ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags30f24
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_474229.1| Oryza sativa (japonica cultivar-group), predic... 250 6e-63
2dbj|AK061921.1| Oryza sativa (japonica cultivar-group) cDNA clon... 250 6e-63
3dbj|AK065171.1| Oryza sativa (japonica cultivar-group) cDNA clon... 250 6e-63
4dbj|AK099504.1| Oryza sativa (japonica cultivar-group) cDNA clon... 242 1e-60
5emb|AL606999.3|OSJN00127 Oryza sativa genomic DNA, chromosome 4,... 70 1e-08
6dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 70 1e-08
7gb|BC102224.1| Bos taurus similar to MAF1 protein, mRNA (cDNA cl... 56 2e-04
8ref|NM_001034424.1| Bos taurus similar to MAF1 protein (MGC12727... 56 2e-04
9gb|BC096891.1| Danio rerio zgc:112356, mRNA (cDNA clone MGC:1123... 54 7e-04
10ref|NM_001030239.1| Danio rerio zgc:112356 (zgc:112356), mRNA 54 7e-04
11ref|XM_852645.1| PREDICTED: Canis familiaris similar to MAF1 pro... 54 7e-04
12ref|XM_539208.2| PREDICTED: Canis familiaris similar to MAF1 pro... 54 7e-04
13emb|BX929817.2| Gallus gallus finished cDNA, clone ChEST549o13 52 0.003
14ref|NM_026859.2| Mus musculus MAF1 homolog (S. cerevisiae) (Maf1... 50 0.010
15gb|BC016260.1| Mus musculus MAF1 homolog (S. cerevisiae), mRNA (... 50 0.010
16dbj|AK154047.1| Mus musculus 2 days neonate thymus thymic cells ... 50 0.010
17dbj|AK042913.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 50 0.010
18dbj|AK004406.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 50 0.010
19dbj|AK196909.1| Mus musculus cDNA, clone:Y1G0123G09, strand:plus... 50 0.010
20dbj|AK189875.1| Mus musculus cDNA, clone:Y1G0101A22, strand:plus... 50 0.010
21ref|NM_032272.3| Homo sapiens MAF1 homolog (S. cerevisiae) (MAF1... 48 0.041
22gb|BC031273.1| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (... 48 0.041
23gb|BC014082.2| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (... 48 0.041
24emb|AL136937.1|HSM801901 Homo sapiens mRNA; cDNA DKFZp586G1123 (... 48 0.041
25emb|CR621223.1| full-length cDNA clone CS0DF003YD16 of Fetal bra... 48 0.041
26emb|CR600048.1| full-length cDNA clone CS0DH001YI22 of T cells (... 48 0.041
27emb|CR533463.1| Homo sapiens full open reading frame cDNA clone ... 48 0.041
28gb|BC018714.1| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (... 48 0.041
29gb|BC004909.1| Homo sapiens aldehyde dehydrogenase 6 family, mem... 44 0.64
30ref|XM_821979.1| Trypanosoma brucei TREU927 hypothetical protein... 44 0.64
31gb|BC083712.1| Rattus norvegicus MAF1 homolog (S. cerevisiae), m... 44 0.64
32ref|NM_001014085.1| Rattus norvegicus MAF1 homolog (S. cerevisia... 44 0.64
33gb|AF130089.1|AF130089 Homo sapiens clone FLB9440 PRO2550 mRNA, ... 44 0.64
34emb|BX248100.9| Zebrafish DNA sequence from clone CH211-222O11 i... 44 0.64
35gb|AC165163.2| Mus musculus BAC clone RP23-146B12 from chromosom... 42 2.5
36ref|NM_001014169.1| Rattus norvegicus LOC361776 (LOC361776), mRNA 42 2.5
37ref|XM_574697.1| PREDICTED: Rattus norvegicus hypothetical gene ... 42 2.5
38gb|BC079324.1| Rattus norvegicus LOC361776, mRNA (cDNA clone MGC... 42 2.5
39emb|AL844608.18| Mouse DNA sequence from clone RP23-27L22 on chr... 42 2.5
40dbj|AP003043.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 42 2.5
41gb|AC153383.1| Mus musculus 6 BAC RP23-168L2 (Roswell Park Cance... 40 9.9
42gb|AC158308.4| Mus musculus chromosome 3, clone RP23-182M12, com... 40 9.9
43gb|AC167724.6| Mus musculus 10 BAC RP23-331P17 (Roswell Park Can... 40 9.9
44gb|AC121275.20| Mus musculus chromosome 8, clone RP24-234C3, com... 40 9.9
45gb|AE006222.1| Pasteurella multocida subsp. multocida str. Pm70 ... 40 9.9
46ref|XM_924200.2| PREDICTED: Mus musculus alpha-kinase 1, transcr... 40 9.9
47gb|AC124488.3| Mus musculus BAC clone RP23-452K20 from chromosom... 40 9.9
48emb|AL357832.11| Human DNA sequence from clone RP11-125D12 on ch... 40 9.9
49emb|AL021329.1|HS239K6 Human DNA sequence from clone RP1-239K6 o... 40 9.9
50emb|AL807374.1|NCB13H18 Neurospora crassa DNA linkage group V BA... 40 9.9
51gb|AC087530.8| Homo sapiens chromosome 17, clone RP11-313F15, co... 40 9.9
52gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome 40 9.9
53gb|AC133012.5| Homo sapiens chromosome 17, clone RP11-582A10, co... 40 9.9
54gb|AC161378.2| Mus musculus BAC clone RP23-202A6 from chromosome... 40 9.9
55gb|AC154429.4| Mus musculus BAC clone RP24-202G18 from chromosom... 40 9.9
56gb|AC102600.11| Mus musculus chromosome 3, clone RP23-376E16, co... 40 9.9
57gb|AC133638.7| Homo sapiens chromosome 17, clone CTD-2125J20, co... 40 9.9
58dbj|AK173191.1| Mus musculus mRNA for mKIAA1527 protein 40 9.9
59gb|AC154800.2| Mus musculus BAC clone RP24-496O9 from 14, comple... 40 9.9
60gb|AY746497.1| Enterobacteria phage JS98 contig9 genomic sequence 40 9.9
61gb|AC124225.13| Mus musculus chromosome 16, clone RP23-83P23, co... 40 9.9
62emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 40 9.9
63gb|M63149.1|TOVM1P Ustilago maydis virus P1 (M1) gene, complete cds 40 9.9 
>ref|XM_474229.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 675

