7918 catatatatgtatgtatgtgta 7939



to top

>gb|AC130666.9| Mus musculus chromosome 5, clone RP24-79O7, complete sequence
          Length = 172995

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 83415 catatatatgtatgtatgtgta 83436



to top

>gb|AC120555.9| Mus musculus chromosome 12, clone RP24-311D18, complete sequence
          Length = 164820

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 141269 catatatatgtatgtatgtgta 141248



to top

>gb|BT015295.1| Drosophila melanogaster GH02989 full insert cDNA
          Length = 4587

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 178  atttattcatatatatgtatgtatgt 203
            |||||| |||||||||||||||||||
Sbjct: 4454 atttatgcatatatatgtatgtatgt 4479



to top

>gb|AC129931.19| Mus musculus chromosome 15, clone RP23-136I22, complete sequence
          Length = 186914

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 184   tcatatatatgtatgtatgtgt 205
             ||||||||||||||||||||||
Sbjct: 63583 tcatatatatgtatgtatgtgt 63562



to top

>gb|AC007889.9| Drosophila melanogaster clone BACR48E12, complete sequence
          Length = 182182

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 186   atatatatgtatgtatgtgtaa 207
             ||||||||||||||||||||||
Sbjct: 47903 atatatatgtatgtatgtgtaa 47924



to top

>gb|AC130649.2| Drosophila melanogaster clone BACR06L03, complete sequence
          Length = 144234

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 178   atttattcatatatatgtatgtatgt 203
             |||||| |||||||||||||||||||
Sbjct: 45244 atttatgcatatatatgtatgtatgt 45219



to top

>gb|BC070803.1| Xenopus laevis hypothetical protein MGC83869, mRNA (cDNA clone
            MGC:83869 IMAGE:6643969), complete cds
          Length = 2472

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 185  catatatatgtatgtatgtgta 206
            ||||||||||||||||||||||
Sbjct: 1943 catatatatgtatgtatgtgta 1964



to top

>gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosome 8, complete sequence
          Length = 183218

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 178   atttattcatatatatgtatgtatgt 203
             |||||||||||| |||||||||||||
Sbjct: 57251 atttattcatatgtatgtatgtatgt 57276



to top

>gb|AC142111.3| Mus musculus BAC clone RP24-63G9 from chromosome 9, complete sequence
          Length = 185361

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 182    attcatatatatgtatgtatgt 203
              ||||||||||||||||||||||
Sbjct: 114691 attcatatatatgtatgtatgt 114670



to top

>gb|AC124361.4| Mus musculus BAC clone RP24-528I8 from chromosome 1, complete sequence
          Length = 172848

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 98687 catatatatgtatgtatgtgta 98708



to top

>gb|AC132844.7| Mus musculus chromosome 17, clone RP24-481P13, complete sequence
          Length = 225183

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 212183 catatatatgtatgtatgtgta 212162



to top

>gb|AC157549.4| Mus musculus chromosome 8, clone RP24-374O12, complete sequence
          Length = 132933

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 12190 catatatatgtatgtatgtgta 12211



to top

>gb|AC144522.12| Homo sapiens 12 BAC RP11-481J8 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 163515

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 136085 catatatatgtatgtatgtgta 136064



to top

>gb|AC113970.8| Mus musculus chromosome 1, clone RP23-125E16, complete sequence
          Length = 235703

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 186818 catatatatgtatgtatgtgta 186839



to top

>gb|AC124826.8| Mus musculus chromosome 12, clone RP23-455F18, complete sequence
          Length = 177979

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 158344 catatatatgtatgtatgtgta 158365



to top

>gb|AC112030.4| Rattus norvegicus 4 BAC CH230-100K8 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 237374

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 66552 catatatatgtatgtatgtgta 66573



to top

>gb|AC147066.2| Pan troglodytes BAC clone RP43-164F2 from 7, complete sequence
          Length = 149431

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 176   gcatttattcatatatatgtatgtat 201
             |||| |||||||||||||||||||||
Sbjct: 78715 gcatgtattcatatatatgtatgtat 78740



to top

>gb|AC146512.2| Pan troglodytes BAC clone RP43-16E21 from 7, complete sequence
          Length = 178648

