ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags29k22 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY123418.1| Triticum aestivum putative ribosomal protein S18 mRNA, complete cds Length = 868 Score = 186 bits (94), Expect = 5e-44 Identities = 142/158 (89%) Strand = Plus / Minus Query: 411 ggcttgggcacggggccgtagtccgggtgtggctggggcttgggctccggcttcggcggc 470 ||||||||||||||| ||||| || || ||||||||||||||||||||||| |||||| Sbjct: 191 ggcttgggcacggggtgatagtcaggatggggctggggcttgggctccggcttgggcggc 132 Query: 471 acgggcttcttatggtggaagtgctccatgatgtgtttcttgatgggcccgcacagggtc 530 ||||||| ||| |||||||| ||||| |||||||| |||||||| |||||||||| |||| Sbjct: 131 acgggctgcttgtggtggaaatgctcgatgatgtgcttcttgatcggcccgcacaaggtc 72 Query: 531 atggacgcgcactccggcgacgctgcagacggcgtggc 568 |||||||||||||| ||||||||||||||| ||||||| Sbjct: 71 atggacgcgcactctggcgacgctgcagaccgcgtggc 34 Score = 48.1 bits (24), Expect = 0.032 Identities = 42/48 (87%) Strand = Plus / Minus Query: 372 acggggtggtagtccgggtggggttgcggcttgggctcgggcttgggc 419 |||||||| ||||| || ||||| || ||||||||||| ||||||||| Sbjct: 182 acggggtgatagtcaggatggggctggggcttgggctccggcttgggc 135
>ref|NM_194867.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.15), mRNA Length = 690 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttctt 481 ||||||||||| ||||| ||||||||||||||||| Sbjct: 617 ggcttgggctctggcttgggcggcacgggcttctt 583 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 644 tgcggcttgggctctggcttgggc 621
>ref|NM_194865.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.13), mRNA Length = 690 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 |||||||| ||||||||||| ||||| |||||||||||| ||||| || ||||| | Sbjct: 494 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 438 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 437 ttcttgatggggccgca 421
>gb|AC084884.2| Oryza sativa chromosome 10 clone OSJNBa0031A07, complete sequence Length = 134553 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttctt 481 ||||||||||| ||||| ||||||||||||||||| Sbjct: 99838 ggcttgggctctggcttgggcggcacgggcttctt 99804 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 |||||||| ||||||||||| ||||| |||||||||||| ||||| || ||||| | Sbjct: 85009 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 84953 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 84952 ttcttgatggggccgca 84936 Score = 52.0 bits (26), Expect = 0.002 Identities = 79/96 (82%), Gaps = 3/96 (3%) Strand = Plus / Plus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 80710 ggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 80766 Query: 507 ttcttgatgggcccgcacagggtcatggacgcgcac 542 |||||||| || ||||| | ||||| |||||||||| Sbjct: 80767 ttcttgattgggccgcagatggtcacggacgcgcac 80802 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 89042 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 88986 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 88985 ttcttgatgggaccgca 88969 Score = 44.1 bits (22), Expect = 0.50 Identities = 64/78 (82%) Strand = Plus / Plus Query: 474 ggcttcttatggtggaagtgctccatgatgtgtttcttgatgggcccgcacagggtcatg 533 ||||| || ||||||||||| || | || ||| |||||||||||| |||| | |||| Sbjct: 67173 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgcagatggtcgcc 67232 Query: 534 gacgcgcactccggcgac 551 ||||||||| |||||||| Sbjct: 67233 gacgcgcacaccggcgac 67250 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Plus Query: 441 ggctggggcttgggctccggcttcggcggcacgggcttctt 481 |||| |||||| ||||| ||||| || |||||||||||||| Sbjct: 80581 ggctcgggcttaggctcaggcttgggtggcacgggcttctt 80621 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 99865 tgcggcttgggctctggcttgggc 99842 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 89192 tgcggcttgggctctggcttgggc 89169 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 tgcggcttgggctcgggctt 415 |||||||||||||||||||| Sbjct: 80572 tgcggcttgggctcgggctt 80591
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttctt 481 ||||||||||| ||||| ||||||||||||||||| Sbjct: 3011416 ggcttgggctctggcttgggcggcacgggcttctt 3011382 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 |||||||| ||||||||||| ||||| |||||||||||| ||||| || ||||| | Sbjct: 2996587 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 2996531 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 2996530 ttcttgatggggccgca 2996514 Score = 52.0 bits (26), Expect = 0.002 Identities = 79/96 (82%), Gaps = 3/96 (3%) Strand = Plus / Plus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 2992288 ggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 2992344 Query: 507 ttcttgatgggcccgcacagggtcatggacgcgcac 542 |||||||| || ||||| | ||||| |||||||||| Sbjct: 2992345 ttcttgattgggccgcagatggtcacggacgcgcac 2992380 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 3000620 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 3000564 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 3000563 ttcttgatgggaccgca 3000547 Score = 44.1 bits (22), Expect = 0.50 Identities = 64/78 (82%) Strand = Plus / Plus Query: 474 ggcttcttatggtggaagtgctccatgatgtgtttcttgatgggcccgcacagggtcatg 533 ||||| || ||||||||||| || | || ||| |||||||||||| |||| | |||| Sbjct: 2978751 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgcagatggtcgcc 2978810 Query: 534 gacgcgcactccggcgac 551 ||||||||| |||||||| Sbjct: 2978811 gacgcgcacaccggcgac 2978828 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 22669859 ccgccgccaccgccaccgccg 22669839 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 16254463 ccgccgccaccgccaccgccg 16254443 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 14282494 ccgccgccaccgccaccgccg 14282514 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 13342446 ccgccgccaccgccaccgccg 13342426 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 4342610 ccgccgccaccgccaccgccg 4342590 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 4129167 ccgccgccaccgccaccgccg 4129187 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Plus Query: 441 ggctggggcttgggctccggcttcggcggcacgggcttctt 481 |||| |||||| ||||| ||||| || |||||||||||||| Sbjct: 2992159 ggctcgggcttaggctcaggcttgggtggcacgggcttctt 2992199 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 22310111 ccgccgccaccgccaccgcc 22310092 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 cgccgccaccgccaccgccg 353 |||||||||||||||||||| Sbjct: 20120407 cgccgccaccgccaccgccg 20120388 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 17867563 ccgccgccaccgccaccgcc 17867544 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 15466265 ccgccgccaccgccaccgcc 15466284 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 14936973 ccgccgccaccgccaccgcc 14936954 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 3011443 tgcggcttgggctctggcttgggc 3011420 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 3000770 tgcggcttgggctctggcttgggc 3000747 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 tgcggcttgggctcgggctt 415 |||||||||||||||||||| Sbjct: 2992150 tgcggcttgggctcgggctt 2992169
>dbj|AK104542.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-305-B03, full insert sequence Length = 1008 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 |||||||| ||||||||||| ||||| |||||||||||| ||||| || ||||| | Sbjct: 539 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 483 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 482 ttcttgatggggccgca 466
>dbj|AK104257.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F02, full insert sequence Length = 1010 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 |||||||| ||||||||||| ||||| |||||||||||| ||||| || ||||| | Sbjct: 542 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 486 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 485 ttcttgatggggccgca 469
>dbj|AK072923.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023146D17, full insert sequence Length = 1015 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 |||||||| ||||||||||| ||||| |||||||||||| ||||| || ||||| | Sbjct: 546 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 490 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 489 ttcttgatggggccgca 473
>dbj|AK062795.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-C07, full insert sequence Length = 862 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttctt 481 ||||||||||| ||||| ||||||||||||||||| Sbjct: 660 ggcttgggctctggcttgggcggcacgggcttctt 626 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 687 tgcggcttgggctctggcttgggc 664
>dbj|AK061576.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-G10, full insert sequence Length = 1011 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 |||||||| ||||||||||| ||||| |||||||||||| ||||| || ||||| | Sbjct: 542 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 486 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 485 ttcttgatggggccgca 469
>dbj|AK061299.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-E05, full insert sequence Length = 928 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttctt 481 ||||||||||| ||||| ||||||||||||||||| Sbjct: 674 ggcttgggctctggcttgggcggcacgggcttctt 640 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 701 tgcggcttgggctctggcttgggc 678
>dbj|AK058887.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-C09, full insert sequence Length = 1011 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 |||||||| ||||||||||| ||||| |||||||||||| ||||| || ||||| | Sbjct: 542 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 486 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 485 ttcttgatggggccgca 469
