ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags30a19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X98124.1|HVJIP H.vulgare gene encoding jasmonate-induced pro... 327 3e-86
2ref|XM_636506.1| Dictyostelium discoideum hypothetical protein (... 44 0.55
3gb|AC068051.7| Homo sapiens BAC clone RP11-172J1 from 2, complet... 44 0.55
4emb|AL591848.13| Human DNA sequence from clone RP11-439E19 on ch... 42 2.2
5gb|AC116984.2| Dictyostelium discoideum chromosome 2 map 2567470... 42 2.2
6emb|BX004833.16| Zebrafish DNA sequence from clone DKEY-153J5 in... 42 2.2
7emb|AL772219.7| Zebrafish DNA sequence from clone DKEY-51K10 in ... 42 2.2
8ref|XM_527031.1| PREDICTED: Pan troglodytes protocadherin alpha ... 40 8.6
9ref|XM_527030.1| PREDICTED: Pan troglodytes protocadherin alpha ... 40 8.6
10ref|XM_527029.1| PREDICTED: Pan troglodytes protocadherin alpha ... 40 8.6
11ref|XM_530846.1| PREDICTED: Pan troglodytes LOC462126 (LOC462126... 40 8.6
12ref|XM_517982.1| PREDICTED: Pan troglodytes similar to protocadh... 40 8.6
13ref|NM_053941.1| Rattus norvegicus protocadherin alpha 3 (Pcdha3... 40 8.6
14gb|DP000016.1| Pan troglodytes target 1 genomic scaffold 40 8.6
15gb|AC005609.1| Homo sapiens chromosome 5, BAC clone 203o13 (LBNL... 40 8.6
16gb|BC080863.1| Mus musculus protocadherin alpha 7, mRNA (cDNA cl... 40 8.6
17gb|BC082326.1| Mus musculus protocadherin alpha 1, mRNA (cDNA cl... 40 8.6
18gb|BC061406.1| Xenopus tropicalis mitochondrial outer membrane p... 40 8.6
19gb|AC117748.13| Mus musculus chromosome 5, clone RP24-317A24, co... 40 8.6
20ref|NG_000016.1| Homo sapiens protocadherin alpha cluster (PCDHA... 40 8.6
21ref|NM_009960.1| Mus musculus protocadherin alpha 11 (Pcdha11), ... 40 8.6
22ref|NM_007766.1| Mus musculus protocadherin alpha 4 (Pcdha4), mRNA 40 8.6
23ref|NM_031856.1| Homo sapiens protocadherin alpha 8 (PCDHA8), tr... 40 8.6
24ref|NM_031852.1| Homo sapiens protocadherin alpha 7 (PCDHA7), tr... 40 8.6
25ref|NM_031497.1| Homo sapiens protocadherin alpha 3 (PCDHA3), tr... 40 8.6
26ref|NM_031496.1| Homo sapiens protocadherin alpha 2 (PCDHA2), tr... 40 8.6
27ref|NM_031495.1| Homo sapiens protocadherin alpha 2 (PCDHA2), tr... 40 8.6
28ref|NM_031861.1| Homo sapiens protocadherin alpha 11 (PCDHA11), ... 40 8.6
29ref|NM_031860.1| Homo sapiens protocadherin alpha 10 (PCDHA10), ... 40 8.6
30ref|NM_031859.1| Homo sapiens protocadherin alpha 10 (PCDHA10), ... 40 8.6
31ref|NM_018905.2| Homo sapiens protocadherin alpha 2 (PCDHA2), tr... 40 8.6
32ref|NM_018906.2| Homo sapiens protocadherin alpha 3 (PCDHA3), tr... 40 8.6
33ref|NM_018910.2| Homo sapiens protocadherin alpha 7 (PCDHA7), tr... 40 8.6
34ref|NM_018911.2| Homo sapiens protocadherin alpha 8 (PCDHA8), tr... 40 8.6
35ref|NM_018901.2| Homo sapiens protocadherin alpha 10 (PCDHA10), ... 40 8.6
36ref|NM_018902.3| Homo sapiens protocadherin alpha 11 (PCDHA11), ... 40 8.6
37gb|BC069064.1| Homo sapiens protocadherin alpha 3, mRNA (cDNA cl... 40 8.6
38ref|XR_004408.1| PREDICTED: Mus musculus similar to protocadheri... 40 8.6
39ref|XM_908963.2| PREDICTED: Mus musculus similar to protocadheri... 40 8.6
40ref|XM_908935.2| PREDICTED: Mus musculus similar to protocadheri... 40 8.6
41ref|XM_991191.1| PREDICTED: Mus musculus protocadherin alpha 7 (... 40 8.6
42ref|XM_908840.2| PREDICTED: Mus musculus similar to protocadheri... 40 8.6
43ref|XM_908824.2| PREDICTED: Mus musculus similar to protocadheri... 40 8.6
44ref|XM_908786.2| PREDICTED: Mus musculus similar to protocadheri... 40 8.6
45ref|XM_991056.1| PREDICTED: Mus musculus protocadherin alpha 6 (... 40 8.6
46ref|XM_908751.2| PREDICTED: Mus musculus similar to protocadheri... 40 8.6
47gb|AY302550.1| Human echovirus 26 strain Coronel complete genome 40 8.6
48gb|BC050257.1| Xenopus laevis hypothetical protein MGC53422, mRN... 40 8.6
49gb|BC060211.1| Mus musculus protocadherin alpha 4, mRNA (cDNA cl... 40 8.6
50gb|BC054813.1| Mus musculus protocadherin alpha 6, mRNA (cDNA cl... 40 8.6
51gb|BC104804.1| Homo sapiens protocadherin alpha 9, transcript va... 40 8.6
52gb|BC104802.1| Homo sapiens protocadherin alpha 9, transcript va... 40 8.6
53gb|BC036674.2| Homo sapiens protocadherin alpha 6, transcript va... 40 8.6
54gb|BC003126.1| Homo sapiens protocadherin alpha 2, transcript va... 40 8.6
55emb|AL844892.5| Human DNA sequence from clone RP11-396M20 on chr... 40 8.6
56emb|AL445201.14| Human DNA sequence from clone RP11-358L16 on ch... 40 8.6
57gb|AC144752.3| Pan troglodytes clone CH251-65N5, complete sequence 40 8.6
58emb|AL137157.7| Human DNA sequence from clone RP5-1116C7 on chro... 40 8.6
59gb|AC148205.3| Callicebus moloch clone LB5-314H24, complete sequ... 40 8.6
60gb|BC042887.1| Homo sapiens protocadherin alpha 6, mRNA (cDNA cl... 40 8.6
61gb|BC043441.2| Homo sapiens protocadherin alpha 6, mRNA (cDNA cl... 40 8.6
62gb|AF464178.1| Mus musculus protocadherin gene, exon alpha 4 and... 40 8.6
63gb|AF464180.1| Mus musculus protocadherin mRNA, complete cds 40 8.6
64gb|BC030897.1| Mus musculus, protocadherin alpha 6, clone IMAGE:... 40 8.6
65gb|AC097063.2| Homo sapiens chromosome 1 clone RP11-430H12, comp... 40 8.6
66ref|NM_031849.1| Homo sapiens protocadherin alpha 6 (PCDHA6), tr... 40 8.6
67ref|NM_018909.2| Homo sapiens protocadherin alpha 6 (PCDHA6), tr... 40 8.6
68ref|NM_031848.1| Homo sapiens protocadherin alpha 6 (PCDHA6), tr... 40 8.6
69dbj|AK141960.1| Mus musculus 12 days embryo spinal ganglion cDNA... 40 8.6
70dbj|AK139436.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 8.6
71gb|AC084200.22| Homo sapiens 12q BAC RP11-654D12 (Roswell Park C... 40 8.6
72dbj|AK139318.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 8.6
73dbj|AK149282.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 40 8.6
74ref|NM_007767.1| Mus musculus protocadherin alpha 6 (Pcdha6), mRNA 40 8.6
75ref|NM_054072.1| Mus musculus protocadherin alpha 1 (Pcdha1), mRNA 40 8.6
76ref|NM_009957.1| Mus musculus protocadherin alpha 7 (Pcdha7), mRNA 40 8.6
77ref|NM_009959.1| Mus musculus protocadherin alpha 5 (Pcdha5), mRNA 40 8.6
78ref|NM_009961.1| Mus musculus protocadherin alpha 10 (Pcdha10), ... 40 8.6
79ref|NM_198117.1| Mus musculus protocadherin alpha 2 (Pcdha2), mRNA 40 8.6