 Score =  250 bits (126), Expect = 6e-63
 Identities = 323/389 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 atatgtccatgtcgatcaacgcatcttcctcctcgccatccgagagcgcaccagcaagga 397
           ||||||||||||| ||||  ||||||||||| || ||||| ||  | ||||  | |||||
Sbjct: 673 atatgtccatgtctatcagtgcatcttcctcttcaccatcggatggtgcactggtaagga 614

                                                                       
Query: 398 aatcatcccctgcaaatttgctagtacagcagcagcgaaagctcactacccgcttgagct 457
           | ||||| ||||  | ||||||  |||| | ||| ||||||||||| || ||||| ||||
Sbjct: 613 agtcatctcctgatattttgcttatacaactgcaacgaaagctcacaactcgctttagct 554

                                                                       
Query: 458 tccggtggtagaagaaaaagttgaccgaccatatggcccctgtctctagaaatggatctc 517
           |||| | ||||||||||||||||| |||||||||| ||||  | || |||||||||||||
Sbjct: 553 tccgattgtagaagaaaaagttgatcgaccatatgacccccttttcaagaaatggatctc 494

                                                                       
Query: 518 catcagagtctgggttgtagctgtagatgtcacactccctgattttgataacctcatcta 577
           ||||   |||||| || ||||||||||||||| |||| | |||||||||||||||||| |
Sbjct: 493 catcttggtctggattatagctgtagatgtcagactctccgattttgataacctcatcaa 434

                                                                       
Query: 578 tggctttagtcatactgtccagaagagaactgccttcatttcttgctgcccagagcctag 637
           || | |||||||||||||| ||||||||| |||| |||||| ||||||||||  || | |
Sbjct: 433 tgacattagtcatactgtctagaagagaagtgccctcatttgttgctgcccattgctttg 374

                                                                       
Query: 638 aagcctccgataagtagttgtccaccatctgcttgaaactttccatgtcttcttctttga 697
           ||||||| ||||||||| ||||   ||||| ||| || ||||||   || ||||||||||
Sbjct: 373 aagcctcagataagtaggtgtctgtcatctccttaaagctttcccactcctcttctttga 314

                                        
Query: 698 agaatangtgtgcccgaacagcactgaaa 726
           |||| | ||||||||||||||||||||||
Sbjct: 313 agaacaggtgtgcccgaacagcactgaaa 285
to top
>dbj|AK061921.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-B09, full
           insert sequence
          Length = 1237

 Score =  250 bits (126), Expect = 6e-63
 Identities = 323/389 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 atatgtccatgtcgatcaacgcatcttcctcctcgccatccgagagcgcaccagcaagga 397
           ||||||||||||| ||||  ||||||||||| || ||||| ||  | ||||  | |||||
Sbjct: 920 atatgtccatgtctatcagtgcatcttcctcttcaccatcggatggtgcactggtaagga 861

                                                                       
Query: 398 aatcatcccctgcaaatttgctagtacagcagcagcgaaagctcactacccgcttgagct 457
           | ||||| ||||  | ||||||  |||| | ||| ||||||||||| || ||||| ||||
Sbjct: 860 agtcatctcctgatattttgcttatacaactgcaacgaaagctcacaactcgctttagct 801