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttctt 481 ||||||||||| ||||| ||||||||||||||||| Sbjct: 3011337 ggcttgggctctggcttgggcggcacgggcttctt 3011303 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 |||||||| ||||||||||| ||||| |||||||||||| ||||| || ||||| | Sbjct: 2996508 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 2996452 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 2996451 ttcttgatggggccgca 2996435 Score = 52.0 bits (26), Expect = 0.002 Identities = 79/96 (82%), Gaps = 3/96 (3%) Strand = Plus / Plus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 2992209 ggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 2992265 Query: 507 ttcttgatgggcccgcacagggtcatggacgcgcac 542 |||||||| || ||||| | ||||| |||||||||| Sbjct: 2992266 ttcttgattgggccgcagatggtcacggacgcgcac 2992301 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 3000541 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 3000485 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 3000484 ttcttgatgggaccgca 3000468 Score = 44.1 bits (22), Expect = 0.50 Identities = 64/78 (82%) Strand = Plus / Plus Query: 474 ggcttcttatggtggaagtgctccatgatgtgtttcttgatgggcccgcacagggtcatg 533 ||||| || ||||||||||| || | || ||| |||||||||||| |||| | |||| Sbjct: 2978672 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgcagatggtcgcc 2978731 Query: 534 gacgcgcactccggcgac 551 ||||||||| |||||||| Sbjct: 2978732 gacgcgcacaccggcgac 2978749 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 22682327 ccgccgccaccgccaccgccg 22682307 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 16262711 ccgccgccaccgccaccgccg 16262691 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 14290736 ccgccgccaccgccaccgccg 14290756 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 13349786 ccgccgccaccgccaccgccg 13349766 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 4343431 ccgccgccaccgccaccgccg 4343411 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 4129988 ccgccgccaccgccaccgccg 4130008 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Plus Query: 441 ggctggggcttgggctccggcttcggcggcacgggcttctt 481 |||| |||||| ||||| ||||| || |||||||||||||| Sbjct: 2992080 ggctcgggcttaggctcaggcttgggtggcacgggcttctt 2992120 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 22322179 ccgccgccaccgccaccgcc 22322160 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 cgccgccaccgccaccgccg 353 |||||||||||||||||||| Sbjct: 20131683 cgccgccaccgccaccgccg 20131664 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 17876816 ccgccgccaccgccaccgcc 17876797 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 15474506 ccgccgccaccgccaccgcc 15474525 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 14945214 ccgccgccaccgccaccgcc 14945195 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 3011364 tgcggcttgggctctggcttgggc 3011341 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 3000691 tgcggcttgggctctggcttgggc 3000668 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 tgcggcttgggctcgggctt 415 |||||||||||||||||||| Sbjct: 2992071 tgcggcttgggctcgggctt 2992090
>dbj|AB071178.1| Oryza sativa (japonica cultivar-group) OsPRP2 mRNA for proline-rich protein 2, complete cds Length = 828 Score = 54.0 bits (27), Expect = 5e-04 Identities = 65/77 (84%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 |||||||| ||||||||||| ||||| |||||||||||| ||||| || ||||| | Sbjct: 494 ggcttgggatccggcttcggtggcaccggcttcttatgg---aagtggtcgatgatcttc 438 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 437 ttcttgatggggccgca 421
>ref|NM_194864.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.12), mRNA Length = 675 Score = 52.0 bits (26), Expect = 0.002 Identities = 79/96 (82%), Gaps = 3/96 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 494 ggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 438 Query: 507 ttcttgatgggcccgcacagggtcatggacgcgcac 542 |||||||| || ||||| | ||||| |||||||||| Sbjct: 437 ttcttgattgggccgcagatggtcacggacgcgcac 402 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 441 ggctggggcttgggctccggcttcggcggcacgggcttctt 481 |||| |||||| ||||| ||||| || |||||||||||||| Sbjct: 623 ggctcgggcttaggctcaggcttgggtggcacgggcttctt 583 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggctt 415 |||||||||||||||||||| Sbjct: 632 tgcggcttgggctcgggctt 613
>dbj|AK104236.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G04, full insert sequence Length = 963 Score = 52.0 bits (26), Expect = 0.002 Identities = 79/96 (82%), Gaps = 3/96 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 557 ggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 501 Query: 507 ttcttgatgggcccgcacagggtcatggacgcgcac 542 |||||||| || ||||| | ||||| |||||||||| Sbjct: 500 ttcttgattgggccgcagatggtcacggacgcgcac 465 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 441 ggctggggcttgggctccggcttcggcggcacgggcttctt 481 |||| |||||| ||||| ||||| || |||||||||||||| Sbjct: 686 ggctcgggcttaggctcaggcttgggtggcacgggcttctt 646 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggctt 415 |||||||||||||||||||| Sbjct: 695 tgcggcttgggctcgggctt 676
>dbj|AK061529.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-E01, full insert sequence Length = 976 Score = 52.0 bits (26), Expect = 0.002 Identities = 79/96 (82%), Gaps = 3/96 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 557 ggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 501 Query: 507 ttcttgatgggcccgcacagggtcatggacgcgcac 542 |||||||| || ||||| | ||||| |||||||||| Sbjct: 500 ttcttgattgggccgcagatggtcacggacgcgcac 465 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 441 ggctggggcttgggctccggcttcggcggcacgggcttctt 481 |||| |||||| ||||| ||||| || |||||||||||||| Sbjct: 686 ggctcgggcttaggctcaggcttgggtggcacgggcttctt 646 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggctt 415 |||||||||||||||||||| Sbjct: 695 tgcggcttgggctcgggctt 676
>dbj|AK059999.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-G07, full insert sequence Length = 963 Score = 52.0 bits (26), Expect = 0.002 Identities = 79/96 (82%), Gaps = 3/96 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 557 ggctttggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 501 Query: 507 ttcttgatgggcccgcacagggtcatggacgcgcac 542 |||||||| || ||||| | ||||| |||||||||| Sbjct: 500 ttcttgattgggccgcagatggtcacggacgcgcac 465 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 441 ggctggggcttgggctccggcttcggcggcacgggcttctt 481 |||| |||||| ||||| ||||| || |||||||||||||| Sbjct: 686 ggctcgggcttaggctcaggcttgggtggcacgggcttctt 646 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggctt 415 |||||||||||||||||||| Sbjct: 695 tgcggcttgggctcgggctt 676
>gb|AC084043.4|AC084043 Mus musculus 1 BAC RP23-265D16 (Roswell Park Cancer Institute Mouse BAC Library) complete sequence Length = 63324 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgtag 356 |||||||||||||||||||||||| Sbjct: 39638 ccgccgccaccgccaccgccgtag 39661
>gb|AC124989.7| Mus musculus chromosome 1, clone RP24-404O8, complete sequence Length = 184453 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgtag 356 |||||||||||||||||||||||| Sbjct: 121889 ccgccgccaccgccaccgccgtag 121866
>gb|AC115893.10| Mus musculus chromosome 1, clone RP24-442I13, complete sequence Length = 153053 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgtag 356 |||||||||||||||||||||||| Sbjct: 19077 ccgccgccaccgccaccgccgtag 19054
>ref|NM_194866.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.14), mRNA Length = 690 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 494 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 438 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 437 ttcttgatgggaccgca 421 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 644 tgcggcttgggctctggcttgggc 621
>gb|AE014075.1| Escherichia coli CFT073, complete genome Length = 5231428 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 331 atccgccgccaccgccaccgccg 353 ||||||||||||||||||||||| Sbjct: 2276648 atccgccgccaccgccaccgccg 2276670
>gb|CP000243.1| Escherichia coli UTI89, complete genome Length = 5065741 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 331 atccgccgccaccgccaccgccg 353 ||||||||||||||||||||||| Sbjct: 2127822 atccgccgccaccgccaccgccg 2127844
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 398 cggcttgggctcgggcttgggcacggg 424 |||||||||||||||||||||| |||| Sbjct: 3480492 cggcttgggctcgggcttgggctcggg 3480518 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 ggcttgggctcgggcttggg 418 |||||||||||||||||||| Sbjct: 3480505 ggcttgggctcgggcttggg 3480524
>dbj|AK104765.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-H08, full insert sequence Length = 1080 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 498 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>dbj|AK104622.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-H10, full insert sequence Length = 1032 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 498 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>dbj|AK104398.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D05, full insert sequence Length = 1032 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 498 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>dbj|AK104262.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-C07, full insert sequence Length = 1030 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 498 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>dbj|AK104235.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-F12, full insert sequence Length = 972 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 557 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 501 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 500 ttcttgatgggaccgca 484 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 707 tgcggcttgggctctggcttgggc 684