80ref|NM_138662.1| Mus musculus protocadherin alpha 3 (Pcdha3), mRNA 40 8.6
81ref|NM_138663.2| Mus musculus protocadherin alpha 12 (Pcdha12), ... 40 8.6
82dbj|AK048980.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 40 8.6
83gb|AC087772.5|AC087772 Genomic Sequence for Mus musculus, clone ... 40 8.6
84dbj|AB176653.1| Macaca fuscata CNRv09 mRNA for Protocadherin alp... 40 8.6
85dbj|AB176651.1| Macaca fuscata CNRv07 mRNA for Protocadherin alp... 40 8.6
86dbj|AB176649.1| Macaca fuscata CNRv05 mRNA for Protocadherin alp... 40 8.6
87dbj|AB176647.1| Macaca fuscata CNRv03 mRNA for Protocadherin alp... 40 8.6
88dbj|AB176646.1| Macaca fuscata CNRv02 mRNA for Protocadherin alp... 40 8.6
89dbj|AK043705.1| Mus musculus 10 days neonate cortex cDNA, RIKEN ... 40 8.6
90gb|AY013765.1| Mus musculus protocadherin alpha 7 mRNA, complete... 40 8.6
91gb|AY013764.1| Mus musculus protocadherin alpha 6 mRNA, complete... 40 8.6
92gb|AY013763.1| Mus musculus protocadherin alpha 5 mRNA, complete... 40 8.6
93gb|AY013762.1| Mus musculus protocadherin alpha 4 mRNA, complete... 40 8.6
94gb|AY013761.1| Mus musculus protocadherin alpha 3 mRNA, complete... 40 8.6
95gb|AY013760.1| Mus musculus protocadherin alpha 2 mRNA, complete... 40 8.6
96gb|AY013759.1| Mus musculus protocadherin alpha 12 mRNA, complet... 40 8.6
97gb|AY013758.1| Mus musculus protocadherin alpha 11 mRNA, complet... 40 8.6
98gb|AY013757.1| Mus musculus protocadherin alpha 10 mRNA, complet... 40 8.6
99gb|AY013756.1| Mus musculus protocadherin alpha 1 mRNA, complete... 40 8.6
100ref|XM_393332.2| PREDICTED: Apis mellifera similar to GH03617p (... 40 8.6
101ref|NM_199504.1| Rattus norvegicus protocadherin alpha 2 (Pcdha2... 40 8.6
102ref|NM_199506.1| Rattus norvegicus protocadherin alpha 6 (Pcdha6... 40 8.6
103gb|AY573980.1| Rattus norvegicus protocadherin alpha 6 (Pcdha6) ... 40 8.6
104gb|AY573977.1| Rattus norvegicus protocadherin alpha 3 (Pcdha3) ... 40 8.6
105gb|AY573976.1| Rattus norvegicus protocadherin alpha 2 (Pcdha2) ... 40 8.6
106gb|AY573972.1| Rattus norvegicus protocadherin alpha 10 (Pcdha10... 40 8.6
107ref|NM_053939.1| Rattus norvegicus protocadherin alpha 10 (Pcdha... 40 8.6
108ref|NM_203794.1| Xenopus tropicalis mitochondrial outer membrane... 40 8.6
109gb|AC020968.3| Mus musculus chromosome 18 clone RP23-193O23, com... 40 8.6
110ref|NM_014005.3| Homo sapiens protocadherin alpha 9 (PCDHA9), tr... 40 8.6
111ref|NM_031857.1| Homo sapiens protocadherin alpha 9 (PCDHA9), tr... 40 8.6
112gb|AC020972.3|AC020972 Mus musculus chromosome 18 clone RP23-6P1... 40 8.6
113gb|AF169694.1|AF169694 Homo sapiens protocadherin alpha 6 altern... 40 8.6
114gb|AF169689.1|AF169689 Homo sapiens protocadherin alpha 10 alter... 40 8.6
115gb|AC008468.6|AC008468 Homo sapiens chromosome 5 clone CTC-365B8... 40 8.6
116dbj|AB113399.1| Rattus norvegicus rCNR gene for cadherin-related... 40 8.6
117dbj|AB113393.1| Rattus norvegicus rCNRv10 mRNA for cadherin-rela... 40 8.6
118dbj|AB113389.1| Rattus norvegicus rCNRv06 mRNA for cadherin-rela... 40 8.6
119dbj|AB113386.1| Rattus norvegicus rCNRv03 mRNA for cadherin-rela... 40 8.6
120dbj|AB113385.1| Rattus norvegicus rCNRv02 mRNA for cadherin-rela... 40 8.6
121dbj|AB002343.1| Homo sapiens mRNA for KIAA0345 gene, partial cds 40 8.6
122dbj|AB114630.1| Mus musculus CNR gene for cadherin-related neuro... 40 8.6
123dbj|AK129120.1| Mus musculus mRNA for mKIAA0345 protein 40 8.6
124dbj|AK102163.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.6
125emb|Z65300.1|HS30F1R H.sapiens CpG island DNA genomic Mse1 fragm... 40 8.6
126emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 8.6
127gb|AC115853.8| Mus musculus chromosome 5, clone RP24-273B9, comp... 40 8.6
128gb|AF152317.1|AF152317 Homo sapiens protocadherin alpha 9 (PCDH-... 40 8.6
129gb|AF152316.1|AF152316 Homo sapiens protocadherin alpha 8 (PCDH-... 40 8.6
130gb|AF152315.1|AF152315 Homo sapiens protocadherin alpha 7 (PCDH-... 40 8.6
131gb|AF152314.1|AF152314 Homo sapiens protocadherin alpha 6 (PCDH-... 40 8.6
132gb|AF152311.1|AF152311 Homo sapiens protocadherin alpha 3 (PCDH-... 40 8.6
133gb|AF152310.1|AF152310 Homo sapiens protocadherin alpha 2 (PCDH-... 40 8.6
134gb|AF152307.1|AF152307 Homo sapiens protocadherin alpha 11 (PCDH... 40 8.6
135gb|AF152306.1|AF152306 Homo sapiens protocadherin alpha 10 (PCDH... 40 8.6
136gb|AF152487.1|AF152487 Homo sapiens protocadherin alpha 9 short ... 40 8.6
137gb|AF152486.1|AF152486 Homo sapiens protocadherin alpha 8 short ... 40 8.6
138gb|AF152485.1|AF152485 Homo sapiens protocadherin alpha 7 short ... 40 8.6
139gb|AF152484.1|AF152484 Homo sapiens protocadherin alpha 6 short ... 40 8.6
140gb|AF152481.1|AF152481 Homo sapiens protocadherin alpha 3 short ... 40 8.6
141gb|AF152480.1|AF152480 Homo sapiens protocadherin alpha 2 short ... 40 8.6
142gb|AF152476.1|AF152476 Homo sapiens protocadherin alpha 11 short... 40 8.6
143gb|AF152475.1|AF152475 Homo sapiens protocadherin alpha 10 short... 40 8.6
144emb|CR762023.2| Xenopus tropicalis finished cDNA, clone TEgg054b02 40 8.6
145gb|AC148186.3| Saimiri boliviensis boliviensis clone CH254-359M1... 40 8.6
146emb|BX005189.9| Mouse DNA sequence from clone RP23-170L24 on chr... 40 8.6
147gb|BC079625.1| Mus musculus cDNA clone IMAGE:30536554, containin... 40 8.6
148gb|DP000019.1| Callicebus moloch target 1 genomic scaffold 40 8.6
149emb|AL732480.12| Mouse DNA sequence from clone RP23-11N21 on chr... 40 8.6
150gb|AC150597.4| Aotus nancymaae clone CH258-191N23, complete sequ... 40 8.6
151emb|AJ007610.1|HSAJ7610 Homo sapiens mRNA for protocadherin alph... 40 8.6
152emb|AJ007609.1|HSAJ7609 Homo sapiens mRNA for protocadherin alph... 40 8.6
153dbj|D86917.1| Mus musculus mRNA for CNR2, complete cds 40 8.6
154dbj|D86916.1| Mus musculus mRNA for CNR1, complete cds 40 8.6
155dbj|AB008182.1| Mus musculus CNR7 mRNA for Cadherin-related neur... 40 8.6
156dbj|AB008181.1| Mus musculus CNR6 mRNA for Cadherin-related neur... 40 8.6
157dbj|AB008180.1| Mus musculus CNR5 mRNA for Cadherin-related neur... 40 8.6
158dbj|AB008179.1| Mus musculus CNR4 mRNA for Cadherin-related neur... 40 8.6
159dbj|AB008178.1| Mus musculus CNR3 mRNA for Cadherin-related neur... 40 8.6

