ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags30d17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, co... 666 0.0
2dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, co... 658 0.0
3dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, co... 609 e-171
4gb|BT016569.1| Zea mays clone Contig402 mRNA sequence 365 1e-97
5gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence 365 1e-97
6gb|AY103710.1| Zea mays PCO123562 mRNA sequence 365 1e-97
7emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274) 353 4e-94
8gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complet... 353 4e-94
9dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clon... 353 4e-94
10ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predic... 339 6e-90
11dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clon... 339 6e-90
12gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence 337 2e-89
13gb|AY103585.1| Zea mays PCO123564 mRNA sequence 325 9e-86
14ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predic... 311 1e-81
15dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clon... 311 1e-81
16gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence 309 5e-81
17dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 3e-79
18gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds 297 2e-77
19gb|AY109370.1| Zea mays CL2029_4 mRNA sequence 278 2e-71
20gb|BT016301.1| Zea mays clone Contig134 mRNA sequence 240 4e-60
21gb|AY104486.1| Zea mays PCO109435 mRNA sequence 232 1e-57
22ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predic... 230 4e-57
23dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 230 4e-57
24gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome... 230 4e-57
25gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence 224 2e-55
26gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 212 9e-52
27gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str... 212 9e-52
28dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 212 9e-52
29dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 212 9e-52
30dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic D... 212 9e-52
31ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA 196 6e-47
32dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 6e-47
33dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 6e-47
34dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 6e-47
35dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 6e-47
36gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome... 192 9e-46
37gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome... 192 9e-46
38ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA 182 8e-43
39dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 8e-43
40dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clon... 176 5e-41
41ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA 159 1e-35
42dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
43dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, co... 159 1e-35
44dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, co... 147 5e-32
45gb|AY104826.1| Zea mays PCO099353 mRNA sequence 143 7e-31
46emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA 137 4e-29
47gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome... 135 2e-28
48gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome... 135 2e-28
49gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic seque... 135 2e-28
50gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependen... 135 2e-28
51gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 129 1e-26
52dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 127 4e-26
53dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 127 4e-26
54dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic D... 127 4e-26
55dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic D... 127 4e-26
56gb|AY110108.1| Zea mays CL14299_1 mRNA sequence 127 4e-26
57gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 127 4e-26
58emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa... 127 4e-26
59emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa... 127 4e-26
60gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1),... 127 4e-26
61gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 127 4e-26
62gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (... 121 3e-24
63gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosom... 121 3e-24
64ref|NM_010436.2| Mus musculus H2A histone family, member X (H2af... 121 3e-24
65emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X 121 3e-24
66gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (... 121 3e-24
67gb|AY108339.1| Zea mays PCO070432 mRNA sequence 121 3e-24
68gb|AY104828.1| Zea mays PCO072413 mRNA sequence 121 3e-24
69ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA 119 1e-23
70ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, ... 119 1e-23
71ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, ... 119 1e-23
72emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 119 1e-23
73ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA 119 1e-23
74emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 119 1e-23
75emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom... 119 1e-23
76gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MG... 119 1e-23
77dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKE... 119 1e-23
78dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 119 1e-23
79gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, ... 119 1e-23
80ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA 119 1e-23
81dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-l... 119 1e-23
82gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, comp... 119 1e-23
83gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, comp... 119 1e-23
84gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, comp... 119 1e-23
85gb|AF517874.1| Griffithsia japonica isolate Gj10 histone protein... 113 6e-22
86emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X 113 6e-22
87dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RI... 113 6e-22
88dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 113 6e-22
89dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic D... 113 6e-22
90dbj|AP004651.3| Oryza sativa (japonica cultivar-group) genomic D... 113 6e-22
91gb|AY104637.1| Zea mays PCO070433 mRNA sequence 113 6e-22
92ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H... 111 3e-21
93gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 111 3e-21
94gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds 111 3e-21
95ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo... 111 3e-21
96gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with appar... 111 3e-21
97emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) 111 3e-21
98emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) 111 3e-21
99gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MG... 111 3e-21
100emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 111 3e-21
101emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 111 3e-21
102gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MG... 111 3e-21
103dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 111 3e-21
104ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA 111 3e-21
105gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365,... 111 3e-21
106gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 111 3e-21
107gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 111 3e-21
108ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA 111 3e-21
109ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA 111 3e-21
110gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 111 3e-21
111dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 111 3e-21
112ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA 111 3e-21
113gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, comp... 111 3e-21
114gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp... 111 3e-21
115gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, comp... 111 3e-21
116gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, comp... 111 3e-21
117gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene... 111 3e-21
118gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp... 111 3e-21
119ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA 111 3e-21
120gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 ... 111 3e-21
121dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells ... 109 1e-20
122gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c... 109 1e-20
123gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and ... 107 4e-20
124gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent ... 107 4e-20
125ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H... 105 2e-19
126gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (... 105 2e-19
127ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone ... 105 2e-19
128ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AF... 105 2e-19
129emb|BX063165.1|CNS09KWH Single read from an extremity of a full-... 105 2e-19
130emb|BX063164.1|CNS09KWG Single read from an extremity of a full-... 105 2e-19
131emb|BX040864.1|CNS093P0 Single read from an extremity of a full-... 105 2e-19
132emb|BX019683.1|CNS08NCN Single read from an extremity of a full-... 105 2e-19
133emb|BX016451.1|CNS08KUV Single read from an extremity of a full-... 105 2e-19
134emb|BX009846.1|CNS08FRE Single read from an extremity of a full-... 105 2e-19
135emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X 105 2e-19
136gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (... 105 2e-19
137emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblas... 105 2e-19
138gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX)... 105 2e-19
139gb|AC119796.2| Oryza sativa (japonica cultivar-group) chromosome... 105 2e-19
140gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (... 105 2e-19
141dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:C... 105 2e-19
142gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:720558... 103 6e-19
143gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC... 103 6e-19
144gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC... 103 6e-19
145gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds 103 6e-19
146ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA 103 6e-19
147emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr... 103 6e-19
148emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 103 6e-19
149dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 103 6e-19
150ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA 103 6e-19
151ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA 103 6e-19
152ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (p... 103 6e-19
153gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, comp... 103 6e-19
154gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp... 103 6e-19
155gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp... 103 6e-19
156dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic D... 103 6e-19
157ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 ... 103 6e-19
158ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 ... 103 6e-19
159ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA 103 6e-19
160emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112... 103 6e-19
161gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complet... 103 6e-19
162gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 103 6e-19
163gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 103 6e-19
164gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complet... 103 6e-19
165gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds 101 2e-18
166ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone... 101 2e-18
167ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
168ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
169ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
170ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
171ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
172ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
173ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
174ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
175ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
176ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
177ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
178ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone ... 98 4e-17
179ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
180ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
181ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone ... 98 4e-17
182emb|BX016452.1|CNS08KUW Single read from an extremity of a full-... 98 4e-17
183emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-... 98 4e-17
184emb|X94693.1|TAH2A254 T.aestivum histone H2A gene 98 4e-17
185emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 98 4e-17
186emb|CR457079.1| Homo sapiens full open reading frame cDNA clone ... 98 4e-17
187gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, comple... 98 4e-17
188gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family me... 98 4e-17
189dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic D... 98 4e-17
190gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, comp... 98 4e-17
191gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds 98 4e-17
192gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds 98 4e-17
193gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone... 96 2e-16
194gb|AY849374.1| Emiliania huxleyi histone H2A mRNA, complete cds 96 2e-16
195ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone... 94 6e-16
196emb|BX008487.1|CNS08EPN Single read from an extremity of a full-... 92 2e-15
197gb|AY849373.1| Emiliania huxleyi histone H2A.X mRNA, complete cds 92 2e-15
198gb|BT016168.1| Zea mays clone Contig1 mRNA sequence 90 9e-15
199ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX ... 90 9e-15
200ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone ... 90 9e-15
201ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone ... 90 9e-15
202emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA 90 9e-15
203emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones 90 9e-15
204ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (H... 90 9e-15
205gb|AY105006.1| Zea mays PCO108932 mRNA sequence 90 9e-15
206gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 ... 88 4e-14
207gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 ... 88 4e-14
208ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 88 4e-14
209ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone ... 88 4e-14
210ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone... 88 4e-14
211gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, com... 88 4e-14
212emb|AL512384.9| Human DNA sequence from clone RP11-317E16 on chr... 86 1e-13
213emb|X14730.1|CMHIST2A Duck H2A histone gene 86 1e-13
214gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2... 86 1e-13
215ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone p... 84 6e-13
216ref|XM_871147.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 84 6e-13
217ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 84 6e-13
218ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A hist... 82 2e-12
219gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp... 82 2e-12
220ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020 ... 82 2e-12
221gb|M11084.1|SUPHIS2A1 Sea urchin (P.miliaris) late histone H2A-1... 82 2e-12
222gb|M14140.1|SUPH2B2 P.miliaris histone H2A-2.1 gene, complete cds 82 2e-12
223ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, ... 80 9e-12
224ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, ... 80 9e-12
225ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, ... 80 9e-12
226ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, ... 80 9e-12
227ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ... 80 9e-12
228ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi... 80 9e-12
229ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone ... 80 9e-12
230emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 80 9e-12
231dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 80 9e-12
232gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (... 80 9e-12
233dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, comple... 80 9e-12
234gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, ... 80 9e-12
235gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, co... 80 9e-12
236emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4,... 80 9e-12
237gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks 80 9e-12
238ref|XM_481315.1| Oryza sativa (japonica cultivar-group), mRNA 78 4e-11
239ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H... 78 4e-11
240ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA 78 4e-11
241ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA 78 4e-11
242gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG... 78 4e-11
243gb|BC104199.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MG... 78 4e-11
244gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 78 4e-11
245gb|BC034487.2| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IM... 78 4e-11
246gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone I... 78 4e-11
247ref|NG_001335.1| Homo sapiens genomic large histone family clust... 78 4e-11
248ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA 78 4e-11
249ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 78 4e-11
250ref|NM_021052.2| Homo sapiens histone 1, H2ae (HIST1H2AE), mRNA 78 4e-11
251ref|NM_003510.2| Homo sapiens histone 1, H2ak (HIST1H2AK), mRNA 78 4e-11
252ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone ... 78 4e-11
253ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone ... 78 4e-11
254ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone ... 78 4e-11
255ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h... 78 4e-11
256gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds 78 4e-11
257gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, comp... 78 4e-11
258emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o... 78 4e-11
259emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o... 78 4e-11
260emb|Z83739.1|HSZ83739 H.sapiens hH2A/d gene 78 4e-11
261emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A ... 78 4e-11
262emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 78 4e-11
263emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes 78 4e-11
264dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 78 4e-11
265dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-... 78 4e-11
266dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-... 78 4e-11
267dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-... 78 4e-11
268dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-... 78 4e-11
269gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ... 78 4e-11
270gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2... 78 4e-11
271dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full... 78 4e-11
272gb|BC093862.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG... 78 4e-11
273gb|BC093836.1| Homo sapiens histone 1, H2ae, mRNA (cDNA clone MG... 78 4e-11
274ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA 78 4e-11
275gb|AY131991.1| Homo sapiens histone H2A (HIST1H2AK) gene, comple... 78 4e-11
276gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, comp... 78 4e-11
277gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, com... 78 4e-11
278gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, com... 78 4e-11
279gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, comp... 78 4e-11
280dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
281dbj|AP005097.3| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
282dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501 78 4e-11
283gb|AY893520.1| Synthetic construct Homo sapiens clone FLH130895.... 78 4e-11
284gb|BC062255.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M... 78 4e-11
285gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 78 4e-11
286gb|AC157656.3| Mus musculus BAC clone RP23-406A5 from chromosome... 78 4e-11
287gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 78 4e-11
288gb|BC053966.1| Mus musculus histone 2, H2aa2, mRNA (cDNA clone I... 78 4e-11
289ref|XM_667061.1| Plasmodium berghei strain ANKA histone h2a (PB3... 78 4e-11
290gb|BC089519.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone M... 78 4e-11
291gb|M60752.1|HUMHISAG Human histone H2A.1 (H2A) gene, complete cds 78 4e-11
292gb|AY131986.1| Homo sapiens histone H2A (HIST1H2AE) gene, comple... 78 4e-11
293gb|AC160122.2| Mus musculus BAC clone RP23-390G1 from chromosome... 78 4e-11
294ref|XM_527283.1| PREDICTED: Pan troglodytes similar to Hist2h2aa... 76 1e-10
295ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, ... 76 1e-10
296ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 76 1e-10
297gb|BC069306.1| Homo sapiens histone 1, H2al, mRNA (cDNA clone MG... 76 1e-10
298ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 76 1e-10
299ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g ... 76 1e-10
300ref|NM_003511.2| Homo sapiens histone 1, H2al (HIST1H2AL), mRNA 76 1e-10
301emb|X83549.1|HSHISTN2A H.sapiens gene for histone H2A 76 1e-10
302emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a... 76 1e-10
303emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq... 76 1e-10
304ref|XM_345255.2| PREDICTED: Rattus norvegicus histone 2, H2aa (p... 76 1e-10
305ref|XM_574998.1| PREDICTED: Rattus norvegicus similar to Hist2h2... 76 1e-10
306ref|XM_574997.1| PREDICTED: Rattus norvegicus similar to histone... 76 1e-10
307gb|AY131992.1| Homo sapiens histone H2A (HIST1H2AL) gene, comple... 76 1e-10
308gb|BC112072.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 76 1e-10
309gb|BC105129.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 76 1e-10
310gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, c... 76 1e-10
311ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA 74 6e-10
312ref|NM_021065.2| Homo sapiens histone 1, H2ad (HIST1H2AD), mRNA 74 6e-10
313ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone ... 74 6e-10
314ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone ... 74 6e-10
315ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone ... 74 6e-10
316ref|XM_785689.1| PREDICTED: Strongylocentrotus purpuratus simila... 74 6e-10
317emb|Z80776.1|HSH2AG H.sapiens H2A/g gene 74 6e-10
318emb|X16495.1|MMHIST2A Murine H2A gene for histone H2A 74 6e-10
319emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones 74 6e-10
320emb|AJ245999.1|BNA245999 Brassica napus H2A gene for Histone H2A 74 6e-10
321emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking r... 74 6e-10
322gb|BC093807.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG... 74 6e-10
323emb|CR541999.1| Homo sapiens full open reading frame cDNA clone ... 74 6e-10
324emb|CR541970.1| Homo sapiens full open reading frame cDNA clone ... 74 6e-10
325gb|BC093809.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MG... 74 6e-10
326gb|AY131985.1| Homo sapiens histone H2A (HIST1H2AD) gene, comple... 74 6e-10
327ref|XM_954349.1| Neurospora crassa OR74A hypothetical protein (N... 72 2e-09
328ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 72 2e-09
329ref|XM_331212.1| Neurospora crassa OR74A hypothetical protein (N... 72 2e-09
330ref|NM_177688.2| Mus musculus H2A histone family, member J (H2af... 72 2e-09
331gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple... 72 2e-09
332emb|CR709561.2|CNS0GAG5 Tetraodon nigroviridis full-length cDNA 72 2e-09
333emb|X06642.1|SPH2BAL3 Strongylocentrotus purpuratus late histone... 72 2e-09
334gb|AY062171.1| Neurospora crassa histone H2A (hh2A) and histone ... 72 2e-09
335dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 72 2e-09
336ref|NM_214553.1| Strongylocentrotus purpuratus late histone L3 H... 72 2e-09
337gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (... 72 2e-09
338ref|XM_527287.1| PREDICTED: Pan troglodytes similar to Histone H... 70 9e-09
339ref|XM_518286.1| PREDICTED: Pan troglodytes similar to Histone H... 70 9e-09
340gb|BC017379.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG... 70 9e-09
341ref|XM_870473.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 70 9e-09
342ref|NM_003514.2| Homo sapiens histone 1, H2am (HIST1H2AM), mRNA 70 9e-09
343ref|NM_003512.3| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA 70 9e-09
344emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro... 70 9e-09
345gb|AY270707.1| Homo sapiens clone SKA08-D09 putative promoter se... 70 9e-09
346emb|Z80778.1|HSH2AL H.sapiens H2A/l gene 70 9e-09
347emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2... 70 9e-09
348ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA 70 9e-09
349emb|CR624886.1| full-length cDNA clone CS0DK009YH13 of HeLa cell... 70 9e-09
350emb|CR621753.1| full-length cDNA clone CS0DI059YA15 of Placenta ... 70 9e-09
351gb|BC032686.1| Homo sapiens, clone IMAGE:5581652, mRNA 70 9e-09
352emb|CR608156.1| full-length cDNA clone CS0DI013YB19 of Placenta ... 70 9e-09
353gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 70 9e-09
354gb|U90551.1|HSU90551 Human histone 2A-like protein (H2A/l) mRNA,... 70 9e-09
355gb|AY131993.1| Homo sapiens histone H2A (HIST1H2AM) gene, comple... 70 9e-09
356gb|BC085010.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG... 70 9e-09
357gb|AY894000.1| Synthetic construct Homo sapiens clone FLH130938.... 70 9e-09
358gb|AY893556.1| Synthetic construct Homo sapiens clone FLH130901.... 70 9e-09
359gb|AY893555.1| Synthetic construct Homo sapiens clone FLH130900.... 70 9e-09
360gb|BC071668.1| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG... 70 9e-09
361gb|BC050602.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MG... 70 9e-09
362gb|BC032756.1| Homo sapiens histone 1, H2am, mRNA (cDNA clone MG... 70 9e-09
363dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, comple... 70 9e-09
364gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, co... 70 9e-09
365gb|AY131984.1| Homo sapiens histone H2A (HIST1H2AC) gene, comple... 70 9e-09
366ref|XM_527254.1| PREDICTED: Pan troglodytes similar to HIST2H3C ... 68 3e-08
367ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H... 68 3e-08
368ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA 68 3e-08
369ref|XM_361034.1| Magnaporthe grisea 70-15 hypothetical protein (... 68 3e-08
370ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 68 3e-08
371gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC... 68 3e-08
372gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMA... 68 3e-08
373ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 68 3e-08
374ref|NM_003513.2| Homo sapiens histone 1, H2ab (HIST1H2AB), mRNA 68 3e-08
375ref|XM_752558.1| Ustilago maydis 521 histone H2A (UM01504.1) par... 68 3e-08
376ref|XM_789760.1| PREDICTED: Strongylocentrotus purpuratus simila... 68 3e-08
377ref|XM_781115.1| PREDICTED: Strongylocentrotus purpuratus simila... 68 3e-08
378emb|X00089.1|HSHISH2A Human histone H2a gene 68 3e-08
379emb|AJ494853.1|ODI494853 Oikopleura dioica mRNA for histone H2A.... 68 3e-08
380emb|Z83741.1|HSZ83741 H.sapiens hH2A/m gene 68 3e-08
381dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 68 3e-08
382dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA... 68 3e-08
383dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 68 3e-08
384dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-... 68 3e-08
385dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN ... 68 3e-08
386dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 68 3e-08
387ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (p... 68 3e-08
388gb|AY131983.1| Homo sapiens histone H2A (HIST1H2AB) gene, comple... 68 3e-08
389gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, compl... 68 3e-08
390gb|AY850346.1| Magnaporthe grisea histone H2A-like protein mRNA,... 68 3e-08
391emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr... 68 3e-08
392ref|NM_100760.2| Arabidopsis thaliana DNA binding AT1G08880 mRNA... 66 1e-07
393ref|XM_870470.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 66 1e-07
394gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC... 66 1e-07
395emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq... 66 1e-07
396gb|AY093975.1| Arabidopsis thaliana At1g08880/F7G19_24 mRNA, com... 66 1e-07
397gb|AF412092.1|AF412092 Arabidopsis thaliana At1g08880/F7G19_24 m... 66 1e-07
398emb|BX818384.1|CNS0ACP9 Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
399emb|BX818184.1|CNS0ACP1 Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
400emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4 66 1e-07
401gb|AY087924.1| Arabidopsis thaliana clone 39667 mRNA, complete s... 66 1e-07
402ref|NM_021840.2| Rattus norvegicus histone 2a (H2a), mRNA 64 5e-07
403gb|BC099140.1| Rattus norvegicus histone 2a, mRNA (cDNA clone MG... 64 5e-07
404dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-1409... 64 5e-07
405gb|AY104725.1| Zea mays PCO121651 mRNA sequence 64 5e-07
406gb|BC060324.1| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MG... 62 2e-06
407ref|XM_527273.1| PREDICTED: Pan troglodytes similar to Histone H... 62 2e-06
408ref|XM_527272.1| PREDICTED: Pan troglodytes similar to Histone H... 62 2e-06
409ref|NM_003517.2| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA 62 2e-06
410gb|AY648852.1| Homo sapiens histone H2A/r gene, complete cds 62 2e-06
411gb|BT018361.1| Zea mays clone EL01N0311D03.c mRNA sequence 62 2e-06
412gb|AY389710.1| Hyacinthus orientalis histone H2A mRNA, partial cds 62 2e-06
413gb|BC016677.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone MG... 62 2e-06
414gb|BC067782.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone IM... 62 2e-06
415ref|NM_021064.3| Homo sapiens histone 1, H2ag (HIST1H2AG), mRNA 62 2e-06
416ref|NM_080596.1| Homo sapiens histone 1, H2ah (HIST1H2AH), mRNA 62 2e-06
417ref|XM_391803.1| Gibberella zeae PH-1 H2A_NEUCR Histone H2A (FG1... 62 2e-06
418emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 62 2e-06
419emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o... 62 2e-06
420emb|AJ494852.1|ODI494852 Oikopleura dioica partial H2A.4 gene fo... 62 2e-06
421gb|BC093851.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 62 2e-06
422gb|BC093849.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 62 2e-06
423ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone... 62 2e-06
424gb|AY131988.1| Homo sapiens histone H2A (HIST1H2AH) gene, comple... 62 2e-06
425gb|AY131987.1| Homo sapiens histone H2A (HIST1H2AG) gene, comple... 62 2e-06
426ref|XM_318363.2| Anopheles gambiae str. PEST ENSANGP00000015971 ... 62 2e-06
427gb|L19778.1|HUMH2A1B Homo sapiens histone H2A.1b mRNA, complete cds 62 2e-06
428ref|NG_000827.2| Homo sapiens genomic histone family microcluste... 62 2e-06
429gb|AY131973.1| Homo sapiens histone H2A (HIST2H2AC) gene, comple... 62 2e-06
430ref|NM_118857.2| Arabidopsis thaliana DNA binding AT4G27230 mRNA... 60 8e-06
431ref|XM_871500.1| PREDICTED: Bos taurus similar to Histone H2A.o ... 60 8e-06
432ref|XM_614586.2| PREDICTED: Bos taurus similar to Histone H2A.o ... 60 8e-06
433ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa... 60 8e-06
434ref|XM_591391.2| PREDICTED: Bos taurus similar to Histone H2A.o ... 60 8e-06
435ref|XM_602557.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 60 8e-06
436gb|BC098891.1| Danio rerio zgc:114037, mRNA (cDNA clone MGC:1140... 60 8e-06
437ref|XM_569065.1| Cryptococcus neoformans var. neoformans JEC21 h... 60 8e-06
438emb|CR722682.2|CNS0GKKG Tetraodon nigroviridis full-length cDNA 60 8e-06
439emb|CR681249.2|CNS0FOLP Tetraodon nigroviridis full-length cDNA 60 8e-06
440emb|CR673736.2|CNS0FITQ Tetraodon nigroviridis full-length cDNA 60 8e-06
441emb|CR659269.2|CNS0F7NV Tetraodon nigroviridis full-length cDNA 60 8e-06
442ref|NM_001031826.1| Danio rerio zgc:114037 (zgc:114037), mRNA 60 8e-06
443emb|BX019514.1|CNS08N7Y Single read from an extremity of a full-... 60 8e-06
444ref|XM_683419.1| PREDICTED: Danio rerio similar to replication-d... 60 8e-06
445gb|BT006076.1| Arabidopsis thaliana clone U20287 putative histon... 60 8e-06
446gb|BT005779.1| Arabidopsis thaliana clone RAFL14-92-E07 (R20287)... 60 8e-06
447gb|AY088714.1| Arabidopsis thaliana clone 927 mRNA, complete seq... 60 8e-06
448gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, comp... 60 8e-06
449ref|XM_318365.1| Anopheles gambiae str. PEST ENSANGP00000015967 ... 60 8e-06
450ref|XM_307083.1| Anopheles gambiae str. PEST ENSANGP00000012043 ... 60 8e-06
451emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 60 8e-06
452gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG... 58 3e-05
453gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG... 58 3e-05
454ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA 58 3e-05
455emb|Z83245.4|CEZK131 Caenorhabditis elegans Cosmid ZK131, comple... 58 3e-05
456emb|Z81495.1|CEF08G2 Caenorhabditis elegans Cosmid F08G2, comple... 58 3e-05
457emb|X15633.1|CEHIS12 C. elegans core histone genes H2A(his12) an... 58 3e-05
458emb|AL606464.11| Mouse DNA sequence from clone RP23-462P2 on chr... 58 3e-05
459dbj|AB226296.1| Aspergillus oryzae cDNA, contig sequence: AoEST3158 58 3e-05
460dbj|AB223400.1| Aspergillus oryzae cDNA, contig sequence: AoEST0232 58 3e-05
461dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 58 3e-05
462ref|XM_683706.1| PREDICTED: Danio rerio similar to histone H2A (... 58 3e-05
463ref|NM_064497.1| Caenorhabditis elegans HIStone family member (h... 58 3e-05
464ref|NM_064490.1| Caenorhabditis elegans HIStone family member (h... 58 3e-05
465ref|NM_064486.2| Caenorhabditis elegans HIStone family member (h... 58 3e-05
466gb|AC084589.1|CBRG41K24 Caenorhabditis briggsae cosmid G41K24, c... 58 3e-05
467emb|BX936232.1| Gallus gallus finished cDNA, clone ChEST960i13 58 3e-05
468emb|BX935272.1| Gallus gallus finished cDNA, clone ChEST959a10 58 3e-05
469emb|BX933654.1| Gallus gallus finished cDNA, clone ChEST946f5 58 3e-05
470gb|AY158921.1| Mus musculus histone protein Hist1h2aa gene, comp... 58 3e-05
471dbj|AK214754.1| Mus musculus cDNA, clone:Y2G0132O07, strand:minu... 58 3e-05
472ref|NM_196515.1| Oryza sativa (japonica cultivar-group) putative... 56 1e-04
473ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261... 56 1e-04
474ref|NM_006632.1| Homo sapiens solute carrier family 17 (sodium p... 56 1e-04
475ref|XM_870822.1| PREDICTED: Bos taurus similar to H2A histone fa... 56 1e-04
476gb|AY573602.1| Toxoplasma gondii histone H2A.1 gene, complete cds 56 1e-04
477emb|CR705345.2|CNS0G771 Tetraodon nigroviridis full-length cDNA 56 1e-04
478emb|AL138726.12| Human DNA sequence from clone RP1-139G21 on chr... 56 1e-04
479gb|BC103043.1| Bos taurus cDNA clone MGC:128401 IMAGE:7983967, c... 56 1e-04
480ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (R... 56 1e-04
481gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica culti... 56 1e-04
482gb|AF098457.1|AF098457 Homo sapiens H2A/t pseudogene, complete s... 56 1e-04
483gb|U90545.1|HSU90545 Human sodium phosphate transporter (NPT4) m... 56 1e-04
484ref|NG_002685.1| Homo sapiens histone 1, H2a, pseudogene 2 (HIST... 56 1e-04
485emb|AL116588.1|CNS01DAS Botrytis cinerea strain T4 cDNA library 56 1e-04
486dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
487gb|BC092032.1| Xenopus laevis hypothetical protein MGC83508, mRN... 56 1e-04
488gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb00... 56 1e-04
489dbj|AK121515.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
490gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 56 1e-04
491gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complet... 56 1e-04
492gb|J00980.1|XELHIS2AL xenopus laevis h2a histone gene & flanks 56 1e-04
493ref|NM_122649.2| Arabidopsis thaliana DNA binding AT5G27670 mRNA... 54 5e-04
494ref|XM_527281.1| PREDICTED: Pan troglodytes similar to H2A histo... 54 5e-04
495ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H... 54 5e-04
496ref|NM_001030332.2| Xenopus tropicalis hypothetical protein LOC5... 54 5e-04
497gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462 54 5e-04
498ref|XM_603142.2| PREDICTED: Bos taurus similar to histone 1, H2a... 54 5e-04
499ref|XM_583411.2| PREDICTED: Bos taurus similar to Histone H2A.l ... 54 5e-04
500ref|XM_869647.1| PREDICTED: Bos taurus similar to Histone H2A.l ... 54 5e-04