>dbj|AK067147.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098B06, full insert sequence Length = 1032 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 556 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 500 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 499 ttcttgatgggaccgca 483 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 706 tgcggcttgggctctggcttgggc 683
>dbj|AK061567.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F04, full insert sequence Length = 1080 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 498 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>dbj|AK059996.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-F05, full insert sequence Length = 989 Score = 46.1 bits (23), Expect = 0.13 Identities = 64/77 (83%), Gaps = 3/77 (3%) Strand = Plus / Minus Query: 447 ggcttgggctccggcttcggcggcacgggcttcttatggtggaagtgctccatgatgtgt 506 ||||| ||||||||||| || ||||| |||||||| ||||||||| || ||||| | Sbjct: 554 ggcttcggctccggcttgggtggcaccggcttctt---gtggaagtggtctatgatcttc 498 Query: 507 ttcttgatgggcccgca 523 ||||||||||| ||||| Sbjct: 497 ttcttgatgggaccgca 481 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 396 tgcggcttgggctcgggcttgggc 419 |||||||||||||| ||||||||| Sbjct: 704 tgcggcttgggctctggcttgggc 681
>ref|NM_111839.2| Arabidopsis thaliana transcription factor AT3G10040 mRNA, complete cds Length = 1657 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 628 tccgccgccaccgccaccgccg 607
>ref|NM_194863.1| Oryza sativa (japonica cultivar-group) putative proline-rich protein (OSJNBa0031A07.11), mRNA Length = 591 Score = 44.1 bits (22), Expect = 0.50 Identities = 64/78 (82%) Strand = Plus / Minus Query: 474 ggcttcttatggtggaagtgctccatgatgtgtttcttgatgggcccgcacagggtcatg 533 ||||| || ||||||||||| || | || ||| |||||||||||| |||| | |||| Sbjct: 470 ggcttgttgtggtggaagtggtcgaagaagtgcttcttgatgggctcgcagatggtcgcc 411 Query: 534 gacgcgcactccggcgac 551 ||||||||| |||||||| Sbjct: 410 gacgcgcacaccggcgac 393
>ref|XM_466209.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1982 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 331 atccgccgccaccgccaccgcc 352 |||||||||||||||||||||| Sbjct: 102 atccgccgccaccgccaccgcc 123
>ref|XM_464229.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1735 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 247 tccgccgccaccgccaccgccg 226
>ref|NM_010135.1| Mus musculus enabled homolog (Drosophila) (Enah), mRNA Length = 2899 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 1468 tccgccgccaccgccaccgccg 1489
>gb|AC133248.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0080I08, complete sequence Length = 197156 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 82671 ccgccgccaccgccaccgccgt 82650
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 5273278 ccgccgccaccgccaccgccgt 5273299 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 35871165 ccgccgccaccgccaccgccg 35871145 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 35820663 ccgccgccaccgccaccgccg 35820683 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 334 cgccgccaccgccaccgccgt 354 ||||||||||||||||||||| Sbjct: 32770029 cgccgccaccgccaccgccgt 32770049 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 16235257 ccgccgccaccgccaccgccg 16235277 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 14376977 ccgccgccaccgccaccgccg 14376957 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 11682732 ccgccgccaccgccaccgccg 11682752 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 4495190 ccgccgccaccgccaccgccg 4495210 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 35190257 ccgccgccaccgccaccgcc 35190276 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 29077821 ccgccgccaccgccaccgcc 29077840 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 29042812 ccgccgccaccgccaccgcc 29042793 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 21508954 ccgccgccaccgccaccgcc 21508973 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 20210573 ccgccgccaccgccaccgcc 20210592 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 13791486 ccgccgccaccgccaccgcc 13791505 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 334 cgccgccaccgccaccgccg 353 |||||||||||||||||||| Sbjct: 2106552 cgccgccaccgccaccgccg 2106571 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 600056 ccgccgccaccgccaccgcc 600075
>gb|AC010927.5|ATAC010927 Arabidopsis thaliana chromosome III BAC T22K18 genomic sequence, complete sequence Length = 96232 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 46093 tccgccgccaccgccaccgccg 46072
>ref|XM_805412.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053511475.24) partial mRNA Length = 6931 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 4927 ccgccgccaccgccaccgccgt 4948
>gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare strain chromosome 3 clone OSJNBa0021H20, complete sequence Length = 133079 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 96680 ccgccgccaccgccaccgccgt 96701
>gb|AY091028.1| Arabidopsis thaliana unknown protein (At3g10040) mRNA, complete cds Length = 1673 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 628 tccgccgccaccgccaccgccg 607
>emb|BX248354.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment 1/8 Length = 348517 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Minus Query: 393 ggttgcggcttgggctcgggcttggg 418 |||| ||||||||||||||||||||| Sbjct: 223026 ggttccggcttgggctcgggcttggg 223001
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 1202710 tccgccgccaccgccaccgccg 1202689
>gb|AF496725.1| Zea mays cultivar Mo17 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 736 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 335 gccgccaccgccaccgccgtag 356 |||||||||||||||||||||| Sbjct: 445 gccgccaccgccaccgccgtag 424
>gb|AF496723.1| Zea mays cultivar TX601 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 752 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 335 gccgccaccgccaccgccgtag 356 |||||||||||||||||||||| Sbjct: 461 gccgccaccgccaccgccgtag 440
>gb|AF496721.1| Zea mays cultivar H60 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 717 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 335 gccgccaccgccaccgccgtag 356 |||||||||||||||||||||| Sbjct: 462 gccgccaccgccaccgccgtag 441
>gb|AF496718.1| Zea mays cultivar CO109 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 753 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 335 gccgccaccgccaccgccgtag 356 |||||||||||||||||||||| Sbjct: 462 gccgccaccgccaccgccgtag 441
>gb|AF496715.1| Zea mays cultivar F_2 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 748 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 335 gccgccaccgccaccgccgtag 356 |||||||||||||||||||||| Sbjct: 457 gccgccaccgccaccgccgtag 436
>gb|AF496714.1| Zea mays cultivar G_1 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 753 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 335 gccgccaccgccaccgccgtag 356 |||||||||||||||||||||| Sbjct: 462 gccgccaccgccaccgccgtag 441
>gb|AF496712.1| Zea mays cultivar H_4 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 734 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 335 gccgccaccgccaccgccgtag 356 |||||||||||||||||||||| Sbjct: 443 gccgccaccgccaccgccgtag 422
>gb|AF496710.1| Zea mays cultivar F_5 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 753 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 335 gccgccaccgccaccgccgtag 356 |||||||||||||||||||||| Sbjct: 462 gccgccaccgccaccgccgtag 441
>gb|AF496706.1| Zea mays cultivar 647 glycine-rich RNA binding protein gene, 3'UTR and partial cds Length = 723 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 335 gccgccaccgccaccgccgtag 356 |||||||||||||||||||||| Sbjct: 466 gccgccaccgccaccgccgtag 445
>gb|AF119697.1|AF119697 Mesocestoides sp. LC9708 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 539 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 190 ccgccgccaccgccaccgccgt 169
>gb|AF119696.1|AF119696 Mesocestoides corti isolate SO2-MC1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 546 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 190 ccgccgccaccgccaccgccgt 169
>gb|AF119695.1|AF119695 Mesocestoides corti isolate SO1-MC1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 546 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 190 ccgccgccaccgccaccgccgt 169
>gb|AF119694.1|AF119694 Mesocestoides corti isolate MeCo2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length = 546 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 190 ccgccgccaccgccaccgccgt 169
>gb|DQ096556.1| Mesocestoides sp. B KP-2005 isolate KAP711 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 497 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 171 ccgccgccaccgccaccgccgt 150
>gb|DQ096555.1| Mesocestoides sp. B KP-2005 isolate KAP299 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 481 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 171 ccgccgccaccgccaccgccgt 150
>gb|DQ096554.1| Mesocestoides sp. B KP-2005 isolate KAP106B 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 497 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 171 ccgccgccaccgccaccgccgt 150
>gb|DQ096553.1| Mesocestoides sp. B KP-2005 isolate KAP300B 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 481 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 171 ccgccgccaccgccaccgccgt 150