                                                                       
Query: 458 tccggtggtagaagaaaaagttgaccgaccatatggcccctgtctctagaaatggatctc 517
           |||| | ||||||||||||||||| |||||||||| ||||  | || |||||||||||||
Sbjct: 800 tccgattgtagaagaaaaagttgatcgaccatatgacccccttttcaagaaatggatctc 741

                                                                       
Query: 518 catcagagtctgggttgtagctgtagatgtcacactccctgattttgataacctcatcta 577
           ||||   |||||| || ||||||||||||||| |||| | |||||||||||||||||| |
Sbjct: 740 catcttggtctggattatagctgtagatgtcagactctccgattttgataacctcatcaa 681

                                                                       
Query: 578 tggctttagtcatactgtccagaagagaactgccttcatttcttgctgcccagagcctag 637
           || | |||||||||||||| ||||||||| |||| |||||| ||||||||||  || | |
Sbjct: 680 tgacattagtcatactgtctagaagagaagtgccctcatttgttgctgcccattgctttg 621

                                                                       
Query: 638 aagcctccgataagtagttgtccaccatctgcttgaaactttccatgtcttcttctttga 697
           ||||||| ||||||||| ||||   ||||| ||| || ||||||   || ||||||||||
Sbjct: 620 aagcctcagataagtaggtgtctgtcatctccttaaagctttcccactcctcttctttga 561

                                        
Query: 698 agaatangtgtgcccgaacagcactgaaa 726
           |||| | ||||||||||||||||||||||
Sbjct: 560 agaacaggtgtgcccgaacagcactgaaa 532
to top
>dbj|AK065171.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002C20, full
           insert sequence
          Length = 1244

 Score =  250 bits (126), Expect = 6e-63
 Identities = 323/389 (83%)
 Strand = Plus / Minus

                                                                       
Query: 338 atatgtccatgtcgatcaacgcatcttcctcctcgccatccgagagcgcaccagcaagga 397
           ||||||||||||| ||||  ||||||||||| || ||||| ||  | ||||  | |||||
Sbjct: 927 atatgtccatgtctatcagtgcatcttcctcttcaccatcggatggtgcactggtaagga 868

                                                                       
Query: 398 aatcatcccctgcaaatttgctagtacagcagcagcgaaagctcactacccgcttgagct 457
           | ||||| ||||  | ||||||  |||| | ||| ||||||||||| || ||||| ||||
Sbjct: 867 agtcatctcctgatattttgcttatacaactgcaacgaaagctcacaactcgctttagct 808

                                                                       
Query: 458 tccggtggtagaagaaaaagttgaccgaccatatggcccctgtctctagaaatggatctc 517
           |||| | ||||||||||||||||| |||||||||| ||||  | || |||||||||||||
Sbjct: 807 tccgattgtagaagaaaaagttgatcgaccatatgacccccttttcaagaaatggatctc 748

                                                                       
Query: 518 catcagagtctgggttgtagctgtagatgtcacactccctgattttgataacctcatcta 577
           ||||   |||||| || ||||||||||||||| |||| | |||||||||||||||||| |
Sbjct: 747 catcttggtctggattatagctgtagatgtcagactctccgattttgataacctcatcaa 688

                                                                       
Query: 578 tggctttagtcatactgtccagaagagaactgccttcatttcttgctgcccagagcctag 637
           || | |||||||||||||| ||||||||| |||| |||||| ||||||||||  || | |
Sbjct: 687 tgacattagtcatactgtctagaagagaagtgccctcatttgttgctgcccattgctttg 628

                                                                       
Query: 638 aagcctccgataagtagttgtccaccatctgcttgaaactttccatgtcttcttctttga 697
           ||||||| ||||||||| ||||   ||||| ||| || ||||||   || ||||||||||
Sbjct: 627 aagcctcagataagtaggtgtctgtcatctccttaaagctttcccactcctcttctttga 568

                                        
Query: 698 agaatangtgtgcccgaacagcactgaaa 726
           |||| | ||||||||||||||||||||||
Sbjct: 567 agaacaggtgtgcccgaacagcactgaaa 539
to top
>dbj|AK099504.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013028O12, full
           insert sequence
          Length = 1243

 Score =  242 bits (122), Expect = 1e-60
 Identities = 322/389 (82%)
 Strand = Plus / Minus

                                                                       
Query: 338 atatgtccatgtcgatcaacgcatcttcctcctcgccatccgagagcgcaccagcaagga 397
           ||||||||||||| ||||  ||||||||||| || ||||| ||  | ||||  | |||||
Sbjct: 928 atatgtccatgtctatcagtgcatcttcctcttcaccatcggatggtgcactggtaagga 869

                                                                       
Query: 398 aatcatcccctgcaaatttgctagtacagcagcagcgaaagctcactacccgcttgagct 457
           | ||||| ||||  | ||||||  |||| | ||| ||||||||||| || ||||| ||||
Sbjct: 868 agtcatctcctgatattttgcttatacaactgcaacgaaagctcacaactcgctttagct 809