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 176    gcatttattcatatatatgtatgtat 201
              |||| |||||||||||||||||||||
Sbjct: 105785 gcatgtattcatatatatgtatgtat 105760



to top

>gb|AC134331.2| Mus musculus BAC clone RP24-344O12 from chromosome 19, complete
             sequence
          Length = 155342

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 95703 catatatatgtatgtatgtgta 95724



to top

>gb|AC116322.5| Mus musculus BAC clone RP23-273O16 from chromosome 15, complete
            sequence
          Length = 190750

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 185  catatatatgtatgtatgtgta 206
            ||||||||||||||||||||||
Sbjct: 8052 catatatatgtatgtatgtgta 8031



to top

>gb|AC130219.3| Mus musculus BAC clone RP23-126O16 from chromosome 15, complete sequence
          Length = 224179

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 153379 catatatatgtatgtatgtgta 153400



to top

>gb|AC125108.3| Mus musculus BAC clone RP24-226A8 from chromosome 10, complete sequence
          Length = 148202

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 65197 catatatatgtatgtatgtgta 65218



to top

>gb|AC124740.4| Mus musculus BAC clone RP23-356M1 from chromosome 18, complete
            sequence
          Length = 190023

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 185  catatatatgtatgtatgtgta 206
            ||||||||||||||||||||||
Sbjct: 3575 catatatatgtatgtatgtgta 3554



to top

>gb|AC113941.16| Mus musculus chromosome 8, clone RP23-161H3, complete sequence
          Length = 194913

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 187    tatatatgtatgtatgtgtaac 208
              ||||||||||||||||||||||
Sbjct: 170361 tatatatgtatgtatgtgtaac 170340



to top

>gb|AC006332.3| Homo sapiens BAC clone RP11-376O14 from 7, complete sequence
          Length = 153477

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 176   gcatttattcatatatatgtatgtat 201
             |||| |||||||||||||||||||||
Sbjct: 75745 gcatgtattcatatatatgtatgtat 75720



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 181   tattcatatatatgtatgtat 201
             |||||||||||||||||||||
Sbjct: 75722 tattcatatatatgtatgtat 75702



to top

>gb|AC113275.8| Mus musculus chromosome 8, clone RP23-383K23, complete sequence
          Length = 253984

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 150138 catatatatgtatgtatgtgta 150159



to top

>gb|AC102441.6| Mus musculus chromosome 18, clone RP24-160I12, complete sequence
          Length = 224556

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 198271 catatatatgtatgtatgtgta 198250



to top

>emb|AL513534.17| Human DNA sequence from clone RP11-119F7 on chromosome 10 Contains a
             novel gene, a novel pseudgoene, the 3' end of the gene for
             leukemia-associated protein with a CXXC domain (LCX) a
             ribosomal protein S3A (RPS3A) pseudogene, the 5' end of a
             novel gene (FLJ10590) (FLJ10839, FLJ13376, FLJ10839) and a
             CpG island, complete sequence
          Length = 167633

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 54239 catatatatgtatgtatgtgta 54260



to top

>emb|AL391427.9| Human DNA sequence from clone RP11-499O7 on chromosome 10 Contains the 5'
              end of the AKR1C2 gene for aldo-keto reductase family 1
              member C2, a novel gene, the AKR1C3 gene for aldo-keto
              reductase family 1 member C3, two aldo-keto reductase
              pseudogenes and the 3' end of the gene for a novel protein
              similar to aldo-keto reductase, complete sequence
          Length = 166974

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 186    atatatatgtatgtatgtgtaa 207
              ||||||||||||||||||||||
Sbjct: 110266 atatatatgtatgtatgtgtaa 110245



to top

>gb|AC096626.31| Mus musculus strain C57BL/6J clone rp23-423p15 map 1, complete sequence
          Length = 208247

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 196199 catatatatgtatgtatgtgta 196178



to top

>emb|AL353643.10| Human DNA sequence from clone RP11-359J23 on chromosome 10, complete
             sequence
          Length = 130077

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 30960 catatatatgtatgtatgtgta 30981



to top

>emb|AL136363.4| Human DNA sequence from clone RP6-43L17 on chromosome Xq21.1-21.33,
             complete sequence
          Length = 93296