>emb|X98124.1|HVJIP H.vulgare gene encoding jasmonate-induced protein
          Length = 2897

 Score =  327 bits (165), Expect = 3e-86
 Identities = 183/189 (96%)
 Strand = Plus / Minus

                                                                        
Query: 440  accccgttggcaccaatgtaggggacggtccaggagaacaaccaatcgcaggacctgggg 499
            ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||  |
Sbjct: 2584 accccgttgtcaccaatgtagggggcggtccaggagaacaaccaatcgcaggacctgctg 2525

                                                                        
Query: 500  ctggaggggatcttgctacgatacacaacggcaccagctgaaccaaccgcagcaccactt 559
            ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2524 ctggaggggatcttggtacgatacacaacggcaccagctgaaccaaccgcagcaccactt 2465

                                                                        
Query: 560  gggtggacgtggaggaatgcaccccattgcccattctgaatatctgatgggtagggtgta 619
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 2464 gggtggacgtggaggaatgcaccccattgcccattctgaatatctgatgggtagggagta 2405

                     
Query: 620  tcatagata 628
            |||||||||
Sbjct: 2404 tcatagata 2396



to top

>ref|XM_636506.1| Dictyostelium discoideum hypothetical protein (DDB0205985), partial
           mRNA
          Length = 819

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 64  acttgtaaataatataaaatca 85
           ||||||||||||||||||||||
Sbjct: 444 acttgtaaataatataaaatca 465



to top

>gb|AC068051.7| Homo sapiens BAC clone RP11-172J1 from 2, complete sequence
          Length = 122076

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 586   ttgcccattctgaatatctgat 607
             ||||||||||||||||||||||
Sbjct: 72556 ttgcccattctgaatatctgat 72577



to top

>emb|AL591848.13| Human DNA sequence from clone RP11-439E19 on chromosome 1 Contains
            the 3' end of the gene for a novel protein (FLJ32001,
            DKFZp451A152, DKFZp451B077, FLJ00215), a putative novel
            transcript, the gene for CGI-49 protein (FLJ90697), a
            ribosomal protein L35a (RPL35A) pseudogene, a novel gene
            (FLJ12783, FLJ43187), the 3' end of a pseudogene similar
            to part of the kinesin family member 1C (KIF1C) and a CpG
            island, complete sequence
          Length = 144941

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 110  tcttccttgattattcataag 130
            |||||||||||||||||||||
Sbjct: 8124 tcttccttgattattcataag 8144



to top

>gb|AC116984.2| Dictyostelium discoideum chromosome 2 map 2567470-3108875 strain AX4,
            complete sequence
          Length = 541399

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 63   gacttgtaaataatataaaat 83
            |||||||||||||||||||||
Sbjct: 7960 gacttgtaaataatataaaat 7940



to top

>emb|BX004833.16| Zebrafish DNA sequence from clone DKEY-153J5 in linkage group 17,
              complete sequence
          Length = 216190