                                                                       
Query: 458 tccggtggtagaagaaaaagttgaccgaccatatggcccctgtctctagaaatggatctc 517
           |||| | ||||||||||||||||| |||||||||| ||||  | || |||||||||||||
Sbjct: 808 tccgattgtagaagaaaaagttgatcgaccatatgacccccttttcaagaaatggatctc 749

                                                                       
Query: 518 catcagagtctgggttgtagctgtagatgtcacactccctgattttgataacctcatcta 577
           ||||   |||||| || || |||||||||||| |||| | |||||||||||||||||| |
Sbjct: 748 catcttggtctggattataactgtagatgtcagactctccgattttgataacctcatcaa 689

                                                                       
Query: 578 tggctttagtcatactgtccagaagagaactgccttcatttcttgctgcccagagcctag 637
           || | |||||||||||||| ||||||||| |||| |||||| ||||||||||  || | |
Sbjct: 688 tgacattagtcatactgtctagaagagaagtgccctcatttgttgctgcccattgctttg 629

                                                                       
Query: 638 aagcctccgataagtagttgtccaccatctgcttgaaactttccatgtcttcttctttga 697
           ||||||| ||||||||| ||||   ||||| ||| || ||||||   || ||||||||||
Sbjct: 628 aagcctcagataagtaggtgtctgtcatctccttaaagctttcccactcctcttctttga 569

                                        
Query: 698 agaatangtgtgcccgaacagcactgaaa 726
           |||| | ||||||||||||||||||||||
Sbjct: 568 agaacaggtgtgcccgaacagcactgaaa 540
to top
>emb|AL606999.3|OSJN00127 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K01,
             complete sequence
          Length = 163448

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                         
Query: 567   aacctcatctatggctttagtcatactgtccagaagagaactgccttcatttcttgctgc 626
             ||||||||| ||| | |||||||||||||| ||||||||| |||| |||||| |||||||
Sbjct: 75445 aacctcatcaatgacattagtcatactgtctagaagagaagtgccctcatttgttgctgc 75504

                
Query: 627   cca 629
             |||
Sbjct: 75505 cca 75507



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                         
Query: 505   agaaatggatctccatcagagtctgggttgtagctgtagatgtcacactccctgattttg 564
             |||||||||||||||||   |||||| || ||||||||||||||| |||| | |||||||
Sbjct: 75307 agaaatggatctccatcttggtctggattatagctgtagatgtcagactctccgattttg 75366

                    
Query: 565   ataacct 571
             |||||||
Sbjct: 75367 ataacct 75373



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                      
Query: 433   cgaaagctcactacccgcttgagcttccggtggtagaagaaaaagttgaccgaccat 489
             ||||||||||| || ||||| |||||||| | ||||||||||||||||| |||||||
Sbjct: 75153 cgaaagctcacaactcgctttagcttccgattgtagaagaaaaagttgatcgaccat 75209



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 73/87 (83%)
 Strand = Plus / Plus

                                                                         
Query: 637   gaagcctccgataagtagttgtccaccatctgcttgaaactttccatgtcttcttctttg 696
             |||||||| ||||||||| ||||   ||||| ||| || ||||||   || |||||||||
Sbjct: 75740 gaagcctcagataagtaggtgtctgtcatctccttaaagctttcccactcctcttctttg 75799

                                        
Query: 697   aagaatangtgtgcccgaacagcactg 723
             ||||| | |||||||||||||||||||
Sbjct: 75800 aagaacaggtgtgcccgaacagcactg 75826



 Score = 40.1 bits (20), Expect = 9.9
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                     
Query: 338   atatgtccatgtcgatcaacgcatcttcctcctcgccatc 377
             ||||||||||||| ||||  ||||||||||| || |||||
Sbjct: 74968 atatgtccatgtctatcagtgcatcttcctcttcaccatc 75007
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                            
Query: 567      aacctcatctatggctttagtcatactgtccagaagagaactgccttcatttcttgctgc 626
                ||||||||| ||| | |||||||||||||| ||||||||| |||| |||||| |||||||
Sbjct: 33863546 aacctcatcaatgacattagtcatactgtctagaagagaagtgccctcatttgttgctgc 33863605

                   
Query: 627      cca 629
                |||
Sbjct: 33863606 cca 33863608



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 59/67 (88%)
 Strand = Plus / Plus

                                                                            
Query: 505      agaaatggatctccatcagagtctgggttgtagctgtagatgtcacactccctgattttg 564
                |||||||||||||||||   |||||| || ||||||||||||||| |||| | |||||||
Sbjct: 33863408 agaaatggatctccatcttggtctggattatagctgtagatgtcagactctccgattttg 33863467

                       
Query: 565      ataacct 571
                |||||||
Sbjct: 33863468 ataacct 33863474