>gb|DQ096552.1| Mesocestoides sp. B KP-2005 isolate KAP302B 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 482 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 171 ccgccgccaccgccaccgccgt 150
>gb|AY129335.1| Mycobacteriophage Corndog, complete genome Length = 69777 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Minus Query: 399 ggcttgggctcgggcttgggcacggg 424 ||||||||||||||||||||| |||| Sbjct: 21903 ggcttgggctcgggcttgggctcggg 21878
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 23668871 ccgccgccaccgccaccgccgt 23668892 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 25590958 ccgccgccaccgccaccgccg 25590938 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 20441582 ccgccgccaccgccaccgccg 20441562 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 6654059 ccgccgccaccgccaccgccg 6654079 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgcc 352 ||||||||||||||||||||| Sbjct: 5221563 tccgccgccaccgccaccgcc 5221543 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 26151312 ccgccgccaccgccaccgcc 26151331 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 24157207 ccgccgccaccgccaccgcc 24157188 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 21670969 ccgccgccaccgccaccgcc 21670988 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 8800697 ccgccgccaccgccaccgcc 8800716 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 5848819 ccgccgccaccgccaccgcc 5848838 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 3937083 ccgccgccaccgccaccgcc 3937064
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 18816777 ccgccgccaccgccaccgccgt 18816756 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 22744471 ccgccgccaccgccaccgccg 22744491 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 22724689 ccgccgccaccgccaccgccg 22724709 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 22372234 ccgccgccaccgccaccgccg 22372214 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 22847803 ccgccgccaccgccaccgcc 22847822 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 334 cgccgccaccgccaccgccg 353 |||||||||||||||||||| Sbjct: 1471581 cgccgccaccgccaccgccg 1471600
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 13515574 tccgccgccaccgccaccgccg 13515595 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 19979049 ccgccgccaccgccaccgccg 19979069 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 7217167 ccgccgccaccgccaccgccg 7217187 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 334 cgccgccaccgccaccgccg 353 |||||||||||||||||||| Sbjct: 19876860 cgccgccaccgccaccgccg 19876879 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgtag 356 |||||||| ||||||||||||||| Sbjct: 18718793 ccgccgccgccgccaccgccgtag 18718770 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 14840646 ccgccgccaccgccaccgcc 14840665 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 8145122 ccgccgccaccgccaccgcc 8145103
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 10783779 ccgccgccaccgccaccgccgt 10783800 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 27524124 ccgccgccaccgccaccgccg 27524104 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgtagg 357 |||||||| |||||||||||||||| Sbjct: 11113402 ccgccgccgccgccaccgccgtagg 11113378 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 7829051 ccgccgccaccgccaccgccg 7829071 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 5036097 ccgccgccaccgccaccgccg 5036117 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 29405632 ccgccgccaccgccaccgcc 29405613 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 16956684 ccgccgccaccgccaccgcc 16956665
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 5272493 ccgccgccaccgccaccgccgt 5272514 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 35961295 ccgccgccaccgccaccgccg 35961275 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 35910793 ccgccgccaccgccaccgccg 35910813 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 334 cgccgccaccgccaccgccgt 354 ||||||||||||||||||||| Sbjct: 32860539 cgccgccaccgccaccgccgt 32860559 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 16228890 ccgccgccaccgccaccgccg 16228910 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 14371952 ccgccgccaccgccaccgccg 14371932 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 11679495 ccgccgccaccgccaccgccg 11679515 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 4495305 ccgccgccaccgccaccgccg 4495325 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 35280329 ccgccgccaccgccaccgcc 35280348 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 29169243 ccgccgccaccgccaccgcc 29169262 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 29134234 ccgccgccaccgccaccgcc 29134215 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 21501983 ccgccgccaccgccaccgcc 21502002 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 20203600 ccgccgccaccgccaccgcc 20203619 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 13786461 ccgccgccaccgccaccgcc 13786480 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 334 cgccgccaccgccaccgccg 353 |||||||||||||||||||| Sbjct: 2106564 cgccgccaccgccaccgccg 2106583 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 600054 ccgccgccaccgccaccgcc 600073
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 331 atccgccgccaccgccaccgcc 352 |||||||||||||||||||||| Sbjct: 21069630 atccgccgccaccgccaccgcc 21069609 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 3541177 tccgccgccaccgccaccgccg 3541156 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 33564968 ccgccgccaccgccaccgccg 33564948 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 28649458 ccgccgccaccgccaccgccg 28649438 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 22595598 ccgccgccaccgccaccgccg 22595618 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 10562323 ccgccgccaccgccaccgccg 10562343 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 8342257 ccgccgccaccgccaccgccg 8342237 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 35872911 ccgccgccaccgccaccgcc 35872930 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 334 cgccgccaccgccaccgccg 353 |||||||||||||||||||| Sbjct: 35629052 cgccgccaccgccaccgccg 35629071 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 cgccgccaccgccaccgccg 353 |||||||||||||||||||| Sbjct: 35502444 cgccgccaccgccaccgccg 35502425 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 35408320 ccgccgccaccgccaccgcc 35408301 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 34906846 ccgccgccaccgccaccgcc 34906865 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 30903806 ccgccgccaccgccaccgcc 30903787 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 cgccgccaccgccaccgccg 353 |||||||||||||||||||| Sbjct: 27927336 cgccgccaccgccaccgccg 27927317 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 26290651 ccgccgccaccgccaccgcc 26290632 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 21445708 ccgccgccaccgccaccgcc 21445689 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 10522420 ccgccgccaccgccaccgcc 10522401
>gb|AC084592.1|CBRG42D24 Caenorhabditis briggsae cosmid G42D24, complete sequence Length = 24534 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 5219 ccgccgccaccgccaccgccgt 5198
>ref|XM_573530.1| PREDICTED: Rattus norvegicus enabled homolog (Drosophila) (predicted) (Enah_predicted), mRNA Length = 2850 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 1417 tccgccgccaccgccaccgccg 1438
>dbj|AP005260.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0557D09 Length = 135315 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 113225 ccgccgccaccgccaccgccgt 113246
>dbj|AP004863.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0023I17 Length = 141852 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 85972 tccgccgccaccgccaccgccg 85951
>dbj|AP006562.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1175F05 Length = 126842 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 90502 tccgccgccaccgccaccgccg 90523
>dbj|AP005804.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0085K21 Length = 180714 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 22467 tccgccgccaccgccaccgccg 22446
>dbj|AP004017.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1008_F08 Length = 105979 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 331 atccgccgccaccgccaccgcc 352 |||||||||||||||||||||| Sbjct: 71375 atccgccgccaccgccaccgcc 71354
>dbj|AK121943.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107F03, full insert sequence Length = 2924 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 563 ccgccgccaccgccaccgccgt 584
>dbj|AK111522.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002M11, full insert sequence Length = 2776 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 556 ccgccgccaccgccaccgccgt 577
>ref|XM_560671.1| Anopheles gambiae str. PEST ENSANGP00000027627 (ENSANGG00000023126), partial mRNA Length = 2037 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Plus Query: 327 tggtatccgccgccaccgccaccgcc 352 |||| ||||||||||||||||||||| Sbjct: 1585 tggtttccgccgccaccgccaccgcc 1610
>dbj|AK111437.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-183-A03, full insert sequence Length = 1587 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 247 tccgccgccaccgccaccgccg 226
>dbj|AK106799.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-116-B09, full insert sequence Length = 2118 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 1363 tccgccgccaccgccaccgccg 1342
>dbj|AK101497.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033043G02, full insert sequence Length = 2672 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 57 ccgccgccaccgccaccgccgt 78
