ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags30i14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_122206.2| Arabidopsis thaliana DNA binding / transcriptio... 46 0.10
2gb|AY519628.1| Arabidopsis thaliana MYB transcription factor (At... 46 0.10
3gb|DQ446976.1| Arabidopsis thaliana clone pENTR221-At5g23000 myb... 46 0.10
4emb|AJ486936.1|ATH486936 Arabidopsis thaliana partial myb37 gene... 46 0.10
5emb|AJ486935.1|ATH486935 Arabidopsis thaliana partial myb37 gene... 46 0.10
6emb|AJ486934.1|ATH486934 Arabidopsis thaliana partial myb37 gene... 46 0.10
7emb|AJ486933.1|ATH486933 Arabidopsis thaliana partial myb37 gene... 46 0.10
8emb|AJ486932.1|ATH486932 Arabidopsis thaliana partial myb37 gene... 46 0.10
9emb|AJ486931.1|ATH486931 Arabidopsis thaliana partial myb37 gene... 46 0.10
10emb|AJ486930.1|ATH486930 Arabidopsis thaliana partial myb37 gene... 46 0.10
11emb|AJ486929.1|ATH486929 Arabidopsis thaliana partial myb37 gene... 46 0.10
12emb|AJ486928.1|ATH486928 Arabidopsis thaliana partial myb37 gene... 46 0.10
13emb|AJ486927.1|ATH486927 Arabidopsis thaliana partial myb37 gene... 46 0.10
14emb|AJ486926.1|ATH486926 Arabidopsis thaliana partial myb37 gene... 46 0.10
15emb|AJ486925.1|ATH486925 Arabidopsis thaliana partial myb37 gene... 46 0.10
16emb|AJ486924.1|ATH486924 Arabidopsis thaliana partial myb37 gene... 46 0.10
17emb|AJ486923.1|ATH486923 Arabidopsis thaliana partial myb37 gene... 46 0.10
18emb|AJ486922.1|ATH486922 Arabidopsis thaliana partial myb37 gene... 46 0.10
19emb|AJ486921.1|ATH486921 Arabidopsis thaliana partial myb37 gene... 46 0.10
20emb|AJ486920.1|ATH486920 Arabidopsis thaliana partial myb37 gene... 46 0.10
21emb|AJ486919.1|ATH486919 Arabidopsis thaliana partial myb37 gene... 46 0.10
22emb|AJ486918.1|ATH486918 Arabidopsis thaliana partial myb37 gene... 46 0.10
23emb|AJ486917.1|ATH486917 Arabidopsis thaliana partial myb37 gene... 46 0.10
24emb|AJ486916.1|ATH486916 Arabidopsis thaliana partial myb37 gene... 46 0.10
25emb|AJ486915.1|ATH486915 Arabidopsis thaliana partial myb37 gene... 46 0.10
26emb|AJ486914.1|ATH486914 Arabidopsis thaliana partial myb37 gene... 46 0.10
27emb|AJ486913.1|ATH486913 Arabidopsis thaliana partial myb37 gene... 46 0.10
28emb|AJ486912.1|ATH486912 Arabidopsis thaliana partial myb37 gene... 46 0.10
29emb|AJ486911.1|ATH486911 Arabidopsis thaliana partial myb37 gene... 46 0.10
30emb|AJ486910.1|ATH486910 Arabidopsis thaliana partial myb37 gene... 46 0.10
31emb|AJ486909.1|ATH486909 Arabidopsis thaliana partial myb37 gene... 46 0.10
32emb|AJ486908.1|ATH486908 Arabidopsis thaliana partial myb37 gene... 46 0.10
33emb|AJ486907.1|ATH486907 Arabidopsis thaliana partial myb37 gene... 46 0.10
34emb|AJ486906.1|ATH486906 Arabidopsis thaliana partial myb37 gene... 46 0.10
35emb|AJ486905.1|ATH486905 Arabidopsis thaliana partial myb37 gene... 46 0.10