>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3
          Length = 1153

 Score =  666 bits (336), Expect = 0.0
 Identities = 411/436 (94%)
 Strand = Plus / Minus

                                                                       
Query: 136 cggctactccttggtggcgggggccttcttcttgggggacttggtggcggccttcttctt 195
           |||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||
Sbjct: 533 cggctactccttggtggctgcggtcttcttcttgggggacttggtggcggccttcttctt 474

                                                                       
Query: 196 gggcgacttggtggcctccttctcggccgcggcggcggacttcttggggagcagaacgga 255
           |||||||||||||| |||||||||||| ||| |||||| ||||||||||||||| |||||
Sbjct: 473 gggcgacttggtggactccttctcggcggcgccggcggccttcttggggagcagcacgga 414

                                                                       
Query: 256 gttgatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgag 315
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 413 gttgatgttggggatgacgccgccgtgggcgatggtgacgccggcgagcagcctgcccag 354

                                                                       
Query: 316 ctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgtt 375
           ||||||||||||||||||||| || ||||||||||||||||||||||| |||||||||||
Sbjct: 353 ctcctggtcgttgcggacggccagcagcaggtggcgcgggatgatgcgcgtcttcttgtt 294

                                                                       
Query: 376 atccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggc 435
            |||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||
Sbjct: 293 gtccttggccgcgttgccggcgagctccaggacctcggcggcgaggtactcgaggacggc 234

                                                                       
Query: 436 ggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggta 495
           |||||||||||| ||||||||||||||||||  ||| |||||||||||||||||||||||
Sbjct: 233 ggcgaggtagacgggggcgccggagccgacggcctgcgcgtagcggcccttcttgaggta 174

                                                                       
Query: 496 gcgcccgatgcggccgacggggaactggagaccggccttcacggaccgggtcaccgcctt 555
           |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 173 gcgcccgatgcggccgacggggaactggagcccggccttcacggagcgggtcaccgcctt 114

                           
Query: 556 cttcctgtcgccgccc 571
           |||||| |||||||||
Sbjct: 113 cttcctctcgccgccc 98



to top

>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9
          Length = 704

 Score =  658 bits (332), Expect = 0.0
 Identities = 400/422 (94%), Gaps = 3/422 (0%)
 Strand = Plus / Minus

                                                                       
Query: 150 tggcgggggccttcttcttgggggacttggtggcggccttcttcttgggcgacttggtgg 209
           |||||| | |||||||||||||||||||||||| || ||||||||||||||||||||   
Sbjct: 495 tggcggcgaccttcttcttgggggacttggtggaggtcttcttcttgggcgacttgg--- 439

                                                                       
Query: 210 cctccttctcggccgcggcggcggacttcttggggagcagaacggagttgatgttgggga 269
           ||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 438 cctccttctcggcggcggcgggggacttcttggggagcagcacggagttgatgttgggga 379

                                                                       
Query: 270 tcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgc 329
           ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 378 tcacgccaccgtgggcgatggtgacgccagcgagcagcctgccgagctcctggtcgttgc 319

                                                                       
Query: 330 ggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgt 389
           |||| ||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||
Sbjct: 318 ggacagcgagcagcaggtggcgcgggatgatgcgggtcttcttgttgtccttggccgcgt 259

                                                                       
Query: 390 tgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggcgaggtagacag 449
           ||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||| |
Sbjct: 258 tgccggcaagctccagcacctcggcggcgaggtactcgaggacggcggcgaggtagacgg 199

                                                                       
Query: 450 gggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggc 509
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 198 gggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggc 139

                                                                       
Query: 510 cgacggggaactggagaccggccttcacggaccgggtcaccgccttcttcctgtcgccgc 569
           |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 138 cgacggggaactggagcccggccttcacggagcgggtcaccgccttcttcctgtcgccgc 79

             
Query: 570 cc 571
           ||
Sbjct: 78  cc 77



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 175 cttggtggcggccttcttcttgggcgacttggtgg 209
           ||||| |||| ||||||||||||| ||||||||||
Sbjct: 497 cttggcggcgaccttcttcttgggggacttggtgg 463



to top

>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2
          Length = 717

 Score =  609 bits (307), Expect = e-171
 Identities = 404/436 (92%), Gaps = 9/436 (2%)
 Strand = Plus / Minus

                                                                       
Query: 136 cggctactccttggtggcgggggccttcttcttgggggacttggtggcggccttcttctt 195
           |||||||||||||||||| | || |||||||||||||||||||| |||||||||||    
Sbjct: 526 cggctactccttggtggctgcggtcttcttcttgggggacttggcggcggccttct---- 471

                                                                       
Query: 196 gggcgacttggtggcctccttctcggccgcggcggcggacttcttggggagcagaacgga 255
             |||||||||   ||||||||||||| || |||| |||||||||||||||||| |||||
Sbjct: 470 --gcgacttgg---cctccttctcggcggctgcgggggacttcttggggagcagcacgga 416

                                                                       
Query: 256 gttgatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgag 315
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 415 gttgatgttggggatgacgccgccgtgggcgatggtgacgccggcgagcagcctgccgag 356

                                                                       
Query: 316 ctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgtt 375
           ||||||||||||||||||||| || ||||||||||||||||||||||| |||||||||||
Sbjct: 355 ctcctggtcgttgcggacggccagcagcaggtggcgcgggatgatgcgcgtcttcttgtt 296

                                                                       
Query: 376 atccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggc 435
            |||||||| ||||||||||| ||||| || ||||| |||||||||||||||||||||||
Sbjct: 295 gtccttggccgcgttgccggcaagctccaggacctcggcggcgaggtactcgaggacggc 236

                                                                       
Query: 436 ggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggta 495
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 235 ggcgaggtagacgggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggta 176

                                                                       
Query: 496 gcgcccgatgcggccgacggggaactggagaccggccttcacggaccgggtcaccgcctt 555
           ||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||||
Sbjct: 175 gcgcccgatgcggccgacggggaactgcagcccggccttgacggagcgggtcaccgcctt 116

                           
Query: 556 cttcctgtcgccgccc 571
           ||||||||||||||||
Sbjct: 115 cttcctgtcgccgccc 100



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 46  cactacggactaccaggcattacatacag 74
           |||||| ||||||||||||||||||||||
Sbjct: 640 cactacagactaccaggcattacatacag 612



to top

>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence
          Length = 719

 Score =  365 bits (184), Expect = 1e-97
 Identities = 295/332 (88%)
 Strand = Plus / Minus

                                                                       
Query: 230 gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 289
           |||| ||||||||| || || || | ||||||||||||||  ||||||||||||||||||
Sbjct: 497 gcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatg 438

                                                                       
Query: 290 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 349
           ||||||||||  |||||| |||||||||||| ||||||||||| ||| || |||| ||||
Sbjct: 437 gtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtgg 378

                                                                       
Query: 350 cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 409
           |||||||||||||||||||||||||| |||||||| ||||||||||| ||||| ||||||
Sbjct: 377 cgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagcacc 318

                                                                       
Query: 410 tctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgc 469
           || ||||| |||||||||||||||||||| |||||||| |||||||| | ||||||||||
Sbjct: 317 tcggcggccaggtactcgaggacggcggccaggtagacgggggcgcccgtgccgacgcgc 258

                                                                       
Query: 470 tgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccg 529
           || ||||| ||||||||||| ||||| |||||||||||||||||||| ||||| || |||
Sbjct: 257 tgcgcgtaccggcccttcttcaggtaccgcccgatgcggccgacgggaaactgcagcccg 198

                                           
Query: 530 gccttcacggaccgggtcaccgccttcttcct 561
           ||||| |||||||  ||||||| |||||||||
Sbjct: 197 gccttgacggacctcgtcaccgacttcttcct 166



to top

>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence
          Length = 674

 Score =  365 bits (184), Expect = 1e-97
 Identities = 293/328 (89%), Gaps = 1/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| || | |||||||||||| | ||||||||||||||||||||| ||
Sbjct: 450 cttcttgggcagcaggaccgggttgatgttgggcaacacgccgccgtgggcgatggtcac 391

                                                                       
Query: 295 gccggcgagcagcctgcc-gagctcctggtcgttgcggacggcgagaagcaggtggcgcg 353
           |||||  |||||||| || |||||||| |||||||||||  || || |||| ||||||||
Sbjct: 390 gccggtcagcagccttcccgagctcctcgtcgttgcggatcgccagcagcacgtggcgcg 331

                                                                       
Query: 354 ggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctg 413
           ||| |||||| ||||||||||| |||||||| ||||||||||||||||| || ||||| |
Sbjct: 330 ggacgatgcgcgtcttcttgttgtccttggcagcgttgccggcgagctccaggacctcag 271

                                                                       
Query: 414 cggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctggg 473
           ||||||||||||| |||||||| ||||||||||| ||||| |||  |||||||||||| |
Sbjct: 270 cggcgaggtactccaggacggccgcgaggtagacgggggcaccgctgccgacgcgctgcg 211

                                                                       
Query: 474 cgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcct 533
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 210 cgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagcccggcct 151

                                       
Query: 534 tcacggaccgggtcaccgccttcttcct 561
           |||||||||  ||||||| |||||||||
Sbjct: 150 tcacggacctcgtcaccgacttcttcct 123



to top

>gb|AY103710.1| Zea mays PCO123562 mRNA sequence
          Length = 770

 Score =  365 bits (184), Expect = 1e-97
 Identities = 295/332 (88%)
 Strand = Plus / Minus

                                                                       
Query: 230 gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 289
           |||| ||||||||| || || || | ||||||||||||||  ||||||||||||||||||
Sbjct: 497 gcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcgatg 438

                                                                       
Query: 290 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 349
           ||||||||||  |||||| |||||||||||| ||||||||||| ||| || |||| ||||
Sbjct: 437 gtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacgtgg 378

                                                                       
Query: 350 cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 409
           |||||||||||||||||||||||||| |||||||| ||||||||||| ||||| ||||||
Sbjct: 377 cgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagcacc 318

                                                                       
Query: 410 tctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgc 469
           || ||||| |||||||||||||||||||| |||||||| |||||||| | ||||||||||
Sbjct: 317 tcggcggccaggtactcgaggacggcggccaggtagacgggggcgcccgtgccgacgcgc 258

                                                                       
Query: 470 tgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccg 529
           || ||||| ||||||||||| ||||| |||||||||||||||||||| ||||| || |||
Sbjct: 257 tgcgcgtaccggcccttcttcaggtaccgcccgatgcggccgacgggaaactgcagcccg 198

                                           
Query: 530 gccttcacggaccgggtcaccgccttcttcct 561
           ||||| |||||||  ||||||| |||||||||
Sbjct: 197 gccttgacggacctcgtcaccgacttcttcct 166



to top

>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274)
          Length = 2546

 Score =  353 bits (178), Expect = 4e-94
 Identities = 234/252 (92%), Gaps = 3/252 (1%)
 Strand = Plus / Minus

                                                                        
Query: 159  ccttcttcttgggggacttggtggcggccttcttcttgggcgacttggtggcctccttct 218
            |||||||||||||||||||||||| || ||||||||||||||||||||   |||||||||
Sbjct: 2308 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttgg---cctccttct 2252

                                                                        
Query: 219  cggccgcggcggcggacttcttggggagcagaacggagttgatgttggggatcacgccgc 278
            |||| ||||||| |||||||||||| ||||| |||||||||||  ||||||| |||||||
Sbjct: 2251 cggcggcggcgggggacttcttgggcagcagcacggagttgattgtggggatgacgccgc 2192

                                                                        
Query: 279  cgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcga 338
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 2191 cgtgggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcggacggcga 2132

                                                                        
Query: 339  gaagcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcga 398
            | ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
Sbjct: 2131 gcagcaggtggcgcgggatgatgcgggtcttcttgttgtccttggctgcgttgccggcaa 2072

                        
Query: 399  gctcaagcacct 410
            |||| |||||||
Sbjct: 2071 gctccagcacct 2060



 Score =  287 bits (145), Expect = 2e-74
 Identities = 160/165 (96%)
 Strand = Plus / Minus

                                                                        
Query: 407  acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
            ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
Sbjct: 1968 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatg 1909

                                                                        
Query: 467  cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1908 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 1849

                                                         
Query: 527  ccggccttcacggaccgggtcaccgccttcttcctgtcgccgccc 571
            |||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1848 ccggccttcacggacctggtcaccgccttcttcctgtcgccgccc 1804



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 87   gtccatgagaaatggatctaagcaacaatggc 118
            ||||| ||||||||||||||||||||||||||
Sbjct: 2373 gtccacgagaaatggatctaagcaacaatggc 2342



to top

>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds
          Length = 2546

 Score =  353 bits (178), Expect = 4e-94
 Identities = 234/252 (92%), Gaps = 3/252 (1%)
 Strand = Plus / Minus

                                                                        
Query: 159  ccttcttcttgggggacttggtggcggccttcttcttgggcgacttggtggcctccttct 218
            |||||||||||||||||||||||| || ||||||||||||||||||||   |||||||||
Sbjct: 2308 ccttcttcttgggggacttggtggaggtcttcttcttgggcgacttgg---cctccttct 2252

                                                                        
Query: 219  cggccgcggcggcggacttcttggggagcagaacggagttgatgttggggatcacgccgc 278
            |||| ||||||| |||||||||||| ||||| |||||||||||  ||||||| |||||||
Sbjct: 2251 cggcggcggcgggggacttcttgggcagcagcacggagttgattgtggggatgacgccgc 2192

                                                                        
Query: 279  cgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcga 338
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 2191 cgtgggcgatggtgacgccggcaagcagcctgccgagctcctggtcgttgcggacggcga 2132

                                                                        
Query: 339  gaagcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcga 398
            | ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
Sbjct: 2131 gcagcaggtggcgcgggatgatgcgggtcttcttgttgtccttggctgcgttgccggcaa 2072

                        
Query: 399  gctcaagcacct 410
            |||| |||||||
Sbjct: 2071 gctccagcacct 2060



 Score =  287 bits (145), Expect = 2e-74
 Identities = 160/165 (96%)
 Strand = Plus / Minus

                                                                        
Query: 407  acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
            ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
Sbjct: 1968 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatg 1909

                                                                        
Query: 467  cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1908 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagc 1849

                                                         
Query: 527  ccggccttcacggaccgggtcaccgccttcttcctgtcgccgccc 571
            |||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1848 ccggccttcacggacctggtcaccgccttcttcctgtcgccgccc 1804



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 87   gtccatgagaaatggatctaagcaacaatggc 118
            ||||| ||||||||||||||||||||||||||
Sbjct: 2373 gtccacgagaaatggatctaagcaacaatggc 2342



to top

>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full
           insert sequence
          Length = 797

 Score =  353 bits (178), Expect = 4e-94
 Identities = 292/330 (88%)
 Strand = Plus / Minus

                                                                       
Query: 230 gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 289
           |||| |||||| |||||||| || | ||||||||| || | |||||||||||| ||||||
Sbjct: 472 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 413

                                                                       
Query: 290 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 349
           ||||| |||||||||||| | |||||||||| |||||||||||  || || |||| ||| 
Sbjct: 412 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 353

                                                                       
Query: 350 cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 409
           | ||||||||| ||| |||||||||| |||   || ||||| ||||||||||| ||||||
Sbjct: 352 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 293

                                                                       
Query: 410 tctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgc 469
           |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||
Sbjct: 292 tctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgc 233

                                                                       
Query: 470 tgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccg 529
           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 232 tgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcccg 173

                                         
Query: 530 gccttcacggaccgggtcaccgccttcttc 559
           ||||| ||||| || | ||||| |||||||
Sbjct: 172 gccttgacggagcgcgacaccggcttcttc 143



to top

>ref|NM_193707.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 480

 Score =  339 bits (171), Expect = 6e-90
 Identities = 288/327 (88%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 399 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 340

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 339 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 280

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||| ||
Sbjct: 279 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggc 220

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           ||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||| ||
Sbjct: 219 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgcgc 160

                                                                       
Query: 475 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
           |||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 159 gtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 100

                                      
Query: 535 cacggaccgggtcaccgccttcttcct 561
            ||||| || | |||||||||||||||
Sbjct: 99  gacggagcgcgacaccgccttcttcct 73



to top

>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full
           insert sequence
          Length = 754

 Score =  339 bits (171), Expect = 6e-90
 Identities = 288/327 (88%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 489 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 430

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 429 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 370

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||| ||
Sbjct: 369 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacctcggc 310

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            |||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||
Sbjct: 309 agcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctgggc 250

                                                                       
Query: 475 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
           |||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 249 gtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 190

                                      
Query: 535 cacggaccgggtcaccgccttcttcct 561
            ||||| || | |||||||||||||||
Sbjct: 189 gacggagcgcgacaccgccttcttcct 163



to top

>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence
          Length = 538

 Score =  337 bits (170), Expect = 2e-89
 Identities = 274/307 (89%), Gaps = 4/307 (1%)
 Strand = Plus / Plus

                                                                       
Query: 8   caggtacaatgtcnccattgctagacgaatcgaacaggcactacggactaccaggcatta 67
           ||||||||||||| || ||||| ||||||||  || |||||||| ||||| |||||| ||
Sbjct: 41  caggtacaatgtcacccttgctcgacgaatctgacgggcactacagactagcaggcacta 100

                                                                       
Query: 68  catacaggatatcatcttagtccatgagaaatggatctaagcaacaatggcggggctatg 127
           ||||||||||  |||||||||||||||||||||||||||||||||||||||  |||||||
Sbjct: 101 catacaggatcccatcttagtccatgagaaatggatctaagcaacaatggctaggctatg 160

