ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags29k07 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY103710.1| Zea mays PCO123562 mRNA sequence Length = 770 Score = 379 bits (191), Expect = e-102 Identities = 323/364 (88%), Gaps = 5/364 (1%) Strand = Plus / Minus Query: 42 gccttcttgggggacttggtggccttcttgggagacttgggctccttgccctcc---ttc 98 ||||||||||||||||||| |||||||||||| ||||||| ||||||| || || ||| Sbjct: 560 gccttcttgggggacttggcggccttcttgggcgacttggcctccttggccgccgccttc 501 Query: 99 tccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcg 158 ||||||||| ||||||| || |||||||||||||| ||||||| ||||||||||| ||| Sbjct: 500 tccgcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcg 441 Query: 159 atggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcagg 218 ||||||||||||| |||||||||||||||||||||||| || | || ||| || |||| | Sbjct: 440 atggtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacg 381 Query: 219 tggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagc 278 |||||||||||||||||| ||||||||||||||||||| ||||| ||||| ||||||||| Sbjct: 380 tggcgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagc 321 Query: 279 agnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgac 338 | ||||||||| |||||||||||||||||||| ||| ||||||||||||| |||||||| Sbjct: 320 a-cctcggcggccaggtactcgaggacggcggccaggtagacgggggcgcccgtgccgac 262 Query: 339 gcgctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactgga 398 |||||| ||||| | ||||||||| ||||| ||||||||||||| ||||||| ||||| | Sbjct: 261 gcgctgcgcgtaccggcccttcttcaggtaccgcccgatgcggc-cgacgggaaactgca 203 Query: 399 gccc 402 |||| Sbjct: 202 gccc 199
>dbj|D38090.1|WHTPH2AD Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-9 Length = 704 Score = 379 bits (191), Expect = e-102 Identities = 270/294 (91%), Gaps = 2/294 (0%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||||||||| | |||||| |||||||||||||| ||||| ||||||||||||| Sbjct: 411 tcttggggagcagcacggagttgatgttggggatcacgccaccgtgggcgatggtgacgc 352 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 | || |||||| |||||||||||| ||| || | ||| |||||||||||||||||||||| Sbjct: 351 cagcgagcagcctgccgagctcctggtcgttgcggacagcgagcagcaggtggcgcggga 292 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcg 288 |||||||| ||||||||||||||||||| ||||| ||||| |||||||||| ||||||| Sbjct: 291 tgatgcgggtcttcttgttgtccttggccgcgttgccggcaagctccagca-cctcggcg 233 Query: 289 gcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcg 348 ||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| Sbjct: 232 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcg 173 Query: 349 tatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 || | ||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 172 tagcggcccttcttgaggtagcgcccgatgcggc-cgacggggaactggagccc 120 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 44 cttcttgggggacttggtgg 63 |||||||||||||||||||| Sbjct: 482 cttcttgggggacttggtgg 463
>ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 480 Score = 377 bits (190), Expect = e-101 Identities = 281/309 (90%), Gaps = 2/309 (0%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| ||| ||||||| ||||||||||||||||| ||||| | |||||| |||| Sbjct: 412 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 353 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 |||||||||| |||||||||||||||||||||||||||||||| ||||||| || |||| Sbjct: 352 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 293 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||||||||||||||| | | |||||||||||||| |||| |||||||||||||||| Sbjct: 292 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 233 Query: 274 ccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtg 333 |||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 232 ccagca-cctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtg 174 Query: 334 ccgacgcgctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaa 393 |||| |||||| ||||| | |||||||||||||||||| ||||| |||| |||||||||| Sbjct: 173 ccgatgcgctgcgcgtagcggcccttcttgaggtagcggccgatacggc-cgacggggaa 115 Query: 394 ctggagccc 402 ||||||||| Sbjct: 114 ctggagccc 106 Score = 48.1 bits (24), Expect = 0.022 Identities = 47/54 (87%), Gaps = 3/54 (5%) Strand = Plus / Minus Query: 41 ggccttcttgggggacttggtg---gccttcttgggagacttgggctccttgcc 91 ||||||||||||||||||| | ||||||||||| ||||||| ||||||||| Sbjct: 477 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttgcc 424
>dbj|AK121750.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087I02, full insert sequence Length = 754 Score = 377 bits (190), Expect = e-101 Identities = 281/309 (90%), Gaps = 2/309 (0%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| ||| ||||||| ||||||||||||||||| ||||| | |||||| |||| Sbjct: 502 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 443 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 |||||||||| |||||||||||||||||||||||||||||||| ||||||| || |||| Sbjct: 442 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 383 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||||||||||||||| | | |||||||||||||| |||| |||||||||||||||| Sbjct: 382 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 323 Query: 274 ccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtg 333 |||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 322 ccagca-cctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtg 264 Query: 334 ccgacgcgctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaa 393 |||| |||||||||||| | |||||||||||||||||| ||||| |||| |||||||||| Sbjct: 263 ccgatgcgctgggcgtagcggcccttcttgaggtagcggccgatacggc-cgacggggaa 205 Query: 394 ctggagccc 402 ||||||||| Sbjct: 204 ctggagccc 196 Score = 56.0 bits (28), Expect = 9e-05 Identities = 48/54 (88%), Gaps = 3/54 (5%) Strand = Plus / Minus Query: 41 ggccttcttgggggactt---ggtggccttcttgggagacttgggctccttgcc 91 |||||||||||||||||| || |||||||||||| ||||||| ||||||||| Sbjct: 567 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttgcc 514
>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence Length = 719 Score = 371 bits (187), Expect = 1e-99 Identities = 322/364 (88%), Gaps = 5/364 (1%) Strand = Plus / Minus Query: 42 gccttcttgggggacttggtggccttcttgggagacttgggctccttgc---cctccttc 98 ||||||||||||||||||| || ||||||||| ||||||| ||||||| || ||||| Sbjct: 560 gccttcttgggggacttggggggcttcttgggggacttggcctccttgggcgccgccttc 501 Query: 99 tccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcg 158 ||||||||| ||||||| || |||||||||||||| ||||||| ||||||||||| ||| Sbjct: 500 tccgcggtcttcttgggcaggagcaccgggttgatgttggggaggacgccgccgtgggcg 441 Query: 159 atggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcagg 218 ||||||||||||| |||||||||||||||||||||||| || | || ||| || |||| | Sbjct: 440 atggtgacgccggacagcagcttgccgagctcctcgtcgttgcggatggcaaggagcacg 381 Query: 219 tggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagc 278 |||||||||||||||||| ||||||||||||||||||| ||||| ||||| ||||||||| Sbjct: 380 tggcgcgggatgatgcgggtcttcttgttgtccttggcagcgttgccggccagctccagc 321 Query: 279 agnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgac 338 | ||||||||| |||||||||||||||||||| ||| ||||||||||||| |||||||| Sbjct: 320 a-cctcggcggccaggtactcgaggacggcggccaggtagacgggggcgcccgtgccgac 262 Query: 339 gcgctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactgga 398 |||||| ||||| | ||||||||| ||||| ||||||||||||| ||||||| ||||| | Sbjct: 261 gcgctgcgcgtaccggcccttcttcaggtaccgcccgatgcggc-cgacgggaaactgca 203 Query: 399 gccc 402 |||| Sbjct: 202 gccc 199