>dbj|AK072152.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013135O09, full insert sequence Length = 3222 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 3011 tccgccgccaccgccaccgccg 2990
>dbj|AK069995.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023037B09, full insert sequence Length = 1917 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 231 ccgccgccaccgccaccgccgt 252
>dbj|AK066206.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013056D20, full insert sequence Length = 1982 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 331 atccgccgccaccgccaccgcc 352 |||||||||||||||||||||| Sbjct: 102 atccgccgccaccgccaccgcc 123
>dbj|AK060547.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-G04, full insert sequence Length = 1734 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 247 tccgccgccaccgccaccgccg 226
>emb|BX572098.1| Prochlorococcus marinus MIT9313 complete genome; segment 4/7 Length = 346683 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 335 gccgccaccgccaccgccgtag 356 |||||||||||||||||||||| Sbjct: 119606 gccgccaccgccaccgccgtag 119627 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 336 ccgccaccgccaccgccgtag 356 ||||||||||||||||||||| Sbjct: 119637 ccgccaccgccaccgccgtag 119657
>gb|U72523.1|MMU72523 Mus musculus neural variant mena+++ protein (Mena) mRNA, complete cds Length = 2899 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 1468 tccgccgccaccgccaccgccg 1489
>gb|U72522.1|MMU72522 Mus musculus neural variant mena++ protein (Mena) mRNA, complete cds Length = 2854 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 1423 tccgccgccaccgccaccgccg 1444
>gb|U72521.1|MMU72521 Mus musculus neural variant mena+ protein (Mena) mRNA, complete cds Length = 2842 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 1411 tccgccgccaccgccaccgccg 1432
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 442 gctggggcttgggctccggctt 463 |||||||||||||||||||||| Sbjct: 1060517 gctggggcttgggctccggctt 1060538
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 18977477 ccgccgccaccgccaccgccgt 18977456 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 23054381 ccgccgccaccgccaccgccg 23054401 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 23034600 ccgccgccaccgccaccgccg 23034620 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 22682145 ccgccgccaccgccaccgccg 22682125 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 23157713 ccgccgccaccgccaccgcc 23157732 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 334 cgccgccaccgccaccgccg 353 |||||||||||||||||||| Sbjct: 1469302 cgccgccaccgccaccgccg 1469321
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 23597058 ccgccgccaccgccaccgccgt 23597079 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 25519134 ccgccgccaccgccaccgccg 25519114 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 20367796 ccgccgccaccgccaccgccg 20367776 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 6653934 ccgccgccaccgccaccgccg 6653954 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgcc 352 ||||||||||||||||||||| Sbjct: 5221545 tccgccgccaccgccaccgcc 5221525 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 26079488 ccgccgccaccgccaccgcc 26079507 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 24085413 ccgccgccaccgccaccgcc 24085394 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 21599314 ccgccgccaccgccaccgcc 21599333 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 8800580 ccgccgccaccgccaccgcc 8800599 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 5848812 ccgccgccaccgccaccgcc 5848831 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 3937057 ccgccgccaccgccaccgcc 3937038
>emb|AL772425.7|CNS08CA3 Oryza sativa chromosome 12, . BAC OJ1396_C02 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 157690 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 37539 ccgccgccaccgccaccgccgt 37518
>emb|AL844878.4|CNS08CB1 Oryza sativa chromosome 12, . BAC OSJNBb0036A19 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 128795 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 86751 ccgccgccaccgccaccgccgt 86730
>gb|AC148879.2| Chlamydomonas reinhardtii clone cr-36D8, complete sequence Length = 53591 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccgt 354 |||||||||||||||||||||| Sbjct: 42506 ccgccgccaccgccaccgccgt 42485
>dbj|D10727.1|MUSNDPP1 Mus musculus mRNA for NDPP-1 protein, complete cds Length = 4308 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 332 tccgccgccaccgccaccgccg 353 |||||||||||||||||||||| Sbjct: 950 tccgccgccaccgccaccgccg 971
>gb|BC108290.1| Homo sapiens loricrin, mRNA (cDNA clone MGC:111513 IMAGE:4754528), complete cds Length = 1293 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 137 ccgccgccaccgccaccgccg 117
>gb|AC165229.7| Mus musculus chromosome 1, clone RP23-47K10, complete sequence Length = 218929 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgcc 352 ||||||||||||||||||||| Sbjct: 196579 tccgccgccaccgccaccgcc 196559
>gb|AC114917.2| Mus musculus chromosome 8 clone RP23-84K6, complete sequence Length = 181442 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 101019 ccgccgccaccgccaccgccg 101039
>ref|XM_550378.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1002 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 64 ccgccgccaccgccaccgccg 44
>ref|XM_550566.1| Oryza sativa (japonica cultivar-group), mRNA Length = 525 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgcc 352 ||||||||||||||||||||| Sbjct: 159 tccgccgccaccgccaccgcc 139
>ref|XM_550344.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1101 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 149 ccgccgccaccgccaccgccg 129
>gb|AC130600.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0048I21, complete sequence Length = 137650 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 27328 ccgccgccaccgccaccgccg 27348
>ref|XM_520669.1| PREDICTED: Pan troglodytes similar to Hypothetical protein C14orf9 (LOC465201), mRNA Length = 1160 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 32 ccgccgccaccgccaccgccg 12
>ref|XM_483739.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3279 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 134 ccgccgccaccgccaccgccg 154
>ref|XM_483051.1| Oryza sativa (japonica cultivar-group), mRNA Length = 288 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 325 cgtggtatccgccgccaccgccaccgccg 353 |||||| ||||||||| |||||||||||| Sbjct: 240 cgtggtgtccgccgccgccgccaccgccg 212
>ref|XM_474472.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1533 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 1069 ccgccgccaccgccaccgccg 1049
>ref|XM_475428.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 3003 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 494 ccgccgccaccgccaccgccg 474
>ref|XM_475262.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2568 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 65 ccgccgccaccgccaccgccg 45
>ref|NM_195006.1| Oryza sativa (japonica cultivar-group) hypothetical protein (OSJNBa0089D15.25), mRNA Length = 1215 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 259 ccgccgccaccgccaccgccg 279
>ref|XM_468193.1| Oryza sativa (japonica cultivar-group), mRNA Length = 909 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 56 ccgccgccaccgccaccgccg 76
>ref|XM_507018.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBa0054K20.35 mRNA Length = 1394 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 61 ccgccgccaccgccaccgccg 81
>ref|XM_466424.1| Oryza sativa (japonica cultivar-group), mRNA Length = 333 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 43 ccgccgccaccgccaccgccg 23
>ref|XM_464962.1| Oryza sativa (japonica cultivar-group), mRNA Length = 495 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 334 ccgccgccaccgccaccgccg 314
>ref|XM_464810.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1930 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 19 ccgccgccaccgccaccgccg 39
>ref|NM_197930.1| Oryza sativa (japonica cultivar-group) putative Clp protease (OSJNBa0056G17.6), mRNA Length = 897 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 67 ccgccgccaccgccaccgccg 47
>ref|NM_196829.1| Oryza sativa (japonica cultivar-group) hypothetical protein (OSJNBa0018F16.20), mRNA Length = 1011 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 904 ccgccgccaccgccaccgccg 884
>ref|NM_193983.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1512 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 1390 ccgccgccaccgccaccgccg 1410
>ref|NM_196417.1| Oryza sativa (japonica cultivar-group) hypothetical protein (OSJNBa0060A14.7), mRNA Length = 633 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 422 ccgccgccaccgccaccgccg 442
>ref|NM_030758.3| Homo sapiens oxysterol binding protein 2 (OSBP2), transcript variant 1, mRNA Length = 4349 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 441 ggctggggcttgggctccggc 461 ||||||||||||||||||||| Sbjct: 265 ggctggggcttgggctccggc 245
>ref|XM_470476.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2565 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 74 ccgccgccaccgccaccgccg 94
>ref|XM_479391.1| Oryza sativa (japonica cultivar-group), mRNA Length = 900 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 314 ccgccgccaccgccaccgccg 294
>ref|XM_477220.1| Oryza sativa (japonica cultivar-group), mRNA Length = 846 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 87 ccgccgccaccgccaccgccg 67