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 18090 catatatatgtatgtatgtgta 18111



to top

>emb|AL596096.7| Mouse DNA sequence from clone RP23-42P20 on chromosome 11 Contains the
             5' end of the Alox12e gene for epidermal arachidonate
             lipoxygenase, the gene for arachidonate 15-lipoxygenase, a
             novel pseudogene, two genes for novel proteins
             (4930563C04Rik, 1110030J09Rik), a Mitochondrial 28S
             ribosomal protein pseudogene, a NADH dehydrogenase
             (ubiquinone) 1 beta subcomplex 8 (Ndufb8) pseudogene, the
             gene for a novel protein similar to Beta-arrestin 2
             (Arrestin, beta 2) (LOC216869), the Cxcl16 gene for
             chemokine (C-X-C motif) ligand 16, the gene for a novel
             protein similar to human zinc finger MYND domain containg
             15 (ZMYND15), the 5' end of the gene for a novel protein
             (2010003F10Rik) and three CpG islands, complete sequence
          Length = 193277

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 182   attcatatatatgtatgtatgt 203
             ||||||||||||||||||||||
Sbjct: 72588 attcatatatatgtatgtatgt 72609



to top

>gb|AC153155.6| Mus musculus BAC clone RP23-25J23 from chromosome 18, complete sequence
          Length = 227880

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 139655 catatatatgtatgtatgtgta 139634



to top

>emb|AL034559.4|PFMAL3P7 Plasmodium falciparum MAL3P7, complete sequence
          Length = 253305

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 186    atatatatgtatgtatgtgtaa 207
              ||||||||||||||||||||||
Sbjct: 199687 atatatatgtatgtatgtgtaa 199666



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 186    atatatatgtatgtatgtgt 205
              ||||||||||||||||||||
Sbjct: 177001 atatatatgtatgtatgtgt 176982



to top

>emb|BX294164.13| Zebrafish DNA sequence from clone CH211-266D19 in linkage group 24,
             complete sequence
          Length = 177516

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 35370 catatatatgtatgtatgtgta 35349



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   atatatatgtatgtatgtgt 205
             ||||||||||||||||||||
Sbjct: 66304 atatatatgtatgtatgtgt 66323



to top

>gb|AC158799.8| Mus musculus  BAC RP24-430K11 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 161705

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 113810 catatatatgtatgtatgtgta 113831



to top

>gb|AC153153.4| Mus musculus BAC clone RP23-79G18 from chromosome 13, complete sequence
          Length = 222383

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 180555 catatatatgtatgtatgtgta 180534



to top

>emb|AL683843.9| Mouse DNA sequence from clone RP23-217E1 on chromosome 11 Contains part
              of the Ranbp17 gene for RAN binding protein 17, an acidic
              (leucine-rich) nuclear phosphoprotein 32 family, member E
              (Anp32e) pseudogene and a high mobility group box 1 (Hmgb1)
              pseudogene, complete sequence
          Length = 198926

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 176    gcatttattcatatatatgtatgtatgtgt 205
              ||||||||  ||||||||||||||||||||
Sbjct: 125884 gcatttatgaatatatatgtatgtatgtgt 125913



to top

>gb|AC104629.10| Homo sapiens 3 BAC RP11-12N13 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 158224

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 181    tattcatatatatgtatgtatgtgta 206
              ||||||||||||||||||||| ||||
Sbjct: 143231 tattcatatatatgtatgtatatgta 143206



to top

>gb|AC090506.7| Homo sapiens chromosome 18, clone RP11-675P14, complete sequence
          Length = 188609

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 186   atatatatgtatgtatgtgtaa 207
             ||||||||||||||||||||||
Sbjct: 97079 atatatatgtatgtatgtgtaa 97058



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   atatatatgtatgtatgtgt 205
             ||||||||||||||||||||
Sbjct: 11031 atatatatgtatgtatgtgt 11050



to top

>gb|AC093452.50| Mus musculus strain C57BL/6J clone rp23-458j13 map 1, complete sequence
          Length = 199859