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 9      tatttatttaggataacagta 29
              |||||||||||||||||||||
Sbjct: 132288 tatttatttaggataacagta 132308



to top

>emb|AL772219.7| Zebrafish DNA sequence from clone DKEY-51K10 in linkage group 17,
             complete sequence
          Length = 117244

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 9     tatttatttaggataacagta 29
             |||||||||||||||||||||
Sbjct: 20565 tatttatttaggataacagta 20585



to top

>ref|XM_527031.1| PREDICTED: Pan troglodytes protocadherin alpha 9 (LOC471653), mRNA
          Length = 5640

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 2549 cgcaggacctggggctggag 2568



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|XM_527030.1| PREDICTED: Pan troglodytes protocadherin alpha 8 (LOC471652), mRNA
          Length = 2409

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|XM_527029.1| PREDICTED: Pan troglodytes protocadherin alpha 3 (LOC471651), mRNA
          Length = 6684

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 4364 cgcaggacctggggctggag 4383



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 1976 cgcaggacctggggctggag 1995



to top

>ref|XM_530846.1| PREDICTED: Pan troglodytes LOC462126 (LOC462126), mRNA
          Length = 581

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 308 cgcaggacctggggctggag 289



to top

>ref|XM_517982.1| PREDICTED: Pan troglodytes similar to protocadherin alpha 7 isoform 2
            precursor; KIAA0345-like 7; ortholog to mouse CNR4
            (LOC462125), mRNA
          Length = 7283

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 4721 cgcaggacctggggctggag 4740



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 2435 cgcaggacctggggctggag 2454



to top

>ref|NM_053941.1| Rattus norvegicus protocadherin alpha 3 (Pcdha3), mRNA
          Length = 5226

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 137 cgcaggacctggggctggag 156



to top

>gb|DP000016.1| Pan troglodytes target 1 genomic scaffold
          Length = 1623484

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 97     tcatttattgtcttcttcct 116
              ||||||||||||||||||||
Sbjct: 976253 tcatttattgtcttcttcct 976272



to top

>gb|AC005609.1| Homo sapiens chromosome 5, BAC clone 203o13 (LBNL H155), complete
             sequence
          Length = 157970

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 96988 cgcaggacctggggctggag 96969



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 90755 cgcaggacctggggctggag 90736



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 63861 cgcaggacctggggctggag 63842



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 57569 cgcaggacctggggctggag 57550



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 50631 cgcaggacctggggctggag 50612



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 43457 cgcaggacctggggctggag 43438



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 35907 cgcaggacctggggctggag 35888



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 22849 cgcaggacctggggctggag 22830



to top

>gb|BC080863.1| Mus musculus protocadherin alpha 7, mRNA (cDNA clone MGC:90581
           IMAGE:30356469), complete cds
          Length = 3882

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 268 cgcaggacctggggctggag 287



to top

>gb|BC082326.1| Mus musculus protocadherin alpha 1, mRNA (cDNA clone MGC:90628
           IMAGE:30356350), complete cds
          Length = 4942

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 250 cgcaggacctggggctggag 269



to top

>gb|BC061406.1| Xenopus tropicalis mitochondrial outer membrane protein TOM40, mRNA
           (cDNA clone MGC:75995 IMAGE:5384501), complete cds
          Length = 1911

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 493 cctggggctggaggggatcttgct 516
           ||||||||||||||||||| ||||
Sbjct: 100 cctggggctggaggggatcctgct 77



to top

>gb|AC117748.13| Mus musculus chromosome 5, clone RP24-317A24, complete sequence
          Length = 180438

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 92    atatctcatttattgtcttc 111
             ||||||||||||||||||||
Sbjct: 37559 atatctcatttattgtcttc 37540



to top

>ref|NG_000016.1| Homo sapiens protocadherin alpha cluster (PCDHA@) on chromosome 5
          Length = 297736

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 135122 cgcaggacctggggctggag 135141



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 122064 cgcaggacctggggctggag 122083



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 114514 cgcaggacctggggctggag 114533



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 107340 cgcaggacctggggctggag 107359



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 100402 cgcaggacctggggctggag 100421



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 94110 cgcaggacctggggctggag 94129



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 67216 cgcaggacctggggctggag 67235



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 60983 cgcaggacctggggctggag 61002



to top

>ref|NM_009960.1| Mus musculus protocadherin alpha 11 (Pcdha11), mRNA
          Length = 5254

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|NM_007766.1| Mus musculus protocadherin alpha 4 (Pcdha4), mRNA
          Length = 5323

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 223 cgcaggacctggggctggag 242



to top

>ref|NM_031856.1| Homo sapiens protocadherin alpha 8 (PCDHA8), transcript variant 2,
           mRNA
          Length = 2445

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|NM_031852.1| Homo sapiens protocadherin alpha 7 (PCDHA7), transcript variant 2,
           mRNA
          Length = 2370

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|NM_031497.1| Homo sapiens protocadherin alpha 3 (PCDHA3), transcript variant 2,
           mRNA
          Length = 2475

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|NM_031496.1| Homo sapiens protocadherin alpha 2 (PCDHA2), transcript variant 3,
           mRNA
          Length = 3070

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 252 cgcaggacctggggctggag 271



to top

>ref|NM_031495.1| Homo sapiens protocadherin alpha 2 (PCDHA2), transcript variant 2,
           mRNA
          Length = 2619

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 252 cgcaggacctggggctggag 271



to top

>ref|NM_031861.1| Homo sapiens protocadherin alpha 11 (PCDHA11), transcript variant 2,
            mRNA
          Length = 3291

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 1004 cgcaggacctggggctggag 1023



to top

>ref|NM_031860.1| Homo sapiens protocadherin alpha 10 (PCDHA10), transcript variant
           3, mRNA
          Length = 4465

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 143 cgcaggacctggggctggag 162



to top

>ref|NM_031859.1| Homo sapiens protocadherin alpha 10 (PCDHA10), transcript variant
           2, mRNA
          Length = 2535

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 143 cgcaggacctggggctggag 162



to top

>ref|NM_018905.2| Homo sapiens protocadherin alpha 2 (PCDHA2), transcript variant 1,
           mRNA
          Length = 5360

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 252 cgcaggacctggggctggag 271



to top

>ref|NM_018906.2| Homo sapiens protocadherin alpha 3 (PCDHA3), transcript variant 1,
           mRNA
          Length = 5260

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|NM_018910.2| Homo sapiens protocadherin alpha 7 (PCDHA7), transcript variant 1,
           mRNA
          Length = 5221

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|NM_018911.2| Homo sapiens protocadherin alpha 8 (PCDHA8), transcript variant 1,
           mRNA
          Length = 5260

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|NM_018901.2| Homo sapiens protocadherin alpha 10 (PCDHA10), transcript variant
           1, mRNA
          Length = 5254