>ref|XM_472593.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 516 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 142 ccgccgccaccgccaccgccg 162
>ref|NM_184593.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1224 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 800 ccgccgccaccgccaccgccg 820
>gb|BC034690.1| Homo sapiens loricrin, mRNA (cDNA clone MGC:21357 IMAGE:4752776), complete cds Length = 1280 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 116 ccgccgccaccgccaccgccg 96
>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete sequence Length = 2300533 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 42178 ccgccgccaccgccaccgccg 42158
>gb|AY023468.1| Oryza sativa microsatellite MRG5793 containing (TCG)X11, genomic sequence Length = 233 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 2 ccgccgccaccgccaccgccg 22
>gb|AY023436.1| Oryza sativa microsatellite MRG5761 containing (TCA)X8, genomic sequence Length = 224 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 26 ccgccgccaccgccaccgccg 46
>gb|AC128647.8| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0062G19, complete sequence Length = 92392 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 74602 ccgccgccaccgccaccgccg 74622
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 1128700 ccgccgccaccgccaccgccg 1128680
>gb|AY644643.1| Oryza sativa (indica cultivar-group) hypothetical protein (RP2) mRNA, complete cds Length = 1343 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 342 ccgccgccaccgccaccgccg 322
>gb|BC079538.1| Mus musculus enhancer of zeste homolog 2 (Drosophila), mRNA (cDNA clone MGC:90723 IMAGE:6817366), complete cds Length = 2617 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 40 ccgccgccaccgccaccgccg 20
>ref|XM_363644.1| Magnaporthe grisea 70-15 hypothetical protein (MG01570.4) partial mRNA Length = 3912 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 1042 ccgccgccaccgccaccgccg 1062
>gb|AC092076.7| Oryza sativa chromosome 3 BAC OSJNBb0021G19 genomic sequence, complete sequence Length = 141582 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 cgccgccaccgccaccgccgt 354 ||||||||||||||||||||| Sbjct: 109512 cgccgccaccgccaccgccgt 109492
>ref|NM_007678.2| Mus musculus CCAAT/enhancer binding protein (C/EBP), alpha (Cebpa), mRNA Length = 2639 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 660 ccgccgccaccgccaccgccg 680
>ref|NM_144568.1| Homo sapiens transmembrane protein 55B (TMEM55B), mRNA Length = 1701 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 77 ccgccgccaccgccaccgccg 57
>gb|BC038034.1| Mus musculus ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila), mRNA (cDNA clone MGC:47121 IMAGE:4035861), complete cds Length = 2326 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 207 ccgccgccaccgccaccgccg 187
>gb|BC072020.1| Homo sapiens C-terminal binding protein 2, transcript variant 1, mRNA (cDNA clone IMAGE:4542562), complete cds Length = 1845 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 48 ccgccgccaccgccaccgccg 68
>gb|AC120984.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBb0026G02, complete sequence Length = 123472 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 105271 ccgccgccaccgccaccgccg 105291 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 85489 ccgccgccaccgccaccgccg 85509
>gb|AC121365.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0053E05, complete sequence Length = 196284 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 161378 ccgccgccaccgccaccgccg 161398
>ref|NM_001039347.1| Mus musculus potassium voltage-gated channel, Shal-related family, member 3 (Kcnd3), transcript variant 1, mRNA Length = 7182 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 164 ccgccgccaccgccaccgccg 144
>ref|NM_009045.3| Mus musculus v-rel reticuloendotheliosis viral oncogene homolog A (avian) (Rela), mRNA Length = 2752 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 203 ccgccgccaccgccaccgccg 183
>gb|AC137150.11| Mus musculus chromosome 18, clone RP23-342A15, complete sequence Length = 213513 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 167044 ccgccgccaccgccaccgccg 167024
>ref|NM_019927.1| Mus musculus ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila) (Arih1), mRNA Length = 2326 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 207 ccgccgccaccgccaccgccg 187
>gb|AC122204.3| Mus musculus BAC clone RP23-73N8 from chromosome 1, complete sequence Length = 197949 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 332 tccgccgccaccgccaccgcc 352 ||||||||||||||||||||| Sbjct: 143806 tccgccgccaccgccaccgcc 143826
>ref|NM_013527.1| Mus musculus growth differentiation factor 7 (Gdf7), mRNA Length = 1399 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 1007 ccgccgccaccgccaccgccg 987
>gb|AC144737.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0018K15, complete sequence Length = 168519 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 129000 ccgccgccaccgccaccgccg 128980
>gb|AC135429.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0636F09, complete sequence Length = 177374 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 156351 ccgccgccaccgccaccgccg 156371
>gb|BC065149.1| Mus musculus CXXC finger 4, mRNA (cDNA clone IMAGE:6853043), partial cds Length = 5216 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 663 ccgccgccaccgccaccgccg 643
>gb|AC097111.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1014_C08, complete sequence Length = 95638 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 7683 ccgccgccaccgccaccgccg 7703
>gb|AC120887.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0088K21, complete sequence Length = 153239 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 4188 ccgccgccaccgccaccgccg 4208 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 107520 ccgccgccaccgccaccgcc 107539
>gb|AY530548.1| Leucocarpus perfoliatus floricaula (FLO) mRNA, FLOA paralog, partial cds Length = 921 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgcc 352 ||||||||||||||||||||| Sbjct: 390 tccgccgccaccgccaccgcc 370
>ref|XM_989990.1| PREDICTED: Mus musculus YTH domain containing 2 (Ythdc2), mRNA Length = 6276 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 104 ccgccgccaccgccaccgccg 84
>ref|XM_910737.2| PREDICTED: Mus musculus YTH domain containing 2 (Ythdc2), mRNA Length = 6276 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 104 ccgccgccaccgccaccgccg 84
>ref|XM_140310.8| PREDICTED: Mus musculus YTH domain containing 2 (Ythdc2), mRNA Length = 6276 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 104 ccgccgccaccgccaccgccg 84
>ref|XM_543959.2| PREDICTED: Canis familiaris similar to Lysyl oxidase homolog 4 precursor (Lysyl oxidase-like protein 4) (Lysyl oxidase related protein C) (LOC486830), mRNA Length = 2467 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 31 ccgccgccaccgccaccgccg 51
>ref|XM_976338.1| PREDICTED: Mus musculus hypothetical protein LOC665357 (LOC665357), mRNA Length = 864 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 511 ccgccgccaccgccaccgccg 531
>ref|XM_976560.1| PREDICTED: Mus musculus hypothetical protein LOC669696 (LOC669696), mRNA Length = 864 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 511 ccgccgccaccgccaccgccg 531
>ref|XM_534736.2| PREDICTED: Canis familiaris similar to oxysterol binding protein 2 isoform a (LOC477541), mRNA Length = 3201 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 441 ggctggggcttgggctccggc 461 ||||||||||||||||||||| Sbjct: 161 ggctggggcttgggctccggc 141
>gb|BC057680.1| Mus musculus ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila), mRNA (cDNA clone MGC:68355 IMAGE:3498094), complete cds Length = 2636 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 527 ccgccgccaccgccaccgccg 507
>gb|AC123847.4| Mus musculus BAC clone RP23-443O1 from chromosome 3, complete sequence Length = 189689 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 69481 ccgccgccaccgccaccgccg 69461
>gb|AC126029.3| Mus musculus BAC clone RP23-389K5 from chromosome 19, complete sequence Length = 212472 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 6284 ccgccgccaccgccaccgccg 6304
>ref|XM_566442.1| Cryptococcus neoformans hypothetical protein (CNA00130) partial mRNA Length = 3025 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 2504 ccgccgccaccgccaccgccg 2484
>ref|XM_883482.1| Leishmania major strain Friedlin hypothetical protein (L4830.10) partial mRNA Length = 2451 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 332 tccgccgccaccgccaccgcc 352 ||||||||||||||||||||| Sbjct: 1962 tccgccgccaccgccaccgcc 1982
>emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end Length = 247462 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgcc 352 ||||||||||||||||||||| Sbjct: 74739 tccgccgccaccgccaccgcc 74719
>ref|XM_850922.1| PREDICTED: Canis familiaris similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1), transcript variant 5 (LOC482895), mRNA Length = 1154 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 109 ccgccgccaccgccaccgccg 129
>ref|XM_850883.1| PREDICTED: Canis familiaris similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1), transcript variant 4 (LOC482895), mRNA Length = 1015 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 109 ccgccgccaccgccaccgccg 129
>ref|XM_850844.1| PREDICTED: Canis familiaris similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1), transcript variant 3 (LOC482895), mRNA Length = 1628 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 109 ccgccgccaccgccaccgccg 129