                                                                       
Query: 128 ggtgcaggcggctactccttggtggcgggggccttcttcttgggggacttggtggcggcc 187
           ||  | | |||||||||||| |||||||  | |||||||||||||||||||| ||| | |
Sbjct: 161 gggac-gacggctactccttcgtggcggccgtcttcttcttgggggacttggcggccgtc 219

                                                                       
Query: 188 ttcttcttgggcgacttggtggcctccttctcggccgcggcggcggacttcttggggagc 247
           |||||||||||||||||||   ||||||||||||| ||||| | ||||||||||||||||
Sbjct: 220 ttcttcttgggcgacttgg---cctccttctcggcggcggcaggggacttcttggggagc 276

                                                                       
Query: 248 agaacggagttgatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagc 307
           || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 277 agcacggagttgatgttggggatcacaccgccgtgggcgatggtgacgccggcgagcagc 336

                  
Query: 308 ctgccga 314
            ||||||
Sbjct: 337 ttgccga 343



to top

>gb|AY103585.1| Zea mays PCO123564 mRNA sequence
          Length = 1953

 Score =  325 bits (164), Expect = 9e-86
 Identities = 287/328 (87%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| || || ||||||| |||||||||||  ||||||||||| |||||||||||
Sbjct: 610 cttcttgggcaggagcacggagtggatgttggggaggacgccgccgtgcgcgatggtgac 551

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||||| |||||| | |||||||||| |||||||||||  || || |||| |||||||||
Sbjct: 550 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 491

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| || || || ||||| || || | ||| || ||||| ||
Sbjct: 490 gatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaactccagaacctcggc 431

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           |||||||||||| |||||||||||||||||||| |||||||| | ||| |||||||| ||
Sbjct: 430 ggcgaggtactccaggacggcggcgaggtagacgggggcgccagtgcccacgcgctgcgc 371

                                                                       
Query: 475 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
           ||| |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||
Sbjct: 370 gtaccggcccttcttgaggtagcgcccgatccggccgacggggaactgcagcccggcctt 311

                                       
Query: 535 cacggaccgggtcaccgccttcttcctg 562
            |||||||| ||||||| ||||||||||
Sbjct: 310 gacggaccgcgtcaccgacttcttcctg 283



to top

>ref|XM_475374.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 492

 Score =  311 bits (157), Expect = 1e-81
 Identities = 283/325 (87%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 393 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 334

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 333 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 274

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| ||| |||||||||| |||   || ||||| || || ||||| |||||||| ||
Sbjct: 273 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 214

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           ||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||| 
Sbjct: 213 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 154

                                                                       
Query: 475 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
           ||||||||| | |||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 153 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 94

                                    
Query: 535 cacggaccgggtcaccgccttcttc 559
            ||||| |||| ||||| |||||||
Sbjct: 93  gacggagcgggacaccggcttcttc 69



to top

>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full
           insert sequence
          Length = 1097

 Score =  311 bits (157), Expect = 1e-81
 Identities = 283/325 (87%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 464 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 405

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 404 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 345

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| ||| |||||||||| |||   || ||||| || || ||||| |||||||| ||
Sbjct: 344 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 285

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           ||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||| 
Sbjct: 284 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 225

                                                                       
Query: 475 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
           ||||||||| | |||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 224 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 165

                                    
Query: 535 cacggaccgggtcaccgccttcttc 559
            ||||| |||| ||||| |||||||
Sbjct: 164 gacggagcgggacaccggcttcttc 140



to top

>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence
          Length = 699

 Score =  309 bits (156), Expect = 5e-81
 Identities = 285/328 (86%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| || || ||||||| |||||||||||  ||||| ||||| |||||||||||
Sbjct: 461 cttcttgggcaggagcacggagtggatgttggggaggacgccaccgtgcgcgatggtgac 402

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||||| |||||| | |||||||||| |||||||||||  || || |||| |||||||||
Sbjct: 401 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccaggagcacgtggcgcgg 342

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| || || || ||||| || || | ||| || ||||| ||
Sbjct: 341 gatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaactccagaacctcggc 282

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           |||||||||||| || ||||||||||||||||| |||||||| | ||| |||||||| ||
Sbjct: 281 ggcgaggtactccagaacggcggcgaggtagacgggggcgccagtgcccacgcgctgcgc 222

                                                                       
Query: 475 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
           ||| |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||
Sbjct: 221 gtaccggcccttcttgaggtagcgcccgatccggccgacggggaactgcagcccggcctt 162

                                       
Query: 535 cacggaccgggtcaccgccttcttcctg 562
            |||||||| ||||||| ||||||||||
Sbjct: 161 gacggaccgcgtcaccgacttcttcctg 134



to top

>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full
           insert sequence
          Length = 912

 Score =  303 bits (153), Expect = 3e-79
 Identities = 282/325 (86%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 463 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 404

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 403 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 344

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| ||| |||||||||| |||   || ||||| || || ||||| |||||||| ||
Sbjct: 343 gatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagcacctcggc 284

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           ||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||| 
Sbjct: 283 ggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgctggga 224

                                                                       
Query: 475 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
           ||||||||| | |||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 223 gtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagcccggcctt 164

                                    
Query: 535 cacggaccgggtcaccgccttcttc 559
            |||||  ||| ||||| |||||||
Sbjct: 163 gacggagggggacaccggcttcttc 139



to top

>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds
          Length = 714

 Score =  297 bits (150), Expect = 2e-77
 Identities = 282/327 (86%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| |||||||| | |||||| ||||||| ||| |||||||| |||||||| ||
Sbjct: 467 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 408

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | | |||| | || ||||||| |||||| ||||  || ||||||| |||||||||
Sbjct: 407 gccgcccaacagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 348

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
            || ||||| ||||||||||| ||| |||| || || ||||||||||| || ||||| ||
Sbjct: 347 aataatgcgagtcttcttgttgtccctggcagcattaccggcgagctccagaacctcagc 288

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           ||||||||| |||||||| |||||||||||||| |||||||||| ||||||   ||| ||
Sbjct: 287 ggcgaggtattcgaggacagcggcgaggtagacgggggcgccggtgccgacrrnctgcgc 228

                                                                       
Query: 475 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
           ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 227 gtagcggcccttcttcaagtagcgcccgatgcggccgacggggaactggagaccggcctt 168

                                      
Query: 535 cacggaccgggtcaccgccttcttcct 561
           ||||||||  | ||||| |||||||||
Sbjct: 167 cacggacctcgacaccgacttcttcct 141



to top

>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence
          Length = 1051

 Score =  278 bits (140), Expect = 2e-71
 Identities = 279/327 (85%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| |||||||| | |||||| ||||||| ||| |||||||| |||||||| ||
Sbjct: 486 cttcttgggcagcagaacagggttgatattggggagcacaccgccgtgagcgatggtcac 427

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| | || ||||||| |||||| ||||  || ||||||| |||||||||
Sbjct: 426 gccgcccagcagcttcccaagctcctcgtcgttccggatcgccagaagcacgtggcgcgg 367

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
            || ||||| ||||||||||| ||| |||| || || || |||||||| || ||||| ||
Sbjct: 366 aataatgcgagtcttcttgttgtccctggcagcattaccagcgagctccagaacctcagc 307

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           ||||||||| |||||||| ||||||||||||||     |||||| |||||| ||||| ||
Sbjct: 306 ggcgaggtattcgaggacagcggcgaggtagacnnnnncgccggtgccgacacgctgcgc 247

                                                                       
Query: 475 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
           ||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 246 gtagcggcccttcttcaagtagcgcccgatgcggccgacggggaactggagcccggcctt 187

                                      
Query: 535 cacggaccgggtcaccgccttcttcct 561
           ||||||||  | ||||| |||||||||
Sbjct: 186 cacggacctcgacaccgacttcttcct 160



to top

>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence
          Length = 846

 Score =  240 bits (121), Expect = 4e-60
 Identities = 259/305 (84%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 295
           |||||||||||||| || | |||||||||||| |  || |||||||| ||||||||||||
Sbjct: 396 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 337

                                                                       
Query: 296 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 355
           ||||| || ||| | |||||||||| |||||||||||  || || || | ||| ||||||
Sbjct: 336 ccggccagtagcttcccgagctcctcgtcgttgcggatcgccagcagtacgtgccgcggg 277

                                                                       
Query: 356 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 415
           ||||| ||| |||||||||| |||   || ||||| || || | ||| || | ||| |||
Sbjct: 276 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 217

                                                                       
Query: 416 gcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggcg 475
           |||||||||||||||||||| ||||||||||| |||||||||| |||||| ||||||| |
Sbjct: 216 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 157

                                                                       
Query: 476 tagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttc 535
           ||||| |||| |||||||||||| ||||| ||||| |||||||||||||| |||||||||
Sbjct: 156 tagcgaccctgcttgaggtagcggccgatacggcctacggggaactggaggccggccttc 97

                
Query: 536 acgga 540
           |||||
Sbjct: 96  acgga 92



to top

>gb|AY104486.1| Zea mays PCO109435 mRNA sequence
          Length = 992

 Score =  232 bits (117), Expect = 1e-57
 Identities = 258/305 (84%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 295
           |||||||||||||| || | |||||||||||| |  || |||||||| ||||||||||||
Sbjct: 467 ttcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacg 408

                                                                       
Query: 296 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 355
           ||||| || ||| | ||||||||||  ||||||||||  || || || | ||| ||||||
Sbjct: 407 ccggccagtagcttcccgagctcctcatcgttgcggatcgccagcagtacgtgtcgcggg 348

                                                                       
Query: 356 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 415
           ||||| ||| |||||||||| |||   || ||||| || || | ||| || | ||| |||
Sbjct: 347 atgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggagctcggcg 288

                                                                       
Query: 416 gcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggcg 475
           |||||||||||||||||||| ||||||||||| |||||||||| |||||| ||||||| |
Sbjct: 287 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 228

                                                                       
Query: 476 tagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttc 535
           ||||| |||| |||||||||||| ||||| ||||| |||||||||||||| |||||||||
Sbjct: 227 tagcgaccctgcttgaggtagcggccgatacggcctacggggaactggaggccggccttc 168

                
Query: 536 acgga 540
           |||||
Sbjct: 167 acgga 163



to top

>ref|XM_475081.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 522

 Score =  230 bits (116), Expect = 4e-57
 Identities = 143/152 (94%)
 Strand = Plus / Minus

                                                                       
Query: 408 cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 467
           |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||
Sbjct: 217 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgc 158

                                                                       
Query: 468 gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagac 527
           ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 157 gctgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcc 98

                                           
Query: 528 cggccttcacggaccgggtcaccgccttcttc 559
           ||||||| ||||| || | ||||| |||||||
Sbjct: 97  cggccttgacggagcgcgacaccggcttcttc 66



 Score =  127 bits (64), Expect = 4e-26
 Identities = 151/180 (83%)
 Strand = Plus / Minus

                                                                       
Query: 230 gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 289
           |||| |||||| |||||||| || | ||||||||| || | |||||||||||| ||||||
Sbjct: 446 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 387

                                                                       
Query: 290 gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 349
           ||||| |||||||||||| | |||||||||| |||||||||||  || || |||| ||| 
Sbjct: 386 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 327

                                                                       
Query: 350 cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 409
           | ||||||||| ||| |||||||||| |||   || ||||| ||||||||||| ||||||
Sbjct: 326 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 267



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5,
              complete sequence
          Length = 29737217

 Score =  230 bits (116), Expect = 4e-57
 Identities = 143/152 (94%)
 Strand = Plus / Minus

                                                                          
Query: 408    cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 467
              |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||
Sbjct: 707152 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgc 707093

                                                                          
Query: 468    gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagac 527
              ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 707092 gctgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcc 707033

                                              
Query: 528    cggccttcacggaccgggtcaccgccttcttc 559
              ||||||| ||||| || | ||||| |||||||
Sbjct: 707032 cggccttgacggagcgcgacaccggcttcttc 707001



 Score =  192 bits (97), Expect = 9e-46
 Identities = 139/153 (90%)
 Strand = Plus / Plus

                                                                            
Query: 407      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
                ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 22512575 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 22512634

                                                                            
Query: 467      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
                ||||||| ||||||||| | |||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 22512635 cgctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagc 22512694

                                                 
Query: 527      ccggccttcacggaccgggtcaccgccttcttc 559
                |||||||| ||||| |||| ||||| |||||||
Sbjct: 22512695 ccggccttgacggagcgggacaccggcttcttc 22512727



 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                            
Query: 235      cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
                ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 22512327 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 22512386

                                                                            
Query: 295      gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
                |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 22512387 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 22512446

                                     
Query: 355      gatgatgcgggtcttcttgtt 375
                |||||| ||| ||||||||||
Sbjct: 22512447 gatgatccggttcttcttgtt 22512467



 Score =  129 bits (65), Expect = 1e-26
 Identities = 152/181 (83%)
 Strand = Plus / Minus

                                                                          
Query: 230    gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 289
              |||| |||||| |||||||| || | ||||||||| || | |||||||||||| ||||||
Sbjct: 707409 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 707350

                                                                          
Query: 290    gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 349
              ||||| |||||||||||| | |||||||||| |||||||||||  || || |||| ||| 
Sbjct: 707349 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 707290

                                                                          
Query: 350    cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 409
              | ||||||||| ||| |||||||||| |||   || ||||| ||||||||||| ||||||
Sbjct: 707289 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 707230

               
Query: 410    t 410
              |
Sbjct: 707229 t 707229



to top

>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0041A22, complete sequence
          Length = 117919

 Score =  230 bits (116), Expect = 4e-57
 Identities = 143/152 (94%)
 Strand = Plus / Minus

                                                                         
Query: 408   cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 467
             |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||
Sbjct: 52351 cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgc 52292

                                                                         
Query: 468   gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagac 527
             ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 52291 gctgggcgtagcggcccttcttgaggtagcggccgatgcggccgacggggaactggagcc 52232

                                             
Query: 528   cggccttcacggaccgggtcaccgccttcttc 559
             ||||||| ||||| || | ||||| |||||||
Sbjct: 52231 cggccttgacggagcgcgacaccggcttcttc 52200



 Score =  129 bits (65), Expect = 1e-26
 Identities = 152/181 (83%)
 Strand = Plus / Minus

                                                                         
Query: 230   gcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatg 289
             |||| |||||| |||||||| || | ||||||||| || | |||||||||||| ||||||
Sbjct: 52608 gcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgtgcgcgatg 52549

                                                                         
Query: 290   gtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtgg 349
             ||||| |||||||||||| | |||||||||| |||||||||||  || || |||| ||| 
Sbjct: 52548 gtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgc 52489

                                                                         
Query: 350   cgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacc 409
             | ||||||||| ||| |||||||||| |||   || ||||| ||||||||||| ||||||
Sbjct: 52488 ctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagctccagcacc 52429

              
Query: 410   t 410
             |
Sbjct: 52428 t 52428



to top

>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence
          Length = 772

 Score =  224 bits (113), Expect = 2e-55
 Identities = 275/329 (83%)
 Strand = Plus / Minus

                                                                       
Query: 228 cggcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcga 287
           |||||| |||||||||||| || |||| ||| |||||||| | ||| |||||||| ||||
Sbjct: 456 cggcggccttcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcga 397

                                                                       
Query: 288 tggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggt 347
           ||||||| ||  | |||||| |||||||||||| ||||||||||| |||||| || ||||
Sbjct: 396 tggtgaccccacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggt 337

                                                                       
Query: 348 ggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagca 407
           ||||||||||||||||||| |||||||| ||    || |||||||| || ||||| || |
Sbjct: 336 ggcgcgggatgatgcgggttttcttgttgtcgcgcgccgcgttgccagccagctccagga 277

                                                                       
Query: 408 cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 467
           |||| |||||||||||||||||||||||||| ||| | || || ||||| | ||| ||||
Sbjct: 276 cctcagcggcgaggtactcgaggacggcggccaggaacacgggagcgcccgtgcccacgc 217

                                                                       
Query: 468 gctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagac 527
           |||| ||||| || || ||||| ||||| || ||||||||||| ||||||||  |||| |
Sbjct: 216 gctgcgcgtaccgccctttcttcaggtaccgtccgatgcggcccacggggaaaaggagcc 157

                                        
Query: 528 cggccttcacggaccgggtcaccgccttc 556
           ||||||| || ||||| | ||||| ||||
Sbjct: 156 cggccttaactgaccgcgacaccggcttc 128



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  212 bits (107), Expect = 9e-52
 Identities = 143/155 (92%)
 Strand = Plus / Plus

                                                                           
Query: 407     acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
               ||||| || |||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 9471496 acctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 9471555

                                                                           
Query: 467     cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
               |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 9471556 cgctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 9471615

                                                  
Query: 527     ccggccttcacggaccgggtcaccgccttcttcct 561
               |||||||| ||||| || | |||||||||||||||
Sbjct: 9471616 ccggccttgacggagcgcgacaccgccttcttcct 9471650



 Score =  135 bits (68), Expect = 2e-28
 Identities = 113/128 (88%)
 Strand = Plus / Minus

                                                                            
Query: 407      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
                ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 28998067 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 28998008

                                                                            
Query: 467      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
                ||||  |||||   |||   ||||||||||||  ||||||||||||||||||||||||| 
Sbjct: 28998007 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 28997948

                        
Query: 527      ccggcctt 534
                ||||||||
Sbjct: 28997947 ccggcctt 28997940



 Score =  135 bits (68), Expect = 2e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                           
Query: 235     cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
               ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 9471223 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9471282

                                                                           
Query: 295     gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
               |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 9471283 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9471342

                                                                       
Query: 355     gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 410
               |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||
Sbjct: 9471343 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 9471398



 Score =  105 bits (53), Expect = 2e-19
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                           
Query: 485     ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 544
               |||||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| || 
Sbjct: 2464021 ttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacggagcgc 2463962

                                
Query: 545     gtcaccgccttcttcct 561
               |||||||||||||||||
Sbjct: 2463961 gtcaccgccttcttcct 2463945



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 151      ggcgggggccttcttcttgg 170
                ||||||||||||||||||||
Sbjct: 30359281 ggcgggggccttcttcttgg 30359262



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 151      ggcgggggccttcttcttgg 170
                ||||||||||||||||||||
Sbjct: 29416085 ggcgggggccttcttcttgg 29416066



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                           
Query: 386     gcgttgccggcgagctcaagcacctctgcggcgaggtactcgag 429
               ||||||||||| ||||| || ||||| ||||  |||||||||||
Sbjct: 3353557 gcgttgccggccagctccaggacctcggcggttaggtactcgag 3353514



to top

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  212 bits (107), Expect = 9e-52
 Identities = 143/155 (92%)
 Strand = Plus / Plus

                                                                          
Query: 407    acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
              ||||| || |||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 168896 acctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 168955

                                                                          
Query: 467    cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
              |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 168956 cgctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 169015

                                                 
Query: 527    ccggccttcacggaccgggtcaccgccttcttcct 561
              |||||||| ||||| || | |||||||||||||||
Sbjct: 169016 ccggccttgacggagcgcgacaccgccttcttcct 169050



 Score =  135 bits (68), Expect = 2e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                          
Query: 235    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
              ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 168623 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 168682

                                                                          
Query: 295    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 168683 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 168742

                                                                      
Query: 355    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 410
              |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||
Sbjct: 168743 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 168798



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  212 bits (107), Expect = 9e-52
 Identities = 143/155 (92%)
 Strand = Plus / Plus

                                                                           
Query: 407     acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
               ||||| || |||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 9469617 acctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 9469676

                                                                           
Query: 467     cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
               |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 9469677 cgctgggcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 9469736

                                                  
Query: 527     ccggccttcacggaccgggtcaccgccttcttcct 561
               |||||||| ||||| || | |||||||||||||||
Sbjct: 9469737 ccggccttgacggagcgcgacaccgccttcttcct 9469771



 Score =  135 bits (68), Expect = 2e-28
 Identities = 113/128 (88%)
 Strand = Plus / Minus

                                                                            
Query: 407      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
                ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 29089489 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 29089430

                                                                            
Query: 467      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
                ||||  |||||   |||   ||||||||||||  ||||||||||||||||||||||||| 
Sbjct: 29089429 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 29089370

                        
Query: 527      ccggcctt 534
                ||||||||
Sbjct: 29089369 ccggcctt 29089362



 Score =  135 bits (68), Expect = 2e-28
 Identities = 149/176 (84%)
 Strand = Plus / Plus

                                                                           
Query: 235     cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
               ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 9469344 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 9469403

                                                                           
Query: 295     gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
               |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 9469404 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 9469463

                                                                       
Query: 355     gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 410
               |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||
Sbjct: 9469464 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 9469519



 Score =  105 bits (53), Expect = 2e-19
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                           
Query: 485     ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 544
               |||||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| || 
Sbjct: 2464131 ttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacggagcgc 2464072

                                
Query: 545     gtcaccgccttcttcct 561
               |||||||||||||||||
Sbjct: 2464071 gtcaccgccttcttcct 2464055



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 151      ggcgggggccttcttcttgg 170
                ||||||||||||||||||||
Sbjct: 30450703 ggcgggggccttcttcttgg 30450684



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 151      ggcgggggccttcttcttgg 170
                ||||||||||||||||||||
Sbjct: 29507507 ggcgggggccttcttcttgg 29507488



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                           
Query: 386     gcgttgccggcgagctcaagcacctctgcggcgaggtactcgag 429
               ||||||||||| ||||| || ||||| ||||  |||||||||||
Sbjct: 3353668 gcgttgccggccagctccaggacctcggcggttaggtactcgag 3353625



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  212 bits (107), Expect = 9e-52
 Identities = 143/155 (92%)
 Strand = Plus / Minus

                                                                            
Query: 407      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
                ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 17416866 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 17416807

                                                                            
Query: 467      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
                ||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 17416806 cgctgcgcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 17416747

                                                   
Query: 527      ccggccttcacggaccgggtcaccgccttcttcct 561
                |||||||| ||||| || | |||||||||||||||
Sbjct: 17416746 ccggccttgacggagcgcgacaccgccttcttcct 17416712



 Score =  135 bits (68), Expect = 2e-28
 Identities = 149/176 (84%)
 Strand = Plus / Minus

                                                                            
Query: 235      cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
                ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 17417149 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 17417090

                                                                            
Query: 295      gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
                |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 17417089 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 17417030

                                                                        
Query: 355      gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 410
                |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||
Sbjct: 17417029 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 17416974



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 41/47 (87%), Gaps = 3/47 (6%)
 Strand = Plus / Minus

                                                               
Query: 163      cttcttgggggactt---ggtggcggccttcttcttgggcgacttgg 206
                |||||||||||||||   ||||||||  |||||||| ||||||||||
Sbjct: 43063463 cttcttgggggacttggcggtggcggggttcttctttggcgacttgg 43063417



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 283      ggcgatggtgacgccggcgag 303
                |||||||||||||||||||||
Sbjct: 23243788 ggcgatggtgacgccggcgag 23243768



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                    
Query: 256      gttgatgttggggatcacgccgccgtgggcgatggt 291
                |||||||||||| | ||| ||||| |||||||||||
Sbjct: 43063370 gttgatgttgggcagcactccgccatgggcgatggt 43063335



to top

>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0507H06
          Length = 136351

 Score =  212 bits (107), Expect = 9e-52
 Identities = 143/155 (92%)
 Strand = Plus / Minus