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 143 cgcaggacctggggctggag 162



to top

>ref|NM_018902.3| Homo sapiens protocadherin alpha 11 (PCDHA11), transcript variant 1,
            mRNA
          Length = 6115

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 1004 cgcaggacctggggctggag 1023



to top

>gb|BC069064.1| Homo sapiens protocadherin alpha 3, mRNA (cDNA clone MGC:95338
           IMAGE:7216877), complete cds
          Length = 2475

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|XR_004408.1| PREDICTED: Mus musculus similar to protocadherin alpha 11
           (LOC634268), mRNA
          Length = 905

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 296 cgcaggacctggggctggag 315



to top

>ref|XM_908963.2| PREDICTED: Mus musculus similar to protocadherin alpha 12
           (LOC634282), mRNA
          Length = 2847

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|XM_908935.2| PREDICTED: Mus musculus similar to protocadherin alpha 10
           (LOC634256), mRNA
          Length = 2587

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 300 cgcaggacctggggctggag 319



to top

>ref|XM_991191.1| PREDICTED: Mus musculus protocadherin alpha 7 (Pcdha7), mRNA
          Length = 2618

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 268 cgcaggacctggggctggag 287



to top

>ref|XM_908840.2| PREDICTED: Mus musculus similar to protocadherin alpha 6
           (LOC634185), mRNA
          Length = 2700

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 311 cgcaggacctggggctggag 330



to top

>ref|XM_908824.2| PREDICTED: Mus musculus similar to protocadherin alpha 5
           (LOC634174), mRNA
          Length = 2555

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|XM_908786.2| PREDICTED: Mus musculus similar to protocadherin alpha 3
           (LOC634146), mRNA
          Length = 2510

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 256 cgcaggacctggggctggag 275



to top

>ref|XM_991056.1| PREDICTED: Mus musculus protocadherin alpha 6 (Pcdha6), mRNA
          Length = 2611

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 330 cgcaggacctggggctggag 349



to top

>ref|XM_908751.2| PREDICTED: Mus musculus similar to protocadherin alpha 1
           (LOC634119), mRNA
          Length = 2564

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 265 cgcaggacctggggctggag 284



to top

>gb|AY302550.1| Human echovirus 26 strain Coronel complete genome
          Length = 7424

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 58   caaacgacttgtaaataatataaa 81
            ||||| ||||||||||||||||||
Sbjct: 5308 caaacaacttgtaaataatataaa 5285



to top

>gb|BC050257.1| Xenopus laevis hypothetical protein MGC53422, mRNA (cDNA clone
           MGC:53422 IMAGE:5571768), complete cds
          Length = 2459

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 493 cctggggctggaggggatcttgct 516
           ||||||||||||||||||| ||||
Sbjct: 78  cctggggctggaggggatcctgct 55



to top

>gb|BC060211.1| Mus musculus protocadherin alpha 4, mRNA (cDNA clone MGC:64735
           IMAGE:6838078), complete cds
          Length = 4166

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 237 cgcaggacctggggctggag 256



to top

>gb|BC054813.1| Mus musculus protocadherin alpha 6, mRNA (cDNA clone
           IMAGE:6841317), partial cds
          Length = 4337

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 252 cgcaggacctggggctggag 271



to top

>gb|BC104804.1| Homo sapiens protocadherin alpha 9, transcript variant 1, mRNA
           (cDNA clone MGC:132464 IMAGE:8143807), complete cds
          Length = 3023

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 239 cgcaggacctggggctggag 258



to top

>gb|BC104802.1| Homo sapiens protocadherin alpha 9, transcript variant 1, mRNA
           (cDNA clone MGC:132462 IMAGE:8143805), complete cds
          Length = 3023

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 239 cgcaggacctggggctggag 258



to top

>gb|BC036674.2| Homo sapiens protocadherin alpha 6, transcript variant 1, mRNA
           (cDNA clone MGC:33675 IMAGE:5263226), complete cds
          Length = 4666

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 260 cgcaggacctggggctggag 279



to top

>gb|BC003126.1| Homo sapiens protocadherin alpha 2, transcript variant 3, mRNA
           (cDNA clone MGC:3223 IMAGE:3503666), complete cds
          Length = 3070

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 252 cgcaggacctggggctggag 271



to top

>emb|AL844892.5| Human DNA sequence from clone RP11-396M20 on chromosome 10 Contains the
             5' end of the GRID1 gene for glutamate receptor
             (ionotropic) delta 1, the 3' end of the gene for  friend
             of EBNA2 (FOE) (KIAA0261) and five CpG islands, complete
             sequence
          Length = 167780

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    aaataatataaaatcacaca 89
             ||||||||||||||||||||
Sbjct: 75191 aaataatataaaatcacaca 75210



to top

>emb|AL445201.14| Human DNA sequence from clone RP11-358L16 on chromosome 10 Contains a
            AFR GTPase-activating protein (MRIP2) pseudogene, a novel
            gene, gene LOC93550, the 3' end of a KIAA0592 pseudogene
            and three CpG islands, complete sequence
          Length = 179193

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 331  atagtttttatcagtagagt 350
            ||||||||||||||||||||
Sbjct: 8874 atagtttttatcagtagagt 8893



to top

>gb|AC144752.3| Pan troglodytes clone CH251-65N5, complete sequence
          Length = 113988

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    tcatttattgtcttcttcct 116
             ||||||||||||||||||||
Sbjct: 76506 tcatttattgtcttcttcct 76525



to top

>emb|AL137157.7| Human DNA sequence from clone RP5-1116C7 on chromosome 1q24.1-25.1
             Contains part of the DNM3 gene for dynamin 3, complete
             sequence
          Length = 109347

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   tgtcttcttccttgattatt 124
             ||||||||||||||||||||
Sbjct: 98366 tgtcttcttccttgattatt 98385



to top

>gb|AC148205.3| Callicebus moloch clone LB5-314H24, complete sequence
          Length = 153386

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 97     tcatttattgtcttcttcct 116
              ||||||||||||||||||||
Sbjct: 112634 tcatttattgtcttcttcct 112653



to top

>gb|BC042887.1| Homo sapiens protocadherin alpha 6, mRNA (cDNA clone IMAGE:4822690)
          Length = 1748

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 1332 cgcaggacctggggctggag 1313



to top

>gb|BC043441.2| Homo sapiens protocadherin alpha 6, mRNA (cDNA clone IMAGE:5297539)
          Length = 3092

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 1880 cgcaggacctggggctggag 1861



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 1120 cgcaggacctggggctggag 1101



to top

>gb|AF464178.1| Mus musculus protocadherin gene, exon alpha 4 and partial cds
          Length = 3391