>ref|XM_850800.1| PREDICTED: Canis familiaris similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1), transcript variant 2 (LOC482895), mRNA Length = 1679 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 109 ccgccgccaccgccaccgccg 129
>ref|XM_540010.2| PREDICTED: Canis familiaris similar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1), transcript variant 1 (LOC482895), mRNA Length = 1790 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 109 ccgccgccaccgccaccgccg 129
>emb|AL117207.1|CEY60A3A Caenorhabditis elegans YAC Y60A3A, complete sequence Length = 122592 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 399 ggcttgggctcgggcttgggc 419 ||||||||||||||||||||| Sbjct: 98883 ggcttgggctcgggcttgggc 98903
>gb|AC123817.4| Mus musculus BAC clone RP24-255D13 from chromosome 9, complete sequence Length = 169614 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 27205 ccgccgccaccgccaccgccg 27225
>emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete chromosome; segment 8/12 Length = 294800 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 149590 ccgccgccaccgccaccgccg 149570
>ref|XM_805980.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053510579.90) partial mRNA Length = 1785 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 1147 ccgccgccaccgccaccgccg 1167
>ref|XM_806085.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053510687.50) partial mRNA Length = 1515 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 535 ccgccgccaccgccaccgccg 555
>ref|XM_808744.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053508569.90) partial mRNA Length = 924 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 772 ccgccgccaccgccaccgccg 792
>ref|XM_797520.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053509923.9) partial mRNA Length = 2118 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 517 ccgccgccaccgccaccgccg 537
>ref|XM_799161.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053507563.9) partial mRNA Length = 5485 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 2687 ccgccgccaccgccaccgccg 2707
>ref|XM_814673.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1 (DGF-1) (Tc00.1047053508641.10) partial mRNA Length = 6093 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 628 ccgccgccaccgccaccgccg 648
>gb|AY390430.1| Homo sapiens NS5ATP1-binding protein 16 mRNA, complete cds Length = 873 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 712 ccgccgccaccgccaccgccg 692
>gb|AF359381.1| Homo sapiens C13orf2 mRNA, complete cds Length = 6216 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 111 ccgccgccaccgccaccgccg 91
>gb|AC113527.8| Mus musculus chromosome 9, clone RP23-314E23, complete sequence Length = 202544 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 22177 ccgccgccaccgccaccgccg 22157
>gb|BC014967.1| Homo sapiens chromobox homolog 4 (Pc class homolog, Drosophila), mRNA (cDNA clone MGC:23084 IMAGE:4856728), complete cds Length = 1578 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 731 ccgccgccaccgccaccgccg 711
>gb|BC052276.1| Homo sapiens C-terminal binding protein 2, mRNA (cDNA clone IMAGE:4562556), complete cds Length = 2360 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 71 ccgccgccaccgccaccgccg 91
>gb|AC164408.4| Mus musculus chromosome 3, clone RP23-384A11, complete sequence Length = 202604 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 45276 ccgccgccaccgccaccgccg 45256
>gb|AC109594.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0007P22, complete sequence Length = 148068 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 80582 ccgccgccaccgccaccgccg 80602
>emb|AL445199.37| Human DNA sequence from clone RP13-439H18 on chromosome 10 Contains the GPR123 gene for G protein-coupled receptor 123, a novel gene (containing KIAA1768, FLJ00378 and FLJ00252), gene FLJ25027, the UTF1 gene for undifferentiated embryonic cell transcription factor 1, the 5' end of the VENTX2 gene for VENT-like homeobox2, a novel gene, a 60S ribosomal protein L5 (RPL5) pseudogene and twenty five CpG islands, complete sequence Length = 212199 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 136689 ccgccgccaccgccaccgccg 136669
>gb|BC058161.1| Mus musculus CCAAT/enhancer binding protein (C/EBP), alpha, mRNA (cDNA clone MGC:65349 IMAGE:5053056), complete cds Length = 2662 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 660 ccgccgccaccgccaccgccg 680
>gb|BC051102.1| Mus musculus CCAAT/enhancer binding protein (C/EBP), alpha, mRNA (cDNA clone MGC:58988 IMAGE:5051761), complete cds Length = 2639 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 660 ccgccgccaccgccaccgccg 680
>gb|BC011118.1| Mus musculus CCAAT/enhancer binding protein (C/EBP), alpha, mRNA (cDNA clone MGC:18705 IMAGE:4194023), complete cds Length = 2639 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 660 ccgccgccaccgccaccgccg 680
>gb|BC028890.1| Mus musculus CCAAT/enhancer binding protein (C/EBP), alpha, mRNA (cDNA clone MGC:19302 IMAGE:4160963), complete cds Length = 2193 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 660 ccgccgccaccgccaccgccg 680
>emb|AL590408.15| Human DNA sequence from clone RP11-227F8 on chromosome 1 Contains the 5' end of a novel gene (DKFZP586L151), a novel gene, the 5' end of the gene for C-terminal PDZ domain ligand of neuronal nitric oxide synthase (CAPON) and two CpG islands, complete sequence Length = 103523 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 332 tccgccgccaccgccaccgcc 352 ||||||||||||||||||||| Sbjct: 64913 tccgccgccaccgccaccgcc 64933
>emb|AL513284.12| Human DNA sequence from clone RP11-518D3 on chromosome 1 Contains the 3' end of a novel gene (FLJ42034, FLJ38762), the gene for a putative NFkB activating protein 373, a C-terminal binding protein 2 (CTBP2) pseudogene, a ribosomal protein S7 (RPS7) pseudogene and a CpG island, complete sequence Length = 169972 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 336 ccgccaccgccaccgccgtaggtgggcgtgggagggacggg 376 |||||||||||||||||| ||| || ||||||||| |||| Sbjct: 51563 ccgccaccgccaccgccgcagggtggggtgggaggggcggg 51523
>emb|AL161636.21| Human DNA sequence from clone RP1-140J1 on chromosome 1 Contains a novel gene, two novel small proline rich proteins, a ribosomal protein, large, P0 (RPLP0) pseudogene, the LOR gene for loricri and the 3' end of the PGLYRPIalpha gene for peptidoglycan recognition protein-I-alpha, complete sequence Length = 137712 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 92384 ccgccgccaccgccaccgccg 92364
>gb|AF525752.1| Mus musculus growth differentiation factor 7 mRNA, complete cds Length = 1399 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 1007 ccgccgccaccgccaccgccg 987
>emb|AL161908.13| Human DNA sequence from clone RP11-123K19 on chromosome 9 Contains two novel genes, the 5' end of the LMX1B gene for LIM homeobox transcription factor 1 beta and two CpG islands, complete sequence Length = 106216 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 64113 ccgccgccaccgccaccgccg 64133
>emb|AL157888.16| Human DNA sequence from clone RP11-151A10 on chromosome 10 Contains the 5' end of the CTBP2 gene for C-terminal binding protein 2, a mitochondrial ribosomal protein S21 (MRPS21) pseudogene and three CpG islands, complete sequence Length = 194431 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 78400 ccgccgccaccgccaccgccg 78380
>emb|AL079299.12|HSBA492A7 Human DNA sequence from clone RP11-492A7 on chromosome 22, complete sequence Length = 15730 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 441 ggctggggcttgggctccggc 461 ||||||||||||||||||||| Sbjct: 3537 ggctggggcttgggctccggc 3517
>emb|AL109938.8|HSJ324N14 Human DNA sequence from clone RP3-324N14 on chromosome 6q23.1-24.3 Contains the 3' end of the EPB41L2 gene for erythrocyte membrane protein band 4.1-like 2, complete sequence Length = 102507 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 60234 ccgccgccaccgccaccgccg 60214
>emb|AL021398.1|HS964D12 Human DNA sequence from clone RP5-964D12 on chromosome 1q24-25 Contains the 5' end of the ASTN gene for astrotactin and the 5' end of the gene for a novel protein (KIAA1747, LOC57795), complete sequence Length = 146963 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 51541 ccgccgccaccgccaccgccg 51561
>gb|AC118674.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0093J20, from chromosome 3, complete sequence Length = 148635 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 71827 ccgccgccaccgccaccgccg 71847
>ref|XM_967085.1| PREDICTED: Tribolium castaneum similar to CG8912-PC, isoform C (LOC660887), mRNA Length = 2533 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 608 ccgccgccaccgccaccgccg 588
>ref|XM_965624.1| PREDICTED: Tribolium castaneum similar to CG12164-PA (LOC659306), mRNA Length = 11136 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 331 atccgccgccaccgccaccgccgta 355 |||||||||| |||||||||||||| Sbjct: 4261 atccgccgcctccgccaccgccgta 4237
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Plus Query: 449 cttgggctccggcttcggcggcacgggcttctt 481 ||||||||||||||| || ||| |||||||||| Sbjct: 4353687 cttgggctccggcttggggggctcgggcttctt 4353719
>emb|BX640445.1| Bordetella bronchiseptica strain RB50, complete genome; segment 9/16 Length = 348706 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 122199 ccgccgccaccgccaccgccg 122179
>gb|BC094053.1| Mus musculus v-rel reticuloendotheliosis viral oncogene homolog A (avian), mRNA (cDNA clone MGC:102574 IMAGE:3157927), complete cds Length = 2752 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 203 ccgccgccaccgccaccgccg 183