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                         
Query: 433      cgaaagctcactacccgcttgagcttccggtggtagaagaaaaagttgaccgaccat 489
                ||||||||||| || ||||| |||||||| | ||||||||||||||||| |||||||
Sbjct: 33863254 cgaaagctcacaactcgctttagcttccgattgtagaagaaaaagttgatcgaccat 33863310



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 73/87 (83%)
 Strand = Plus / Plus

                                                                            
Query: 637      gaagcctccgataagtagttgtccaccatctgcttgaaactttccatgtcttcttctttg 696
                |||||||| ||||||||| ||||   ||||| ||| || ||||||   || |||||||||
Sbjct: 33863841 gaagcctcagataagtaggtgtctgtcatctccttaaagctttcccactcctcttctttg 33863900

                                           
Query: 697      aagaatangtgtgcccgaacagcactg 723
                ||||| | |||||||||||||||||||
Sbjct: 33863901 aagaacaggtgtgcccgaacagcactg 33863927



 Score = 40.1 bits (20), Expect = 9.9
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                        
Query: 338      atatgtccatgtcgatcaacgcatcttcctcctcgccatc 377
                ||||||||||||| ||||  ||||||||||| || |||||
Sbjct: 33863069 atatgtccatgtctatcagtgcatcttcctcttcaccatc 33863108
to top
>gb|BC102224.1| Bos taurus similar to MAF1 protein, mRNA (cDNA clone MGC:127274
           IMAGE:7946591), complete cds
          Length = 1523

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 524 agtctgggttgtagctgtagatgtcaca 551
           ||||||||||||||||||||||||||||
Sbjct: 899 agtctgggttgtagctgtagatgtcaca 872
to top
>ref|NM_001034424.1| Bos taurus similar to MAF1 protein (MGC127274), mRNA
          Length = 1523

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 524 agtctgggttgtagctgtagatgtcaca 551
           ||||||||||||||||||||||||||||
Sbjct: 899 agtctgggttgtagctgtagatgtcaca 872
to top
>gb|BC096891.1| Danio rerio zgc:112356, mRNA (cDNA clone MGC:112356 IMAGE:7286091),
           complete cds
          Length = 2717

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 525 gtctgggttgtagctgtagatgtcaca 551
           |||||||||||||||||||||||||||
Sbjct: 993 gtctgggttgtagctgtagatgtcaca 967
to top
>ref|NM_001030239.1| Danio rerio zgc:112356 (zgc:112356), mRNA
          Length = 2717

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 525 gtctgggttgtagctgtagatgtcaca 551
           |||||||||||||||||||||||||||
Sbjct: 993 gtctgggttgtagctgtagatgtcaca 967
to top
>ref|XM_852645.1| PREDICTED: Canis familiaris similar to MAF1 protein, transcript
           variant 2 (LOC482087), mRNA
          Length = 1507

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 524 agtctgggttgtagctgtagatgtcacactc 554
           ||||||||||||| |||||||||||||||||
Sbjct: 844 agtctgggttgtaactgtagatgtcacactc 814
to top
>ref|XM_539208.2| PREDICTED: Canis familiaris similar to MAF1 protein, transcript
           variant 1 (LOC482087), mRNA
          Length = 1545

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 524 agtctgggttgtagctgtagatgtcacactc 554
           ||||||||||||| |||||||||||||||||
Sbjct: 882 agtctgggttgtaactgtagatgtcacactc 852
to top
>emb|BX929817.2| Gallus gallus finished cDNA, clone ChEST549o13
          Length = 768

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 525 gtctgggttgtagctgtagatgtcacactc 554
           |||||||||||||||||||||||| |||||
Sbjct: 2   gtctgggttgtagctgtagatgtcgcactc 31
to top
>ref|NM_026859.2| Mus musculus MAF1 homolog (S. cerevisiae) (Maf1), mRNA
          Length = 1702

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 526 tctgggttgtagctgtagatgtcacactc 554
           |||||||| ||||||||||||||||||||
Sbjct: 916 tctgggttatagctgtagatgtcacactc 888
to top
>gb|BC016260.1| Mus musculus MAF1 homolog (S. cerevisiae), mRNA (cDNA clone
           MGC:28902 IMAGE:4914167), complete cds
          Length = 1702

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 526 tctgggttgtagctgtagatgtcacactc 554
           |||||||| ||||||||||||||||||||
Sbjct: 916 tctgggttatagctgtagatgtcacactc 888
to top
>dbj|AK154047.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430029D09
           product:MAF1 homolog (yeast), full insert sequence
          Length = 1640

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 526 tctgggttgtagctgtagatgtcacactc 554
           |||||||| ||||||||||||||||||||
Sbjct: 871 tctgggttatagctgtagatgtcacactc 843
to top
>dbj|AK042913.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730038N03 product:HOMOLOG OF
           YEAST MAF1 homolog [Homo sapiens], full insert sequence
          Length = 1597