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 638 cgcaggacctggggctggag 657



to top

>gb|AF464180.1| Mus musculus protocadherin mRNA, complete cds
          Length = 2856

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 171 cgcaggacctggggctggag 190



to top

>gb|BC030897.1| Mus musculus, protocadherin alpha 6, clone IMAGE:4502027, mRNA
          Length = 2891

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 259 cgcaggacctggggctggag 278



to top

>gb|AC097063.2| Homo sapiens chromosome 1 clone RP11-430H12, complete sequence
          Length = 183086

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 10     atttatttaggataacagta 29
              ||||||||||||||||||||
Sbjct: 125790 atttatttaggataacagta 125771



to top

>ref|NM_031849.1| Homo sapiens protocadherin alpha 6 (PCDHA6), transcript variant 3,
           mRNA
          Length = 4495

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 173 cgcaggacctggggctggag 192



to top

>ref|NM_018909.2| Homo sapiens protocadherin alpha 6 (PCDHA6), transcript variant 1,
           mRNA
          Length = 5287

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 173 cgcaggacctggggctggag 192



to top

>ref|NM_031848.1| Homo sapiens protocadherin alpha 6 (PCDHA6), transcript variant 2,
           mRNA
          Length = 2439

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 173 cgcaggacctggggctggag 192



to top

>dbj|AK141960.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
           enriched library, clone:D130075J08 product:protocadherin
           alpha 11, full insert sequence
          Length = 3324

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 293 cgcaggacctggggctggag 312



to top

>dbj|AK139436.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length
           enriched library, clone:A830082M15 product:protocadherin
           alpha 11, full insert sequence
          Length = 4040

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 292 cgcaggacctggggctggag 311



to top

>gb|AC084200.22| Homo sapiens 12q BAC RP11-654D12 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 191886

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 86     cacatgatatctcatttatt 105
              ||||||||||||||||||||
Sbjct: 139418 cacatgatatctcatttatt 139399



to top

>dbj|AK139318.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched
            library, clone:A830007O22 product:protocadherin alpha 11,
            full insert sequence
          Length = 4969

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 2835 cgcaggacctggggctggag 2816



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 306 cgcaggacctggggctggag 287



to top

>dbj|AK149282.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library,
           clone:A930010F15 product:protocadherin alpha 4, full
           insert sequence
          Length = 2876

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 265 cgcaggacctggggctggag 284



to top

>ref|NM_007767.1| Mus musculus protocadherin alpha 6 (Pcdha6), mRNA
          Length = 5369

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 272 cgcaggacctggggctggag 291



to top

>ref|NM_054072.1| Mus musculus protocadherin alpha 1 (Pcdha1), mRNA
          Length = 5248

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 149 cgcaggacctggggctggag 168



to top

>ref|NM_009957.1| Mus musculus protocadherin alpha 7 (Pcdha7), mRNA
          Length = 5215

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|NM_009959.1| Mus musculus protocadherin alpha 5 (Pcdha5), mRNA
          Length = 5206

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|NM_009961.1| Mus musculus protocadherin alpha 10 (Pcdha10), mRNA
          Length = 5242

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 149 cgcaggacctggggctggag 168



to top

>ref|NM_198117.1| Mus musculus protocadherin alpha 2 (Pcdha2), mRNA
          Length = 5248

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|NM_138662.1| Mus musculus protocadherin alpha 3 (Pcdha3), mRNA
          Length = 5230

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 137 cgcaggacctggggctggag 156



to top

>ref|NM_138663.2| Mus musculus protocadherin alpha 12 (Pcdha12), mRNA
          Length = 5254

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>dbj|AK048980.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230087K19 product:protocadherin
           alpha 4, full insert sequence
          Length = 2894

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 254 cgcaggacctggggctggag 273



to top

>gb|AC087772.5|AC087772 Genomic Sequence for Mus musculus, clone RP23-326L17, complete sequence
          Length = 218905

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 218788 cgcaggacctggggctggag 218807



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 212220 cgcaggacctggggctggag 212239



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 205340 cgcaggacctggggctggag 205359



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 196310 cgcaggacctggggctggag 196329



to top

>dbj|AB176653.1| Macaca fuscata CNRv09 mRNA for Protocadherin alpha, complete cds
          Length = 3162

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>dbj|AB176651.1| Macaca fuscata CNRv07 mRNA for Protocadherin alpha, complete cds
          Length = 3123

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>dbj|AB176649.1| Macaca fuscata CNRv05 mRNA for Protocadherin alpha, complete cds
          Length = 3120

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 143 cgcaggacctggggctggag 162



to top

>dbj|AB176647.1| Macaca fuscata CNRv03 mRNA for Protocadherin alpha, complete cds
          Length = 3168

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 152 cgcaggacctggggctggag 171



to top

>dbj|AB176646.1| Macaca fuscata CNRv02 mRNA for Protocadherin alpha, complete cds
          Length = 3156

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>dbj|AK043705.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length
           enriched library, clone:A830022B16 product:protocadherin
           alpha 11, full insert sequence
          Length = 2878

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 254 cgcaggacctggggctggag 273



to top

>gb|AY013765.1| Mus musculus protocadherin alpha 7 mRNA, complete cds
          Length = 5215

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AY013764.1| Mus musculus protocadherin alpha 6 mRNA, complete cds
          Length = 5242

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AY013763.1| Mus musculus protocadherin alpha 5 mRNA, complete cds
          Length = 5206

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AY013762.1| Mus musculus protocadherin alpha 4 mRNA, complete cds
          Length = 5245

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AY013761.1| Mus musculus protocadherin alpha 3 mRNA, complete cds
          Length = 5230

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 137 cgcaggacctggggctggag 156



to top

>gb|AY013760.1| Mus musculus protocadherin alpha 2 mRNA, complete cds
          Length = 5248

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AY013759.1| Mus musculus protocadherin alpha 12 mRNA, complete cds
          Length = 5254

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AY013758.1| Mus musculus protocadherin alpha 11 mRNA, complete cds
          Length = 5254

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AY013757.1| Mus musculus protocadherin alpha 10 mRNA, complete cds
          Length = 5242

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 149 cgcaggacctggggctggag 168



to top

>gb|AY013756.1| Mus musculus protocadherin alpha 1 mRNA, complete cds
          Length = 5248

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 149 cgcaggacctggggctggag 168



to top

>ref|XM_393332.2| PREDICTED: Apis mellifera similar to GH03617p (LOC409841), mRNA
          Length = 2610

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 317  ttggaaacatatccatagtt 336
            ||||||||||||||||||||
Sbjct: 1857 ttggaaacatatccatagtt 1838



to top

>ref|NM_199504.1| Rattus norvegicus protocadherin alpha 2 (Pcdha2), mRNA
          Length = 5244