>dbj|D38087.1|WHTPH2AA Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-2 Length = 717 Score = 363 bits (183), Expect = 3e-97 Identities = 268/294 (91%), Gaps = 2/294 (0%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||||||||| | |||||| |||||||| ||||||||||| ||||||||||||| Sbjct: 434 tcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatggtgacgc 375 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 |||| |||||| |||||||||||| ||| || | |||||| ||||||||||||||||||| Sbjct: 374 cggcgagcagcctgccgagctcctggtcgttgcggacggccagcagcaggtggcgcggga 315 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcg 288 ||||||| ||||||||||||||||||| ||||| ||||| |||||||| | ||||||| Sbjct: 314 tgatgcgcgtcttcttgttgtccttggccgcgttgccggcaagctccagga-cctcggcg 256 Query: 289 gcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcg 348 ||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| Sbjct: 255 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacgcgctgggcg 196 Query: 349 tatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 || | ||||||||||||||||||||||||||||| ||||||||||||| ||||| Sbjct: 195 tagcggcccttcttgaggtagcgcccgatgcggc-cgacggggaactgcagccc 143
>dbj|D38088.1|WHTPH2AB Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-3 Length = 1153 Score = 347 bits (175), Expect = 2e-92 Identities = 266/294 (90%), Gaps = 2/294 (0%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||||||||| | |||||| |||||||| ||||||||||| ||||||||||||| Sbjct: 432 tcttggggagcagcacggagttgatgttggggatgacgccgccgtgggcgatggtgacgc 373 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 |||| |||||| |||| ||||||| ||| || | |||||| ||||||||||||||||||| Sbjct: 372 cggcgagcagcctgcccagctcctggtcgttgcggacggccagcagcaggtggcgcggga 313 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcg 288 ||||||| ||||||||||||||||||| ||||| |||||||||||||| | ||||||| Sbjct: 312 tgatgcgcgtcttcttgttgtccttggccgcgttgccggcgagctccagga-cctcggcg 254 Query: 289 gcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcg 348 ||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||| ||| Sbjct: 253 gcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgacggcctgcgcg 194 Query: 349 tatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 || | ||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 193 tagcggcccttcttgaggtagcgcccgatgcggc-cgacggggaactggagccc 141 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 44 cttcttgggggacttggtggc 64 ||||||||||||||||||||| Sbjct: 506 cttcttgggggacttggtggc 486
>dbj|AK074018.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075N03, full insert sequence Length = 797 Score = 345 bits (174), Expect = 7e-92 Identities = 277/309 (89%), Gaps = 2/309 (0%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||||||| |||| |||||||||||||||||||| || || | ||||||||||| Sbjct: 480 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 421 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 ||||||||||||| ||||| |||||||| |||||||||||||| || | || || |||| Sbjct: 420 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 361 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||| | ||||||||| ||| |||||||||||||| || |||||||||||||||| Sbjct: 360 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 301 Query: 274 ccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtg 333 |||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 300 ccagca-cctctgcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtg 242 Query: 334 ccgacgcgctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaa 393 ||||||||||||||||| | |||||||||||||||||| |||||||||| |||||||||| Sbjct: 241 ccgacgcgctgggcgtagcggcccttcttgaggtagcggccgatgcggc-cgacggggaa 183 Query: 394 ctggagccc 402 ||||||||| Sbjct: 182 ctggagccc 174
>ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 492 Score = 303 bits (153), Expect = 2e-79 Identities = 265/300 (88%), Gaps = 2/300 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||||||||||||||||||||| ||||| | ||| |||||||||||||||| Sbjct: 397 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 338 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 ||||||||||||||||||| |||||||||||||| || | || || ||||||| ||| | Sbjct: 337 tgacgccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcc 278 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 |||||||||| ||| |||||||||||||| || |||||||| || ||||| |||| | Sbjct: 277 gcgggatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagca-cc 219 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| Sbjct: 218 tcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgc 159 Query: 343 tgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 |||| ||| | ||| | |||||||||||| ||||| |||| ||||||||||||||||||| Sbjct: 158 tgggagtagcggccttgcttgaggtagcggccgatacggc-cgacggggaactggagccc 100 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 58 tggtggccttcttgggagacttggg 82 |||||||||||||||| |||||||| Sbjct: 460 tggtggccttcttgggcgacttggg 436 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 37 tggtggccttcttgggggacttgg 60 |||||||||||||||| ||||||| Sbjct: 460 tggtggccttcttgggcgacttgg 437
>dbj|AK099763.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094K03, full insert sequence Length = 912 Score = 303 bits (153), Expect = 2e-79 Identities = 265/300 (88%), Gaps = 2/300 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||||||||||||||||||||| ||||| | ||| |||||||||||||||| Sbjct: 467 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 408 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 ||||||||||||||||||| |||||||||||||| || | || || ||||||| ||| | Sbjct: 407 tgacgccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcc 348 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 |||||||||| ||| |||||||||||||| || |||||||| || ||||| |||| | Sbjct: 347 gcgggatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagca-cc 289 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| Sbjct: 288 tcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgc 229 Query: 343 tgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 |||| ||| | ||| | |||||||||||| ||||| |||| ||||||||||||||||||| Sbjct: 228 tgggagtagcggccttgcttgaggtagcggccgatacggc-cgacggggaactggagccc 170 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 58 tggtggccttcttgggagacttggg 82 |||||||||||||||| |||||||| Sbjct: 530 tggtggccttcttgggcgacttggg 506 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 37 tggtggccttcttgggggacttgg 60 |||||||||||||||| ||||||| Sbjct: 530 tggtggccttcttgggcgacttgg 507