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 102606 catatatatgtatgtatgtgta 102627



to top

>gb|AC093318.52| Mus musculus strain C57BL/6J clone rp23-252h7 map 1, complete sequence
          Length = 198381

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 196182 catatatatgtatgtatgtgta 196161



to top

>gb|AC009990.9| Homo sapiens chromosome 05 clone RP11-94N1, complete sequence
          Length = 159772

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 181   tattcatatatatgtatgtatgtgta 206
             |||| |||||||||||||||||||||
Sbjct: 46783 tatttatatatatgtatgtatgtgta 46758



to top

>ref|NM_176778.1| Drosophila melanogaster lethal (1) G0196 CG14616-RD, transcript
            variant D (l(1)G0196), mRNA
          Length = 4724

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 178  atttattcatatatatgtatgtatgt 203
            |||||| |||||||||||||||||||
Sbjct: 4616 atttatgcatatatatgtatgtatgt 4641



to top

>gb|AC005831.1| Homo sapiens 12p13.3 PAC RPCI5-1180D12 (Roswell Park Cancer Institute
             Human PAC Library) complete sequence
          Length = 144515

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 90708 catatatatgtatgtatgtgta 90729



to top

>gb|AC092185.3| Homo sapiens 3q BAC RP11-148O7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 165962

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 181    tattcatatatatgtatgtatgtgta 206
              |||| |||||||||||||||||||||
Sbjct: 155388 tatttatatatatgtatgtatgtgta 155413



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 186    atatatatgtatgtatgtgta 206
              |||||||||||||||||||||
Sbjct: 155443 atatatatgtatgtatgtgta 155463



to top

>gb|AC112031.4| Rattus norvegicus  BAC CH230-99K18 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 242158

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 224402 catatatatgtatgtatgtgta 224381



to top

>gb|AC104515.1| Drosophila melanogaster, chromosome X, region 20B-20C, BAC clone
              BACR27K09, complete sequence
          Length = 179386

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 178    atttattcatatatatgtatgtatgt 203
              |||||| |||||||||||||||||||
Sbjct: 109854 atttatgcatatatatgtatgtatgt 109829



to top

>gb|AC008573.5| Homo sapiens chromosome 5 clone CTC-551I11, complete sequence
          Length = 169544

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 113645 catatatatgtatgtatgtgta 113666



to top

>gb|AC074254.4| Homo sapiens BAC clone RP11-784D7 from 4, complete sequence
          Length = 171073

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 86766 catatatatgtatgtatgtgta 86745



to top

>gb|AC024897.23| Homo sapiens 3 BAC RP11-505J9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 204794

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 55927 catatatatgtatgtatgtgta 55906



to top

>emb|BX511027.20| Zebrafish DNA sequence from clone CH211-281P14 in linkage group 14,
              complete sequence
          Length = 198761

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 181    tattcatatatatgtatgtatgtgta 206
              |||| |||||||||||||||||||||
Sbjct: 196614 tattaatatatatgtatgtatgtgta 196589



to top

>gb|AC163694.2| Mus musculus BAC clone RP24-80O2 from chromosome 16, complete sequence
          Length = 244730

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 148428 catatatatgtatgtatgtgta 148407



to top

>gb|AC010259.7| Homo sapiens chromosome 5 clone CTC-454M9, complete sequence
          Length = 195476

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 181   tattcatatatatgtatgtatgtgta 206
             |||| |||||||||||||||||||||
Sbjct: 55406 tatttatatatatgtatgtatgtgta 55381



to top

>gb|AC020937.6| Homo sapiens chromosome 5 clone CTD-2299I21, complete sequence
          Length = 94161

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 182   attcatatatatgtatgtatgt 203
             ||||||||||||||||||||||
Sbjct: 91309 attcatatatatgtatgtatgt 91288



to top

>dbj|AK032932.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
            region cDNA, RIKEN full-length enriched library,
            clone:6720474J12 product:unclassifiable, full insert
            sequence
          Length = 2814

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 182  attcatatatatgtatgtatgt 203
            ||||||||||||||||||||||
Sbjct: 2630 attcatatatatgtatgtatgt 2609



to top

>emb|AJ586737.2| Drosophila virilis partial mod(mdg4) gene
          Length = 24391