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 526 tctgggttgtagctgtagatgtcacactc 554
           |||||||| ||||||||||||||||||||
Sbjct: 822 tctgggttatagctgtagatgtcacactc 794
to top
>dbj|AK004406.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110068E11 product:MAF1 homolog
           (yeast), full insert sequence
          Length = 1370

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 526 tctgggttgtagctgtagatgtcacactc 554
           |||||||| ||||||||||||||||||||
Sbjct: 601 tctgggttatagctgtagatgtcacactc 573
to top
>dbj|AK196909.1| Mus musculus cDNA, clone:Y1G0123G09, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023212, based on BLAT search
          Length = 240

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 526 tctgggttgtagctgtagatgtcacactc 554
           |||||||| ||||||||||||||||||||
Sbjct: 140 tctgggttatagctgtagatgtcacactc 112
to top
>dbj|AK189875.1| Mus musculus cDNA, clone:Y1G0101A22, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023212, based on BLAT search
          Length = 239

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 526 tctgggttgtagctgtagatgtcacactc 554
           |||||||| ||||||||||||||||||||
Sbjct: 140 tctgggttatagctgtagatgtcacactc 112
to top
>ref|NM_032272.3| Homo sapiens MAF1 homolog (S. cerevisiae) (MAF1), mRNA
          Length = 1766

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 524  agtctgggttgtagctgtagatgtcaca 551
            |||||||||| |||||||||||||||||
Sbjct: 1002 agtctgggttatagctgtagatgtcaca 975
to top
>gb|BC031273.1| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (cDNA clone
           MGC:39758 IMAGE:5288176), complete cds
          Length = 1705

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 524 agtctgggttgtagctgtagatgtcaca 551
           |||||||||| |||||||||||||||||
Sbjct: 917 agtctgggttatagctgtagatgtcaca 890
to top
>gb|BC014082.2| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (cDNA clone
           MGC:20332 IMAGE:4304506), complete cds
          Length = 1691

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 524 agtctgggttgtagctgtagatgtcaca 551
           |||||||||| |||||||||||||||||
Sbjct: 907 agtctgggttatagctgtagatgtcaca 880
to top
>emb|AL136937.1|HSM801901 Homo sapiens mRNA; cDNA DKFZp586G1123 (from clone DKFZp586G1123)
          Length = 1674

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 524 agtctgggttgtagctgtagatgtcaca 551
           |||||||||| |||||||||||||||||
Sbjct: 906 agtctgggttatagctgtagatgtcaca 879
to top
>emb|CR621223.1| full-length cDNA clone CS0DF003YD16 of Fetal brain of Homo sapiens
           (human)
          Length = 1659

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 524 agtctgggttgtagctgtagatgtcaca 551
           |||||||||| |||||||||||||||||
Sbjct: 913 agtctgggttatagctgtagatgtcaca 886
to top
>emb|CR600048.1| full-length cDNA clone CS0DH001YI22 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1661

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 524 agtctgggttgtagctgtagatgtcaca 551
           |||||||||| |||||||||||||||||
Sbjct: 912 agtctgggttatagctgtagatgtcaca 885
to top
>emb|CR533463.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0317D for
           gene MAF1, homolog of yeast MAF1; complete cds, incl.
           stopcodon
          Length = 787

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 524 agtctgggttgtagctgtagatgtcaca 551
           |||||||||| |||||||||||||||||
Sbjct: 514 agtctgggttatagctgtagatgtcaca 487
to top
>gb|BC018714.1| Homo sapiens MAF1 homolog (S. cerevisiae), mRNA (cDNA clone
           MGC:31779 IMAGE:5014952), complete cds
          Length = 1727

 Score = 48.1 bits (24), Expect = 0.041
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 524 agtctgggttgtagctgtagatgtcaca 551
           |||||||||| |||||||||||||||||
Sbjct: 914 agtctgggttatagctgtagatgtcaca 887
to top
>gb|BC004909.1| Homo sapiens aldehyde dehydrogenase 6 family, member A1, mRNA (cDNA
            clone MGC:4657 IMAGE:3530715), complete cds
          Length = 1854

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 211  aaagtttctacagggaactgcc 232
            ||||||||||||||||||||||
Sbjct: 1784 aaagtttctacagggaactgcc 1805
to top
>ref|XM_821979.1| Trypanosoma brucei TREU927 hypothetical protein (Tb09.160.5230)
           partial mRNA
          Length = 618

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 345 catgtcgatcaacgcatcttcc 366
           ||||||||||||||||||||||
Sbjct: 216 catgtcgatcaacgcatcttcc 195
to top
>gb|BC083712.1| Rattus norvegicus MAF1 homolog (S. cerevisiae), mRNA (cDNA clone
           MGC:94603 IMAGE:7190634), complete cds
          Length = 1649