>ref|NM_001329.1| Homo sapiens C-terminal binding protein 2 (CTBP2), transcript variant 1, mRNA Length = 2368 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 34 ccgccgccaccgccaccgccg 54
>emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segment 7/7 Length = 344615 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 335 gccgccaccgccaccgccgta 355 ||||||||||||||||||||| Sbjct: 306358 gccgccaccgccaccgccgta 306378
>gb|BC020947.1| Homo sapiens transmembrane protein 55B, mRNA (cDNA clone MGC:26684 IMAGE:4816227), complete cds Length = 1701 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 77 ccgccgccaccgccaccgccg 57
>emb|AL731596.3|OSJN00236 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0024J22, complete sequence Length = 174430 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 332 tccgccgccaccgccaccgcc 352 ||||||||||||||||||||| Sbjct: 134739 tccgccgccaccgccaccgcc 134719
>emb|AL606656.3|OSJN00099 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0020J19, complete sequence Length = 123272 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 22828 ccgccgccaccgccaccgccg 22808
>emb|AJ439060.1|AGA439060 Anopheles gambiae DNA from 2R chromosome, clone 11N17 Length = 147295 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 102925 ccgccgccaccgccaccgccg 102905
>gb|AC131375.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAb0015J03, complete sequence Length = 165933 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 110151 ccgccgccaccgccaccgccg 110131
>emb|CR860450.1| Pongo pygmaeus mRNA; cDNA DKFZp459L071 (from clone DKFZp459L071) Length = 4187 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 441 ggctggggcttgggctccggc 461 ||||||||||||||||||||| Sbjct: 178 ggctggggcttgggctccggc 158
>gb|AC119840.12| Mus musculus chromosome 3, clone RP24-112E5, complete sequence Length = 206159 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 6758 ccgccgccaccgccaccgccg 6738
>dbj|AK097581.1| Homo sapiens cDNA FLJ40262 fis, clone TESTI2025846, highly similar to Homo sapiens OSBP-related protein 4 mRNA Length = 2048 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 441 ggctggggcttgggctccggc 461 ||||||||||||||||||||| Sbjct: 197 ggctggggcttgggctccggc 177
>gb|AC150683.3| Mus musculus BAC clone RP23-435E16 from chromosome 7, complete sequence Length = 198646 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 50710 ccgccgccaccgccaccgccg 50730
>gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270O7, complete sequence Length = 188834 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 76352 ccgccgccaccgccaccgccg 76332
>emb|AL833398.1|HSM804711 Homo sapiens mRNA; cDNA DKFZp762O119 (from clone DKFZp762O119) Length = 2938 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 86 ccgccgccaccgccaccgccg 106
>dbj|AK220174.1| Mus musculus mRNA for mKIAA4065 protein Length = 2600 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 44 ccgccgccaccgccaccgccg 24
>gb|AC100776.2| Homo sapiens chromosome 18, clone CTD-2009D8, complete sequence Length = 67543 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 97 aatctttgaaaagcaatacaa 117 ||||||||||||||||||||| Sbjct: 51935 aatctttgaaaagcaatacaa 51955
>emb|CR625488.1| full-length cDNA clone CS0DL002YB24 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 1600 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 21 ccgccgccaccgccaccgccg 1
>emb|CR620640.1| full-length cDNA clone CS0DE004YA23 of Placenta of Homo sapiens (human) Length = 1623 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 29 ccgccgccaccgccaccgccg 9
>emb|CR620252.1| full-length cDNA clone CS0DL005YG13 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 1506 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 33 ccgccgccaccgccaccgccg 13
>emb|CR598955.1| full-length cDNA clone CS0DC007YJ08 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1617 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 25 ccgccgccaccgccaccgccg 5
>gb|AC025905.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone nbxb0018F16, complete sequence Length = 179157 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 133352 ccgccgccaccgccaccgccg 133332
>tpg|BK002912.1| TPA: TPA_inf: Drosophila melanogaster HDC16228 (HDC16228) gene, complete cds Length = 1747 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 579 ccgccgccaccgccaccgccg 599
>tpg|BK000922.1| TPA: TPA_inf: Oryza sativa transposon Rim2-M323, complete sequence Length = 11861 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 6648 ccgccgccaccgccaccgccg 6628
>ref|NM_001013108.1| Rattus norvegicus ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila) (Arih1), mRNA Length = 2020 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 531 ccgccgccaccgccaccgccg 511
>gb|AC034258.10| Oryza sativa chromosome 10 BAC OSJNBb0011A08 genomic sequence, complete sequence Length = 117157 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 103613 ccgccgccaccgccaccgccg 103633
>gb|AC116665.1| Papio hamadryas chromosome , clone RP41-119J13, complete sequence Length = 176602 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 48421 ccgccgccaccgccaccgccg 48401 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgcc 352 |||||||||||||||||||| Sbjct: 64015 ccgccgccaccgccaccgcc 63996
>gb|AC025945.12| Homo sapiens chromosome 10 clone RP11-288B9, complete sequence Length = 180392 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 78400 ccgccgccaccgccaccgccg 78380
>gb|AC090488.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0081F12 from chromosome 10, complete sequence Length = 128388 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 4218 ccgccgccaccgccaccgccg 4198
>gb|AF426021.1| Trypanosoma rangeli clone TrTel 3 telomeric sequence Length = 2592 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 62 ccgccgccaccgccaccgccg 42
>dbj|AK158072.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched library, clone:F930025O12 product:v-rel reticuloendotheliosis viral oncogene homolog A (avian), full insert sequence Length = 2507 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 213 ccgccgccaccgccaccgccg 193
>dbj|AK147574.1| Mus musculus cDNA, RIKEN full-length enriched library, clone:M5C1081C08 product:potassium voltage-gated channel, Shal-related family, member 3, full insert sequence Length = 7076 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 75 ccgccgccaccgccaccgccg 55
>dbj|AK157853.1| Mus musculus erythroblast cDNA, RIKEN full-length enriched library, clone:K0C0026B09 product:enhancer of zeste homolog 2 (Drosophila), full insert sequence Length = 2652 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 90 ccgccgccaccgccaccgccg 70
>gb|AC091135.9| Homo sapiens chromosome 18, clone RP11-289E15, complete sequence Length = 166207 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 97 aatctttgaaaagcaatacaa 117 ||||||||||||||||||||| Sbjct: 151083 aatctttgaaaagcaatacaa 151063
>dbj|AK155473.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630230M04 product:hypothetical Alanine-rich region profile containing protein, full insert sequence Length = 1146 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 117 ccgccgccaccgccaccgccg 137
>dbj|AK155321.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630220B17 product:v-rel reticuloendotheliosis viral oncogene homolog A (avian), full insert sequence Length = 2255 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 214 ccgccgccaccgccaccgccg 194
>dbj|AK155281.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630214A13 product:CCAAT/enhancer binding protein (C/EBP), alpha, full insert sequence Length = 2592 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 630 ccgccgccaccgccaccgccg 650
>emb|CR536555.1| Homo sapiens full open reading frame cDNA clone RZPDo834H1020D for gene LOR, loricrin; complete cds, incl. stopcodon Length = 951 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 83 ccgccgccaccgccaccgccg 63
>gb|S73519.1| pro-opiomelanocortin [swine, pituitary anterior and intermediate lobes, mRNA, 995 nt] Length = 995 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 437 ccgccgccaccgccaccgccg 417
>gb|AF325155.1|AF325155 Spodoptera litura nucleopolyhedrovirus strain G2, complete genome Length = 139342 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 101973 ccgccgccaccgccaccgccg 101993
>gb|AF323731.1|AF323731 Homo sapiens OSBP-related protein 4 mRNA, complete cds Length = 2886 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 441 ggctggggcttgggctccggc 461 ||||||||||||||||||||| Sbjct: 265 ggctggggcttgggctccggc 245
>gb|AC021893.18|AC021893 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0060A14, from chromosome 10, complete sequence Length = 151343 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ccgccgccaccgccaccgccg 353 ||||||||||||||||||||| Sbjct: 34823 ccgccgccaccgccaccgccg 34803 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,416,573 Number of Sequences: 3902068 Number of extensions: 4416573 Number of successful extensions: 112618 Number of sequences better than 10.0: 738 Number of HSP's better than 10.0 without gapping: 801 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 101496 Number of HSP's gapped (non-prelim): 10957 length of query: 579 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 556 effective length of database: 17,143,297,704 effective search space: 9531673523424 effective search space used: 9531673523424 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