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 22714 catatatatgtatgtatgtgta 22735



to top

>gb|AC010596.8| Homo sapiens chromosome 5 clone CTC-483B24, complete sequence
          Length = 165193

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 181    tattcatatatatgtatgtatgtgta 206
              |||| |||||||||||||||||||||
Sbjct: 144034 tatttatatatatgtatgtatgtgta 144009



to top

>gb|AC008502.8| Homo sapiens chromosome 5 clone CTC-442G11, complete sequence
          Length = 123495

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 182   attcatatatatgtatgtatgt 203
             ||||||||||||||||||||||
Sbjct: 21611 attcatatatatgtatgtatgt 21590



to top

>gb|AC019187.3|AC019187 Homo sapiens BAC clone RP11-304J20 from 1, complete sequence
          Length = 174673

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 62445 catatatatgtatgtatgtgta 62424



to top

>gb|AC158635.6| Mus musculus 10 BAC RP23-396A23 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 183931

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 39513 catatatatgtatgtatgtgta 39492



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 182      attcatatatatgtatgtatgt 203
                ||||||||||||||||||||||
Sbjct: 11599914 attcatatatatgtatgtatgt 11599893



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 186      atatatatgtatgtatgtgta 206
                |||||||||||||||||||||
Sbjct: 17161797 atatatatgtatgtatgtgta 17161817



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 186     atatatatgtatgtatgtgta 206
               |||||||||||||||||||||
Sbjct: 9547342 atatatatgtatgtatgtgta 9547362



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 178      atttattcatatatatgtat 197
                ||||||||||||||||||||
Sbjct: 11135084 atttattcatatatatgtat 11135103



to top

>gb|AC023274.2|AC023274 Homo sapiens clone RP11-307L15, complete sequence
          Length = 137682

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 186   atatatatgtatgtatgtgtaa 207
             ||||||||||||||||||||||
Sbjct: 92074 atatatatgtatgtatgtgtaa 92053



to top

>gb|AC078916.19| Homo sapiens 12 BAC RP11-463C23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 172678

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 104498 catatatatgtatgtatgtgta 104477



to top

>emb|BX817431.1|CNS0ACFH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL22ZB05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 687

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 7   catggtacaaaatacaataaactctt 32
           ||||||||||||| ||||||||||||
Sbjct: 166 catggtacaaaattcaataaactctt 191



to top

>gb|AC106860.6| Homo sapiens BAC clone RP13-488D7 from 4, complete sequence
          Length = 180424

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 186    atatatatgtatgtatgtgtaa 207
              ||||||||||||||||||||||
Sbjct: 113965 atatatatgtatgtatgtgtaa 113944



to top

>gb|AC007725.5|AC007725 Drosophila melanogaster, chromosome 3R, region 87A-87A, BAC clone
              BACR03N24, complete sequence
          Length = 144152

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 186    atatatatgtatgtatgtgtaa 207
              ||||||||||||||||||||||
Sbjct: 128709 atatatatgtatgtatgtgtaa 128730



to top

>gb|AC019195.10| Homo sapiens BAC clone RP11-355K7 from 2, complete sequence
          Length = 143823

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 91217 catatatatgtatgtatgtgta 91196



to top

>gb|AC139530.3| Homo sapiens chromosome 17, clone RP13-1032I1, complete sequence
          Length = 159125

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 126460 catatatatgtatgtatgtgta 126481



to top

>gb|AC022464.4|AC022464 Genomic sequence for Arabidopsis thaliana BAC F22G5 from chromosome
            I, complete sequence
          Length = 104830

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 7    catggtacaaaatacaataaactctt 32
            ||||||||||||| ||||||||||||
Sbjct: 4862 catggtacaaaattcaataaactctt 4887



to top

>gb|AC007562.4|AC007562 Homo sapiens BAC clone RP11-497C14 from Y, complete sequence
          Length = 137077

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 186  atatatatgtatgtatgtgtaa 207
            ||||||||||||||||||||||
Sbjct: 8409 atatatatgtatgtatgtgtaa 8430



to top

>ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P3 and inverted repeat IR2
               (P1-P2-P3-IR2@) on chromosome Y
          Length = 4538292