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 526 tctgggttgtagctgtagatgtcaca 551
           |||||||| |||||||||||||||||
Sbjct: 867 tctgggttatagctgtagatgtcaca 842
to top
>ref|NM_001014085.1| Rattus norvegicus MAF1 homolog (S. cerevisiae) (Maf1), mRNA
          Length = 1649

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 526 tctgggttgtagctgtagatgtcaca 551
           |||||||| |||||||||||||||||
Sbjct: 867 tctgggttatagctgtagatgtcaca 842
to top
>gb|AF130089.1|AF130089 Homo sapiens clone FLB9440 PRO2550 mRNA, complete cds
          Length = 2144

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 211  aaagtttctacagggaactgcc 232
            ||||||||||||||||||||||
Sbjct: 1450 aaagtttctacagggaactgcc 1429
to top
>emb|BX248100.9| Zebrafish DNA sequence from clone CH211-222O11 in linkage group 7,
              complete sequence
          Length = 223489

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 65     atgtctccagagtccagaccaa 86
              ||||||||||||||||||||||
Sbjct: 108066 atgtctccagagtccagaccaa 108045
to top
>gb|AC165163.2| Mus musculus BAC clone RP23-146B12 from chromosome 14, complete
             sequence
          Length = 178254

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 559   attttgataacctcatctatg 579
             |||||||||||||||||||||
Sbjct: 46865 attttgataacctcatctatg 46885
to top
>ref|NM_001014169.1| Rattus norvegicus LOC361776 (LOC361776), mRNA
          Length = 1505

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 675  actttccatgtcttcttcttt 695
            |||||||||||||||||||||
Sbjct: 1015 actttccatgtcttcttcttt 995
to top
>ref|XM_574697.1| PREDICTED: Rattus norvegicus hypothetical gene supported by BC079324
            (LOC499379), mRNA
          Length = 1481

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 675  actttccatgtcttcttcttt 695
            |||||||||||||||||||||
Sbjct: 1015 actttccatgtcttcttcttt 995
to top
>gb|BC079324.1| Rattus norvegicus LOC361776, mRNA (cDNA clone MGC:94503
            IMAGE:7135457), complete cds
          Length = 1505

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 675  actttccatgtcttcttcttt 695
            |||||||||||||||||||||
Sbjct: 1015 actttccatgtcttcttcttt 995
to top
>emb|AL844608.18| Mouse DNA sequence from clone RP23-27L22 on chromosome 2, complete
              sequence
          Length = 207035

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 182    tctccaaacagacaaacaaagtcac 206
              |||||||||| ||||||||||||||
Sbjct: 201622 tctccaaacaaacaaacaaagtcac 201646
to top
>dbj|AP003043.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-617B3, complete
              sequence
          Length = 180648

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 181    ctctccaaacagacaaacaaa 201
              |||||||||||||||||||||
Sbjct: 145184 ctctccaaacagacaaacaaa 145204
to top
>gb|AC153383.1| Mus musculus 6 BAC RP23-168L2 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 197962

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 678   ttccatgtcttcttctttga 697
             ||||||||||||||||||||
Sbjct: 35099 ttccatgtcttcttctttga 35118
to top
>gb|AC158308.4| Mus musculus chromosome 3, clone RP23-182M12, complete sequence
          Length = 176856

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 181    ctctccaaacagacaaacaa 200
              ||||||||||||||||||||
Sbjct: 121878 ctctccaaacagacaaacaa 121897
to top
>gb|AC167724.6| Mus musculus 10 BAC RP23-331P17 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 230186

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 678    ttccatgtcttcttctttga 697
              ||||||||||||||||||||
Sbjct: 114501 ttccatgtcttcttctttga 114482
to top
>gb|AC121275.20| Mus musculus chromosome 8, clone RP24-234C3, complete sequence
          Length = 158075

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 620    ttgctgcccagagcctagaa 639
              ||||||||||||||||||||
Sbjct: 139696 ttgctgcccagagcctagaa 139677
to top
>gb|AE006222.1| Pasteurella multocida subsp. multocida str. Pm70 section 189 of 204
            of the complete genome
          Length = 10085

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 551  actccctgattttgataacc 570
            ||||||||||||||||||||
Sbjct: 8364 actccctgattttgataacc 8345
to top
>ref|XM_924200.2| PREDICTED: Mus musculus alpha-kinase 1, transcript variant 6 (Alpk1),
            mRNA
          Length = 6505

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 181  ctctccaaacagacaaacaa 200
            ||||||||||||||||||||
Sbjct: 6322 ctctccaaacagacaaacaa 6303
to top
>gb|AC124488.3| Mus musculus BAC clone RP23-452K20 from chromosome 1, complete sequence
          Length = 178446

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 505    agaaatggatctccatcaga 524
              ||||||||||||||||||||
Sbjct: 129588 agaaatggatctccatcaga 129569
to top
>emb|AL357832.11| Human DNA sequence from clone RP11-125D12 on chromosome 6 Contains 2
             novel genes, complete sequence
          Length = 147458