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>ref|NM_199506.1| Rattus norvegicus protocadherin alpha 6 (Pcdha6), mRNA
          Length = 5289

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 197 cgcaggacctggggctggag 216



to top

>gb|AY573980.1| Rattus norvegicus protocadherin alpha 6 (Pcdha6) mRNA, complete cds
          Length = 5239

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AY573977.1| Rattus norvegicus protocadherin alpha 3 (Pcdha3) mRNA, complete cds
          Length = 5227

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 137 cgcaggacctggggctggag 156



to top

>gb|AY573976.1| Rattus norvegicus protocadherin alpha 2 (Pcdha2) mRNA, complete cds
          Length = 5245

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AY573972.1| Rattus norvegicus protocadherin alpha 10 (Pcdha10) mRNA, complete
           cds
          Length = 5338

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 236 cgcaggacctggggctggag 255



to top

>ref|NM_053939.1| Rattus norvegicus protocadherin alpha 10 (Pcdha10), mRNA
          Length = 5337

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 236 cgcaggacctggggctggag 255



to top

>ref|NM_203794.1| Xenopus tropicalis mitochondrial outer membrane protein TOM40
           (MGC75995), mRNA
          Length = 1911

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 493 cctggggctggaggggatcttgct 516
           ||||||||||||||||||| ||||
Sbjct: 100 cctggggctggaggggatcctgct 77



to top

>gb|AC020968.3| Mus musculus chromosome 18 clone RP23-193O23, complete sequence
          Length = 199704

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 191727 cgcaggacctggggctggag 191746



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 185594 cgcaggacctggggctggag 185613



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 179426 cgcaggacctggggctggag 179445



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 172110 cgcaggacctggggctggag 172129



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 164436 cgcaggacctggggctggag 164455



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 157868 cgcaggacctggggctggag 157887



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 150988 cgcaggacctggggctggag 151007



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 141958 cgcaggacctggggctggag 141977



to top

>ref|NM_014005.3| Homo sapiens protocadherin alpha 9 (PCDHA9), transcript variant 2,
           mRNA
          Length = 6388

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 870 cgcaggacctggggctggag 889



to top

>ref|NM_031857.1| Homo sapiens protocadherin alpha 9 (PCDHA9), transcript variant 1,
           mRNA
          Length = 5984

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 870 cgcaggacctggggctggag 889



to top

>gb|AC020972.3|AC020972 Mus musculus chromosome 18 clone RP23-6P18, complete sequence
          Length = 218100

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 214841 cgcaggacctggggctggag 214822



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 207167 cgcaggacctggggctggag 207148



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 199851 cgcaggacctggggctggag 199832



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 193683 cgcaggacctggggctggag 193664



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 187550 cgcaggacctggggctggag 187531



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 162284 cgcaggacctggggctggag 162265



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 156749 cgcaggacctggggctggag 156730



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 147377 cgcaggacctggggctggag 147358



to top

>gb|AF169694.1|AF169694 Homo sapiens protocadherin alpha 6 alternate isoform (PCDH-alpha6)
           mRNA, complete cds
          Length = 2231

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 173 cgcaggacctggggctggag 192



to top

>gb|AF169689.1|AF169689 Homo sapiens protocadherin alpha 10 alternate isoform
           (PCDH-alpha10) mRNA, complete cds
          Length = 2201

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 143 cgcaggacctggggctggag 162



to top

>gb|AC008468.6|AC008468 Homo sapiens chromosome 5 clone CTC-365B8, complete sequence
          Length = 117096

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 486    cgcaggacctggggctggag 505
              ||||||||||||||||||||
Sbjct: 114785 cgcaggacctggggctggag 114766



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 87892 cgcaggacctggggctggag 87873



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 81600 cgcaggacctggggctggag 81581



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 74667 cgcaggacctggggctggag 74648



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 67495 cgcaggacctggggctggag 67476



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 59941 cgcaggacctggggctggag 59922



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 46880 cgcaggacctggggctggag 46861



to top

>dbj|AB113399.1| Rattus norvegicus rCNR gene for cadherin-related neuronal receptor,
             exon cluster
          Length = 249555

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 60064 cgcaggacctggggctggag 60083



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 36310 cgcaggacctggggctggag 36329



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 486   cgcaggacctggggctggag 505
             ||||||||||||||||||||
Sbjct: 15296 cgcaggacctggggctggag 15315



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 9132 cgcaggacctggggctggag 9151



to top

>dbj|AB113393.1| Rattus norvegicus rCNRv10 mRNA for cadherin-related neuronal
           receptor 10, complete cds
          Length = 5337

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 236 cgcaggacctggggctggag 255



to top

>dbj|AB113389.1| Rattus norvegicus rCNRv06 mRNA for cadherin-related neuronal
           receptor 6, complete cds
          Length = 5289

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 197 cgcaggacctggggctggag 216



to top

>dbj|AB113386.1| Rattus norvegicus rCNRv03 mRNA for cadherin-related neuronal
           receptor 3, complete cds
          Length = 5226

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 137 cgcaggacctggggctggag 156



to top

>dbj|AB113385.1| Rattus norvegicus rCNRv02 mRNA for cadherin-related neuronal
           receptor 2, complete cds
          Length = 5244

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>dbj|AB002343.1| Homo sapiens mRNA for KIAA0345 gene, partial cds
          Length = 6387

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 870 cgcaggacctggggctggag 889



to top

>dbj|AB114630.1| Mus musculus CNR gene for cadherin-related neuronal receptor,
            complete cds
          Length = 10521

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 4185 cgcaggacctggggctggag 4204



to top

>dbj|AK129120.1| Mus musculus mRNA for mKIAA0345 protein
          Length = 4568

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 239 cgcaggacctggggctggag 258



to top

>dbj|AK102163.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086H01, full
           insert sequence
          Length = 1467

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Plus

                                           
Query: 353 agatctgaatttgcaagcttcacaccatagat 384
           ||||||||| ||||||| ||||||||||||||
Sbjct: 245 agatctgaaattgcaag-ttcacaccatagat 275



to top

>emb|Z65300.1|HS30F1R H.sapiens CpG island DNA genomic Mse1 fragment, clone 30f1, reverse
           read cpg30f1.rt1a
          Length = 255

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 198 cgcaggacctggggctggag 217



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 488     caggacctggggctggaggg 507
               ||||||||||||||||||||
Sbjct: 3547912 caggacctggggctggaggg 3547893



to top

>gb|AC115853.8| Mus musculus chromosome 5, clone RP24-273B9, complete sequence
          Length = 188562

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 107    tcttcttccttgattattca 126
              ||||||||||||||||||||
Sbjct: 128567 tcttcttccttgattattca 128586



to top

>gb|AF152317.1|AF152317 Homo sapiens protocadherin alpha 9 (PCDH-alpha9) mRNA, complete cds
          Length = 5260