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 186     atatatatgtatgtatgtgtaa 207
               ||||||||||||||||||||||
Sbjct: 3708329 atatatatgtatgtatgtgtaa 3708350



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 186     atatatatgtatgtatgtgtaa 207
               ||||||||||||||||||||||
Sbjct: 2340043 atatatatgtatgtatgtgtaa 2340022



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 186  atatatatgtatgtatgtgt 205
            ||||||||||||||||||||
Sbjct: 4963 atatatatgtatgtatgtgt 4982



to top

>gb|AE016753.1| Mus musculus chromosome 10 high-growth region, section 1 of 2 of the
              complete sequence
          Length = 350029

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 248173 catatatatgtatgtatgtgta 248152



to top

>gb|AC146595.2| Mus musculus BAC clone RP24-164G18 from chromosome 17, complete
             sequence
          Length = 132103

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 91280 catatatatgtatgtatgtgta 91301



to top

>gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 sequence, complete sequence
          Length = 107234

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 7      catggtacaaaatacaataaactctt 32
              ||||||||||||| ||||||||||||
Sbjct: 106033 catggtacaaaattcaataaactctt 106058



to top

>dbj|AP005836.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBa0013F08
          Length = 166989

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 182    attcatatatatgtatgtatgt 203
              ||||||||||||||||||||||
Sbjct: 115921 attcatatatatgtatgtatgt 115900



to top

>dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0711F01
          Length = 193091

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 182   attcatatatatgtatgtatgt 203
             ||||||||||||||||||||||
Sbjct: 34548 attcatatatatgtatgtatgt 34527



to top

>emb|BX649381.5| Mouse DNA sequence from clone RP23-245K23 on chromosome 2, complete
              sequence
          Length = 195508

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 181    tattcatatatatgtatgtatgtgta 206
              ||||||||| ||||||||||||||||
Sbjct: 189361 tattcatatgtatgtatgtatgtgta 189336



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 559     ggccaccagggcgaccagcacg 580
               ||||||||||||||||||||||
Sbjct: 4508691 ggccaccagggcgaccagcacg 4508670



to top

>emb|AL589623.27| Mouse DNA sequence from clone RP23-111C11 on chromosome X, complete
             sequence
          Length = 43644

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 181   tattcatatatatgtatgtatgtgta 206
             ||||||||| ||||||||||||||||
Sbjct: 36919 tattcatatgtatgtatgtatgtgta 36894



to top

>gb|AC153366.7| Mus musculus 10 BAC RP23-243B24 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 184707

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 79719 catatatatgtatgtatgtgta 79740



to top

>emb|AL954686.9| Mouse DNA sequence from clone RP23-167L6 on chromosome X, complete
             sequence
          Length = 78045

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 181   tattcatatatatgtatgtatgtgta 206
             ||||||||| ||||||||||||||||
Sbjct: 77174 tattcatatgtatgtatgtatgtgta 77149



to top

>dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MIK19
          Length = 84129

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 7     catggtacaaaatacaataaactctt 32
             ||||||||||||| ||||||||||||
Sbjct: 70529 catggtacaaaattcaataaactctt 70504



to top

>gb|AC008056.6|AC008056 Homo sapiens chromosome 14 clone RP11-242P2 containing gene for neurexin
              III gene, partial cds, complete sequence
          Length = 163584

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 155516 catatatatgtatgtatgtgta 155537



to top

>gb|AC007058.2|AC007058 Homo sapiens chromosome 14 clone containing intron for neurexin III,
            complete sequence
          Length = 95956

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 185  catatatatgtatgtatgtgta 206
            ||||||||||||||||||||||
Sbjct: 8948 catatatatgtatgtatgtgta 8969



to top

>emb|AL391158.5|CNS06C83 Human chromosome 14 DNA sequence BAC R-560O13 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 202792

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 71779 catatatatgtatgtatgtgta 71800



to top

>gb|AE003693.3| Drosophila melanogaster chromosome 3R, section 31 of 118 of the complete
              sequence
          Length = 226782