                                                                         
Query: 407   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
             ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 70258 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 70199

                                                                         
Query: 467   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
             ||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 70198 cgctgcgcgtagcggcccttcttgaggtagcggccgatacggccgacggggaactggagc 70139

                                                
Query: 527   ccggccttcacggaccgggtcaccgccttcttcct 561
             |||||||| ||||| || | |||||||||||||||
Sbjct: 70138 ccggccttgacggagcgcgacaccgccttcttcct 70104



 Score =  135 bits (68), Expect = 2e-28
 Identities = 149/176 (84%)
 Strand = Plus / Minus

                                                                         
Query: 235   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
             ||||||||| ||||| || | |||||||||||| | |||||| ||||| |||||||| ||
Sbjct: 70541 cttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgtgcgcgatggtcac 70482

                                                                         
Query: 295   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             |||||| |||||| |||||||||||| |||||| | ||  || || |||| |||||||||
Sbjct: 70481 gccggccagcagcttgccgagctcctcgtcgttcctgatcgccagcagcacgtggcgcgg 70422

                                                                     
Query: 355   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 410
             |||||| | | |||||||||| ||| |||| ||||| ||||||||||| |||||||
Sbjct: 70421 gatgatcctgttcttcttgttgtccctggccgcgttcccggcgagctccagcacct 70366



to top

>ref|XM_478632.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 823

 Score =  196 bits (99), Expect = 6e-47
 Identities = 189/219 (86%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| ||||||||||||  |||||||||| ||||| |||||||| ||   | |||
Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||| ||
Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
           | | || ||||| ||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309

                                                  
Query: 439 gaggtagacaggggcgccggagccgacgcgctgggcgta 477
           ||||||||| ||||| |||| ||||||||||| ||||||
Sbjct: 308 gaggtagacgggggccccggcgccgacgcgctcggcgta 270



to top

>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full
           insert sequence
          Length = 823

 Score =  196 bits (99), Expect = 6e-47
 Identities = 189/219 (86%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| ||||||||||||  |||||||||| ||||| |||||||| ||   | |||
Sbjct: 488 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 429

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||| ||
Sbjct: 428 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 369

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
           | | || ||||| ||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 368 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 309

                                                  
Query: 439 gaggtagacaggggcgccggagccgacgcgctgggcgta 477
           ||||||||| ||||| |||| ||||||||||| ||||||
Sbjct: 308 gaggtagacgggggccccggcgccgacgcgctcggcgta 270



to top

>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full
           insert sequence
          Length = 824

 Score =  196 bits (99), Expect = 6e-47
 Identities = 189/219 (86%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| || |||||||||  |||||||||| ||||| |||||||| ||  ||||||
Sbjct: 454 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 395

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||| ||
Sbjct: 394 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 335

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
           | | || ||||| ||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 334 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 275

                                                  
Query: 439 gaggtagacaggggcgccggagccgacgcgctgggcgta 477
           ||||||||| || ||||||| ||||||||||| ||||||
Sbjct: 274 gaggtagacgggagcgccggcgccgacgcgctcggcgta 236



to top

>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full
           insert sequence
          Length = 733

 Score =  196 bits (99), Expect = 6e-47
 Identities = 189/219 (86%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| || |||||||||  |||||||||| ||||| |||||||| ||  ||||||
Sbjct: 453 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 394

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||| ||
Sbjct: 393 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 334

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
           | | || ||||| ||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 333 cctcgccgcgttcccggcgagctccagcacctcggcggcgaggtactcgaggacggcggc 274

                                                  
Query: 439 gaggtagacaggggcgccggagccgacgcgctgggcgta 477
           ||||||||| || ||||||| ||||||||||| ||||||
Sbjct: 273 gaggtagacgggagcgccggcgccgacgcgctcggcgta 235



to top

>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full
           insert sequence
          Length = 1718

 Score =  196 bits (99), Expect = 6e-47
 Identities = 189/219 (86%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| ||||||||||||  |||||||||| ||||| |||||||| ||   | |||
Sbjct: 489 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 430

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||| ||
Sbjct: 429 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 370

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
           | | || ||||| ||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 369 cctcgccgcgttcccggcgagctcgagcacctcagcggcgaggtactcgaggacggcggc 310

                                                  
Query: 439 gaggtagacaggggcgccggagccgacgcgctgggcgta 477
           ||||||||| ||||| |||| ||||||||||| ||||||
Sbjct: 309 gaggtagacgggggccccggcgccgacgcgctcggcgta 271



to top

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
            complete sequence
          Length = 93826

 Score =  192 bits (97), Expect = 9e-46
 Identities = 139/153 (90%)
 Strand = Plus / Plus

                                                                        
Query: 407  acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
            ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 7625 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 7684

                                                                        
Query: 467  cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
            ||||||| ||||||||| | |||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 7685 cgctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagc 7744

                                             
Query: 527  ccggccttcacggaccgggtcaccgccttcttc 559
            |||||||| ||||| |||| ||||| |||||||
Sbjct: 7745 ccggccttgacggagcgggacaccggcttcttc 7777



 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 7377 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 7436

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 7437 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 7496

                                 
Query: 355  gatgatgcgggtcttcttgtt 375
            |||||| ||| ||||||||||
Sbjct: 7497 gatgatccggttcttcttgtt 7517



to top

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
              complete sequence
          Length = 163130

 Score =  192 bits (97), Expect = 9e-46
 Identities = 139/153 (90%)
 Strand = Plus / Plus

                                                                          
Query: 407    acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
              ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
Sbjct: 101982 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatg 102041

                                                                          
Query: 467    cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
              ||||||| ||||||||| | |||||||||||| ||||| |||||||||||||||||||| 
Sbjct: 102042 cgctgggagtagcggccttgcttgaggtagcggccgatacggccgacggggaactggagc 102101

                                               
Query: 527    ccggccttcacggaccgggtcaccgccttcttc 559
              |||||||| ||||| |||| ||||| |||||||
Sbjct: 102102 ccggccttgacggagcgggacaccggcttcttc 102134



 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                          
Query: 235    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
              ||||||||||||||| || | |||||||||||| | ||| |||||||| |||||||||||
Sbjct: 101734 cttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatggtgac 101793

                                                                          
Query: 295    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              |||||| |||||| | |||||||||| |||||||||||  || || |||| ||| |||||
Sbjct: 101794 gccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgccgcgg 101853

                                   
Query: 355    gatgatgcgggtcttcttgtt 375
              |||||| ||| ||||||||||
Sbjct: 101854 gatgatccggttcttcttgtt 101874



to top

>ref|XM_482492.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 405

 Score =  182 bits (92), Expect = 8e-43
 Identities = 230/276 (83%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| || |||||||||| ||||||||||||| || ||||||| |     |||||
Sbjct: 339 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 280

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||| ||||||||  | | ||| | ||| | ||| || ||||||||||| ||
Sbjct: 279 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 220

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
           |   || ||||| |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 219 ccgcgccgcgttcccggcgagctcaagaacctcggcggcgaggtactcgaggacggcggc 160

                                                                       
Query: 439 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcg 498
           ||||||||| |||||||||| ||||||||||| ||||||   |||   ||||||| ||||
Sbjct: 159 gaggtagacgggggcgccggcgccgacgcgctcggcgtacttgccggccttgaggaagcg 100

                                               
Query: 499 cccgatgcggccgacggggaactggagaccggcctt 534
             |||| | |||||||||||||||||| ||||||||
Sbjct: 99  ggcgatcctgccgacggggaactggagcccggcctt 64



to top

>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full
           insert sequence
          Length = 747

 Score =  182 bits (92), Expect = 8e-43
 Identities = 230/276 (83%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| | ||||||||||  ||||||||||||| || ||||||||||||  |||||
Sbjct: 455 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 396

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||| || || ||  | | ||| | ||| | ||| ||| |||||||||| ||
Sbjct: 395 ctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttgttgtc 336

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
           | | || ||||| || || ||||| |||||||| ||||||||||||||||||||||||| 
Sbjct: 335 cctcgccgcgttccccgccagctccagcacctcggcggcgaggtactcgaggacggcgga 276

                                                                       
Query: 439 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcg 498
           ||||||||| |||||||||| ||||||||||| ||||||   |||   ||||||||| | 
Sbjct: 275 gaggtagacgggggcgccggcgccgacgcgctcggcgtacttgccggccttgaggtacct 216

                                               
Query: 499 cccgatgcggccgacggggaactggagaccggcctt 534
             ||||||||||||||||||||||||| ||||||||
Sbjct: 215 ggcgatgcggccgacggggaactggaggccggcctt 180



to top

>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full
           insert sequence
          Length = 724

 Score =  176 bits (89), Expect = 5e-41
 Identities = 230/277 (83%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| | ||||||||||  |||||| ||||||  | | ||||||||||  |||||
Sbjct: 452 gatgttgggcagcacgccgccggcggcgatcgtgacggtgcccagcagcctgctcagctc 393

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||| || || ||  | | ||| ||||| | ||| | | |||||||||| ||
Sbjct: 392 ctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttgttgtc 333

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
           | | || ||||| ||||| ||||| |||||||| ||||||||||||||||||||||||| 
Sbjct: 332 cctcgccgcgttcccggccagctccagcacctcggcggcgaggtactcgaggacggcgga 273

                                                                       
Query: 439 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcg 498
           ||||||||| |||||||||| |||||||||||  |||||   |||   ||||||||||||
Sbjct: 272 gaggtagacgggggcgccggcgccgacgcgctccgcgtacttgccggccttgaggtagcg 213

                                                
Query: 499 cccgatgcggccgacggggaactggagaccggccttc 535
             ||||||||||||||||||||||||| |||||||||
Sbjct: 212 ggcgatgcggccgacggggaactggagcccggccttc 176



to top

>ref|XM_478633.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 830

 Score =  159 bits (80), Expect = 1e-35
 Identities = 134/152 (88%)
 Strand = Plus / Minus

                                                                       
Query: 314 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 373
           ||||||| ||||||||||||||||||  | | |||||| || |  |||||||||||||||
Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380

                                                                       
Query: 374 ttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacg 433
           || ||| | || ||||| |||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacg 320

                                           
Query: 434 gcggcgaggtagacaggggcgccggagccgac 465
           |||||||||||||| |||||||||| ||||||
Sbjct: 319 gcggcgaggtagaccggggcgccggcgccgac 288



to top

>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full
           insert sequence
          Length = 830

 Score =  159 bits (80), Expect = 1e-35
 Identities = 134/152 (88%)
 Strand = Plus / Minus

                                                                       
Query: 314 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 373
           ||||||| ||||||||||||||||||  | | |||||| || |  |||||||||||||||
Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380

                                                                       
Query: 374 ttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacg 433
           || ||| | || ||||| |||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaacctcagcggcgaggtactcgaggacg 320

                                           
Query: 434 gcggcgaggtagacaggggcgccggagccgac 465
           |||||||||||||| |||||||||| ||||||
Sbjct: 319 gcggcgaggtagaccggggcgccggcgccgac 288



to top

>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4
          Length = 725

 Score =  159 bits (80), Expect = 1e-35
 Identities = 245/300 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||||||||||| |  || ||||||||| || || ||||||  |||||| |||||
Sbjct: 445 cttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtgac 386

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | ||||||| | |  |||||||| ||||||||||||||||||  | | |||||||||
Sbjct: 385 catgccgagcaggcgggagagctcctcgtcgttgcggacggcgagctggatgtggcgcgg 326

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
            | |||||||||||||||||| ||| | || ||||| ||||| | ||| || ||||| ||
Sbjct: 325 cacgatgcgggtcttcttgttgtccctcgccgcgttcccggccaactccagaacctcagc 266

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           |||||| ||||| || ||||||||||||||||| |||||||||| |||||| | || |||
Sbjct: 265 ggcgagatactccagcacggcggcgaggtagacgggggcgccggcgccgaccctctcggc 206

                                                                       
Query: 475 gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
           |||   |||   ||||||| | ||| |||| | |||||||||||||||||| ||||||||
Sbjct: 205 gtacttgccggccttgaggaaccgcgcgatcctgccgacggggaactggagcccggcctt 146



to top

>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone
           wcH2A-10
          Length = 691

 Score =  147 bits (74), Expect = 5e-32
 Identities = 185/222 (83%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||||||||||  | | ||||||||| | |||||||||||||||
Sbjct: 369 gagctcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttctt 310

                                                                       
Query: 373 gttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 432
           ||| ||| | || ||||| ||||| | ||| || ||||| |||||||| ||||| || ||
Sbjct: 309 gttgtccctcgccgcgttcccggccaactccagaacctcagcggcgagatactccagcac 250

                                                                       
Query: 433 ggcggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgag 492
           ||||||||||||||| |||||||||| |||||| | || ||||||   |||   ||||||
Sbjct: 249 ggcggcgaggtagacgggggcgccggcgccgaccctctcggcgtacttgccggccttgag 190

                                                     
Query: 493 gtagcgcccgatgcggccgacggggaactggagaccggcctt 534
           | | ||| |||| | |||||||||||||||||| ||||||||
Sbjct: 189 gaaccgcgcgatcctgccgacggggaactggagcccggcctt 148



to top

>gb|AY104826.1| Zea mays PCO099353 mRNA sequence
          Length = 793

 Score =  143 bits (72), Expect = 7e-31
 Identities = 141/164 (85%)
 Strand = Plus / Minus

                                                                       
Query: 314 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 373
           ||||||| ||||||||| ||||||||  | | ||| ||||| | ||||||||||||||||
Sbjct: 383 agctcctcgtcgttgcgcacggcgagctggatgtgacgcggcacgatgcgggtcttcttg 324

                                                                       
Query: 374 ttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacg 433
           |||||| | || ||||| || || ||||| || ||||| |||||||||||||||||||| 
Sbjct: 323 ttatccctcgctgcgttcccagcaagctccaggacctcagcggcgaggtactcgaggaca 264

                                                       
Query: 434 gcggcgaggtagacaggggcgccggagccgacgcgctgggcgta 477
           || |||||||||||||||||||||| ||| ||||||| ||||||
Sbjct: 263 gctgcgaggtagacaggggcgccggcgcccacgcgctcggcgta 220



to top

>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA
          Length = 547

 Score =  137 bits (69), Expect = 4e-29
 Identities = 189/229 (82%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| | ||||||||| ||||||||||| || ||| | |||||| ||   |||||
Sbjct: 365 gatgttgggcagcacgccgccctgggcgatggtcactccgcccagcagcttgttcagctc 306

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||| ||||| ||  ||||||| ||||||||||| | |||||||||||| ||
Sbjct: 305 ctcgtcgttgcgcacggccagctgcaggtgccgcgggatgatcctggtcttcttgttgtc 246

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
              ||||||||| ||||| ||||| || | ||| ||||  |||||||| || ||||| ||
Sbjct: 245 gcgggcggcgttcccggccagctccaggatctcagcggtcaggtactccagcacggccgc 186

                                                            
Query: 439 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttc 487
            |||||||| |||||||||| |||||| ||||||||||||  |||||||
Sbjct: 185 caggtagaccggggcgccggcgccgacacgctgggcgtagttgcccttc 137



to top

>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone
             OSJNBa0031O09, complete sequence
          Length = 161339

 Score =  135 bits (68), Expect = 2e-28
 Identities = 113/128 (88%)
 Strand = Plus / Minus

                                                                         
Query: 407   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
             ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 38208 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 38149

                                                                         
Query: 467   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
             ||||  |||||   |||   ||||||||||||  ||||||||||||||||||||||||| 
Sbjct: 38148 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 38089

                     
Query: 527   ccggcctt 534
             ||||||||
Sbjct: 38088 ccggcctt 38081



to top

>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map
              near C10769, complete sequence
          Length = 194856

 Score =  135 bits (68), Expect = 2e-28
 Identities = 113/128 (88%)
 Strand = Plus / Plus

                                                                          
Query: 407    acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
              ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 141224 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 141283

                                                                          
Query: 467    cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
              ||||  |||||   |||   ||||||||||||  ||||||||||||||||||||||||| 
Sbjct: 141284 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 141343

                      
Query: 527    ccggcctt 534
              ||||||||
Sbjct: 141344 ccggcctt 141351



to top

>gb|AC147426.2| Oryza sativa chromosome 3  B1377B10 genomic sequence, complete sequence
          Length = 184366

 Score =  135 bits (68), Expect = 2e-28
 Identities = 113/128 (88%)
 Strand = Plus / Minus

                                                                          
Query: 407    acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
              ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 181362 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 181303

                                                                          
Query: 467    cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
              ||||  |||||   |||   ||||||||||||  ||||||||||||||||||||||||| 
Sbjct: 181302 cgctccgcgtacttgccggccttgaggtagcgggcgatgcggccgacggggaactggagc 181243

                      
Query: 527    ccggcctt 534
              ||||||||
Sbjct: 181242 ccggcctt 181235



to top

>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete
            cds
          Length = 2120

 Score =  135 bits (68), Expect = 2e-28
 Identities = 200/244 (81%)
 Strand = Plus / Minus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| ||||  | ||||||||| |  ||||| || ||||||||||||||
Sbjct: 1165 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatggtgac 1106

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            |||| | |||||| ||  |||||||| ||||||||| ||||| ||  ||||||| || ||
Sbjct: 1105 gccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacgggg 1046

                                                                        
Query: 355  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
            ||||||||||||||||||||| ||   |||||| |||||||| ||||| || | ||| ||
Sbjct: 1045 gatgatgcgggtcttcttgttgtcgcgggcggcattgccggccagctccaggatctcggc 986

                                                                        
Query: 415  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            || ||| |||||||| || ||||| | |||||| || ||||||| ||| || | ||||||
Sbjct: 985  ggtgagatactcgagcacagcggccaagtagacgggagcgccggcgcccaccctctgggc 926

                
Query: 475  gtag 478
            ||||
Sbjct: 925  gtag 922



to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score =  129 bits (65), Expect = 1e-26
 Identities = 191/233 (81%)
 Strand = Plus / Minus

                                                                        
Query: 302  agcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatg 361
            |||||| |||| ||||||| ||||||||||| ||| ||  | | |||||| || | ||||
Sbjct: 4093 agcagcttgcccagctcctcgtcgttgcggatggccagctggatgtggcggggcacgatg 4034

                                                                        
Query: 362  cgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcggcgagg 421
            ||| |||||||||| ||   ||||||||||||||| ||||| |||||||| ||||  |||
Sbjct: 4033 cggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagcggtcagg 3974

                                                                        
Query: 422  tactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcgg 481
            ||||| || || ||||| ||||| || || |||||||  |||| ||||| ||||||   |
Sbjct: 3973 tactccagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtacttg 3914

                                                                 
Query: 482  cccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
            |||||||| ||||||||| | |||||||| ||||||||||| || ||||||||
Sbjct: 3913 cccttcttcaggtagcgcgcaatgcggccaacggggaactgcaggccggcctt 3861



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  127 bits (64), Expect = 4e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                            
Query: 407      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
                ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 20924703 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 20924762

                                                                            
Query: 467      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
                |||| ||||||   |||   ||||||||| |   ||||||||||||||||||||||||| 
Sbjct: 20924763 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 20924822

                        
Query: 527      ccggcctt 534
                ||||||||
Sbjct: 20924823 ccggcctt 20924830



 Score =  103 bits (52), Expect = 6e-19
 Identities = 127/152 (83%)
 Strand = Plus / Plus

                                                                            
Query: 259      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
                ||||||||| || |||||||||  |||||||||| ||||| |||||||| ||  ||||||
Sbjct: 14468549 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14468608

                                                                            
Query: 319      ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
                || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||| ||
Sbjct: 14468609 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14468668

                                                
Query: 379      cttggcggcgttgccggcgagctcaagcacct 410
                | | || ||||| ||||||||||| |||||||
Sbjct: 14468669 cctcgccgcgttcccggcgagctccagcacct 14468700



 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Plus

                                                                            
Query: 407      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
                ||||| ||||||||||||||||||||||||||||||||||| || ||||||| |||||||
Sbjct: 14468900 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 14468959

                           
Query: 467      cgctgggcgta 477
                |||| ||||||
Sbjct: 14468960 cgctcggcgta 14468970



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                            
Query: 259      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
                ||||||||| | ||||||||||  ||||||||||||| || ||||||||||||  |||||
Sbjct: 20924457 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20924516

                            
Query: 319      ctggtcgttgcg 330
                || |||||||||
Sbjct: 20924517 ctcgtcgttgcg 20924528



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 219      cggccgcggcggcggacttc 238
                ||||||||||||||||||||
Sbjct: 24757542 cggccgcggcggcggacttc 24757561



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  127 bits (64), Expect = 4e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                            
Query: 407      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
                ||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||
Sbjct: 20566250 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 20566191

                                                                            
Query: 467      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
                |||| ||||||   |||   ||||||| ||||  |||| | |||||||||||||||||| 
Sbjct: 20566190 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 20566131

                        
Query: 527      ccggcctt 534
                ||||||||
Sbjct: 20566130 ccggcctt 20566123



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                            
Query: 408      cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 467
                |||||||||| |||||| |||||||||| ||||||||||| |||| ||| | ||||||||
Sbjct: 11503412 cctctgcggcaaggtacccgaggacggcagcgaggtagacgggggtgccagtgccgacgc 11503471

                                               
Query: 468      gctgggcgtagcggcccttcttgaggtagcg 498
                | || ||||  ||||| |||| |||||||||
Sbjct: 11503472 gttgcgcgtgccggccgttctcgaggtagcg 11503502



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 122/152 (80%)
 Strand = Plus / Minus

                                                                            
Query: 259      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
                ||||||||| || |||||||||| ||||||||||||| || ||||||| |     |||||
Sbjct: 20566495 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 20566436

                                                                            
Query: 319      ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
                || ||||||||| ||||||||  | | ||| | ||| | ||| || ||||||||||| ||
Sbjct: 20566435 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 20566376

                                                
Query: 379      cttggcggcgttgccggcgagctcaagcacct 410
                |   || ||||| |||||||||||||| ||||
Sbjct: 20566375 ccgcgccgcgttcccggcgagctcaagaacct 20566344



to top

>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0032E15
          Length = 120419

 Score =  127 bits (64), Expect = 4e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                         
Query: 407   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
             ||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||
Sbjct: 70211 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 70152

                                                                         
Query: 467   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
             |||| ||||||   |||   ||||||| ||||  |||| | |||||||||||||||||| 
Sbjct: 70151 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 70092

                     
Query: 527   ccggcctt 534
             ||||||||
Sbjct: 70091 ccggcctt 70084



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 122/152 (80%)
 Strand = Plus / Minus

                                                                         
Query: 259   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
             ||||||||| || |||||||||| ||||||||||||| || ||||||| |     |||||
Sbjct: 70456 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 70397

                                                                         
Query: 319   ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
             || ||||||||| ||||||||  | | ||| | ||| | ||| || ||||||||||| ||
Sbjct: 70396 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 70337

                                             
Query: 379   cttggcggcgttgccggcgagctcaagcacct 410
             |   || ||||| |||||||||||||| ||||
Sbjct: 70336 ccgcgccgcgttcccggcgagctcaagaacct 70305



to top

>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1663_D06
          Length = 139103

