ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags30a02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP001803.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 0.43
2gb|AC120555.9| Mus musculus chromosome 12, clone RP24-311D18, co... 38 6.7
3ref|XM_451494.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A11374g ... 38 6.7
4gb|AC124826.8| Mus musculus chromosome 12, clone RP23-455F18, co... 38 6.7
5gb|AC124607.4| Mus musculus BAC clone RP23-84H10 from chromosome... 38 6.7
6gb|AC146608.2| Mus musculus BAC clone RP23-159D24 from chromosom... 38 6.7
7gb|AC184714.1| Macaca mulatta clone CH250-396P23 map human ortho... 38 6.7
8gb|AC184713.1| Macaca mulatta clone CH250-569D9 map human orthol... 38 6.7
9gb|AC184712.1| Macaca mulatta clone CH250-14G4 map human ortholo... 38 6.7
10gb|AC184711.1| Macaca mulatta clone CH250-63N16 map human orthol... 38 6.7
11emb|CR382121.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 38 6.7
12emb|AL645809.8| Mouse DNA sequence from clone RP23-402D13 on chr... 38 6.7
13gb|AC007289.9| Arabidopsis thaliana chromosome 2 clone F16J10 ma... 38 6.7
14gb|AC006220.4| Arabidopsis thaliana chromosome 2 clone T20G20 ma... 38 6.7
15gb|AC160763.3| Mus musculus BAC clone RP23-238A4 from chromosome... 38 6.7
16gb|AC018680.4|AC018680 Homo sapiens BAC clone RP11-384E2 from 4,... 38 6.7
17gb|AC005476.4|AC005476 Homo sapiens PAC clone RP1-261D10 from 14... 38 6.7
18gb|AC154561.2| Mus musculus BAC clone RP23-400M17 from chromosom... 38 6.7
19gb|AC154904.4| Mus musculus BAC clone RP23-416C3 from chromosome... 38 6.7
20gb|AC016697.8| Homo sapiens BAC clone RP11-140C4 from 2, complet... 38 6.7
21gb|AC006572.2|AC006572 Homo sapiens, clone hRPK.60_A_1, complete... 38 6.7
22dbj|AP000919.6| Homo sapiens genomic DNA, chromosome 18 clone:RP... 38 6.7
23dbj|AP005431.3| Homo sapiens genomic DNA, chromosome 18 clone:RP... 38 6.7

>dbj|AP001803.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-100N3, complete
             sequences
          Length = 159372

 Score = 42.1 bits (21), Expect = 0.43
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 93    cacaaatgaccatatatttga 113
             |||||||||||||||||||||
Sbjct: 82776 cacaaatgaccatatatttga 82796



to top

>gb|AC120555.9| Mus musculus chromosome 12, clone RP24-311D18, complete sequence
          Length = 164820

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 109    tttgacagcatttcccttc 127
              |||||||||||||||||||
Sbjct: 163956 tttgacagcatttcccttc 163974



to top

>ref|XM_451494.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A11374g predicted mRNA
          Length = 1866

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 97  aatgaccatatatttgaca 115
           |||||||||||||||||||
Sbjct: 211 aatgaccatatatttgaca 229



to top

>gb|AC124826.8| Mus musculus chromosome 12, clone RP23-455F18, complete sequence
          Length = 177979

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 109    tttgacagcatttcccttc 127
              |||||||||||||||||||
Sbjct: 135657 tttgacagcatttcccttc 135639



to top

>gb|AC124607.4| Mus musculus BAC clone RP23-84H10 from chromosome 12, complete sequence
          Length = 168842

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 106    atatttgacagcatttcccttct 128
              ||||||||||| |||||||||||
Sbjct: 117476 atatttgacagtatttcccttct 117498



to top

>gb|AC146608.2| Mus musculus BAC clone RP23-159D24 from chromosome 12, complete sequence
          Length = 173569

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 106    atatttgacagcatttcccttct 128
              ||||||||||| |||||||||||
Sbjct: 112254 atatttgacagtatttcccttct 112232



to top

>gb|AC184714.1| Macaca mulatta clone CH250-396P23 map human ortholog 8p23.1, complete
             sequence
          Length = 174987

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    ccttctgccaaccacagga 53
             |||||||||||||||||||
Sbjct: 39457 ccttctgccaaccacagga 39475



to top

>gb|AC184713.1| Macaca mulatta clone CH250-569D9 map human ortholog 8p23.1, complete
             sequence
          Length = 153308

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    ccttctgccaaccacagga 53
             |||||||||||||||||||
Sbjct: 24890 ccttctgccaaccacagga 24908



to top

>gb|AC184712.1| Macaca mulatta clone CH250-14G4 map human ortholog 8p23.1, complete
             sequence
          Length = 190509