36emb|AJ486904.1|ATH486904 Arabidopsis thaliana partial myb37 gene... 46 0.10
37emb|AJ486902.1|ATH486902 Arabidopsis thaliana partial myb37 gene... 46 0.10
38emb|AJ486901.1|ATH486901 Arabidopsis thaliana partial myb37 gene... 46 0.10
39emb|AJ486900.1|ATH486900 Arabidopsis thaliana partial myb37 gene... 46 0.10
40emb|AJ131517.1|ATH131517 Arabidopsis thaliana MYB37 homologue ge... 46 0.10
41emb|BX832392.1|CNS09YP1 Arabidopsis thaliana Full-length cDNA Co... 46 0.10
42dbj|AK175507.1| Arabidopsis thaliana mRNA for myb like transcrip... 46 0.10
43emb|AJ486903.1|ATH486903 Arabidopsis thaliana partial myb37 gene... 46 0.10
44dbj|AB026660.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 46 0.10
45gb|AF062879.1|AF062879 Arabidopsis thaliana putative transcripti... 46 0.10
46gb|AC139335.3| Mus musculus BAC clone RP23-376N11 from chromosom... 42 1.6
47emb|AL024473.1|HS707K17 Human DNA sequence from clone RP4-707K17... 42 1.6
48emb|BX539346.8| Zebrafish DNA sequence from clone DKEYP-73G7 in ... 42 1.6
49emb|BX649634.8| Zebrafish DNA sequence from clone CH211-284G18 i... 42 1.6
50emb|BX293568.7| Zebrafish DNA sequence from clone CH211-215F13 i... 42 1.6
51emb|BX247907.8| Zebrafish DNA sequence from clone CH211-232D19 i... 42 1.6
52gb|AC147634.3| Mus musculus BAC clone RP23-305G22 from 10, compl... 42 1.6
53ref|NM_103690.2| Arabidopsis thaliana unknown protein AT1G47920 ... 40 6.2
54gb|DQ214212.1| Taeniopygia guttata clone 0065P0009H12 ribosomal ... 40 6.2
55gb|DQ214211.1| Taeniopygia guttata clone 0058P0021E12 ribosomal ... 40 6.2
56gb|DQ214210.1| Taeniopygia guttata clone 0058P0030G07 ribosomal ... 40 6.2
57gb|AC093351.8| Mus musculus chromosome 7, clone RP23-16L19, comp... 40 6.2
58gb|AC139883.8| Mus musculus chromosome 16, clone RP24-304O16, co... 40 6.2
59gb|AC138026.4| Mus musculus BAC clone RP24-501L6 from chromosome... 40 6.2
60ref|XM_546022.2| PREDICTED: Canis familiaris hypothetical LOC488... 40 6.2
61gb|DQ446338.1| Arabidopsis thaliana clone pENTR221-At1g47920 syn... 40 6.2
62gb|AC154226.3| Mus musculus BAC clone RP24-353J14 from chromosom... 40 6.2
63gb|AC079679.4|AC079679 Arabidopsis thaliana chromosome 1 BAC T6B... 40 6.2
64emb|BX005002.9| Zebrafish DNA sequence from clone CH211-130M12, ... 40 6.2
65emb|CR759840.6| Zebrafish DNA sequence from clone DKEY-239O7 in ... 40 6.2
66emb|Z71267.1|CEW01A8 Caenorhabditis elegans Cosmid W01A8, comple... 40 6.2
67gb|AC110039.13| Mus musculus chromosome 7, clone RP23-264N6, com... 40 6.2
68emb|AL929309.6| Zebrafish DNA sequence from clone CH211-51L3 in ... 40 6.2
69gb|AC163644.4| Mus musculus BAC clone RP24-394I24 from chromosom... 40 6.2
70dbj|AB006605.1| Petunia x hybrida mRNA for ZPT3-3, complete cds 40 6.2
71dbj|AB035133.1| Petunia x hybrida gene for C2H2 zinc-finger prot... 40 6.2