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 92    caaactttgccagttcaaat 111
             ||||||||||||||||||||
Sbjct: 58618 caaactttgccagttcaaat 58637
to top
>emb|AL021329.1|HS239K6 Human DNA sequence from clone RP1-239K6 on chromosome 6p22.3-23
             Contains a novel gene, complete sequence
          Length = 105162

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 536   agctgtagatgtcacactccctgatttt 563
             ||||| |||| |||||||||||||||||
Sbjct: 83186 agctggagatatcacactccctgatttt 83159
to top
>emb|AL807374.1|NCB13H18 Neurospora crassa DNA linkage group V BAC contig B13H18
          Length = 122576

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     ctccagagtccagaccaaag 88
              ||||||||||||||||||||
Sbjct: 115471 ctccagagtccagaccaaag 115490
to top
>gb|AC087530.8| Homo sapiens chromosome 17, clone RP11-313F15, complete sequence
          Length = 170507

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 385    gcaccagcaaggaaatcatc 404
              ||||||||||||||||||||
Sbjct: 119397 gcaccagcaaggaaatcatc 119416
to top
>gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome
          Length = 2839318

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 345     catgtcgatcaacgcatcttcctc 368
               |||||||||| |||||||||||||
Sbjct: 1987228 catgtcgatcgacgcatcttcctc 1987251
to top
>gb|AC133012.5| Homo sapiens chromosome 17, clone RP11-582A10, complete sequence
          Length = 153014

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 385   gcaccagcaaggaaatcatc 404
             ||||||||||||||||||||
Sbjct: 52689 gcaccagcaaggaaatcatc 52670
to top
>gb|AC161378.2| Mus musculus BAC clone RP23-202A6 from chromosome 16, complete sequence
          Length = 219298

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 606    actgccttcatttcttgctg 625
              ||||||||||||||||||||
Sbjct: 189761 actgccttcatttcttgctg 189742
to top
>gb|AC154429.4| Mus musculus BAC clone RP24-202G18 from chromosome 16, complete sequence
          Length = 170875

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 606    actgccttcatttcttgctg 625
              ||||||||||||||||||||
Sbjct: 144298 actgccttcatttcttgctg 144279
to top
>gb|AC102600.11| Mus musculus chromosome 3, clone RP23-376E16, complete sequence
          Length = 131703

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   ctctccaaacagacaaacaa 200
             ||||||||||||||||||||
Sbjct: 79231 ctctccaaacagacaaacaa 79212
to top
>gb|AC133638.7| Homo sapiens chromosome 17, clone CTD-2125J20, complete sequence
          Length = 139560

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 385   gcaccagcaaggaaatcatc 404
             ||||||||||||||||||||
Sbjct: 85950 gcaccagcaaggaaatcatc 85931
to top
>dbj|AK173191.1| Mus musculus mRNA for mKIAA1527 protein
          Length = 6402

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 181  ctctccaaacagacaaacaa 200
            ||||||||||||||||||||
Sbjct: 6308 ctctccaaacagacaaacaa 6289
to top
>gb|AC154800.2| Mus musculus BAC clone RP24-496O9 from 14, complete sequence
          Length = 175264

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 607    ctgccttcatttcttgctgc 626
              ||||||||||||||||||||
Sbjct: 110197 ctgccttcatttcttgctgc 110216
to top
>gb|AY746497.1| Enterobacteria phage JS98 contig9 genomic sequence
          Length = 48675

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 113   tggcagactgaagttaaatc 132
             ||||||||||||||||||||
Sbjct: 34683 tggcagactgaagttaaatc 34702
to top
>gb|AC124225.13| Mus musculus chromosome 16, clone RP23-83P23, complete sequence
          Length = 157891

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 606    actgccttcatttcttgctg 625
              ||||||||||||||||||||
Sbjct: 149899 actgccttcatttcttgctg 149918
to top
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 292    gtcacactggttggttggtcatgt 315
              ||||||||||||||||| ||||||
Sbjct: 906541 gtcacactggttggttgctcatgt 906518
to top
>gb|M63149.1|TOVM1P Ustilago maydis virus P1 (M1) gene, complete cds
          Length = 1504

 Score = 40.1 bits (20), Expect = 9.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 203 tcacgctaaaagtttctaca 222
           ||||||||||||||||||||
Sbjct: 187 tcacgctaaaagtttctaca 168


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,057,291
Number of Sequences: 3902068
Number of extensions: 7057291
Number of successful extensions: 130203
Number of sequences better than 10.0: 63
Number of HSP's better than 10.0 without gapping: 63
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 130012
Number of HSP's gapped (non-prelim): 183
length of query: 726
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 703
effective length of database: 17,143,297,704
effective search space: 12051738285912
effective search space used: 12051738285912
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top