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    ccttctgccaaccacagga 53
             |||||||||||||||||||
Sbjct: 57701 ccttctgccaaccacagga 57719



to top

>gb|AC184711.1| Macaca mulatta clone CH250-63N16 map human ortholog 8p23.1, complete
             sequence
          Length = 200536

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    ccttctgccaaccacagga 53
             |||||||||||||||||||
Sbjct: 72207 ccttctgccaaccacagga 72225



to top

>emb|CR382121.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome A of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1062590

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 97     aatgaccatatatttgaca 115
              |||||||||||||||||||
Sbjct: 987126 aatgaccatatatttgaca 987108



to top

>emb|AL645809.8| Mouse DNA sequence from clone RP23-402D13 on chromosome 11 Contains the
             5' end of the Tisp78 gene for transcript increased in
             spermiogenesis 78, the Epn3 gene for epsin 3, the Mycbpap
             gene for mycbp associated protein, the gene for a novel
             protein (B430319G23Rik), the 5' end of the gene for a
             novel protein (9330162N21Rik) and the Chad gene for
             chondroadherin, complete sequence
          Length = 106815

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 44    aaccacaggactgactgtcaaca 66
             ||||||||||||||||| |||||
Sbjct: 86628 aaccacaggactgactggcaaca 86606



to top

>gb|AC007289.9| Arabidopsis thaliana chromosome 2 clone F16J10 map RNS1, complete
            sequence
          Length = 43982

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 25   aagaatatatccttctgcc 43
            |||||||||||||||||||
Sbjct: 2373 aagaatatatccttctgcc 2355



to top

>gb|AC006220.4| Arabidopsis thaliana chromosome 2 clone T20G20 map m246, complete
              sequence
          Length = 110352

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 25     aagaatatatccttctgcc 43
              |||||||||||||||||||
Sbjct: 107001 aagaatatatccttctgcc 106983



to top

>gb|AC160763.3| Mus musculus BAC clone RP23-238A4 from chromosome 17, complete sequence
          Length = 215626

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    cacaggactgactgtcaac 65
             |||||||||||||||||||
Sbjct: 14484 cacaggactgactgtcaac 14466



to top

>gb|AC018680.4|AC018680 Homo sapiens BAC clone RP11-384E2 from 4, complete sequence
          Length = 181850

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 99     tgaccatatatttgacagcattt 121
              ||||||||||||||||| |||||
Sbjct: 169577 tgaccatatatttgacaacattt 169555



to top

>gb|AC005476.4|AC005476 Homo sapiens PAC clone RP1-261D10 from 14q24.3, complete sequence
          Length = 107731

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 94    acaaatgaccatatatttg 112
             |||||||||||||||||||
Sbjct: 60558 acaaatgaccatatatttg 60540



to top

>gb|AC154561.2| Mus musculus BAC clone RP23-400M17 from chromosome 17, complete
             sequence
          Length = 191047

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    cacaggactgactgtcaac 65
             |||||||||||||||||||
Sbjct: 62219 cacaggactgactgtcaac 62237



to top

>gb|AC154904.4| Mus musculus BAC clone RP23-416C3 from chromosome 12, complete sequence
          Length = 194547

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 106   atatttgacagcatttcccttct 128
             ||||||||||| |||||||||||
Sbjct: 24169 atatttgacagtatttcccttct 24191



to top

>gb|AC016697.8| Homo sapiens BAC clone RP11-140C4 from 2, complete sequence
          Length = 163489

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 31     atatccttctgccaaccac 49
              |||||||||||||||||||
Sbjct: 132473 atatccttctgccaaccac 132455



to top

>gb|AC006572.2|AC006572 Homo sapiens, clone hRPK.60_A_1, complete sequence
          Length = 179691

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 99   tgaccatatatttgacagcattt 121
            ||||||||||||||||| |||||
Sbjct: 3891 tgaccatatatttgacaacattt 3869



to top

>dbj|AP000919.6| Homo sapiens genomic DNA, chromosome 18 clone:RP11-737O24, complete
              sequence
          Length = 184440

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 42     ccaaccacaggactgactg 60
              |||||||||||||||||||
Sbjct: 143164 ccaaccacaggactgactg 143182



to top

>dbj|AP005431.3| Homo sapiens genomic DNA, chromosome 18 clone:RP11-193E15, complete
             sequence
          Length = 177785

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 42    ccaaccacaggactgactg 60
             |||||||||||||||||||
Sbjct: 19241 ccaaccacaggactgactg 19259


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 879,866
Number of Sequences: 3902068
Number of extensions: 879866
Number of successful extensions: 55159
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55125
Number of HSP's gapped (non-prelim): 34
length of query: 140
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 119
effective length of database: 17,151,101,840
effective search space: 2040981118960
effective search space used: 2040981118960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top