 Score =  127 bits (64), Expect = 4e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                         
Query: 407   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
             ||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||
Sbjct: 40622 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacg 40563

                                                                         
Query: 467   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
             |||| ||||||   |||   ||||||| ||||  |||| | |||||||||||||||||| 
Sbjct: 40562 cgctcggcgtacttgccggccttgaggaagcgggcgatcctgccgacggggaactggagc 40503

                     
Query: 527   ccggcctt 534
             ||||||||
Sbjct: 40502 ccggcctt 40495



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 122/152 (80%)
 Strand = Plus / Minus

                                                                         
Query: 259   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
             ||||||||| || |||||||||| ||||||||||||| || ||||||| |     |||||
Sbjct: 40867 gatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagctc 40808

                                                                         
Query: 319   ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
             || ||||||||| ||||||||  | | ||| | ||| | ||| || ||||||||||| ||
Sbjct: 40807 ctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttgtc 40748

                                             
Query: 379   cttggcggcgttgccggcgagctcaagcacct 410
             |   || ||||| |||||||||||||| ||||
Sbjct: 40747 ccgcgccgcgttcccggcgagctcaagaacct 40716



to top

>gb|AY110108.1| Zea mays CL14299_1 mRNA sequence
          Length = 712

 Score =  127 bits (64), Expect = 4e-26
 Identities = 205/252 (81%)
 Strand = Plus / Plus

                                                                       
Query: 283 ggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaag 342
           ||||||||||||  |  |||||||| ||| ||| |||| ||||||||| ||||||||  |
Sbjct: 320 ggcgatggtgacagctccgagcagcttgctgagttcctcgtcgttgcgcacggcgagctg 379

                                                                       
Query: 343 caggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctc 402
            | ||| ||||| | ||||||| |||||||||| ||    || |||||||| || || ||
Sbjct: 380 gatgtgacgcggcacgatgcggttcttcttgttgtcgcgcgccgcgttgcccgccagttc 439

                                                                       
Query: 403 aagcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagcc 462
            | ||||||||| ||||| |||||||||||||||| ||||||||| || || ||   |||
Sbjct: 440 caacacctctgccgcgagatactcgaggacggcggagaggtagacgggcgcaccaccgcc 499

                                                                       
Query: 463 gacgcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactg 522
           |||||||| ||||||   |||   ||||||||||||| ||||||||||||||||||||||
Sbjct: 500 gacgcgctcggcgtacttgccggccttgaggtagcgcgcgatgcggccgacggggaactg 559

                       
Query: 523 gagaccggcctt 534
            || ||||||||
Sbjct: 560 cagcccggcctt 571



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  127 bits (64), Expect = 4e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                            
Query: 407      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
                ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 20850917 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 20850976

                                                                            
Query: 467      cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
                |||| ||||||   |||   ||||||||| |   ||||||||||||||||||||||||| 
Sbjct: 20850977 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 20851036

                        
Query: 527      ccggcctt 534
                ||||||||
Sbjct: 20851037 ccggcctt 20851044



 Score =  103 bits (52), Expect = 6e-19
 Identities = 127/152 (83%)
 Strand = Plus / Plus

                                                                            
Query: 259      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
                ||||||||| || |||||||||  |||||||||| ||||| |||||||| ||  ||||||
Sbjct: 14422833 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 14422892

                                                                            
Query: 319      ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
                || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||| ||
Sbjct: 14422893 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 14422952

                                                
Query: 379      cttggcggcgttgccggcgagctcaagcacct 410
                | | || ||||| ||||||||||| |||||||
Sbjct: 14422953 cctcgccgcgttcccggcgagctccagcacct 14422984



 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Plus

                                                                            
Query: 407      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
                ||||| ||||||||||||||||||||||||||||||||||| || ||||||| |||||||
Sbjct: 14423184 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 14423243

                           
Query: 467      cgctgggcgta 477
                |||| ||||||
Sbjct: 14423244 cgctcggcgta 14423254



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                            
Query: 259      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
                ||||||||| | ||||||||||  ||||||||||||| || ||||||||||||  |||||
Sbjct: 20850671 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 20850730

                            
Query: 319      ctggtcgttgcg 330
                || |||||||||
Sbjct: 20850731 ctcgtcgttgcg 20850742



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 219      cggccgcggcggcggacttc 238
                ||||||||||||||||||||
Sbjct: 24685748 cggccgcggcggcggacttc 24685767



to top

>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 182172

 Score =  127 bits (64), Expect = 4e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                         
Query: 407   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
             ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 10193 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 10252

                                                                         
Query: 467   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
             |||| ||||||   |||   ||||||||| |   ||||||||||||||||||||||||| 
Sbjct: 10253 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 10312

                     
Query: 527   ccggcctt 534
             ||||||||
Sbjct: 10313 ccggcctt 10320



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                         
Query: 259   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
             ||||||||| | ||||||||||  ||||||||||||| || ||||||||||||  |||||
Sbjct: 9947  gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 10006

                         
Query: 319   ctggtcgttgcg 330
             || |||||||||
Sbjct: 10007 ctcgtcgttgcg 10018



to top

>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 107819

 Score =  127 bits (64), Expect = 4e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                         
Query: 407   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
             ||||| ||||||||||||||||||||||||| ||||||||| |||||||||| |||||||
Sbjct: 34292 acctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacg 34233

                                                                         
Query: 467   cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
             |||| ||||||   |||   ||||||||| |   ||||||||||||||||||||||||| 
Sbjct: 34232 cgctcggcgtacttgccggccttgaggtacctggcgatgcggccgacggggaactggagg 34173

                     
Query: 527   ccggcctt 534
             ||||||||
Sbjct: 34172 ccggcctt 34165



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                         
Query: 259   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
             ||||||||| | ||||||||||  ||||||||||||| || ||||||||||||  |||||
Sbjct: 34538 gatgttgggcagcacgccgccggcggcgatggtgacggcgccgagcagcctgctcagctc 34479

                         
Query: 319   ctggtcgttgcg 330
             || |||||||||
Sbjct: 34478 ctcgtcgttgcg 34467



to top

>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV),
            and histone H2B (ch2b-IV) genes, complete cds
          Length = 4502

 Score =  127 bits (64), Expect = 4e-26
 Identities = 241/300 (80%)
 Strand = Plus / Plus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| |||| || ||||||||| | ||| |||||   ||||||||| ||
Sbjct: 3115 cttcttgggcagcagcacggcgtggatgttgggcagcacaccgcccgaggcgatggtcac 3174

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              || | |||||| |||| |||||||  |||||||||| ||| ||  | | |||||| ||
Sbjct: 3175 ctcgcccagcagcttgcccagctcctcatcgttgcggatggccagctggatgtggcgagg 3234

                                                                        
Query: 355  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             |  |||||| |||||||||| ||   ||||||||||||||| ||||| |||||||| ||
Sbjct: 3235 cacaatgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagc 3294

                                                                        
Query: 415  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            ||  |||||||| || |||||||| ||||| || || |||||||  |||| ||||| |||
Sbjct: 3295 ggtcaggtactccagcacggcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3354

                                                                        
Query: 475  gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
            |||   ||||||||| ||||||||| | |||||||| || |||||||| || ||||||||
Sbjct: 3355 gtacttgcccttcttcaggtagcgcgcaatgcggcccacagggaactgcaggccggcctt 3414



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score =  127 bits (64), Expect = 4e-26
 Identities = 241/300 (80%)
 Strand = Plus / Minus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| |||| || ||||||||| | ||| |||||   ||||||||| ||
Sbjct: 3579 cttcttgggcagcagcacggcgtggatgttgggcagcacaccgcccgaggcgatggtcac 3520

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              || | |||||| |||| |||||||  |||||||||| ||| ||  | | |||||| ||
Sbjct: 3519 ctcgcccagcagcttgcccagctcctcatcgttgcggatggccagctggatgtggcgggg 3460

                                                                        
Query: 355  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             | ||||||| |||||||||| ||   ||||||||||||||| ||||| |||||||| ||
Sbjct: 3459 cacgatgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagcacctcagc 3400

                                                                        
Query: 415  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            ||  ||||||||||| || ||||| ||||| || || |||||||  |||| ||||| |||
Sbjct: 3399 ggtcaggtactcgagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3340

                                                                        
Query: 475  gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
            |||   ||||||||| ||||||||  | |||||||| || |||||||| || ||||||||
Sbjct: 3339 gtacttgcccttcttcaggtagcgtgcaatgcggcccacagggaactgcaggccggcctt 3280



to top

>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:11561 IMAGE:3156946), complete cds
          Length = 1414

 Score =  121 bits (61), Expect = 3e-24
 Identities = 202/249 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 228

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 227 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 168

                    
Query: 475 gtagcggcc 483
           |||| ||||
Sbjct: 167 gtagtggcc 159



to top

>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence
          Length = 185902

 Score =  121 bits (61), Expect = 3e-24
 Identities = 202/249 (81%)
 Strand = Plus / Plus

                                                                          
Query: 235    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 149654 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 149713

                                                                          
Query: 295    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 149714 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 149773

                                                                          
Query: 355    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 149774 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 149833

                                                                          
Query: 415    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
               | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 149834 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 149893

                       
Query: 475    gtagcggcc 483
              |||| ||||
Sbjct: 149894 gtagtggcc 149902



to top

>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA
          Length = 1414

 Score =  121 bits (61), Expect = 3e-24
 Identities = 202/249 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 407 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 348

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 347 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 288

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 287 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 228

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 227 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 168

                    
Query: 475 gtagcggcc 483
           |||| ||||
Sbjct: 167 gtagtggcc 159



to top

>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X
          Length = 2166

 Score =  121 bits (61), Expect = 3e-24
 Identities = 202/249 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 986 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 927

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 926 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 867

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 866 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 807

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 806 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 747

                    
Query: 475 gtagcggcc 483
           |||| ||||
Sbjct: 746 gtagtggcc 738



to top

>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone
           MGC:6616 IMAGE:3490058), complete cds
          Length = 1367

 Score =  121 bits (61), Expect = 3e-24
 Identities = 202/249 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 401 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 342

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 341 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 282

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 281 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 222

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 221 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 162

                    
Query: 475 gtagcggcc 483
           |||| ||||
Sbjct: 161 gtagtggcc 153



to top

>gb|AY108339.1| Zea mays PCO070432 mRNA sequence
          Length = 811

 Score =  121 bits (61), Expect = 3e-24
 Identities = 130/153 (84%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||||||||||  | | ||||||||||| |||||||||||||||
Sbjct: 395 gagctcctcgtcgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttctt 336

                                                                       
Query: 373 gttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 432
           ||| |||   || ||||| ||||| ||||| || ||||| || || || |||||||| ||
Sbjct: 335 gttgtcccgagccgcgttcccggcaagctcgagaacctcagcagcaagatactcgagcac 276

                                            
Query: 433 ggcggcgaggtagacaggggcgccggagccgac 465
           ||| ||||||||||| |||||||||| ||||||
Sbjct: 275 ggcagcgaggtagacgggggcgccggcgccgac 243



to top

>gb|AY104828.1| Zea mays PCO072413 mRNA sequence
          Length = 741

 Score =  121 bits (61), Expect = 3e-24
 Identities = 157/189 (83%)
 Strand = Plus / Minus

                                                                       
Query: 346 gtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaag 405
           ||||||||| |  ||||||||||||||||| ||| | |||||||| ||||| || || ||
Sbjct: 309 gtggcgcggcacaatgcgggtcttcttgttgtccctcgcggcgttcccggcaagttcgag 250

                                                                       
Query: 406 cacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgac 465
            ||||| || ||||||||||||||||||||||||||||| || |||||||||| ||||||
Sbjct: 249 aacctcagccgcgaggtactcgaggacggcggcgaggtacacgggggcgccggcgccgac 190

                                                                       
Query: 466 gcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggag 525
           |||||  |||||   ||||  ||||||| | |   | || | ||||||||||||||||||
Sbjct: 189 gcgctccgcgtacttgcccgccttgaggaacctggcaatcctgccgacggggaactggag 130

                    
Query: 526 accggcctt 534
            ||||||||
Sbjct: 129 tccggcctt 121



to top

>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA
          Length = 393

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 125



to top

>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2
           (LOC665433), mRNA
          Length = 465

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 392 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 333

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 213

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 212 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 157



to top

>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1
           (LOC665433), mRNA
          Length = 467

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 394 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 335

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 334 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 275

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 274 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 215

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 214 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 159



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
              novel gene, the genes for three H1, four H2a, five H2b,
              four H3 and four H4 histone family members, the 3' end of a
              variant of the Hfe gene for hemochromatosis protein (Mr2)
              and ten CpG islands, complete sequence
          Length = 184730

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Plus

                                                                          
Query: 235    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 163973 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 164032

                                                                          
Query: 295    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 164033 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 164092

                                                                          
Query: 355    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 164093 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 164152

                                                                      
Query: 415    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
               |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 164153 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 164208



 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                         
Query: 235   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 55436 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 55377

                                                                         
Query: 295   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 55376 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 55317

                                                                         
Query: 355   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 55316 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 55257

                                                                     
Query: 415   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 55256 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 55201



 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                         
Query: 235   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 51355 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 51414

                                                                         
Query: 295   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 51415 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 51474

                                                                         
Query: 355   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 51475 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 51534

                                                                     
Query: 415   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 51535 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 51590



 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                         
Query: 235   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 14872 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 14813

                                                                         
Query: 295   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             || | | | |||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 14812 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 14753

                                                                         
Query: 355   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 14752 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 14693

                                                                     
Query: 415   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 14692 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 14637



to top

>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA
          Length = 2493

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 225

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 224 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 169



to top

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Plus

                                                                         
Query: 235   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 33283 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 33342

                                                                         
Query: 295   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 33343 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 33402

                                                                         
Query: 355   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 33403 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 33462

                                                                     
Query: 415   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
              |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 33463 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 33518



 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                         
Query: 235   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 10993 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 10934

                                                                         
Query: 295   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 10933 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 10874

                                                                         
Query: 355   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 10873 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 10814

                                                                     
Query: 415   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
              |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 10813 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 10758



to top

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Plus

                                                                         
Query: 235   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 59924 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 59983

                                                                         
Query: 295   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 59984 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60043

                                                                         
Query: 355   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 60044 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 60103

                                                                     
Query: 415   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
              |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 60104 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 60159



 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                         
Query: 235   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 52549 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 52608

                                                                         
Query: 295   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 52609 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 52668

                                                                         
Query: 355   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 52669 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 52728

                                                                     
Query: 415   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 52729 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 52784



to top

>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771
           IMAGE:1263745), complete cds
          Length = 527

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 203

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 202 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 147



to top

>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:I0C0045N09 product:histone 1,
           H2ad, full insert sequence
          Length = 446

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 393 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 334

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 333 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 274

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 273 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 214

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 213 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 158



to top

>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920064A15 product:histone 1, H2ad, full
           insert sequence
          Length = 445

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 212

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 211 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 156



to top

>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds
          Length = 444

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 192 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 137



to top

>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA
          Length = 527

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 382 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 323

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 322 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 263

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 262 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 203

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 202 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 147



to top

>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
           library, clone:9030420B16 product:histone 1, H2ac, full
           insert sequence
          Length = 2493

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 345

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 344 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 284 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 225

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 224 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 169



to top

>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds
          Length = 1390

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 680 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 625



to top

>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds
          Length = 1392

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 859 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 800

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 799 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 740

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 739 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 680

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 679 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 624



to top

>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds
          Length = 1390

 Score =  119 bits (60), Expect = 1e-23
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || |||||||| |||||||||| ||| |||||||
Sbjct: 680 cgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgct 625



to top

>gb|AF517874.1| Griffithsia japonica isolate Gj10 histone protein mRNA, partial cds
          Length = 628

 Score =  113 bits (57), Expect = 6e-22
 Identities = 174/213 (81%)
 Strand = Plus / Minus

                                                                       
Query: 322 gtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatcctt 381
           |||||| |||||||||||  | | |||||| |||||||| |||| ||||||||||||   
Sbjct: 347 gtcgttacggacggcgagctggatgtggcgggggatgatacgggacttcttgttatcgcg 288

                                                                       
Query: 382 ggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggcgag 441
           ||||||||||||||||||||| |||||||| || |  | |||||| | ||||||||| | 
Sbjct: 287 ggcggcgttgccggcgagctcgagcacctcggccgtcaagtactccatgacggcggccat 228

                                                                       
Query: 442 gtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttgaggtagcgccc 501
            || ||||||||||||| ||| ||||| | |||||||| ||||||   |||| ||||  |
Sbjct: 227 atacacaggggcgccggcgcccacgcggtcggcgtagccgcccttgcggaggaagcggtc 168

                                            
Query: 502 gatgcggccgacggggaactggagaccggcctt 534
           ||| || ||||| |||||||| || ||||||||
Sbjct: 167 gatacgaccgaccgggaactgcagcccggcctt 135



to top

>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X
          Length = 1359

 Score =  113 bits (57), Expect = 6e-22
 Identities = 201/249 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 411 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 352

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 351 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 292

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 291 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 232

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 231 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctgcgcccacgcgctcggc 172

                    
Query: 475 gtagcggcc 483
           |||| ||||
Sbjct: 171 gtagtggcc 163



to top

>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010005I09 product:H2A histone
           family, member X, full insert sequence
          Length = 564

 Score =  113 bits (57), Expect = 6e-22
 Identities = 202/249 (81%), Gaps = 1/249 (0%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 427 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 368

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 367 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 308

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 307 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 248

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 247 agtgaggtactcgagcaccgctgccaggtacaccggcgcgcctg-gcccacgcgctcggc 189

                    
Query: 475 gtagcggcc 483
           |||| ||||
Sbjct: 188 gtagtggcc 180



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                           
Query: 485     ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 544
               |||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| || 
Sbjct: 7800552 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 7800493

                                
Query: 545     gtcaccgccttcttcct 561
               |||||||||||||||||
Sbjct: 7800492 gtcaccgccttcttcct 7800476



to top

>dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0431E05
          Length = 146091

 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                         
Query: 485   ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 544
             |||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| || 
Sbjct: 14934 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 14875

                              
Query: 545   gtcaccgccttcttcct 561
             |||||||||||||||||
Sbjct: 14874 gtcaccgccttcttcct 14858



to top

>dbj|AP004651.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0091G06
          Length = 161851

 Score =  113 bits (57), Expect = 6e-22
 Identities = 72/77 (93%)
 Strand = Plus / Minus

                                                                          
Query: 485    ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 544
              |||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| || 
Sbjct: 113050 ttcttgaggtagcgcccgatacggccgacggggaactggagcccggccttgacggagcgt 112991

                               
Query: 545    gtcaccgccttcttcct 561
              |||||||||||||||||
Sbjct: 112990 gtcaccgccttcttcct 112974



to top

>gb|AY104637.1| Zea mays PCO070433 mRNA sequence
          Length = 767

 Score =  113 bits (57), Expect = 6e-22
 Identities = 129/153 (84%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||| | ||||||||||||||||||  | | ||||||||| | |||||||||||||||
Sbjct: 395 gagctcttcgtcgttgcggacggcgagctggatgtggcgcggtacgatgcgggtcttctt 336

                                                                       
Query: 373 gttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 432
           ||| ||    || || |||||||| |||||||| ||||| || || || |||||||| ||
Sbjct: 335 gttgtcacgtgccgcattgccggccagctcaagaacctcagcagcaagatactcgagcac 276

                                            
Query: 433 ggcggcgaggtagacaggggcgccggagccgac 465
           ||| |||||||||||||||||||||| ||||||
Sbjct: 275 ggcagcgaggtagacaggggcgccggcgccgac 243



to top

>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700),
           mRNA
          Length = 393

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 360 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 181

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  ||||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 180 agtcaggtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 125



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                         
Query: 235   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 64629 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 64570

                                                                         
Query: 295   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 64569 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 64510

                                                                         
Query: 355   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 64509 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 64450

                                                                     
Query: 415   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 64449 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 64394



 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                         
Query: 235   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
             ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 60548 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 60607

                                                                         
Query: 295   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 60608 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 60667

                                                                         
Query: 355   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 60668 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 60727

                                                                     
Query: 415   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
              |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 60728 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 60783



 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Plus

                                                                          
Query: 235    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 101108 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 101167

                                                                          
Query: 295    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              || | | | |||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 101168 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 101227

                                                                          
Query: 355    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 101228 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 101287

                                                                      
Query: 415    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
               |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 101288 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 101343



to top

>gb|BC068823.1| Xenopus laevis cDNA clone IMAGE:6635737, partial cds
          Length = 763

 Score =  111 bits (56), Expect = 3e-21
 Identities = 173/212 (81%)
 Strand = Plus / Plus

                                                                       
Query: 236 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 295
           |||||||||||||| || || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 290 ttcttggggagcagcacagactggatgttgggcagaaccccgccctgggcgatggtgacc 349

                                                                       
Query: 296 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 355
           ||  |||||||  ||  |||||||| ||||||||| ||||||||  ||||||| |  |||
Sbjct: 350 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 409

                                                                       
Query: 356 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 415
           |||||||| |||||||||||||||  ||| ||||||||||| | ||| || | ||| |||
Sbjct: 410 atgatgcgagtcttcttgttatcccgggcagcgttgccggccaactccaggatctcggcg 469

                                           
Query: 416 gcgaggtactcgaggacggcggcgaggtagac 447
           |  || |||||||| || ||||| ||||||||
Sbjct: 470 gtcagatactcgagcaccgcggccaggtagac 501



to top

>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome
           13
          Length = 1357

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 663

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 662 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 607



to top

>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained
           intron
          Length = 497

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 391 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 332

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 331 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 272

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 271 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 212

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 211 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 156



to top

>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B)
          Length = 1826

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1308 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1249

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 1248 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1189

                                                                        
Query: 355  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
            ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 1188 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1129

                                                                    
Query: 415  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
             |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 1128 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1073



to top

>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A)
          Length = 1797

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1309 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1250

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 1249 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1190

                                                                        
Query: 355  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
            ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 1189 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1130

                                                                    
Query: 415  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
             |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 1129 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1074



to top

>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571
           IMAGE:30789778), complete cds
          Length = 1075

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 370 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 311

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 310 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 251

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 250 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 191

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 190 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 135



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                          
Query: 235    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 142450 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142509

                                                                          
Query: 295    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 142510 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142569

                                                                          
Query: 355    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 142570 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 142629

                                                                      
Query: 415    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
               |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 142630 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 142685



 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                          
Query: 235    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 137771 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 137712

                                                                          
Query: 295    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 137711 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137652

                                                                          
Query: 355    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 137651 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 137592

                                                                      
Query: 415    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
               |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 137591 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137536



 Score =  103 bits (52), Expect = 6e-19
 Identities = 172/212 (81%)
 Strand = Plus / Plus

                                                                          
Query: 259    gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
              ||||||||| |  |||||||| || |||||||| |||| | | |||||| ||  ||||||
Sbjct: 207873 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 207932

                                                                          
Query: 319    ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
              || ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||||| ||
Sbjct: 207933 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 207992

                                                                          
Query: 379    cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
                 ||| |||||||| || ||||| || | ||| || |  |||||||| || ||||| ||
Sbjct: 207993 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 208052