>ref|NM_122206.2| Arabidopsis thaliana DNA binding / transcription factor AT5G23000
           mRNA, complete cds
          Length = 1205

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 923 aggttgcttatcgaactagaaga 901



to top

>gb|AY519628.1| Arabidopsis thaliana MYB transcription factor (At5g23000) mRNA,
           complete cds
          Length = 990

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 923 aggttgcttatcgaactagaaga 901



to top

>gb|DQ446976.1| Arabidopsis thaliana clone pENTR221-At5g23000 myb family
           transcription factor (At5g23000) mRNA, complete cds
          Length = 990

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 923 aggttgcttatcgaactagaaga 901



to top

>emb|AJ486936.1|ATH486936 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant yo-0
          Length = 974

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 723 aggttgcttatcgaactagaaga 701



to top

>emb|AJ486935.1|ATH486935 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant su-0
          Length = 974

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 723 aggttgcttatcgaactagaaga 701



to top

>emb|AJ486934.1|ATH486934 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant wl-0
          Length = 941

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486933.1|ATH486933 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant tsu-1
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486932.1|ATH486932 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant tac
          Length = 976

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486931.1|ATH486931 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant sorbo
          Length = 974

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486930.1|ATH486930 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant sei-0
          Length = 981

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486929.1|ATH486929 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant pla-0
          Length = 1015

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486928.1|ATH486928 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant pi-0
          Length = 1015

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486927.1|ATH486927 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant petergof
          Length = 995

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486926.1|ATH486926 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant per-1
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486925.1|ATH486925 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant pa-1
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486924.1|ATH486924 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant oy-0
          Length = 1015

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486923.1|ATH486923 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant no-0
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486922.1|ATH486922 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant mt-0
          Length = 976

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486921.1|ATH486921 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant mrk-0
          Length = 974

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 723 aggttgcttatcgaactagaaga 701



to top

>emb|AJ486920.1|ATH486920 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant mr-0
          Length = 1003

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486919.1|ATH486919 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant ma-0
          Length = 1015

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486918.1|ATH486918 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant lip-0
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486917.1|ATH486917 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant condara
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 765 aggttgcttatcgaactagaaga 743



to top

>emb|AJ486916.1|ATH486916 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant cnt-1
          Length = 992

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 740 aggttgcttatcgaactagaaga 718



to top

>emb|AJ486915.1|ATH486915 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant can-0
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486914.1|ATH486914 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant cal-0
          Length = 1017

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 765 aggttgcttatcgaactagaaga 743



to top

>emb|AJ486913.1|ATH486913 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant bla-10
          Length = 1017

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 765 aggttgcttatcgaactagaaga 743



to top

>emb|AJ486912.1|ATH486912 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant bl-0
          Length = 1017

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 765 aggttgcttatcgaactagaaga 743



to top

>emb|AJ486911.1|ATH486911 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant ler
          Length = 1017

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 765 aggttgcttatcgaactagaaga 743



to top

>emb|AJ486910.1|ATH486910 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant ag-0
          Length = 976

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 765 aggttgcttatcgaactagaaga 743



to top

>emb|AJ486909.1|ATH486909 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant kil-1
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 763 aggttgcttatcgaactagaaga 741



to top

>emb|AJ486908.1|ATH486908 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant kas-1
          Length = 973

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 723 aggttgcttatcgaactagaaga 701



to top

>emb|AJ486907.1|ATH486907 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant ka-0
          Length = 1004

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 765 aggttgcttatcgaactagaaga 743



to top

>emb|AJ486906.1|ATH486906 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant hodja
          Length = 1016

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 765 aggttgcttatcgaactagaaga 743



to top

>emb|AJ486905.1|ATH486905 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant ema-1
          Length = 1004

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 765 aggttgcttatcgaactagaaga 743



to top

>emb|AJ486904.1|ATH486904 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant di-g
          Length = 993

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 741 aggttgcttatcgaactagaaga 719



to top

>emb|AJ486902.1|ATH486902 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant di-0
          Length = 993

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 741 aggttgcttatcgaactagaaga 719



to top

>emb|AJ486901.1|ATH486901 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant cvi-0
          Length = 991

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 740 aggttgcttatcgaactagaaga 718



to top

>emb|AJ486900.1|ATH486900 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant aa-0
          Length = 993

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 741 aggttgcttatcgaactagaaga 719



to top

>emb|AJ131517.1|ATH131517 Arabidopsis thaliana MYB37 homologue gene and ORF1
          Length = 19132

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 110  aggttgcttatcgaactagaaga 132
            |||||||||||||||||||||||
Sbjct: 6672 aggttgcttatcgaactagaaga 6650



to top

>emb|BX832392.1|CNS09YP1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH6ZG04 of Hormone Treated Callus of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1697

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 110  aggttgcttatcgaactagaaga 132
            |||||||||||||||||||||||
Sbjct: 1490 aggttgcttatcgaactagaaga 1468



to top

>dbj|AK175507.1| Arabidopsis thaliana mRNA for myb like transcription factor (MYB37),
            complete cds, clone: RAFL21-93-G12
          Length = 1143

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 110  aggttgcttatcgaactagaaga 132
            |||||||||||||||||||||||
Sbjct: 1022 aggttgcttatcgaactagaaga 1000



to top

>emb|AJ486903.1|ATH486903 Arabidopsis thaliana partial myb37 gene for MYB37 transcription
           factor, exon 3, population variant di-1
          Length = 704

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 453 aggttgcttatcgaactagaaga 431



to top

>dbj|AB026660.1| Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T20O7
          Length = 18446