>dbj|AK067406.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099N23, full insert sequence Length = 1097 Score = 303 bits (153), Expect = 2e-79 Identities = 265/300 (88%), Gaps = 2/300 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||||||||||||||||||||| ||||| | ||| |||||||||||||||| Sbjct: 468 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 409 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 ||||||||||||||||||| |||||||||||||| || | || || ||||||| ||| | Sbjct: 408 tgacgccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcc 349 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 |||||||||| ||| |||||||||||||| || |||||||| || ||||| |||| | Sbjct: 348 gcgggatgatccggttcttcttgttgtcccgcgccgcgttccccgcaagctcgagca-cc 290 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| Sbjct: 289 tcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcgc 230 Query: 343 tgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 |||| ||| | ||| | |||||||||||| ||||| |||| ||||||||||||||||||| Sbjct: 229 tgggagtagcggccttgcttgaggtagcggccgatacggc-cgacggggaactggagccc 171 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 58 tggtggccttcttgggagacttggg 82 |||||||||||||||| |||||||| Sbjct: 531 tggtggccttcttgggcgacttggg 507 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 37 tggtggccttcttgggggacttgg 60 |||||||||||||||| ||||||| Sbjct: 531 tggtggccttcttgggcgacttgg 508
>gb|BT019008.1| Zea mays clone Contig499.F mRNA sequence Length = 674 Score = 299 bits (151), Expect = 4e-78 Identities = 273/310 (88%), Gaps = 3/310 (0%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| ||| ||||||| ||||| ||||||||||| ||||| | ||||||||||| Sbjct: 463 ccttctccgccgtcttcttgggcagcaggaccgggttgatgttgggcaacacgccgccgt 404 Query: 154 gcgcgatggtgacgccggccagcagc-ttgccgagctcctcgtcattcctgacggcgagc 212 | |||||||| ||||||| ||||||| || |||||||||||||| || | || || ||| Sbjct: 403 gggcgatggtcacgccggtcagcagccttcccgagctcctcgtcgttgcggatcgccagc 344 Query: 213 agcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagc 272 |||| ||||||||||| |||||| ||||||||||||||||||| ||||| ||||||||| Sbjct: 343 agcacgtggcgcgggacgatgcgcgtcttcttgttgtccttggcagcgttgccggcgagc 284 Query: 273 tccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggt 332 ||||| | ||| |||||||||||||| |||||||| |||||| |||||||||| ||| | Sbjct: 283 tccagga-cctcagcggcgaggtactccaggacggccgcgaggtagacgggggcaccgct 225 Query: 333 gccgacgcgctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacgggga 392 |||||||||||| ||||| | ||||||||||||||||||||||||||||| ||||||||| Sbjct: 224 gccgacgcgctgcgcgtagcggcccttcttgaggtagcgcccgatgcggc-cgacgggga 166 Query: 393 actggagccc 402 |||||||||| Sbjct: 165 actggagccc 156 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 42 gccttcttgggggacttggtggccttcttgggagacttgggctccttgc 90 ||||||||||||||||||| |||||||||||| ||||||| |||||||| Sbjct: 527 gccttcttgggggacttggcggccttcttgggcgacttggcctccttgc 479
>gb|AY103585.1| Zea mays PCO123564 mRNA sequence Length = 1953 Score = 274 bits (138), Expect = 2e-70 Identities = 268/309 (86%), Gaps = 2/309 (0%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| | | ||||||| || ||||| | || ||| ||||||| |||||||||| Sbjct: 623 ccttctccgccgccttcttgggcaggagcacggagtggatgttggggaggacgccgccgt 564 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 |||||||||||||||||||||||||||| |||||||||||||| || | || || || | Sbjct: 563 gcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgttgcggatcgccagga 504 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| |||||||||||||||||| ||||||||||||| || || |||||||| || | || Sbjct: 503 gcacgtggcgcgggatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaact 444 Query: 274 ccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtg 333 |||| | |||||||||||||||||| ||||||||||||||| ||||||||||||| ||| Sbjct: 443 ccagaa-cctcggcggcgaggtactccaggacggcggcgaggtagacgggggcgccagtg 385 Query: 334 ccgacgcgctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaa 393 || |||||||| ||||| | |||||||||||||||||||||||| |||| |||||||||| Sbjct: 384 cccacgcgctgcgcgtaccggcccttcttgaggtagcgcccgatccggc-cgacggggaa 326 Query: 394 ctggagccc 402 ||| ||||| Sbjct: 325 ctgcagccc 317 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 42 gccttcttgggggacttggtggccttcttgggagacttgggctccttgc 90 ||||||||||||||||||| | |||||||||| |||||||||||||||| Sbjct: 687 gccttcttgggggacttggcgcccttcttgggggacttgggctccttgc 639
>gb|BT019315.1| Zea mays clone Contig989.F mRNA sequence Length = 699 Score = 258 bits (130), Expect = 1e-65 Identities = 266/309 (86%), Gaps = 2/309 (0%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| | | ||||||| || ||||| | || ||| ||||||| ||||| |||| Sbjct: 474 ccttctccgccgccttcttgggcaggagcacggagtggatgttggggaggacgccaccgt 415 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 |||||||||||||||||||||||||||| |||||||||||||| || | || || || | Sbjct: 414 gcgcgatggtgacgccggccagcagcttcccgagctcctcgtcgttgcggatcgccagga 355 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| |||||||||||||||||| ||||||||||||| || || |||||||| || | || Sbjct: 354 gcacgtggcgcgggatgatgcgcgtcttcttgttgtctttcgccgcgttccctgccaact 295 Query: 274 ccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtg 333 |||| | |||||||||||||||||| || |||||||||||| ||||||||||||| ||| Sbjct: 294 ccagaa-cctcggcggcgaggtactccagaacggcggcgaggtagacgggggcgccagtg 236 Query: 334 ccgacgcgctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaa 393 || |||||||| ||||| | |||||||||||||||||||||||| |||| |||||||||| Sbjct: 235 cccacgcgctgcgcgtaccggcccttcttgaggtagcgcccgatccggc-cgacggggaa 177 Query: 394 ctggagccc 402 ||| ||||| Sbjct: 176 ctgcagccc 168 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 42 gccttcttgggggacttggtggccttcttgggagacttgggctccttgc 90 ||||||||||||||||||| | |||||||||| |||||||||||||||| Sbjct: 538 gccttcttgggggacttggcgcccttcttgggggacttgggctccttgc 490
>gb|U08225.1|ZMU08225 Zea mays W-22 histone H2A mRNA, complete cds Length = 714 Score = 242 bits (122), Expect = 7e-61 Identities = 261/306 (85%), Gaps = 2/306 (0%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| ||| ||||||| ||||| || |||||||| ||||||| ||| ||||||| Sbjct: 480 ccttctccgccgtcttcttgggcagcagaacagggttgatattggggagcacaccgccgt 421 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 | |||||||| |||||| ||| |||||| || ||||||||||| |||| || || || | Sbjct: 420 gagcgatggtcacgccgcccaacagcttcccaagctcctcgtcgttccggatcgccagaa 361 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||||||||| || ||||| |||||||||||||| |||| || || |||||||||| Sbjct: 360 gcacgtggcgcggaataatgcgagtcttcttgttgtccctggcagcattaccggcgagct 301 Query: 274 ccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtg 333 |||| | ||| ||||||||||| |||||||| ||||||||| ||||||||||||||||| Sbjct: 300 ccag-aacctcagcggcgaggtattcgaggacagcggcgaggtagacgggggcgccggtg 242 Query: 334 ccgacgcgctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaa 393 ||||| ||| ||||| | ||||||||| | ||||||||||||||||| |||||||||| Sbjct: 241 ccgacrrnctgcgcgtagcggcccttcttcaagtagcgcccgatgcggc-cgacggggaa 183 Query: 394 ctggag 399 |||||| Sbjct: 182 ctggag 177 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 42 gccttcttgggggacttggtggccttcttgggagacttgggctccttgc 90 |||||||| |||||||||| |||||||||||| ||||| | |||||||| Sbjct: 544 gccttcttaggggacttggcggccttcttgggcgactttgcctccttgc 496