                                              
Query: 439    gaggtagacaggggcgccggagccgacgcgct 470
               ||||| || |||||||||| ||| |||||||
Sbjct: 208053 caggtacaccggggcgccggcgcccacgcgct 208084



 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Plus

                                                                          
Query: 235    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 174458 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 174517

                                                                          
Query: 295    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 174518 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 174577

                                                                          
Query: 355    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
              ||| ||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 174578 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 174637

                                                                      
Query: 415    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
               |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 174638 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 174693



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                          
Query: 235    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 136886 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 136945

                                                                          
Query: 295    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 136946 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 137005

                                                                          
Query: 355    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
              ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 137006 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 137065

                                                                      
Query: 415    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
               |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 137066 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137121



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                          
Query: 235    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
              ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 142180 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 142121

                                                                          
Query: 295    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 142120 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 142061

                                   
Query: 355    gatgatgcgggtcttcttgtt 375
              ||||||||| |||||||||||
Sbjct: 142060 gatgatgcgcgtcttcttgtt 142040



to top

>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847
           IMAGE:5713252), complete cds
          Length = 492

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 390 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 331

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 330 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 271

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 270 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 211

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 210 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 155



to top

>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730004H15 product:histone 1, H2ai, full insert
           sequence
          Length = 1396

 Score =  111 bits (56), Expect = 3e-21
 Identities = 192/236 (81%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 371 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 312

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || ||| |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 311 gc-ggccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 192 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137



to top

>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA
          Length = 506

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 405 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 346

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 345 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 286

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 285 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 226

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 225 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 170



to top

>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds
          Length = 447

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 372 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 313

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 312 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 253

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 252 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 193

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 192 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 137



to top

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 630 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 571

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 570 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 511

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 510 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 451

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 450 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 395



to top

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 628 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 569

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 568 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 509

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 508 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 449

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 448 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 393



to top

>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA
          Length = 705

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 294

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 293 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 238



to top

>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA
          Length = 393

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125



to top

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone
            H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Plus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1469 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1528

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 1529 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1588

                                                                        
Query: 355  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
            ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 1589 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1648

                                                                    
Query: 415  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
             |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 1649 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 1704



to top

>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1190022L06 product:HISTONE H2A
           homolog [Homo sapiens], full insert sequence
          Length = 705

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 473 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 414

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 413 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 354

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 353 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 294

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 293 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 238



to top

>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA
          Length = 393

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125



to top

>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds
          Length = 1390

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625



to top

>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds
          Length = 1390

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625



to top

>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds
          Length = 1390

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 860 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 801

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 800 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 741

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 740 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 681

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 680 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 625



to top

>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds
          Length = 1381

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 677 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 622



to top

>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence
          Length = 1357

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 842 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 783

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 782 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 723

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 722 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 663

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 662 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 607



to top

>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds
          Length = 1387

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 857 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 798

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 797 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 738

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 737 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 678

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 677 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 622



to top

>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA
          Length = 387

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125



to top

>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene
          Length = 668

 Score =  111 bits (56), Expect = 3e-21
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 483 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 424

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 423 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 364

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 363 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 304

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 303 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 248



to top

>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430002L09
           product:H2A histone family, member X, full insert
           sequence
          Length = 1379

 Score =  109 bits (55), Expect = 1e-20
 Identities = 160/195 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 430 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 371

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 370 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 311

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 310 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 251

                          
Query: 415 ggcgaggtactcgag 429
            | ||||||||||||
Sbjct: 250 agtgaggtactcgag 236



to top

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score =  109 bits (55), Expect = 1e-20
 Identities = 241/303 (79%)
 Strand = Plus / Plus

                                                                       
Query: 232 ggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggt 291
           |||||||||||| |||||||||| ||  |||||||| | ||| ||||||   || |||||
Sbjct: 468 ggacttcttgggcagcagaacggcgtgaatgttgggcagcacaccgccggacgcaatggt 527

                                                                       
Query: 292 gacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcg 351
            ||| || | |||||| |||| ||||||| ||||||||||| ||||||  | | ||||||
Sbjct: 528 cacgtcgcccagcagcttgcccagctcctcgtcgttgcggatggcgagctggatgtggcg 587

                                                                       
Query: 352 cgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctc 411
           ||||| ||||||| |||||||||| ||   ||| |||||||| || ||||| || |||||
Sbjct: 588 cgggacgatgcggttcttcttgttgtcgcgggccgcgttgccagccagctccagaacctc 647

                                                                       
Query: 412 tgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctg 471
            || |  |||||||| || || ||||| |||||||| |||||||| |  |||| ||||| 
Sbjct: 648 agcagtcaggtactccagcacagcggccaggtagacgggggcgccagcaccgatgcgctc 707

                                                                       
Query: 472 ggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggc 531
           ||| ||   ||||||||| | ||| ||  | |||||||| || |||||||| ||||| ||
Sbjct: 708 ggcatacttgcccttcttcaagtaacgagcaatgcggcccacagggaactgcagaccagc 767

              
Query: 532 ctt 534
           |||
Sbjct: 768 ctt 770



to top

>gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and histone H2A variant (H2AInr)
            genes, complete cds
          Length = 2396

 Score =  107 bits (54), Expect = 4e-20
 Identities = 197/244 (80%), Gaps = 3/244 (1%)
 Strand = Plus / Minus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| ||||||||||||||
Sbjct: 1584 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgggcgatggtgac 1525

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             ||| | |||||| ||  |||||||| ||||||||| ||||| ||  ||||||| || ||
Sbjct: 1524 tccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgacgggg 1465

                                                                        
Query: 355  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
            |||||||||||   ||||||| ||   |||||| |||||||| ||||| || | ||| ||
Sbjct: 1464 gatgatgcggg---tcttgttgtcgcgggcggcattgccggccagctccaggatctcggc 1408

                                                                        
Query: 415  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            || ||| |||||||| || ||||| | |||||| || ||||||| ||| || | ||||||
Sbjct: 1407 ggtgagatactcgagcacagcggccaagtagacgggagcgccggcgcccaccctctgggc 1348

                
Query: 475  gtag 478
            ||||
Sbjct: 1347 gtag 1344



to top

>gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent histone H2A mRNA,
           complete cds
          Length = 466

 Score =  107 bits (54), Expect = 4e-20
 Identities = 162/198 (81%)
 Strand = Plus / Minus

                                                                       
Query: 281 tgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgaga 340
           |||||||||||||| ||| | |||||| ||  |||||||| ||||||||| ||||| || 
Sbjct: 335 tgggcgatggtgactccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagc 276

                                                                       
Query: 341 agcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagc 400
            ||||||| || ||||||||||| ||||||||||| ||   |||||| |||||||| |||
Sbjct: 275 tgcaggtgacgggggatgatgcgagtcttcttgttgtcgcgggcggcattgccggccagc 216

                                                                       
Query: 401 tcaagcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggag 460
           || || | ||| |||| ||| |||||||| || ||||| | |||||| || ||||||| |
Sbjct: 215 tccaggatctcggcggtgagatactcgagcacagcggccaagtagacgggagcgccggcg 156

                             
Query: 461 ccgacgcgctgggcgtag 478
           || || | ||||||||||
Sbjct: 155 cccaccctctgggcgtag 138



to top

>ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H2A.x (H2a/x)
           (LOC466864), mRNA
          Length = 432

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 300 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 240 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 181

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 180 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 121

                        
Query: 475 gtagcggcccttc 487
           |||| ||||||||
Sbjct: 120 gtagtggcccttc 108



to top

>gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone
           MGC:4759 IMAGE:3537648), complete cds
          Length = 1580

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 403 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 344

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 343 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 284

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 283 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 224

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 223 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 164

                        
Query: 475 gtagcggcccttc 487
           |||| ||||||||
Sbjct: 163 gtagtggcccttc 151



to top

>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x)
           (LOC489372), mRNA
          Length = 841

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || ||||| || ||
Sbjct: 657 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgcgcgatcgtcac 598

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 597 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 538

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 537 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 478

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            |  ||||||||||| ||||| || ||||| || || ||||||| ||| || |||| |||
Sbjct: 477 cgtcaggtactcgagcacggccgccaggtacaccggcgcgccggcgcccacccgctcggc 418

                        
Query: 475 gtagcggcccttc 487
           |||| ||||||||
Sbjct: 417 gtagtggcccttc 405



to top

>ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AFX), mRNA
          Length = 1651

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 433 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 374

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 373 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 314

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 313 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 254

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 253 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 194

                        
Query: 475 gtagcggcccttc 487
           |||| ||||||||
Sbjct: 193 gtagtggcccttc 181



to top

>emb|BX063165.1|CNS09KWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Plus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 524 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 583

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 584 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 643

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 644 gatgatgcgcgtcttcttgtt 664



to top

>emb|BX063164.1|CNS09KWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 477 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 418

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 417 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 358

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 357 gatgatgcgcgtcttcttgtt 337



to top

>emb|BX040864.1|CNS093P0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 470 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 411

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 410 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 351

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 350 gatgatgcgcgtcttcttgtt 330



to top

>emb|BX019683.1|CNS08NCN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 481 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 422

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 421 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 362

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 361 gatgatgcgcgtcttcttgtt 341



to top

>emb|BX016451.1|CNS08KUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 556

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 404 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 345

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 344 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 285

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 284 gatgatgcgcgtcttcttgtt 264



to top

>emb|BX009846.1|CNS08FRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 357

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Plus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 117 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 176

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 177 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 236

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 237 gatgatgcgcgtcttcttgtt 257



to top

>emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X
          Length = 1585

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 433 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 374

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 373 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 314

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 313 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 254

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 253 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 194

                        
Query: 475 gtagcggcccttc 487
           |||| ||||||||
Sbjct: 193 gtagtggcccttc 181



to top

>gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone
           MGC:4703 IMAGE:3534359), complete cds
          Length = 1616

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 398 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 339

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 338 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 279

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 278 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 219

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 218 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 159

                        
Query: 475 gtagcggcccttc 487
           |||| ||||||||
Sbjct: 158 gtagtggcccttc 146



to top

>emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1373

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 415 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 356

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 355 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 296

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 295 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 236

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 235 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 176

                        
Query: 475 gtagcggcccttc 487
           |||| ||||||||
Sbjct: 175 gtagtggcccttc 163



to top

>gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX) gene, complete cds
          Length = 5462

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 2431 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 2372

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 2371 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 2312

                                                                        
Query: 355  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
            |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 2311 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 2252

                                                                        
Query: 415  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 2251 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 2192

                         
Query: 475  gtagcggcccttc 487
            |||| ||||||||
Sbjct: 2191 gtagtggcccttc 2179



to top

>gb|AC119796.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1172F09,
             complete sequence
          Length = 106057

 Score =  105 bits (53), Expect = 2e-19
 Identities = 71/77 (92%)
 Strand = Plus / Minus

                                                                         
Query: 485   ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 544
             |||||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| || 
Sbjct: 36517 ttcttgaggtagcgcccgatacggccgacggggaattggagcccggccttgacggagcgc 36458

                              
Query: 545   gtcaccgccttcttcct 561
             |||||||||||||||||
Sbjct: 36457 gtcaccgccttcttcct 36441



to top

>gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (cDNA clone
           MGC:19656 IMAGE:3139343), complete cds
          Length = 1589

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 413 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 354

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 353 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 294

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 293 gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 234

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 233 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 174

                        
Query: 475 gtagcggcccttc 487
           |||| ||||||||
Sbjct: 173 gtagtggcccttc 161



to top

>dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:CTD-2589C9, complete
             sequences
          Length = 46239

 Score =  105 bits (53), Expect = 2e-19
 Identities = 203/253 (80%)
 Strand = Plus / Plus

                                                                         
Query: 235   cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
             ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 9807  cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 9866

                                                                         
Query: 295   gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
             |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 9867  gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 9926

                                                                         
Query: 355   gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             |||||| || ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 9927  gatgattcgcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 9986

                                                                         
Query: 415   ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
             || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 9987  ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 10046

                          
Query: 475   gtagcggcccttc 487
             |||| ||||||||
Sbjct: 10047 gtagtggcccttc 10059



to top

>gb|BC106331.1| Xenopus laevis cDNA clone MGC:130860 IMAGE:7205580, complete cds
          Length = 799

 Score =  103 bits (52), Expect = 6e-19
 Identities = 172/212 (81%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 295
           |||||||||||||| || || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 371 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 312

                                                                       
Query: 296 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 355
           ||  |||||||  ||  |||||||| ||||||||| ||||||||  ||||||| |  |||
Sbjct: 311 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 252

                                                                       
Query: 356 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 415
           ||||| || |||||||||||||||  ||| ||||||||||| | ||| || | ||| |||
Sbjct: 251 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 192

                                           
Query: 416 gcgaggtactcgaggacggcggcgaggtagac 447
           |  || |||||||| || ||||| ||||||||
Sbjct: 191 gtcagatactcgagcaccgcggcaaggtagac 160



to top

>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165
           IMAGE:3355200), complete cds
          Length = 897

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 223

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  | ||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 222 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 167



to top

>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456
           IMAGE:6671338), complete cds
          Length = 889

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 392 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 333

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 332 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 273

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 272 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 213

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  | ||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 212 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 157



to top

>gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds
          Length = 635

 Score =  103 bits (52), Expect = 6e-19
 Identities = 109/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 407 acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
           ||||||||||| |||||||||||||||||||| |||||||| || || ||||  ||||| 
Sbjct: 227 acctctgcggctaggtactcgaggacggcggcaaggtagaccggagctccggtaccgaca 168

                                                                       
Query: 467 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
           ||||| ||||| | ||||||||| | ||| || ||||  || ||||||||||||||||| 
Sbjct: 167 cgctgagcgtacctgcccttcttcaagtatcggccgagacgaccgacggggaactggagg 108

                   
Query: 527 ccggcctt 534
           ||||||||
Sbjct: 107 ccggcctt 100



to top

>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA
          Length = 496

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 402 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 343

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 342 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 283

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 282 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 223

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  | ||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 222 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 167



to top

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                          
Query: 235    cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
              ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 100907 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 100848

                                                                          
Query: 295    gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 100847 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 100788

                                                                          
Query: 355    gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
              ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 100787 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 100728

                                                                      
Query: 415    ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
               |  | ||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 100727 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 100672



to top

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  103 bits (52), Expect = 6e-19
 Identities = 172/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 236  ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 295
            |||||||||||||| || || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 4730 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 4671

                                                                        
Query: 296  ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 355
            ||  |||||||  ||  |||||||| ||||||||| ||||||||  ||||||| |  |||
Sbjct: 4670 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 4611

                                                                        
Query: 356  atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 415
            ||||| || |||||||||||||||  ||| ||||||||||| | ||| || | ||| |||
Sbjct: 4610 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 4551

                                            
Query: 416  gcgaggtactcgaggacggcggcgaggtagac 447
            |  || |||||||| || ||||| ||||||||
Sbjct: 4550 gtcagatactcgagcaccgcggcaaggtagac 4519



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  103 bits (52), Expect = 6e-19
 Identities = 127/152 (83%)
 Strand = Plus / Minus

                                                                            
Query: 259      gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
                ||||||||| ||||||||||||  |||||||||| ||||| |||||||| ||   | |||
Sbjct: 21537003 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 21536944

                                                                            
Query: 319      ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
                || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||| ||
Sbjct: 21536943 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 21536884

                                                
Query: 379      cttggcggcgttgccggcgagctcaagcacct 410
                | | || ||||| ||||||||||| |||||||
Sbjct: 21536883 cctcgccgcgttcccggcgagctcgagcacct 21536852



 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                            
Query: 407      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
                ||||| ||||||||||||||||||||||||||||||||||| ||||| |||| |||||||
Sbjct: 21536579 acctcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacg 21536520

                           
Query: 467      cgctgggcgta 477
                |||| ||||||
Sbjct: 21536519 cgctcggcgta 21536509



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                            
Query: 485      ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 544
                |||||||||||||||||||| |||| |||||| |||||||| |||||||| ||||| || 
Sbjct: 22313886 ttcttgaggtagcgcccgatacggctgacgggcaactggagcccggccttgacggagcgc 22313945

                                 
Query: 545      gtcaccgccttcttcct 561
                |||||||||||||||||
Sbjct: 22313946 gtcaccgccttcttcct 22313962



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 56/59 (94%)
 Strand = Plus / Minus

                                                                           
Query: 407      acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgac 465
                ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||
Sbjct: 21539259 acctcagcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 21539201



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                            
Query: 314      agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 373
                ||||||| ||||||||||||||||||  | | |||||| || |  |||||||||||||||
Sbjct: 21539587 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 21539528

                                                     
Query: 374      ttatccttggcggcgttgccggcgagctcaagcacct 410
                || ||| | || ||||| |||||||||||||| ||||
Sbjct: 21539527 ttgtccctcgccgcgttcccggcgagctcaagaacct 21539491



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 151      ggcgggggccttcttcttgg 170
                ||||||||||||||||||||
Sbjct: 29547682 ggcgggggccttcttcttgg 29547663



to top

>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA
          Length = 393

 Score =  103 bits (52), Expect = 6e-19
 Identities = 172/212 (81%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| |  |||||||| || |||||||| |||| | | |||||| ||  ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||||| ||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
              ||| |||||||| || ||||| || | ||| || |  |||||||| || ||||| ||
Sbjct: 216 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157

                                           
Query: 439 gaggtagacaggggcgccggagccgacgcgct 470
            ||||| || |||||||||| ||| |||||||
Sbjct: 156 caggtacaccggggcgccggcgcccacgcgct 125



to top

>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA
          Length = 393

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||| ||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 125



to top

>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted)
           (Hist1h2an_predicted), mRNA
          Length = 546

 Score =  103 bits (52), Expect = 6e-19
 Identities = 163/200 (81%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| |  |||||||| || |||||||| |||| | | |||||| ||  ||||||
Sbjct: 336 gatgttgggcaggacgccgccctgtgcgatggtcacgcggcccagcagcttgttgagctc 277

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||||| ||
Sbjct: 276 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 217

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
           | | || |||||||| || ||||| || | ||| || |  |||||||| || ||||| ||
Sbjct: 216 cctcgctgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 157

                               
Query: 439 gaggtagacaggggcgccgg 458
            ||||| || ||||||||||
Sbjct: 156 caggtacaccggggcgccgg 137



to top

>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds
          Length = 1390

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 884 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 825

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | | |||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 824 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 765

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 764 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 705

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 704 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 649



to top

>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds
          Length = 1390

 Score =  103 bits (52), Expect = 6e-19
 Identities = 172/212 (81%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| |  |||||||| || |||||||| |||| | | |||||| ||  ||||||
Sbjct: 836 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 777

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||||| ||
Sbjct: 776 ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 717

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
              ||| |||||||| || ||||| || | ||| || |  |||||||| || ||||| ||
Sbjct: 716 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 657

                                           
Query: 439 gaggtagacaggggcgccggagccgacgcgct 470
            ||||| || |||||||||| ||| |||||||
Sbjct: 656 caggtacaccggggcgccggcgcccacgcgct 625



to top

>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds
          Length = 1201

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 894 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 835

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 834 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 775

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||| ||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 774 gataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 715

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 714 cgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgct 659



to top

>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1582_D10
          Length = 103475

 Score =  103 bits (52), Expect = 6e-19
 Identities = 127/152 (83%)
 Strand = Plus / Minus

                                                                         
Query: 259   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
             ||||||||| ||||||||||||  |||||||||| ||||| |||||||| ||   | |||
Sbjct: 74787 gatgttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactc 74728

                                                                         
Query: 319   ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
             || ||||||||| || |||||  | | ||||||||| | |||||||||||||||||| ||
Sbjct: 74727 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtc 74668

                                             
Query: 379   cttggcggcgttgccggcgagctcaagcacct 410
             | | || ||||| ||||||||||| |||||||
Sbjct: 74667 cctcgccgcgttcccggcgagctcgagcacct 74636



 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                         
Query: 407   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
             ||||| ||||||||||||||||||||||||||||||||||| ||||| |||| |||||||
Sbjct: 74363 acctcagcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacg 74304

                        
Query: 467   cgctgggcgta 477
             |||| ||||||
Sbjct: 74303 cgctcggcgta 74293



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 56/59 (94%)
 Strand = Plus / Minus

                                                                        
Query: 407   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgac 465
             ||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||
Sbjct: 77043 acctcagcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 76985



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                         
Query: 314   agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 373
             ||||||| ||||||||||||||||||  | | |||||| || |  |||||||||||||||
Sbjct: 77371 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 77312

                                                  
Query: 374   ttatccttggcggcgttgccggcgagctcaagcacct 410
             || ||| | || ||||| |||||||||||||| ||||
Sbjct: 77311 ttgtccctcgccgcgttcccggcgagctcaagaacct 77275



to top

>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040
           (ENSANGG00000013551), partial mRNA
          Length = 375

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 357 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 298

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||| ||||||||
Sbjct: 297 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 238

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| ||||| || || ||||| ||||| || ||
Sbjct: 237 gatgatgcgcgtcttcttgttgtcgcgggccgcgttacccgccagctcgagcacttccgc 178

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            || |||||||| | ||| ||||| || ||||| || ||||| |  ||||||||||
Sbjct: 177 cgccaggtactccatgaccgcggccagatagacgggcgcgcccgctccgacgcgct 122



to top

>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004
           (ENSANGG00000000004), mRNA
          Length = 630

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 471 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 412

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||| ||||||||
Sbjct: 411 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 352

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| ||||| || || ||||| ||||| || ||
Sbjct: 351 gatgatgcgcgtcttcttgttgtcgcgggccgcgttacccgccagctcgagcacttccgc 292

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            || |||||||| | ||| ||||| || ||||| || ||||| |  ||||||||||
Sbjct: 291 cgccaggtactccatgaccgcggccagatagacgggcgcgcccgctccgacgcgct 236



to top

>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA
          Length = 393

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | | |||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 125



to top

>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118101

 Score =  103 bits (52), Expect = 6e-19
 Identities = 127/152 (83%)
 Strand = Plus / Minus

                                                                         
Query: 259   gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
             ||||||||| || |||||||||  |||||||||| ||||| |||||||| ||  ||||||
Sbjct: 48743 gatgttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctc 48684

                                                                         
Query: 319   ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
             || ||||||||| || |||||  | | ||||||||| |  ||||||||||||||||| ||
Sbjct: 48683 ctcgtcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtc 48624

                                             
Query: 379   cttggcggcgttgccggcgagctcaagcacct 410
             | | || ||||| ||||||||||| |||||||
Sbjct: 48623 cctcgccgcgttcccggcgagctccagcacct 48592



 Score =  101 bits (51), Expect = 2e-18
 Identities = 66/71 (92%)
 Strand = Plus / Minus

                                                                         
Query: 407   acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
             ||||| ||||||||||||||||||||||||||||||||||| || ||||||| |||||||
Sbjct: 48392 acctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacg 48333

                        
Query: 467   cgctgggcgta 477
             |||| ||||||
Sbjct: 48332 cgctcggcgta 48322



to top

>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence
          Length = 567

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||  ||||||||||| ||| ||  |||||||||||||
Sbjct: 363 gcggcccagcagcttgttgagctccacgtcgttgcggatggccagctgcaggtggcgcgg 304