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 186    atatatatgtatgtatgtgtaa 207
              ||||||||||||||||||||||
Sbjct: 201069 atatatatgtatgtatgtgtaa 201090



to top

>emb|AL162311.5|CNS01RHR Human chromosome 14 DNA sequence BAC R-317N8 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 167127

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 186    atatatatgtatgtatgtgtaacctc 211
              |||||||||||||||||| |||||||
Sbjct: 132427 atatatatgtatgtatgtataacctc 132452



to top

>gb|AE003574.6| Drosophila melanogaster chromosome X, section 73 of 74 of the complete
             sequence
          Length = 273468

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 178   atttattcatatatatgtatgtatgt 203
             |||||| |||||||||||||||||||
Sbjct: 69770 atttatgcatatatatgtatgtatgt 69795



to top

>dbj|AP001683.1| Homo sapiens genomic DNA, chromosome 21q, section 27/105
          Length = 340000

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 184558 catatatatgtatgtatgtgta 184537



to top

>gb|AC107808.20| Mus musculus chromosome 9, clone RP23-61B14, complete sequence
          Length = 188589

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 152465 catatatatgtatgtatgtgta 152444



to top

>gb|AC102262.9| Mus musculus chromosome 15, clone RP24-216B4, complete sequence
          Length = 191626

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 84504 catatatatgtatgtatgtgta 84483



to top

>gb|AC166336.15| Mus musculus chromosome 1, clone RP24-74G12, complete sequence
          Length = 215765

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 167877 catatatatgtatgtatgtgta 167898



to top

>gb|AC137896.5| Homo sapiens chromosome 17, clone RP11-765O14, complete sequence
          Length = 107289

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 97943 catatatatgtatgtatgtgta 97922



to top

>gb|AC159036.3| Pan troglodytes BAC clone CH251-318E5 from chromosome unknown, complete
             sequence
          Length = 156920

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   catatatatgtatgtatgtgta 206
             ||||||||||||||||||||||
Sbjct: 38153 catatatatgtatgtatgtgta 38174



to top

>emb|AL808133.17| Mouse DNA sequence from clone RP23-457N24 on chromosome X, complete
             sequence
          Length = 170192

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 181   tattcatatatatgtatgtatgtgta 206
             ||||||||| ||||||||||||||||
Sbjct: 80524 tattcatatgtatgtatgtatgtgta 80549



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 181  tattcatatatatgtatgtatgtgta 206
            ||||||||| ||||||||||||||||
Sbjct: 1129 tattcatatgtatgtatgtatgtgta 1104



to top

>emb|AL845267.2| Mouse DNA sequence from clone RP23-426D2 on chromosome 2, complete
              sequence
          Length = 216597

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 163013 catatatatgtatgtatgtgta 163034



to top

>emb|AL929540.9| Mouse DNA sequence from clone RP23-132M12 on chromosome X, complete
              sequence
          Length = 145087

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 136258 catatatatgtatgtatgtgta 136279



to top

>gb|AC148011.3| Mus musculus BAC clone RP23-202I21 from 18, complete sequence
          Length = 220253

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 155710 catatatatgtatgtatgtgta 155731



to top

>gb|AC148007.3| Mus musculus BAC clone RP23-273G4 from 1, complete sequence
          Length = 184937

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 177    catttattcatatatatgtatgtatg 202
              ||||||||||||||||||||| ||||
Sbjct: 116747 catttattcatatatatgtatatatg 116722



to top

>gb|AC125046.3| Mus musculus BAC clone RP23-349O22 from 6, complete sequence
          Length = 223938

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 170104 catatatatgtatgtatgtgta 170125



to top

>gb|AC112266.6| Mus musculus BAC clone RP23-422B6 from 13, complete sequence
          Length = 190943

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    catatatatgtatgtatgtgta 206
              ||||||||||||||||||||||
Sbjct: 124960 catatatatgtatgtatgtgta 124939


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,622,974
Number of Sequences: 3902068
Number of extensions: 5622974
Number of successful extensions: 256842
Number of sequences better than 10.0: 1872
Number of HSP's better than 10.0 without gapping: 1888
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 242412
Number of HSP's gapped (non-prelim): 14217
length of query: 638
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 615
effective length of database: 17,143,297,704
effective search space: 10543128087960
effective search space used: 10543128087960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top