>gb|BT016301.1| Zea mays clone Contig134 mRNA sequence Length = 846 Score = 228 bits (115), Expect = 1e-56 Identities = 249/291 (85%), Gaps = 2/291 (0%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||||||||| |||||||| ||||| | || |||||||| ||||||||||||| Sbjct: 395 tcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacgc 336 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 ||||||| ||||| |||||||||||||| || | || || ||||| | ||| ||||||| Sbjct: 335 cggccagtagcttcccgagctcctcgtcgttgcggatcgccagcagtacgtgccgcggga 276 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcg 288 |||| ||| |||||||||||||| || |||||||| || | ||| || || ||||||| Sbjct: 275 tgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggag-ctcggcg 217 Query: 289 gcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcg 348 |||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||| | Sbjct: 216 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 157 Query: 349 tatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggag 399 || | |||| |||||||||||| ||||| |||| | |||||||||||||| Sbjct: 156 tagcgaccctgcttgaggtagcggccgatacggc-ctacggggaactggag 107
>gb|AY109370.1| Zea mays CL2029_4 mRNA sequence Length = 1051 Score = 228 bits (115), Expect = 1e-56 Identities = 261/309 (84%), Gaps = 2/309 (0%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| ||| ||||||| ||||| || |||||||| ||||||| ||| ||||||| Sbjct: 499 ccttctccgccgtcttcttgggcagcagaacagggttgatattggggagcacaccgccgt 440 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 | |||||||| |||||| |||||||||| || ||||||||||| |||| || || || | Sbjct: 439 gagcgatggtcacgccgcccagcagcttcccaagctcctcgtcgttccggatcgccagaa 380 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||||||||| || ||||| |||||||||||||| |||| || || || ||||||| Sbjct: 379 gcacgtggcgcggaataatgcgagtcttcttgttgtccctggcagcattaccagcgagct 320 Query: 274 ccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtg 333 |||| | ||| ||||||||||| |||||||| ||||||||| |||| |||||||| Sbjct: 319 ccag-aacctcagcggcgaggtattcgaggacagcggcgaggtagacnnnnncgccggtg 261 Query: 334 ccgacgcgctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaa 393 ||||| ||||| ||||| | ||||||||| | ||||||||||||||||| |||||||||| Sbjct: 260 ccgacacgctgcgcgtagcggcccttcttcaagtagcgcccgatgcggc-cgacggggaa 202 Query: 394 ctggagccc 402 ||||||||| Sbjct: 201 ctggagccc 193 Score = 40.1 bits (20), Expect = 5.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 55 acttggtggccttcttgggagacttgggctccttgc 90 |||||| |||||||||||| ||||| | |||||||| Sbjct: 550 acttggcggccttcttgggcgactttgcctccttgc 515
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 226 bits (114), Expect = 4e-56 Identities = 168/186 (90%) Strand = Plus / Plus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| ||| ||||||| ||||||||||||||||| ||||| | |||||| |||| Sbjct: 9471210 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 9471269 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 |||||||||| |||||||||||||||||||||||||||||||| ||||||| || |||| Sbjct: 9471270 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 9471329 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||||||||||||||| | | |||||||||||||| |||| |||||||||||||||| Sbjct: 9471330 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 9471389 Query: 274 ccagca 279 |||||| Sbjct: 9471390 ccagca 9471395 Score = 168 bits (85), Expect = 9e-39 Identities = 113/121 (93%), Gaps = 1/121 (0%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| ||| Sbjct: 9471498 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 9471557 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 ||||||||| | |||||||||||||||||| ||||| |||| |||||||||||||||||| Sbjct: 9471558 ctgggcgtagcggcccttcttgaggtagcggccgatacggc-cgacggggaactggagcc 9471616 Query: 402 c 402 | Sbjct: 9471617 c 9471617 Score = 129 bits (65), Expect = 8e-27 Identities = 108/121 (89%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 ||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||| Sbjct: 28998065 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 28998006 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 || ||||| |||| |||||||||||| ||||||||| |||||||||||||||||| Sbjct: 28998005 ctccgcgtacttgccggccttgaggtagcgggcgatgcggc-cgacggggaactggagcc 28997947 Query: 402 c 402 | Sbjct: 28997946 c 28997946 Score = 58.0 bits (29), Expect = 2e-05 Identities = 42/45 (93%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 358 ttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 |||||||||||||||||||| |||| |||||||||| |||||||| Sbjct: 2464021 ttcttgaggtagcgcccgatacggc-cgacggggaattggagccc 2463978 Score = 56.0 bits (28), Expect = 9e-05 Identities = 48/54 (88%), Gaps = 3/54 (5%) Strand = Plus / Plus Query: 41 ggccttcttgggggactt---ggtggccttcttgggagacttgggctccttgcc 91 |||||||||||||||||| || |||||||||||| ||||||| ||||||||| Sbjct: 9471145 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttgcc 9471198 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Minus Query: 238 tcttcttgttgtccttggcggcgttcccggcgagctccagca 279 |||||||||||||| | || ||||||||||| |||||||||| Sbjct: 28998212 tcttcttgttgtccctcgccgcgttcccggccagctccagca 28998171 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 303 gacggcggcgaggaagacgg 322 |||||||||||||||||||| Sbjct: 27412387 gacggcggcgaggaagacgg 27412406
>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0002D01, from chromosome 3, complete sequence Length = 187589 Score = 226 bits (114), Expect = 4e-56 Identities = 168/186 (90%) Strand = Plus / Plus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| ||| ||||||| ||||||||||||||||| ||||| | |||||| |||| Sbjct: 168610 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 168669 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 |||||||||| |||||||||||||||||||||||||||||||| ||||||| || |||| Sbjct: 168670 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 168729 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||||||||||||||| | | |||||||||||||| |||| |||||||||||||||| Sbjct: 168730 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 168789 Query: 274 ccagca 279 |||||| Sbjct: 168790 ccagca 168795 Score = 168 bits (85), Expect = 9e-39 Identities = 113/121 (93%), Gaps = 1/121 (0%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| ||| Sbjct: 168898 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 168957 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 ||||||||| | |||||||||||||||||| ||||| |||| |||||||||||||||||| Sbjct: 168958 ctgggcgtagcggcccttcttgaggtagcggccgatacggc-cgacggggaactggagcc 169016 Query: 402 c 402 | Sbjct: 169017 c 169017 Score = 56.0 bits (28), Expect = 9e-05 Identities = 48/54 (88%), Gaps = 3/54 (5%) Strand = Plus / Plus Query: 41 ggccttcttgggggactt---ggtggccttcttgggagacttgggctccttgcc 91 |||||||||||||||||| || |||||||||||| ||||||| ||||||||| Sbjct: 168545 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttgcc 168598