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 110  aggttgcttatcgaactagaaga 132
            |||||||||||||||||||||||
Sbjct: 6064 aggttgcttatcgaactagaaga 6042



to top

>gb|AF062879.1|AF062879 Arabidopsis thaliana putative transcription factor (MYB37) mRNA,
           partial cds
          Length = 1062

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 110 aggttgcttatcgaactagaaga 132
           |||||||||||||||||||||||
Sbjct: 761 aggttgcttatcgaactagaaga 739



to top

>gb|AC139335.3| Mus musculus BAC clone RP23-376N11 from chromosome 10, complete sequence
          Length = 195132

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     gcatatactacatacacaaac 77
              |||||||||||||||||||||
Sbjct: 170303 gcatatactacatacacaaac 170323



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     gcatatactacatacacaaac 77
              |||||||||||||||||||||
Sbjct: 170173 gcatatactacatacacaaac 170193



to top

>emb|AL024473.1|HS707K17 Human DNA sequence from clone RP4-707K17 on chromosome 20q13.1 Contains
             part of the PTPRT gene for protein tyrosine phosphatase
             receptor type T, ESTs, STSs and GSSs, complete sequence
          Length = 107387

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 353   ggcctcatcatcatcagaata 373
             |||||||||||||||||||||
Sbjct: 13668 ggcctcatcatcatcagaata 13648



to top

>emb|BX539346.8| Zebrafish DNA sequence from clone DKEYP-73G7 in linkage group 23,
              complete sequence
          Length = 171486

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 158    caggacagttgttggcaccag 178
              |||||||||||||||||||||
Sbjct: 168071 caggacagttgttggcaccag 168051



to top

>emb|BX649634.8| Zebrafish DNA sequence from clone CH211-284G18 in linkage group 2,
              complete sequence
          Length = 154030

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 158    caggacagttgttggcaccag 178
              |||||||||||||||||||||
Sbjct: 118844 caggacagttgttggcaccag 118824



to top

>emb|BX293568.7| Zebrafish DNA sequence from clone CH211-215F13 in linkage group 20,
              complete sequence
          Length = 221849

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 158    caggacagttgttggcaccag 178
              |||||||||||||||||||||
Sbjct: 199897 caggacagttgttggcaccag 199877



to top

>emb|BX247907.8| Zebrafish DNA sequence from clone CH211-232D19 in linkage group 8,
             complete sequence
          Length = 169530

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 300   tttatattcttgtcaaattct 320
             |||||||||||||||||||||
Sbjct: 51378 tttatattcttgtcaaattct 51358



to top

>gb|AC147634.3| Mus musculus BAC clone RP23-305G22 from 10, complete sequence
          Length = 207157

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 57     gcatatactacatacacaaac 77
              |||||||||||||||||||||
Sbjct: 137843 gcatatactacatacacaaac 137823



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 57     gcatatactacatacacaaac 77
              |||||||||||||||||||||
Sbjct: 137713 gcatatactacatacacaaac 137693



to top

>ref|NM_103690.2| Arabidopsis thaliana unknown protein AT1G47920 mRNA, complete cds
          Length = 1140

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 355 cctcatcatcatcagaataa 374
           ||||||||||||||||||||
Sbjct: 544 cctcatcatcatcagaataa 525



to top

>gb|DQ214212.1| Taeniopygia guttata clone 0065P0009H12 ribosomal protein L30-like
           mRNA, complete sequence
          Length = 642

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 155 aagcaggacagttgttggca 174
           ||||||||||||||||||||
Sbjct: 365 aagcaggacagttgttggca 346



to top

>gb|DQ214211.1| Taeniopygia guttata clone 0058P0021E12 ribosomal protein L30-like
           mRNA, complete sequence
          Length = 567

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 155 aagcaggacagttgttggca 174
           ||||||||||||||||||||
Sbjct: 313 aagcaggacagttgttggca 294



to top

>gb|DQ214210.1| Taeniopygia guttata clone 0058P0030G07 ribosomal protein L30-like
           mRNA, complete sequence
          Length = 577

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 155 aagcaggacagttgttggca 174
           ||||||||||||||||||||
Sbjct: 326 aagcaggacagttgttggca 307



to top

>gb|AC093351.8| Mus musculus chromosome 7, clone RP23-16L19, complete sequence
          Length = 239688

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 58   catatactacatacacaaac 77
            ||||||||||||||||||||
Sbjct: 6678 catatactacatacacaaac 6659



to top

>gb|AC139883.8| Mus musculus chromosome 16, clone RP24-304O16, complete sequence
          Length = 138043