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 303 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 244

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || |||||||||| ||| |||||||
Sbjct: 243 cgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgct 188



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III),
            histone H2B (ch2b-III) and histone H2A (ch2a-III) genes,
            complete cds
          Length = 4582

 Score =  103 bits (52), Expect = 6e-19
 Identities = 238/300 (79%)
 Strand = Plus / Minus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| |||| || ||||||||| | ||| |||||   |||||| || ||
Sbjct: 3458 cttcttgggcagcagcacggcgtggatgttgggcagcacaccgcccgaggcgatcgtcac 3399

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              || | |||||| |||| |||||||  || ||||||| ||| ||  | | |||||| ||
Sbjct: 3398 ctcgcccagcagcttgcccagctcctcatcattgcggatggccagctggatgtggcgggg 3339

                                                                        
Query: 355  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
             | ||| ||| |||||||||| ||   ||||||||||||||| ||||| |||||||| ||
Sbjct: 3338 cacgatacggttcttcttgttgtcgcgggcggcgttgccggccagctctagcacctcagc 3279

                                                                        
Query: 415  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            ||  |||||||| || || ||||| ||||| || || |||||||  |||| ||||| |||
Sbjct: 3278 ggtcaggtactccagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggc 3219

                                                                        
Query: 475  gtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggagaccggcctt 534
            |||   ||||||||| ||||||||| | |||||||| || |||||||| || ||||||||
Sbjct: 3218 gtacttgcccttcttcaggtagcgcgcaatgcggcccacagggaactgcaggccggcctt 3159



to top

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score =  103 bits (52), Expect = 6e-19
 Identities = 172/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 236  ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 295
            |||||||||||||| || || | ||||||||| |  || ||||| |||||||||||||| 
Sbjct: 4747 ttcttggggagcagcacagactggatgttgggcaggacaccgccctgggcgatggtgacc 4688

                                                                        
Query: 296  ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 355
            ||  |||||||  ||  |||||||| ||||||||| ||||||||  ||||||| |  |||
Sbjct: 4687 cctccgagcagtttgttgagctcctcgtcgttgcgcacggcgagctgcaggtgcctgggg 4628

                                                                        
Query: 356  atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 415
            ||||| || |||||||||||||||  ||| ||||||||||| | ||| || | ||| |||
Sbjct: 4627 atgatccgagtcttcttgttatcccgggcagcgttgccggccaactcgaggatctcggcg 4568

                                            
Query: 416  gcgaggtactcgaggacggcggcgaggtagac 447
            |  || |||||||| || ||||| ||||||||
Sbjct: 4567 gtcagatactcgagcaccgcggcaaggtagac 4536



to top

>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds
          Length = 1173

 Score =  103 bits (52), Expect = 6e-19
 Identities = 190/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || || |||||||| ||
Sbjct: 752 cttcttgggcagcagtacggcctggatgttgggcaggacgccaccctgcgcgatggtcac 693

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 692 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 633

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||    || ||||||||||| ||||| || | ||| ||
Sbjct: 632 gatgatgcgcgtcttcttgttgtcgcgcgccgcgttgccggcaagctccaggatctcggc 573

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  | ||||||||| || ||||| || ||||| |||||||||| ||| |||||||
Sbjct: 572 agtcaagtactcgagcaccgcggccagatagaccggggcgccggcgcccacgcgct 517



to top

>gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds
          Length = 643

 Score =  101 bits (51), Expect = 2e-18
 Identities = 129/155 (83%)
 Strand = Plus / Minus

                                                                       
Query: 407 acctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacg 466
           ||||| || ||||||||||| | |||||||||||||||||| || || |||| |||||| 
Sbjct: 242 acctcagcagcgaggtactccaagacggcggcgaggtagaccggagctccggtgccgaca 183

                                                                       
Query: 467 cgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactggaga 526
           ||||| ||||| | ||||||||| | ||| || ||||  ||||| |||||||||||||| 
Sbjct: 182 cgctgagcgtacctgcccttcttcaagtatcggccgagacggccaacggggaactggagc 123

                                              
Query: 527 ccggccttcacggaccgggtcaccgccttcttcct 561
           |||||||| ||||| || | |||||  ||||||||
Sbjct: 122 ccggccttgacggatcgagacaccgatttcttcct 88



to top

>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129),
           mRNA
          Length = 393

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Minus

                                                                       
Query: 272 acgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcgg 331
           |||||||| || |||||||| |||| | | |||||| ||  |||||||| ||||||||||
Sbjct: 323 acgccgccctgtgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 264

                                                                       
Query: 332 acggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttg 391
           | ||| ||  |||||||||||||||||||||| ||||||||||| ||| | || ||||||
Sbjct: 263 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtccctcgctgcgttg 204

                                                                       
Query: 392 ccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggg 451
           || || ||||| || | ||| || |  |||||||| || ||||| || ||||| || |||
Sbjct: 203 cccgccagctccaggatctcggccgtcaggtactccagcacggccgccaggtacaccggg 144

                  
Query: 452 gcgccgg 458
           |||||||
Sbjct: 143 gcgccgg 137



to top

>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488308), mRNA
          Length = 456

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 423 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 364

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 363 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 304

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 303 gatgatgcgcgtcttcttgtt 283



to top

>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC611496), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488291), mRNA
          Length = 387

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488278), mRNA
          Length = 576

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488272), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488270), mRNA
          Length = 462

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 429 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 370

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 369 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 310

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 309 gatgatgcgcgtcttcttgtt 289



to top

>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488262), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488254), mRNA
          Length = 417

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 384 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 325

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 324 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 265

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 264 gatgatgcgcgtcttcttgtt 244



to top

>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251),
           mRNA
          Length = 396

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 2 (LOC488268), mRNA
          Length = 402

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l),
           transcript variant 1 (LOC488268), mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203),
           mRNA
          Length = 393

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>emb|BX016452.1|CNS08KUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Plus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 74  cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 133

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            ||||  |||||| ||   ||||||| ||||||||||| ||| |   |||||||||||||
Sbjct: 134 cccggacagcagcttgttcagctcctcgtcgttgcggatggccaactgcaggtggcgcgg 193

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 194 gatgatgcgcgtcttcttgtt 214



to top

>emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 100/117 (85%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| | ||||||||| ||||||||||| || ||||  |||||| ||   |||||
Sbjct: 141 gatgttgggcagcacgccgccctgggcgatggtcaccccggacagcagcttgttcagctc 82

                                                                    
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgtt 375
           || ||||||||||| ||| ||  |||||||||||||||||||||| |||||||||||
Sbjct: 81  ctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgtt 25



to top

>emb|X94693.1|TAH2A254 T.aestivum histone H2A gene
          Length = 2241

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                        
Query: 405  gcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccga 464
            ||||||| |||||||||||||| |||||||||||||||||||| ||||||||||  ||||
Sbjct: 1295 gcacctcagcggcgaggtactcaaggacggcggcgaggtagacgggggcgccggctccga 1236

                         
Query: 465  cgcgctgggcgta 477
            |||||| ||||||
Sbjct: 1235 cgcgctcggcgta 1223



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                        
Query: 259  gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
            ||||||||| ||||| ||||||  |||||||||| ||||| |||||| | ||   |||||
Sbjct: 1707 gatgttgggcatcacaccgccgctggcgatggtggcgccgccgagcaacttggtcagctc 1648

                                                                        
Query: 319  ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
            || ||| ||||| ||||||||  | | ||||||||| | ||| |||||||||||||| ||
Sbjct: 1647 ctcgtcattgcgcacggcgagctggatgtggcgcggcacgatacgggtcttcttgttgtc 1588

                                    
Query: 379  cttggcggcgttgccggcgagctc 402
            | |||||||||| ||||| |||||
Sbjct: 1587 cctggcggcgtttccggccagctc 1564



to top

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1933 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1874

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 1873 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1814

                                 
Query: 355  gatgatgcgggtcttcttgtt 375
            ||||||||| |||||||||||
Sbjct: 1813 gatgatgcgcgtcttcttgtt 1793



to top

>emb|CR457079.1| Homo sapiens full open reading frame cDNA clone RZPDo834A117D for
           gene H2AFX, H2A histone family, member X; complete cds,
           incl. stopcodon
          Length = 432

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 202/253 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  ||||| || |||||||| || ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatcgtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 300 gccgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||  | ||||||||||| ||   ||| || ||||| || ||||| || | ||| ||
Sbjct: 240 gatgattagcgtcttcttgttgtcgcgggccgcattgcccgccagctccaggatctcagc 181

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
           || ||||||||| || || || || ||||| || || ||||||| ||| ||||||| |||
Sbjct: 180 ggtgaggtactccagcactgccgccaggtacactggcgcgccggcgccaacgcgctcggc 121

                        
Query: 475 gtagcggcccttc 487
           |||| ||||||||
Sbjct: 120 gtagtggcccttc 108



to top

>gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, complete cds
          Length = 2241

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                        
Query: 405  gcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccga 464
            ||||||| |||||||||||||| |||||||||||||||||||| ||||||||||  ||||
Sbjct: 1295 gcacctcagcggcgaggtactcaaggacggcggcgaggtagacgggggcgccggctccga 1236

                         
Query: 465  cgcgctgggcgta 477
            |||||| ||||||
Sbjct: 1235 cgcgctcggcgta 1223



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                        
Query: 259  gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
            ||||||||| ||||| ||||||  |||||||||| ||||| |||||| | ||   |||||
Sbjct: 1707 gatgttgggcatcacaccgccgctggcgatggtggcgccgccgagcaacttggtcagctc 1648

                                                                        
Query: 319  ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
            || ||| ||||| ||||||||  | | ||||||||| | ||| |||||||||||||| ||
Sbjct: 1647 ctcgtcattgcgcacggcgagctggatgtggcgcggcacgatacgggtcttcttgttgtc 1588

                                    
Query: 379  cttggcggcgttgccggcgagctc 402
            | |||||||||| ||||| |||||
Sbjct: 1587 cctggcggcgtttccggccagctc 1564



to top

>gb|AY760064.1| Muntiacus muntjak vaginalis H2A histone family member X (H2AX)
           mRNA, partial cds
          Length = 300

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 184/229 (80%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| |  ||||| || |||||||| || |||||| | |||||| ||  ||||||
Sbjct: 297 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 238

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||||| ||| ||  |||||||||| ||||| || || ||||||||||| ||
Sbjct: 237 ctcgtcgttgcggatggccagctgcaggtggcgggggattatccgcgtcttcttgttgtc 178

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
              ||| |||||||| || ||||| || | ||| |||| |||||||||||| || || ||
Sbjct: 177 gcgggccgcgttgcccgccagctccaggatctcagcggtgaggtactcgagtaccgccgc 118

                                                            
Query: 439 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttc 487
            |||||||| || ||||||| ||| || | || ||||||| ||||||||
Sbjct: 117 caggtagaccggcgcgccggcgcccaccctctcggcgtagtggcccttc 69



to top

>dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0567H04
          Length = 181420

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                          
Query: 485    ttcttgaggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgg 544
              |||||||||||||||||||| |||| |||||| |||||||| |||||||| ||||| || 
Sbjct: 119132 ttcttgaggtagcgcccgatacggctgacgggcaactggagcccggccttgacggagcgc 119191

                               
Query: 545    gtcaccgccttcttcct 561
              |||||||||||||||||
Sbjct: 119192 gtcaccgccttcttcct 119208



to top

>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence
          Length = 531

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 387 cttcttgggcagcagcacggcctggatgttgggcacgacgccgccctgcgcgatggtcac 328

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 327 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 268

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 267 gatgatgcgcgtcttcttgtt 247



to top

>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds
          Length = 929

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 523 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 464

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 463 gcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 404

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 403 gatgatgcgcgtcttcttgtt 383



to top

>gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds
          Length = 375

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 118/141 (83%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| |||||||||||| || ||  | || ||||| |||||||| | | |||||||
Sbjct: 279 gagctcctcgtcgttgcggacagccagctgaagatggcgggggatgatcctgctcttctt 220

                                                                       
Query: 373 gttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 432
           ||| ||   ||||||||||||||||||||| || | ||| |||| |||||||||||||||
Sbjct: 219 gttgtcgcgggcggcgttgccggcgagctcgaggatctcagcggtgaggtactcgaggac 160

                                
Query: 433 ggcggcgaggtagacaggggc 453
           ||| |||||||| || |||||
Sbjct: 159 ggctgcgaggtacactggggc 139



to top

>gb|BC077427.1| Xenopus laevis MGC82198 protein, mRNA (cDNA clone MGC:82198
           IMAGE:3402168), complete cds
          Length = 1591

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 171/212 (80%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 295
           |||||||| ||||| ||||| | ||||||||| |  || ||||| || ||||| ||||| 
Sbjct: 367 ttcttgggcagcagcacggactggatgttgggcaggaccccgccctgagcgatagtgact 308

                                                                       
Query: 296 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 355
           ||  |||||||  ||  ||||||||  |||||||| || |||||  ||||||| |  |||
Sbjct: 307 cctccgagcagtttgttgagctcctcatcgttgcgcacagcgagctgcaggtgcctgggg 248

                                                                       
Query: 356 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 415
           ||||||||||||||||||||||||  ||| ||||||||||| | ||| || | ||| |||
Sbjct: 247 atgatgcgggtcttcttgttatcccgggcagcgttgccggccaactccaggatctcagcg 188

                                           
Query: 416 gcgaggtactcgaggacggcggcgaggtagac 447
           |  ||||||||||| || |||||||| |||||
Sbjct: 187 gtcaggtactcgagcactgcggcgagatagac 156



to top

>gb|AY849374.1| Emiliania huxleyi histone H2A mRNA, complete cds
          Length = 680

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 201/252 (79%)
 Strand = Plus / Minus

                                                                       
Query: 232 ggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggt 291
           ||||||||| || || || || |||| |||||||||||  |||||||| || |||| |||
Sbjct: 357 ggacttcttcggcaggagcaccgagtggatgttggggaggacgccgccctgcgcgacggt 298

                                                                       
Query: 292 gacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcg 351
            |||||| |||| | | ||  |||||||| ||||||||| || |||||    | ||| ||
Sbjct: 297 cacgccgccgaggaacttgttgagctcctcgtcgttgcgcaccgcgagggtgatgtgccg 238

                                                                       
Query: 352 cgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctc 411
            || |||||||| | ||||||||| ||    ||||||||||| |||||||| ||||||||
Sbjct: 237 gggaatgatgcgcgacttcttgttgtcgcgcgcggcgttgcccgcgagctcgagcacctc 178

                                                                       
Query: 412 tgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctg 471
            || || | |||||||||||||||||| |||||||| || || || | ||||| ||||  
Sbjct: 177 ggccgccatgtactcgaggacggcggccaggtagaccggcgctcccgcgccgatgcgcga 118

                       
Query: 472 ggcgtagcggcc 483
           ||||||||||||
Sbjct: 117 ggcgtagcggcc 106



to top

>ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone H2A.x (H2a/x)
           (LOC500987), mRNA
          Length = 1569

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 194/243 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || ||||| || ||
Sbjct: 639 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatagtcac 580

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           |||| | |||||| ||  |||||||| |||||||||||  || ||  |||||||||||||
Sbjct: 579 gccgcccagcagcttgttgagctcctcgtcgttgcggatagccagctgcaggtggcgcgg 520

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||| ||||| ||||||||||| |||   || |||||||| || ||||| || | ||| ||
Sbjct: 519 gataatgcgcgtcttcttgttgtcccgagccgcgttgcccgccagctccaggatctcggc 460

                                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgctgggc 474
            | |||||||||||| || || || ||||| || || ||||| | ||| ||||||| |||
Sbjct: 459 agtgaggtactcgagcaccgccgccaggtacacgggcgcgcctgcgcccacgcgctcggc 400

              
Query: 475 gta 477
           |||
Sbjct: 399 gta 397



to top

>emb|BX008487.1|CNS08EPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 119/142 (83%), Gaps = 1/142 (0%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 231 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 172

                                                                       
Query: 295 g-ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcg 353
             ||||  |||||| ||   ||||||| ||||||||||| ||| ||  ||||||||||||
Sbjct: 171 ctccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcg 112

                                 
Query: 354 ggatgatgcgggtcttcttgtt 375
           |||||||||| |||||||||||
Sbjct: 111 ggatgatgcgcgtcttcttgtt 90



to top

>gb|AY849373.1| Emiliania huxleyi histone H2A.X mRNA, complete cds
          Length = 613

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                       
Query: 233 gacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtg 292
           ||||||||||| || || || |||| |||||||||||  ||||||||   ||| ||||||
Sbjct: 359 gacttcttgggcaggagcaccgagtggatgttggggaggacgccgcccgaggcaatggtg 300

                                                                       
Query: 293 acgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgc 352
           |||||| |||| | | ||  |||||||| |||||||||||| ||||| |  |||||||||
Sbjct: 299 acgccgccgaggaacttgttgagctcctcgtcgttgcggaccgcgaggacgaggtggcgc 240

                                                                       
Query: 353 gggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctct 412
           ||  ||| |||  |||||||||| ||      ||| ||||| |||||||| |||||||| 
Sbjct: 239 ggcgtgacgcgcttcttcttgttgtcgcgacaggcattgcccgcgagctcgagcacctcg 180

                                                 
Query: 413 gcggcgaggtactcgaggacggcggcgaggtagacagg 450
           || || | |||||||| |||||||| ||||||||||||
Sbjct: 179 gcagccatgtactcgatgacggcggtgaggtagacagg 142



to top

>gb|BT016168.1| Zea mays clone Contig1 mRNA sequence
          Length = 676

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 144/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 gtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaag 405
           ||||||||| | ||| ||| |||||||||| |||   || ||||| ||||| ||||| ||
Sbjct: 350 gtggcgcggcacgatacggttcttcttgttgtcccgagcagcgttcccggccagctccag 291

                                                                       
Query: 406 cacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgac 465
           |||||| |||||||| |||||||| ||||||| |||||| || ||||| |||| ||||||
Sbjct: 290 cacctcggcggcgagatactcgagaacggcggagaggtacacgggggccccggcgccgac 231

                                                                    
Query: 466 gcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactg 522
           |||||  || ||    ||   ||||||||| ||| ||||||| ||||||||||||||
Sbjct: 230 gcgctccgcatacttcccggccttgaggtaccgcgcgatgcgaccgacggggaactg 174



to top

>ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX (Histone H2A.X)
           (H2a/x) (LOC531733), mRNA
          Length = 1724

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 183/229 (79%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| |  ||||| || |||||||| || |||||| | |||||| ||  ||||||
Sbjct: 825 gatgttgggcaggacgcctccctgggcgatcgtcacgccgcccagcagcttgttgagctc 766

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||||| ||| ||  |||||||||| ||||| || || ||||||||||| ||
Sbjct: 765 ctcgtcgttgcggatggccagctgcaggtggcgggggattatccgcgtcttcttgttgtc 706

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
              ||| || ||||| || ||||| || | ||| |||| |||||||||||| || || ||
Sbjct: 705 gcgggccgcattgcccgccagctccaggatctcagcggtgaggtactcgagtaccgccgc 646

                                                            
Query: 439 gaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttc 487
            |||||||| || ||||||| ||| || | || ||||||| ||||||||
Sbjct: 645 caggtagaccggcgcgccggcgcccaccctctcggcgtagtggcccttc 597



to top

>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299),
           mRNA
          Length = 387

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297),
           mRNA
          Length = 393

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatggtgac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           ||||||||| |||||||||||
Sbjct: 240 gatgatgcgcgtcttcttgtt 220



to top

>emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA
          Length = 775

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 154/189 (81%), Gaps = 1/189 (0%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| | ||||||||| || |||||||| || ||  | |||||| ||  ||||||
Sbjct: 374 gatgttgggcagcacgccgccctgagcgatggtcactcctcccagcagcttgttgagctc 315

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||| || || ||  |||||||||| |||||||||||||| |||||||| ||
Sbjct: 314 ctcgtcgttgcgcaccgccagctgcaggtggcgggggatgatgcgggt-ttcttgttgtc 256

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
              ||| ||||||||||| ||||| || | ||| ||||  |||||||| || ||||||||
Sbjct: 255 gcgggcagcgttgccggccagctccaggatctcggcggtcaggtactccagcacggcggc 196

                    
Query: 439 gaggtagac 447
            ||||||||
Sbjct: 195 caggtagac 187



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 506 cggccgacggggaactggagaccggcc 532
           |||||||||||||||||||| ||||||
Sbjct: 128 cggccgacggggaactggagcccggcc 102



to top

>emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones
          Length = 1653

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 1496 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 1437

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            || | | |||||| |   |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 1436 gcggcccagcagcttattgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 1377

                                     
Query: 355  gatgatgcgggtcttcttgttatcc 379
            ||| ||||| |||||||||||||||
Sbjct: 1376 gataatgcgcgtcttcttgttatcc 1352



to top

>ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (Hist1h2aa), mRNA
          Length = 393

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
           || | | |||||| |   |||||||| ||||||||||| ||| ||  |||||||||||||
Sbjct: 300 gcggcccagcagcttattgagctcctcgtcgttgcggatggccagctgcaggtggcgcgg 241

                                    
Query: 355 gatgatgcgggtcttcttgttatcc 379
           ||| ||||| |||||||||||||||
Sbjct: 240 gataatgcgcgtcttcttgttatcc 216



to top

>gb|AY105006.1| Zea mays PCO108932 mRNA sequence
          Length = 841

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 144/177 (81%)
 Strand = Plus / Minus

                                                                       
Query: 346 gtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaag 405
           ||||||||| | ||| ||| |||||||||| |||   || ||||| ||||| ||||| ||
Sbjct: 338 gtggcgcggcacgatacggttcttcttgttgtcccgagcagcgttcccggccagctccag 279

                                                                       
Query: 406 cacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgac 465
           |||||| |||||||| |||||||| ||||||| |||||| || ||||| |||| ||||||
Sbjct: 278 cacctcggcggcgagatactcgagaacggcggagaggtacacgggggccccggcgccgac 219

                                                                    
Query: 466 gcgctgggcgtagcggcccttcttgaggtagcgcccgatgcggccgacggggaactg 522
           |||||  || ||    ||   ||||||||| ||| ||||||| ||||||||||||||
Sbjct: 218 gcgctccgcatacttcccggccttgaggtaccgcgcgatgcgaccgacggggaactg 162



to top

>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 188/236 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| || ||||| || ||
Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||||||  |||||||||| ||
Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 264

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || || ||||||| ||| |||||||
Sbjct: 263 cgtcaggtactccagcacggccgccaggtacaccggcgcgccggcgcccacgcgct 208



to top

>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA,
           complete sequence
          Length = 786

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 188/236 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| || ||||| || ||
Sbjct: 443 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcac 384

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||||||  |||||||||| ||
Sbjct: 383 cttgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcgggg 324

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 323 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 264

                                                                   
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgcgct 470
            |  |||||||| || ||||| || ||||| || || ||||||| ||| |||||||
Sbjct: 263 cgtcaggtactccagcacggccgccaggtacaccggcgcgccggcgcccacgcgct 208



to top

>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA
          Length = 393

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           |||||| |||||||| ||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 360 cttcttagggagcagcacggcctggatgttgggcaggacgccgccctgagcgatggtgac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  ||| ||| |||||
Sbjct: 300 tttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaagtgacgcgg 241