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 226 bits (114), Expect = 4e-56 Identities = 168/186 (90%) Strand = Plus / Plus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| ||| ||||||| ||||||||||||||||| ||||| | |||||| |||| Sbjct: 9469331 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 9469390 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 |||||||||| |||||||||||||||||||||||||||||||| ||||||| || |||| Sbjct: 9469391 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 9469450 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||||||||||||||| | | |||||||||||||| |||| |||||||||||||||| Sbjct: 9469451 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 9469510 Query: 274 ccagca 279 |||||| Sbjct: 9469511 ccagca 9469516 Score = 168 bits (85), Expect = 9e-39 Identities = 113/121 (93%), Gaps = 1/121 (0%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| ||| Sbjct: 9469619 ctcggcagcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 9469678 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 ||||||||| | |||||||||||||||||| ||||| |||| |||||||||||||||||| Sbjct: 9469679 ctgggcgtagcggcccttcttgaggtagcggccgatacggc-cgacggggaactggagcc 9469737 Query: 402 c 402 | Sbjct: 9469738 c 9469738 Score = 129 bits (65), Expect = 8e-27 Identities = 108/121 (89%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 ||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||| Sbjct: 29089487 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 29089428 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 || ||||| |||| |||||||||||| ||||||||| |||||||||||||||||| Sbjct: 29089427 ctccgcgtacttgccggccttgaggtagcgggcgatgcggc-cgacggggaactggagcc 29089369 Query: 402 c 402 | Sbjct: 29089368 c 29089368 Score = 58.0 bits (29), Expect = 2e-05 Identities = 42/45 (93%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 358 ttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 |||||||||||||||||||| |||| |||||||||| |||||||| Sbjct: 2464131 ttcttgaggtagcgcccgatacggc-cgacggggaattggagccc 2464088 Score = 56.0 bits (28), Expect = 9e-05 Identities = 48/54 (88%), Gaps = 3/54 (5%) Strand = Plus / Plus Query: 41 ggccttcttgggggactt---ggtggccttcttgggagacttgggctccttgcc 91 |||||||||||||||||| || |||||||||||| ||||||| ||||||||| Sbjct: 9469266 ggccttcttgggggacttcccggcggccttcttgggcgacttggcctccttgcc 9469319 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Minus Query: 238 tcttcttgttgtccttggcggcgttcccggcgagctccagca 279 |||||||||||||| | || ||||||||||| |||||||||| Sbjct: 29089634 tcttcttgttgtccctcgccgcgttcccggccagctccagca 29089593 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 303 gacggcggcgaggaagacgg 322 |||||||||||||||||||| Sbjct: 27503710 gacggcggcgaggaagacgg 27503729
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 226 bits (114), Expect = 4e-56 Identities = 168/186 (90%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| ||| ||||||| ||||||||||||||||| ||||| | |||||| |||| Sbjct: 17417162 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 17417103 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 |||||||||| |||||||||||||||||||||||||||||||| ||||||| || |||| Sbjct: 17417102 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 17417043 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||||||||||||||| | | |||||||||||||| |||| |||||||||||||||| Sbjct: 17417042 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 17416983 Query: 274 ccagca 279 |||||| Sbjct: 17416982 ccagca 17416977 Score = 168 bits (85), Expect = 9e-39 Identities = 113/121 (93%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| Sbjct: 17416864 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 17416805 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 ||| ||||| | |||||||||||||||||| ||||| |||| |||||||||||||||||| Sbjct: 17416804 ctgcgcgtagcggcccttcttgaggtagcggccgatacggc-cgacggggaactggagcc 17416746 Query: 402 c 402 | Sbjct: 17416745 c 17416745 Score = 63.9 bits (32), Expect = 4e-07 Identities = 108/132 (81%), Gaps = 1/132 (0%) Strand = Plus / Minus Query: 65 cttcttgggagacttgggctccttgccctccttctccgcggtcctcttggggagcagcac 124 |||||| || ||||||| ||||||| |||||||||||| |||||| ||||| ||||| Sbjct: 43063433 cttctttggcgacttggcctccttgttggccttctccgcggccctctttgggaggagcac 43063374 Query: 125 cgggttgatcttggggatcacgccgccgtgcgcgatggtga-cgccggccagcagcttgc 183 | ||||||| ||||| | ||| ||||| || |||||||| | | || | ||||||||| Sbjct: 43063373 caggttgatgttgggcagcactccgccatgggcgatggtcacccccagacagcagcttct 43063314 Query: 184 cgagctcctcgt 195 |||||||||||| Sbjct: 43063313 cgagctcctcgt 43063302 Score = 48.1 bits (24), Expect = 0.022 Identities = 47/54 (87%), Gaps = 3/54 (5%) Strand = Plus / Minus Query: 41 ggccttcttgggggacttggtggc---cttcttgggagacttgggctccttgcc 91 ||||||||||||||||||| ||| ||||||||| ||||||| ||||||||| Sbjct: 17417227 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttgcc 17417174
>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0507H06 Length = 136351 Score = 226 bits (114), Expect = 4e-56 Identities = 168/186 (90%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||| ||| ||||||| ||||||||||||||||| ||||| | |||||| |||| Sbjct: 70554 ccttctccgccgtcttcttgggcagcagcaccgggttgatgttgggcagcacgcctccgt 70495 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 |||||||||| |||||||||||||||||||||||||||||||| ||||||| || |||| Sbjct: 70494 gcgcgatggtcacgccggccagcagcttgccgagctcctcgtcgttcctgatcgccagca 70435 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||||||||||||||| | | |||||||||||||| |||| |||||||||||||||| Sbjct: 70434 gcacgtggcgcgggatgatcctgttcttcttgttgtccctggccgcgttcccggcgagct 70375 Query: 274 ccagca 279 |||||| Sbjct: 70374 ccagca 70369 Score = 168 bits (85), Expect = 9e-39 Identities = 113/121 (93%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| Sbjct: 70256 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 70197 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 ||| ||||| | |||||||||||||||||| ||||| |||| |||||||||||||||||| Sbjct: 70196 ctgcgcgtagcggcccttcttgaggtagcggccgatacggc-cgacggggaactggagcc 70138 Query: 402 c 402 | Sbjct: 70137 c 70137 Score = 48.1 bits (24), Expect = 0.022 Identities = 47/54 (87%), Gaps = 3/54 (5%) Strand = Plus / Minus Query: 41 ggccttcttgggggacttggtggc---cttcttgggagacttgggctccttgcc 91 ||||||||||||||||||| ||| ||||||||| ||||||| ||||||||| Sbjct: 70619 ggccttcttgggggacttgccggccgccttcttgggcgacttggcctccttgcc 70566