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 130   agaaataaaactacagagac 149
             ||||||||||||||||||||
Sbjct: 81245 agaaataaaactacagagac 81226



to top

>gb|AC138026.4| Mus musculus BAC clone RP24-501L6 from chromosome 10, complete sequence
          Length = 183477

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 55    tagcatatactacatacaca 74
             ||||||||||||||||||||
Sbjct: 12100 tagcatatactacatacaca 12081



to top

>ref|XM_546022.2| PREDICTED: Canis familiaris hypothetical LOC488905 (LOC488905), mRNA
          Length = 1374

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 141  tacagagacataagaagcag 160
            ||||||||||||||||||||
Sbjct: 1344 tacagagacataagaagcag 1325



to top

>gb|DQ446338.1| Arabidopsis thaliana clone pENTR221-At1g47920 syntaxin-like family
           protein (At1g47920) mRNA, complete cds
          Length = 1026

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 355 cctcatcatcatcagaataa 374
           ||||||||||||||||||||
Sbjct: 430 cctcatcatcatcagaataa 411



to top

>gb|AC154226.3| Mus musculus BAC clone RP24-353J14 from chromosome 13, complete sequence
          Length = 196991

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    ataagaagcaggacagttgt 169
              ||||||||||||||||||||
Sbjct: 152375 ataagaagcaggacagttgt 152394



to top

>gb|AC079679.4|AC079679 Arabidopsis thaliana chromosome 1 BAC T6B12 genomic sequence, complete
             sequence
          Length = 30734

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 355   cctcatcatcatcagaataa 374
             ||||||||||||||||||||
Sbjct: 21616 cctcatcatcatcagaataa 21597



to top

>emb|BX005002.9| Zebrafish DNA sequence from clone CH211-130M12, complete sequence
          Length = 170274

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 128   gaagaaataaaactacagagacat 151
             ||||||||||||||||||| ||||
Sbjct: 43674 gaagaaataaaactacagacacat 43651



to top

>emb|CR759840.6| Zebrafish DNA sequence from clone DKEY-239O7 in linkage group 25,
             complete sequence
          Length = 110071

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 420   gtcgccggcgagagagcgtg 439
             ||||||||||||||||||||
Sbjct: 29769 gtcgccggcgagagagcgtg 29750



to top

>emb|Z71267.1|CEW01A8 Caenorhabditis elegans Cosmid W01A8, complete sequence
          Length = 25284

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 189  gcaacgtcgcacgccgtctcaattttat 216
            ||||||||| ||||| ||||||||||||
Sbjct: 1423 gcaacgtcggacgccttctcaattttat 1396



to top

>gb|AC110039.13| Mus musculus chromosome 7, clone RP23-264N6, complete sequence
          Length = 173706

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    catatactacatacacaaac 77
             ||||||||||||||||||||
Sbjct: 27770 catatactacatacacaaac 27789



to top

>emb|AL929309.6| Zebrafish DNA sequence from clone CH211-51L3 in linkage group 25,
             complete sequence
          Length = 191745

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 420   gtcgccggcgagagagcgtg 439
             ||||||||||||||||||||
Sbjct: 55279 gtcgccggcgagagagcgtg 55260



to top

>gb|AC163644.4| Mus musculus BAC clone RP24-394I24 from chromosome 16, complete sequence
          Length = 177627

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 130    agaaataaaactacagagac 149
              ||||||||||||||||||||
Sbjct: 134922 agaaataaaactacagagac 134903



to top

>dbj|AB006605.1| Petunia x hybrida mRNA for ZPT3-3, complete cds
          Length = 1200

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 355 cctcatcatcatcagaataa 374
           ||||||||||||||||||||
Sbjct: 499 cctcatcatcatcagaataa 480



to top

>dbj|AB035133.1| Petunia x hybrida gene for C2H2 zinc-finger protein ZPT3-3, complete
            cds
          Length = 3444

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 355  cctcatcatcatcagaataa 374
            ||||||||||||||||||||
Sbjct: 2743 cctcatcatcatcagaataa 2724


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,970,104
Number of Sequences: 3902068
Number of extensions: 4970104
Number of successful extensions: 93505
Number of sequences better than 10.0: 71
Number of HSP's better than 10.0 without gapping: 71
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93415
Number of HSP's gapped (non-prelim): 90
length of query: 458
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 436
effective length of database: 17,147,199,772
effective search space: 7476179100592
effective search space used: 7476179100592
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top