                                                           
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctc 402
           ||||||||||||||||||||| |||  ||| |||||||| || |||||
Sbjct: 240 gatgatgcgggtcttcttgttgtcccgggccgcgttgcccgccagctc 193



to top

>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l)
           (LOC488304), mRNA
          Length = 588

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 272 acgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcgg 331
           |||||||| || |||||||| |||| | | |||||| ||  |||||||| ||||||||||
Sbjct: 470 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 411

                                                       
Query: 332 acggcgagaagcaggtggcgcgggatgatgcgggtcttcttgtt 375
           | ||| ||  |||||||||||||||||||||| |||||||||||
Sbjct: 410 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgtt 367



to top

>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962),
           mRNA
          Length = 437

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 275 ccgccgtgggcgatggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacg 334
           ||||| || |||||||| |||| | | |||||| ||  |||||||| ||||||||||| |
Sbjct: 334 ccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcggatg 275

                                                                       
Query: 335 gcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccg 394
           || ||  |||||||||||||||||||||| ||||||||||| ||| | || |||||||| 
Sbjct: 274 gccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtccctcgccgcgttgccc 215

                   
Query: 395 gcgagctc 402
           || |||||
Sbjct: 214 gccagctc 207



to top

>gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, complete sequence
          Length = 571

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 170/212 (80%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           ||||||||| |  |||||||| || |||||||| |||| | | |||||| ||  ||||||
Sbjct: 403 gatgttgggcaggacgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctc 344

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || ||||||||||| ||| ||  ||||||||| |||||||||||| || |||||||| ||
Sbjct: 343 ctcgtcgttgcggatggccagctgcaggtggcacgggatgatgcgcgttttcttgttgtc 284

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
              ||| |||||||| || ||||| || | ||| || |  |||||||| || ||||| ||
Sbjct: 283 gcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcacggccgc 224

                                           
Query: 439 gaggtagacaggggcgccggagccgacgcgct 470
            ||||| || |||||||||| ||| |||||||
Sbjct: 223 caggtacaccggggcgccggcgcccacgcgct 192



to top

>emb|AL512384.9| Human DNA sequence from clone RP11-317E16 on chromosome 6 Contains the
             3' end of the gene for sectretagogin (SECRET), the genes
             for novel H2A and H2B histone family members, H2A and H2B
             histone family pseudogenes, complete sequence
          Length = 49963

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                         
Query: 302   agcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatg 361
             |||||| || ||||||||| ||||||||||| ||| ||  ||||||||||||||||||||
Sbjct: 39873 agcagcttgtcgagctccttgtcgttgcggatggccagctgcaggtggcgcgggatgatg 39814

                        
Query: 362   cgggtcttctt 372
             |||||||||||
Sbjct: 39813 cgggtcttctt 39803



to top

>emb|X14730.1|CMHIST2A Duck H2A histone gene
          Length = 845

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 178/223 (79%)
 Strand = Plus / Minus

                                                                       
Query: 236 ttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacg 295
           |||||||| ||||| ||||  | ||||||||| | ||| ||||| || ||||||||||| 
Sbjct: 509 ttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtgacc 450

                                                                       
Query: 296 ccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcggg 355
             | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| |||
Sbjct: 449 ttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcggggg 390

                                                                       
Query: 356 atgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgcg 415
           |||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| || 
Sbjct: 389 atgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctctaggatctcggcc 330

                                                      
Query: 416 gcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
           |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 329 gttaggtactccagtacggccgccaggtacaccggggcgccgg 287



to top

>gb|M11085.1|SUPHIS2A2 Sea urchin (P.miliaris) late histone H2A-2 late mRNA, complete cds
          Length = 430

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 157/195 (80%)
 Strand = Plus / Minus

                                                                       
Query: 259 gatgttggggatcacgccgccgtgggcgatggtgacgccggcgagcagcctgccgagctc 318
           |||||||||||  || || || || ||||||||||| ||  |||| ||| ||  ||||||
Sbjct: 348 gatgttggggaggacaccaccctgagcgatggtgactcctccgagaagcttgttgagctc 289

                                                                       
Query: 319 ctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttgttatc 378
           || |||||||||||| || |   | || || || |||||||| | | |||||||||| ||
Sbjct: 288 ctcgtcgttgcggacagccaactgaagatgacgggggatgatcctgctcttcttgttgtc 229

                                                                       
Query: 379 cttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggacggcggc 438
              ||||||||||||||||||||| || | ||| |||| |||||||||||||||||| ||
Sbjct: 228 gcgggcggcgttgccggcgagctcgaggatctcagcggtgaggtactcgaggacggctgc 169

                          
Query: 439 gaggtagacaggggc 453
           |||||| || |||||
Sbjct: 168 gaggtacactggggc 154



to top

>ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone protein Hist1h2af
           (LOC471884), mRNA
          Length = 420

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                       
Query: 314 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 373
           ||||||| ||||||||||| ||| ||  ||||||||||||||||||||||||||||||||
Sbjct: 281 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttcttg 222

             
Query: 374 tt 375
           ||
Sbjct: 221 tt 220



to top

>ref|XM_871147.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC618824), mRNA
          Length = 453

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| |||||||||||  || ||  ||||||| |||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggattgccagctgcaggtgacgcgggatgatgcgggtcttctt 223

                                         
Query: 373 gttatccttggcggcgttgccggcgagctc 402
           |||||||  ||| |||||||| || |||||
Sbjct: 222 gttatcccgggccgcgttgcccgccagctc 193



to top

>ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616790), mRNA
          Length = 413

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||| ||| ||  ||||||| |||||||||||||||||||||||
Sbjct: 302 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgggtcttctt 243

                                         
Query: 373 gttatccttggcggcgttgccggcgagctc 402
           ||| |||  ||| |||||||| || |||||
Sbjct: 242 gttgtcccgggccgcgttgcccgccagctc 213



to top

>ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A histone family, member J
           isoform 2 (LOC486669), mRNA
          Length = 598

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 116/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| |  |||||||| || |||||||||||
Sbjct: 438 cttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatggtgac 379

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
                | |||||| ||  |||||||| ||||||||||| ||||||  |||||||||||||
Sbjct: 378 tttccccagcagcttgttgagctcctcgtcgttgcggatggcgagttgcaggtggcgcgg 319

                                
Query: 355 gatgatgcgggtcttcttgtt 375
           |||||| | ||||||||||||
Sbjct: 318 gatgatcctggtcttcttgtt 298



to top

>gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, complete cds
          Length = 1401

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 107/129 (82%)
 Strand = Plus / Plus

                                                                       
Query: 342 gcaggtggcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagct 401
           |||||||||||||||||||||| ||||||||||| ||   ||| |||||||| || ||||
Sbjct: 17  gcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagct 76

                                                                       
Query: 402 caagcacctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagc 461
           | || | ||| || |  |||||||| || ||||| || |||||||| |||||||||| ||
Sbjct: 77  ccaggatctcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgc 136

                    
Query: 462 cgacgcgct 470
           | |||||||
Sbjct: 137 ccacgcgct 145



to top

>ref|XM_551996.1| Anopheles gambiae str. PEST ENSANGP00000029020
           (ENSANGG00000023190), partial mRNA
          Length = 297

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||||||||| ||||||||||| ||
Sbjct: 279 cttcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcac 220

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            ||||  |||||| ||   ||||||| ||||||||||| ||| ||  |||| ||||||||
Sbjct: 219 cccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcgg 160

                    
Query: 355 gatgatgcg 363
           |||||||||
Sbjct: 159 gatgatgcg 151



to top

>gb|M11084.1|SUPHIS2A1 Sea urchin (P.miliaris) late histone H2A-1 late mRNA, complete cds
          Length = 465

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 179/225 (79%)
 Strand = Plus / Minus

                                                                       
Query: 229 ggcggacttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgat 288
           ||||| |||||||||||| || || |  | |||||||||||  || || || || |||||
Sbjct: 404 ggcggtcttcttggggaggaggacagcctggatgttggggaggacaccaccctgagcgat 345

                                                                       
Query: 289 ggtgacgccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtg 348
           |||||| ||  |||| ||| ||  |||||||| |||||||||||| || |   | || ||
Sbjct: 344 ggtgactcctccgagaagcttgttgagctcctcgtcgttgcggacagccaactgaagatg 285

                                                                       
Query: 349 gcgcgggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcac 408
            || |||||||| | | |||||||||| ||   ||||||||||||||||||||| || | 
Sbjct: 284 acgggggatgatcctgctcttcttgttgtcgcgggcggcgttgccggcgagctcgaggat 225

                                                        
Query: 409 ctctgcggcgaggtactcgaggacggcggcgaggtagacaggggc 453
           ||| |||| |||||||||||| ||||| |||||||| || |||||
Sbjct: 224 ctcagcggtgaggtactcgagtacggctgcgaggtacactggggc 180



to top

>gb|M14140.1|SUPH2B2 P.miliaris histone H2A-2.1 gene, complete cds
          Length = 375

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 353 gggatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctct 412
           |||||||| | | |||||||||| ||   ||||||||||||||||||||| || | ||| 
Sbjct: 239 gggatgatcctgctcttcttgttgtcgcgggcggcgttgccggcgagctcgaggatctca 180

                                                    
Query: 413 gcggcgaggtactcgaggacggcggcgaggtagacaggggc 453
           |||| |||||||||||||||||| |||||||| || |||||
Sbjct: 179 gcggtgaggtactcgaggacggctgcgaggtacactggggc 139



to top

>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895),
           mRNA
          Length = 390

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137



to top

>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891),
           mRNA
          Length = 390

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137



to top

>ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427885),
           mRNA
          Length = 918

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 360 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 301

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 300 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 241

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 240 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 181

                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 180 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 137



to top

>ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427881),
           mRNA
          Length = 534

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 504 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 445

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 444 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 385

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 384 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 325

                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 324 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 281



to top

>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA
          Length = 1220

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 1190 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 1131

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
               | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 1130 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 1071

                                                                        
Query: 355  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
            ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 1070 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 1011

                                                        
Query: 415  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
             |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 1010 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 967



to top

>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC417952), mRNA
          Length = 1374

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 178/224 (79%)
 Strand = Plus / Plus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 730 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 789

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 790 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 849

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 850 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 909

                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 910 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 953



to top

>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J
           (LOC632401), mRNA
          Length = 1833

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||| ||||| |  |||||||| || |||||||| ||
Sbjct: 456 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 397

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            | | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 396 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 337

                                                           
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctc 402
           ||||||||| ||||||||||| ||| | || |||||||| || |||||
Sbjct: 336 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 289



to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                        
Query: 235  cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
            ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 5291 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 5232

                                                                        
Query: 295  gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
               | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 5231 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 5172

                                                                        
Query: 355  gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
            ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 5171 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 5112

                                                        
Query: 415  ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
             |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 5111 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 5068



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 119/146 (81%)
 Strand = Plus / Plus

                                                                        
Query: 313  gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
            |||||||| ||||||||||| ||| ||  |||||||||| ||||||||||| ||||||||
Sbjct: 2231 gagctcctcgtcgttgcggatggccagctgcaggtggcgggggatgatgcgcgtcttctt 2290

                                                                        
Query: 373  gttatccttggcggcgttgccggcgagctcaagcacctctgcggcgaggtactcgaggac 432
            ||| ||   ||| |||||||| || ||||| || | ||| || |  |||||||| || ||
Sbjct: 2291 gttgtcgcgggccgcgttgcccgccagctccaggatctcggccgtcaggtactccagcac 2350

                                      
Query: 433  ggcggcgaggtagacaggggcgccgg 458
            ||| || ||||| || ||||||||||
Sbjct: 2351 ggccgccaggtacaccggggcgccgg 2376



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 105/128 (82%), Gaps = 9/128 (7%)
 Strand = Plus / Minus

                                                                           
Query: 432     cggcggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttga 491
               |||||||||||||||| || ||||||  |||||||||||| || ||||| ||||||||||
Sbjct: 7508224 cggcggcgaggtagacgggtgcgccgatgccgacgcgctgcgcatagcgtcccttcttga 7508165

                                                                           
Query: 492     ggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgggtcaccg 551
               ||||||         ||||||||||||||||||| | ||||||  |||| |||| |||||
Sbjct: 7508164 ggtagc---------ggccgacggggaactggagcctggccttgccggagcgggacaccg 7508114

                       
Query: 552     ccttcttc 559
                |||||||
Sbjct: 7508113 gcttcttc 7508106



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 163     cttcttgggggacttggtggc 183
               |||||||||||||||||||||
Sbjct: 7508532 cttcttgggggacttggtggc 7508512



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 133/169 (78%), Gaps = 1/169 (0%)
 Strand = Plus / Minus

                                                                           
Query: 242     gggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacgccggcg 301
               |||||||| || | ||||||||| || | ||| || || || |||||||||||||| || 
Sbjct: 7508467 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 7508408

                                                                           
Query: 302     agcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatg 361
               ||||| || |||||||| | |||||||  ||  || || |||| ||| | ||||||||| 
Sbjct: 7508407 agcag-cttccgagctcatcgtcgttgtagatcgccagcagcacgtgcctcgggatgatc 7508349

                                                                
Query: 362     cgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 410
               ||| | ||||||||  ||   || ||||| ||||||||||| |||||||
Sbjct: 7508348 cggtttttcttgttgccccgcgccgcgttcccggcgagctccagcacct 7508300



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 151      ggcgggggccttcttcttgg 170
                ||||||||||||||||||||
Sbjct: 32130756 ggcgggggccttcttcttgg 32130737



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    cggccgcggcggcggacttc 238
              ||||||||||||||||||||
Sbjct: 377412 cggccgcggcggcggacttc 377393



to top

>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:36202 IMAGE:5055276), complete cds
          Length = 550

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 136/168 (80%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||| ||||| |  |||||||| || |||||||| ||
Sbjct: 412 cttcttgggcagcagcacggcctggatattgggcaggacgccgccctgcgcgatggtcac 353

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
            | | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 352 acggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgagg 293

                                                           
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctc 402
           ||||||||| ||||||||||| ||| | || |||||||| || |||||
Sbjct: 292 gatgatgcgcgtcttcttgttgtccctcgccgcgttgcccgccagctc 245



to top

>dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, complete cds
          Length = 1028

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 691 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 632

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 631 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 572

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 571 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 512

                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 511 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 468



to top

>gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, complete cds
          Length = 740

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 538 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 479

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 478 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 419

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 418 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 359

                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 358 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 315



to top

>gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, complete cds
          Length = 743

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 178/224 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 383 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 324

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 323 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 264

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 263 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccaggatctcggc 204

                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 203 cgtcaggtactccagcacggccgccaggtacaccggggcgccgg 160



to top

>emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0021F22,
             complete sequence
          Length = 181498

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 105/128 (82%), Gaps = 9/128 (7%)
 Strand = Plus / Minus

                                                                         
Query: 432   cggcggcgaggtagacaggggcgccggagccgacgcgctgggcgtagcggcccttcttga 491
             |||||||||||||||| || ||||||  |||||||||||| || ||||| ||||||||||
Sbjct: 30697 cggcggcgaggtagacgggtgcgccgatgccgacgcgctgcgcatagcgtcccttcttga 30638

                                                                         
Query: 492   ggtagcgcccgatgcggccgacggggaactggagaccggccttcacggaccgggtcaccg 551
             ||||||         ||||||||||||||||||| | ||||||  |||| |||| |||||
Sbjct: 30637 ggtagc---------ggccgacggggaactggagcctggccttgccggagcgggacaccg 30587

                     
Query: 552   ccttcttc 559
              |||||||
Sbjct: 30586 gcttcttc 30579



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 163   cttcttgggggacttggtggc 183
             |||||||||||||||||||||
Sbjct: 31005 cttcttgggggacttggtggc 30985



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 133/169 (78%), Gaps = 1/169 (0%)
 Strand = Plus / Minus

                                                                         
Query: 242   gggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgacgccggcg 301
             |||||||| || | ||||||||| || | ||| || || || |||||||||||||| || 
Sbjct: 30940 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 30881

                                                                         
Query: 302   agcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatg 361
             ||||| || |||||||| | |||||||  ||  || || |||| ||| | ||||||||| 
Sbjct: 30880 agcag-cttccgagctcatcgtcgttgtagatcgccagcagcacgtgcctcgggatgatc 30822

                                                              
Query: 362   cgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacct 410
             ||| | ||||||||  ||   || ||||| ||||||||||| |||||||
Sbjct: 30821 cggtttttcttgttgccccgcgccgcgttcccggcgagctccagcacct 30773



to top

>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks
          Length = 1564

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 178/224 (79%)
 Strand = Plus / Plus

                                                                       
Query: 235 cttcttggggagcagaacggagttgatgttggggatcacgccgccgtgggcgatggtgac 294
           ||||||||| ||||| ||||  | ||||||||| | ||| ||||| || |||||||| ||
Sbjct: 286 cttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtcac 345

                                                                       
Query: 295 gccggcgagcagcctgccgagctcctggtcgttgcggacggcgagaagcaggtggcgcgg 354
              | | |||||| ||  |||||||| ||||||||||| ||| ||  |||||||||| ||
Sbjct: 346 cttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgggg 405

                                                                       
Query: 355 gatgatgcgggtcttcttgttatccttggcggcgttgccggcgagctcaagcacctctgc 414
           ||||||||| ||||||||||| ||   ||| |||||||| || ||||| || | ||| ||
Sbjct: 406 gatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgctagctccaggatctcggc 465

                                                       
Query: 415 ggcgaggtactcgaggacggcggcgaggtagacaggggcgccgg 458
            |  |||||||| || ||||| || ||||| || ||||||||||
Sbjct: 466 cgtcaggtactccagcacggccgctaggtacaccggggcgccgg 509



to top

>ref|XM_481315.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 936

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 408 cctctgcggcgaggtactcgaggacggcggcgaggtagacaggggcgccggagccgacgc 467
           |||||||||| |||||| |||||||||| ||||||||||| |||| ||| | ||||||||
Sbjct: 490 cctctgcggcaaggtacccgaggacggcagcgaggtagacgggggtgccagtgccgacgc 431

                                          
Query: 468 gctgggcgtagcggcccttcttgaggtagcg 498
           | || ||||  ||||| |||| |||||||||
Sbjct: 430 gttgcgcgtgccggccgttctcgaggtagcg 400



to top

>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507),
           mRNA
          Length = 846

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||||||
Sbjct: 228 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 169

              
Query: 373 gtt 375
           |||
Sbjct: 168 gtt 166



to top

>ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA
          Length = 390

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

              
Query: 373 gtt 375
           |||
Sbjct: 222 gtt 220



to top

>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA
          Length = 578

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||
Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266

              
Query: 373 gtt 375
           |||
Sbjct: 265 gtt 263



to top

>gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125892
           IMAGE:40031339), complete cds
          Length = 438

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

              
Query: 373 gtt 375
           |||
Sbjct: 222 gtt 220



to top

>gb|BC104199.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125893
           IMAGE:40031340), complete cds
          Length = 438

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223

              
Query: 373 gtt 375
           |||
Sbjct: 222 gtt 220



to top

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

              
Query: 373 gtt 375
           |||
Sbjct: 249 gtt 247



to top

>gb|BC034487.2| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IMAGE:4825623), with
           apparent retained intron
          Length = 2884

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||||||
Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 259

              
Query: 373 gtt 375
           |||
Sbjct: 258 gtt 256



to top

>gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone IMAGE:3582122),
           partial cds
          Length = 543

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||
Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250

              
Query: 373 gtt 375
           |||
Sbjct: 249 gtt 247



to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6
          Length = 269712

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                         
Query: 314    agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
              ||||||| ||||||||||| ||| ||  |||||||||||||||||||||||||||||||
Sbjct: 201255 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttctt 201197



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                          
Query: 314    agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttcttg 373
              ||||||| ||||||||||| ||| ||  ||||||| || |||||||||||||||||||||
Sbjct: 182963 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 183022

                                           
Query: 374    ttatccttggcggcgttgccggcgagctc 402
              || ||   |||||||||||| || |||||
Sbjct: 183023 ttgtcgcgggcggcgttgcccgccagctc 183051



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                          
Query: 313    gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
              |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||| ||||||||
Sbjct: 108456 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 108397

                 
Query: 373    gtt 375
              |||
Sbjct: 108396 gtt 108394



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                               
Query: 342   gcaggtggcgcgggatgatgcgggtcttcttgtt 375
             ||||||||||||||||||||||||||||||||||
Sbjct: 17258 gcaggtggcgcgggatgatgcgggtcttcttgtt 17291



to top

>ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA
          Length = 390

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 313 gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           |||||||| ||||||||||| ||| ||  |||||||||||||||||||||| ||||||||
Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223

              
Query: 373 gtt 375
           |||
Sbjct: 222 gtt 220



to top

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                         
Query: 313   gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
             |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||||||
Sbjct: 56394 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 56335

                
Query: 373   gtt 375
             |||
Sbjct: 56334 gtt 56332



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 77/90 (85%)
 Strand = Plus / Plus

                                                                         
Query: 313   gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
             |||||||| ||||||||||| ||| ||  ||| |||||||||||| ||||||||||||||
Sbjct: 28816 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 28875

                                           
Query: 373   gttatccttggcggcgttgccggcgagctc 402
             ||| ||   |||||||||||| || |||||
Sbjct: 28876 gttgtcgcgggcggcgttgcccgccagctc 28905



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                        
Query: 313  gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
            |||||||| ||||||||||| ||| ||  ||| |||||||||||||||||||||||| ||
Sbjct: 1584 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 1525

               
Query: 373  gtt 375
            |||
Sbjct: 1524 gtt 1522



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                         
Query: 313   gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
             ||||||||  |||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 85961 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 86020

                
Query: 373   gtt 375
             |||
Sbjct: 86021 gtt 86023



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                         
Query: 313   gagctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
             ||||||||  |||||||||| ||| ||  | ||||| |||||||||||||| ||||||||
Sbjct: 79993 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 79934

                
Query: 373   gtt 375
             |||
Sbjct: 79933 gtt 79931



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 506   cggccgacggggaactggagaccggc 531
             ||||| ||||||||||||||||||||
Sbjct: 29009 cggcccacggggaactggagaccggc 29034



to top

>ref|NM_021052.2| Homo sapiens histone 1, H2ae (HIST1H2AE), mRNA
          Length = 564

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 314 agctcctggtcgttgcggacggcgagaagcaggtggcgcgggatgatgcgggtcttctt 372
           ||||||| ||||||||||| ||| ||  |||||||||||||||||||||||||||||||
Sbjct: 336 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttctt 278


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,916,162
Number of Sequences: 3902068
Number of extensions: 3916162
Number of successful extensions: 83356
Number of sequences better than 10.0: 778
Number of HSP's better than 10.0 without gapping: 797
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 77781
Number of HSP's gapped (non-prelim): 5489
length of query: 571
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 548
effective length of database: 17,143,297,704
effective search space: 9394527141792
effective search space used: 9394527141792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top