>gb|AY104486.1| Zea mays PCO109435 mRNA sequence Length = 992 Score = 220 bits (111), Expect = 3e-54 Identities = 248/291 (85%), Gaps = 2/291 (0%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||||||||| |||||||| ||||| | || |||||||| ||||||||||||| Sbjct: 466 tcttggggagcagcacagggttgatgttgggcagaaccccgccgtgtgcgatggtgacgc 407 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 ||||||| ||||| ||||||||||| || || | || || ||||| | ||| ||||||| Sbjct: 406 cggccagtagcttcccgagctcctcatcgttgcggatcgccagcagtacgtgtcgcggga 347 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcg 288 |||| ||| |||||||||||||| || |||||||| || | ||| || || ||||||| Sbjct: 346 tgatccggttcttcttgttgtcccgcgctgcgttccccgccaactcgaggag-ctcggcg 288 Query: 289 gcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcg 348 |||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||| | Sbjct: 287 gcgaggtactcgaggacggcagcgaggtagacgggggcgccggtgccgacacgctgggag 228 Query: 349 tatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggag 399 || | |||| |||||||||||| ||||| |||| | |||||||||||||| Sbjct: 227 tagcgaccctgcttgaggtagcggccgatacggc-ctacggggaactggag 178
>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274) Length = 2546 Score = 204 bits (103), Expect = 2e-49 Identities = 154/171 (90%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | |||||| ||||||| ||||||||||| ||||||||||||| Sbjct: 2233 tcttgggcagcagcacggagttgattgtggggatgacgccgccgtgggcgatggtgacgc 2174 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 |||| |||||| |||||||||||| ||| || | |||||||||||||||||||||||||| Sbjct: 2173 cggcaagcagcctgccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 2114 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagca 279 |||||||| ||||||||||||||||||| ||||| ||||| |||||||||| Sbjct: 2113 tgatgcgggtcttcttgttgtccttggctgcgttgccggcaagctccagca 2063 Score = 184 bits (93), Expect = 1e-43 Identities = 115/121 (95%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||| Sbjct: 1966 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatgcg 1907 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 ||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 1906 ctgggcgtagcggcccttcttgaggtagcgcccgatgcggc-cgacggggaactggagcc 1848 Query: 402 c 402 | Sbjct: 1847 c 1847 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 44 cttcttgggggacttggtgg 63 |||||||||||||||||||| Sbjct: 2304 cttcttgggggacttggtgg 2285
>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds Length = 2546 Score = 204 bits (103), Expect = 2e-49 Identities = 154/171 (90%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | |||||| ||||||| ||||||||||| ||||||||||||| Sbjct: 2233 tcttgggcagcagcacggagttgattgtggggatgacgccgccgtgggcgatggtgacgc 2174 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 |||| |||||| |||||||||||| ||| || | |||||||||||||||||||||||||| Sbjct: 2173 cggcaagcagcctgccgagctcctggtcgttgcggacggcgagcagcaggtggcgcggga 2114 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagca 279 |||||||| ||||||||||||||||||| ||||| ||||| |||||||||| Sbjct: 2113 tgatgcgggtcttcttgttgtccttggctgcgttgccggcaagctccagca 2063 Score = 184 bits (93), Expect = 1e-43 Identities = 115/121 (95%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||| Sbjct: 1966 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggagccgatgcg 1907 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 ||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 1906 ctgggcgtagcggcccttcttgaggtagcgcccgatgcggc-cgacggggaactggagcc 1848 Query: 402 c 402 | Sbjct: 1847 c 1847 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 44 cttcttgggggacttggtgg 63 |||||||||||||||||||| Sbjct: 2304 cttcttgggggacttggtgg 2285
>gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence Length = 772 Score = 190 bits (96), Expect = 2e-45 Identities = 246/294 (83%), Gaps = 2/294 (0%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||| || || ||||| || ||||| | ||| |||||||||||||||||||| | Sbjct: 447 tcttggggaggaggacggggttaatgttgggcagcacaccgccgtgcgcgatggtgaccc 388 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 | ||||||||||||||||||||||||| || | || |||||| || ||||||||||||| Sbjct: 387 cacccagcagcttgccgagctcctcgtcgttgcggatggcgaggaggaggtggcgcggga 328 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcg 288 |||||||| | ||||||||||| || ||||| || || |||||||| | ||| ||| Sbjct: 327 tgatgcgggttttcttgttgtcgcgcgccgcgttgccagccagctccagga-cctcagcg 269 Query: 289 gcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcg 348 ||||||||||||||||||||||| ||||| ||||| ||||| ||||| |||||||| ||| Sbjct: 268 gcgaggtactcgaggacggcggccaggaacacgggagcgcccgtgcccacgcgctgcgcg 209 Query: 349 tatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 || | || ||||| ||||| || |||||||||| | |||||||| ||||||| Sbjct: 208 taccgccctttcttcaggtaccgtccgatgcggccc-acggggaaaaggagccc 156 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 ggccttcttgggggacttgg 60 |||||||||||||||||||| Sbjct: 506 ggccttcttgggggacttgg 487
>ref|XM_475081.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 522 Score = 184 bits (93), Expect = 1e-43 Identities = 112/117 (95%), Gaps = 1/117 (0%) Strand = Plus / Minus Query: 286 gcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgg 345 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 212 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgctgg 153 Query: 346 gcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 ||||| | |||||||||||||||||| |||||||||| ||||||||||||||||||| Sbjct: 152 gcgtagcggcccttcttgaggtagcggccgatgcggc-cgacggggaactggagccc 97 Score = 178 bits (90), Expect = 9e-42 Identities = 162/186 (87%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||||||| |||| |||||||||||||||||||| || || | ||||||||||| Sbjct: 454 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 395 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 ||||||||||||| ||||| |||||||| |||||||||||||| || | || || |||| Sbjct: 394 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 335 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||| | ||||||||| ||| |||||||||||||| || |||||||||||||||| Sbjct: 334 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 275 Query: 274 ccagca 279 |||||| Sbjct: 274 ccagca 269