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152316.1|AF152316 Homo sapiens protocadherin alpha 8 (PCDH-alpha8) mRNA, complete cds
          Length = 5260

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152315.1|AF152315 Homo sapiens protocadherin alpha 7 (PCDH-alpha7) mRNA, complete cds
          Length = 5221

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152314.1|AF152314 Homo sapiens protocadherin alpha 6 (PCDH-alpha6) mRNA, complete cds
          Length = 5260

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152311.1|AF152311 Homo sapiens protocadherin alpha 3 (PCDH-alpha3) mRNA, complete cds
          Length = 5260

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152310.1|AF152310 Homo sapiens protocadherin alpha 2 (PCDH-alpha2) mRNA, complete cds
          Length = 5254

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152307.1|AF152307 Homo sapiens protocadherin alpha 11 (PCDH-alpha11) mRNA, complete
           cds
          Length = 5257

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152306.1|AF152306 Homo sapiens protocadherin alpha 10 (PCDH-alpha10) mRNA, complete
           cds
          Length = 5254

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 143 cgcaggacctggggctggag 162



to top

>gb|AF152487.1|AF152487 Homo sapiens protocadherin alpha 9 short form protein (PCDH-alpha9)
           variable region sequence, complete cds
          Length = 2529

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152486.1|AF152486 Homo sapiens protocadherin alpha 8 short form protein (PCDH-alpha8)
           variable region sequence, complete cds
          Length = 2445

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152485.1|AF152485 Homo sapiens protocadherin alpha 7 short form protein (PCDH-alpha7)
           variable region sequence, complete cds
          Length = 2370

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152484.1|AF152484 Homo sapiens protocadherin alpha 6 short form protein (PCDH-alpha6)
           variable region sequence, complete cds
          Length = 2412

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152481.1|AF152481 Homo sapiens protocadherin alpha 3 short form protein (PCDH-alpha3)
           variable region sequence, complete cds
          Length = 2475

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152480.1|AF152480 Homo sapiens protocadherin alpha 2 short form protein (PCDH-alpha2)
           variable region sequence, complete cds
          Length = 2513

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152476.1|AF152476 Homo sapiens protocadherin alpha 11 short form protein
           (PCDH-alpha11) variable region sequence, complete cds
          Length = 2433

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 146 cgcaggacctggggctggag 165



to top

>gb|AF152475.1|AF152475 Homo sapiens protocadherin alpha 10 short form protein
           (PCDH-alpha10) variable region sequence, complete cds
          Length = 2535

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 143 cgcaggacctggggctggag 162



to top

>emb|CR762023.2| Xenopus tropicalis finished cDNA, clone TEgg054b02
          Length = 1215

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 493 cctggggctggaggggatcttgct 516
           ||||||||||||||||||| ||||
Sbjct: 75  cctggggctggaggggatcctgct 52



to top

>gb|AC148186.3| Saimiri boliviensis boliviensis clone CH254-359M10, complete sequence
          Length = 189199

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 97     tcatttattgtcttcttcct 116
              ||||||||||||||||||||
Sbjct: 111058 tcatttattgtcttcttcct 111077



to top

>emb|BX005189.9| Mouse DNA sequence from clone RP23-170L24 on chromosome X, complete
              sequence
          Length = 206372

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 349    gttgagatctgaatttgcaa 368
              ||||||||||||||||||||
Sbjct: 122017 gttgagatctgaatttgcaa 121998



to top

>gb|BC079625.1| Mus musculus cDNA clone IMAGE:30536554, containing frame-shift
           errors
          Length = 4877

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 266 cgcaggacctggggctggag 285



to top

>gb|DP000019.1| Callicebus moloch target 1 genomic scaffold
          Length = 2105003

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 97      tcatttattgtcttcttcct 116
               ||||||||||||||||||||
Sbjct: 1027186 tcatttattgtcttcttcct 1027205



to top

>emb|AL732480.12| Mouse DNA sequence from clone RP23-11N21 on chromosome 4, complete
             sequence
          Length = 209063

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    ttgtaaataatataaaatca 85
             ||||||||||||||||||||
Sbjct: 70574 ttgtaaataatataaaatca 70593



to top

>gb|AC150597.4| Aotus nancymaae clone CH258-191N23, complete sequence
          Length = 97432

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    tcatttattgtcttcttcct 116
             ||||||||||||||||||||
Sbjct: 71615 tcatttattgtcttcttcct 71634



to top

>emb|AJ007610.1|HSAJ7610 Homo sapiens mRNA for protocadherin alpha 9 (PCDHA9 gene)
          Length = 4020

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 1181 cgcaggacctggggctggag 1200



to top

>emb|AJ007609.1|HSAJ7609 Homo sapiens mRNA for protocadherin alpha 11 (PCDHA11 gene)
          Length = 3856

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 486  cgcaggacctggggctggag 505
            ||||||||||||||||||||
Sbjct: 1003 cgcaggacctggggctggag 1022



to top

>dbj|D86917.1| Mus musculus mRNA for CNR2, complete cds
          Length = 5369

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 272 cgcaggacctggggctggag 291



to top

>dbj|D86916.1| Mus musculus mRNA for CNR1, complete cds
          Length = 5323

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 223 cgcaggacctggggctggag 242



to top

>dbj|AB008182.1| Mus musculus CNR7 mRNA for Cadherin-related neural recepter 7,
           partial cds
          Length = 2746

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 39  cgcaggacctggggctggag 58



to top

>dbj|AB008181.1| Mus musculus CNR6 mRNA for Cadherin-related neural recepter 6,
           partial cds
          Length = 2698

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 39  cgcaggacctggggctggag 58



to top

>dbj|AB008180.1| Mus musculus CNR5 mRNA for Cadherin-related neural recepter 5,
           partial cds
          Length = 2746

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 39  cgcaggacctggggctggag 58



to top

>dbj|AB008179.1| Mus musculus CNR4 mRNA for Cadherin-related neural recepter 4,
           partial cds
          Length = 2707

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 39  cgcaggacctggggctggag 58



to top

>dbj|AB008178.1| Mus musculus CNR3 mRNA for Cadherin-related neural recepter 3,
           partial cds
          Length = 2731

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 486 cgcaggacctggggctggag 505
           ||||||||||||||||||||
Sbjct: 39  cgcaggacctggggctggag 58


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,591,046
Number of Sequences: 3902068
Number of extensions: 5591046
Number of successful extensions: 151525
Number of sequences better than 10.0: 159
Number of HSP's better than 10.0 without gapping: 158
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 151196
Number of HSP's gapped (non-prelim): 330
length of query: 628
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 605
effective length of database: 17,143,297,704
effective search space: 10371695110920
effective search space used: 10371695110920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top