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 184 bits (93), Expect = 1e-43 Identities = 112/117 (95%), Gaps = 1/117 (0%) Strand = Plus / Minus Query: 286 gcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgg 345 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 707147 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgctgg 707088 Query: 346 gcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 ||||| | |||||||||||||||||| |||||||||| ||||||||||||||||||| Sbjct: 707087 gcgtagcggcccttcttgaggtagcggccgatgcggc-cgacggggaactggagccc 707032 Score = 178 bits (90), Expect = 9e-42 Identities = 162/186 (87%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||||||| |||| |||||||||||||||||||| || || | ||||||||||| Sbjct: 707417 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 707358 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 ||||||||||||| ||||| |||||||| |||||||||||||| || | || || |||| Sbjct: 707357 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 707298 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||| | ||||||||| ||| |||||||||||||| || |||||||||||||||| Sbjct: 707297 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 707238 Query: 274 ccagca 279 |||||| Sbjct: 707237 ccagca 707232 Score = 168 bits (85), Expect = 9e-39 Identities = 133/149 (89%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||||||||||||||||||||| ||||| | ||| |||||||||||||||| Sbjct: 22512323 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 22512382 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 ||||||||||||||||||| |||||||||||||| || | || || ||||||| ||| | Sbjct: 22512383 tgacgccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcc 22512442 Query: 223 gcgggatgatgcggctcttcttgttgtcc 251 |||||||||| ||| |||||||||||||| Sbjct: 22512443 gcgggatgatccggttcttcttgttgtcc 22512471 Score = 153 bits (77), Expect = 5e-34 Identities = 111/121 (91%), Gaps = 1/121 (0%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| Sbjct: 22512577 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 22512636 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 ||||| ||| | ||| | |||||||||||| ||||| |||| |||||||||||||||||| Sbjct: 22512637 ctgggagtagcggccttgcttgaggtagcggccgatacggc-cgacggggaactggagcc 22512695 Query: 402 c 402 | Sbjct: 22512696 c 22512696 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 58 tggtggccttcttgggagacttggg 82 |||||||||||||||| |||||||| Sbjct: 22512260 tggtggccttcttgggcgacttggg 22512284 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 37 tggtggccttcttgggggacttgg 60 |||||||||||||||| ||||||| Sbjct: 22512260 tggtggccttcttgggcgacttgg 22512283 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 329 cggtgccgacgcgctgggcg 348 |||||||||||||||||||| Sbjct: 1869159 cggtgccgacgcgctgggcg 1869140
>gb|AC093921.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0041A22, complete sequence Length = 117919 Score = 184 bits (93), Expect = 1e-43 Identities = 112/117 (95%), Gaps = 1/117 (0%) Strand = Plus / Minus Query: 286 gcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgg 345 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 52346 gcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgacgcgctgg 52287 Query: 346 gcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 ||||| | |||||||||||||||||| |||||||||| ||||||||||||||||||| Sbjct: 52286 gcgtagcggcccttcttgaggtagcggccgatgcggc-cgacggggaactggagccc 52231 Score = 178 bits (90), Expect = 9e-42 Identities = 162/186 (87%) Strand = Plus / Minus Query: 94 ccttctccgcggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgt 153 |||||||||||||| |||| |||||||||||||||||||| || || | ||||||||||| Sbjct: 52616 ccttctccgcggtcttcttcgggagcagcaccgggttgatgttcggcagcacgccgccgt 52557 Query: 154 gcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagca 213 ||||||||||||| ||||| |||||||| |||||||||||||| || | || || |||| Sbjct: 52556 gcgcgatggtgaccccggcgagcagcttcccgagctcctcgtcgttgcggatcgccagca 52497 Query: 214 gcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagct 273 ||| ||| | ||||||||| ||| |||||||||||||| || |||||||||||||||| Sbjct: 52496 gcacgtgcctcgggatgatccggttcttcttgttgtcccgcgccgcgttcccggcgagct 52437 Query: 274 ccagca 279 |||||| Sbjct: 52436 ccagca 52431
>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full insert sequence Length = 824 Score = 176 bits (89), Expect = 4e-41 Identities = 185/216 (85%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| || ||||||||| ||||||||| ||||| | ||||||||| |||||||||| Sbjct: 450 ttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctcctcg 391 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 || || | || |||||| | | ||||||||| | |||||| |||||||||||||| | Sbjct: 390 tcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtccctc 331 Query: 255 gcggcgttcccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgag 314 || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 330 gccgcgttcccggcgagctccagca-cctcggcggcgaggtactcgaggacggcggcgag 272 Query: 315 gaagacgggggcgccggtgccgacgcgctgggcgta 350 | ||||||| ||||||| ||||||||||| |||||| Sbjct: 271 gtagacgggagcgccggcgccgacgcgctcggcgta 236
>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full insert sequence Length = 733 Score = 176 bits (89), Expect = 4e-41 Identities = 185/216 (85%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| || ||||||||| ||||||||| ||||| | ||||||||| |||||||||| Sbjct: 449 ttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctcctcg 390 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 || || | || |||||| | | ||||||||| | |||||| |||||||||||||| | Sbjct: 389 tcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtccctc 330 Query: 255 gcggcgttcccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgag 314 || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 329 gccgcgttcccggcgagctccagca-cctcggcggcgaggtactcgaggacggcggcgag 271 Query: 315 gaagacgggggcgccggtgccgacgcgctgggcgta 350 | ||||||| ||||||| ||||||||||| |||||| Sbjct: 270 gtagacgggagcgccggcgccgacgcgctcggcgta 235
>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete sequence Length = 93826 Score = 168 bits (85), Expect = 9e-39 Identities = 133/149 (89%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||||||||||||||||||||| ||||| | ||| |||||||||||||||| Sbjct: 7373 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 7432 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 ||||||||||||||||||| |||||||||||||| || | || || ||||||| ||| | Sbjct: 7433 tgacgccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcc 7492 Query: 223 gcgggatgatgcggctcttcttgttgtcc 251 |||||||||| ||| |||||||||||||| Sbjct: 7493 gcgggatgatccggttcttcttgttgtcc 7521 Score = 153 bits (77), Expect = 5e-34 Identities = 111/121 (91%), Gaps = 1/121 (0%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| Sbjct: 7627 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 7686 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 ||||| ||| | ||| | |||||||||||| ||||| |||| |||||||||||||||||| Sbjct: 7687 ctgggagtagcggccttgcttgaggtagcggccgatacggc-cgacggggaactggagcc 7745 Query: 402 c 402 | Sbjct: 7746 c 7746 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 58 tggtggccttcttgggagacttggg 82 |||||||||||||||| |||||||| Sbjct: 7310 tggtggccttcttgggcgacttggg 7334 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 37 tggtggccttcttgggggacttgg 60 |||||||||||||||| ||||||| Sbjct: 7310 tggtggccttcttgggcgacttgg 7333
>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05, complete sequence Length = 163130 Score = 168 bits (85), Expect = 9e-39 Identities = 133/149 (89%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||||||||||||||||||||| ||||| | ||| |||||||||||||||| Sbjct: 101730 cggtcttcttggggagcagcaccgggttgatgttgggcagcaccccgccgtgcgcgatgg 101789 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 ||||||||||||||||||| |||||||||||||| || | || || ||||||| ||| | Sbjct: 101790 tgacgccggccagcagcttcccgagctcctcgtcgttgcggatcgccagcagcacgtgcc 101849 Query: 223 gcgggatgatgcggctcttcttgttgtcc 251 |||||||||| ||| |||||||||||||| Sbjct: 101850 gcgggatgatccggttcttcttgttgtcc 101878 Score = 153 bits (77), Expect = 5e-34 Identities = 111/121 (91%), Gaps = 1/121 (0%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| Sbjct: 101984 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggtgccgatgcg 102043 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 ||||| ||| | ||| | |||||||||||| ||||| |||| |||||||||||||||||| Sbjct: 102044 ctgggagtagcggccttgcttgaggtagcggccgatacggc-cgacggggaactggagcc 102102 Query: 402 c 402 | Sbjct: 102103 c 102103 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 58 tggtggccttcttgggagacttggg 82 |||||||||||||||| |||||||| Sbjct: 101667 tggtggccttcttgggcgacttggg 101691 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 37 tggtggccttcttgggggacttgg 60 |||||||||||||||| ||||||| Sbjct: 101667 tggtggccttcttgggcgacttgg 101690
>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full insert sequence Length = 724 Score = 163 bits (82), Expect = 5e-37 Identities = 146/165 (88%), Gaps = 2/165 (1%) Strand = Plus / Minus Query: 238 tcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcggcgaggtac 297 |||||||||||||| | || ||||||||||| |||||||||| |||||||||||||||| Sbjct: 345 tcttcttgttgtccctcgccgcgttcccggccagctccagca-cctcggcggcgaggtac 287 Query: 298 tcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtatctgccc 357 ||||||||||||| |||| ||||||||||||||| ||||||||||| ||||| |||| Sbjct: 286 tcgaggacggcggagaggtagacgggggcgccggcgccgacgcgctccgcgtacttgccg 227 Query: 358 ttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 |||||||||||| ||||||||| ||||||||||||||||||| Sbjct: 226 gccttgaggtagcgggcgatgcggc-cgacggggaactggagccc 183
>ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA Length = 823 Score = 161 bits (81), Expect = 2e-36 Identities = 183/216 (84%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| |||||||||||| ||||||||| ||||| | ||||||||| | ||||||| Sbjct: 484 ttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactcctcg 425 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 || || | || |||||| | | ||||||||| | ||||||| |||||||||||||| | Sbjct: 424 tcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtccctc 365 Query: 255 gcggcgttcccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgag 314 || ||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||| Sbjct: 364 gccgcgttcccggcgagctcgagca-cctcagcggcgaggtactcgaggacggcggcgag 306 Query: 315 gaagacgggggcgccggtgccgacgcgctgggcgta 350 | |||||||||| |||| ||||||||||| |||||| Sbjct: 305 gtagacgggggccccggcgccgacgcgctcggcgta 270
>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full insert sequence Length = 823 Score = 161 bits (81), Expect = 2e-36 Identities = 183/216 (84%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| |||||||||||| ||||||||| ||||| | ||||||||| | ||||||| Sbjct: 484 ttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactcctcg 425 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 || || | || |||||| | | ||||||||| | ||||||| |||||||||||||| | Sbjct: 424 tcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtccctc 365 Query: 255 gcggcgttcccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgag 314 || ||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||| Sbjct: 364 gccgcgttcccggcgagctcgagca-cctcagcggcgaggtactcgaggacggcggcgag 306 Query: 315 gaagacgggggcgccggtgccgacgcgctgggcgta 350 | |||||||||| |||| ||||||||||| |||||| Sbjct: 305 gtagacgggggccccggcgccgacgcgctcggcgta 270
>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full insert sequence Length = 1718 Score = 161 bits (81), Expect = 2e-36 Identities = 183/216 (84%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| |||||||||||| ||||||||| ||||| | ||||||||| | ||||||| Sbjct: 485 ttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactcctcg 426 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 || || | || |||||| | | ||||||||| | ||||||| |||||||||||||| | Sbjct: 425 tcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtccctc 366 Query: 255 gcggcgttcccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgag 314 || ||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||| Sbjct: 365 gccgcgttcccggcgagctcgagca-cctcagcggcgaggtactcgaggacggcggcgag 307 Query: 315 gaagacgggggcgccggtgccgacgcgctgggcgta 350 | |||||||||| |||| ||||||||||| |||||| Sbjct: 306 gtagacgggggccccggcgccgacgcgctcggcgta 271
>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full insert sequence Length = 747 Score = 151 bits (76), Expect = 2e-33 Identities = 239/291 (82%), Gaps = 2/291 (0%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||||||| | ||| ||| ||||| | |||||||||| |||||||||||| Sbjct: 477 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 418 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 || | |||||| ||| ||||||||||| || | || || ||| | | ||| | ||| | Sbjct: 417 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 358 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcg 288 ||| ||| |||||||||||||| | || |||||||| || |||||||||| ||||||| Sbjct: 357 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctccagca-cctcggcg 299 Query: 289 gcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcg 348 |||||||||||||||||||||| |||| ||||||||||||||| ||||||||||| |||| Sbjct: 298 gcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcgctcggcg 239 Query: 349 tatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggag 399 || |||| ||||||||| | ||||||||| |||||||||||||||| Sbjct: 238 tacttgccggccttgaggtacctggcgatgcggc-cgacggggaactggag 189
>ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA Length = 405 Score = 139 bits (70), Expect = 8e-30 Identities = 143/165 (86%), Gaps = 2/165 (1%) Strand = Plus / Minus Query: 238 tcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcggcgaggtac 297 |||||||||||||| || ||||||||||||||||| || | |||||||||||||||| Sbjct: 232 tcttcttgttgtcccgcgccgcgttcccggcgagctcaagaa-cctcggcggcgaggtac 174 Query: 298 tcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtatctgccc 357 |||||||||||||||||| ||||||||||||||| ||||||||||| |||||| |||| Sbjct: 173 tcgaggacggcggcgaggtagacgggggcgccggcgccgacgcgctcggcgtacttgccg 114 Query: 358 ttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 ||||||| |||| |||| | || ||||||||||||||||||| Sbjct: 113 gccttgaggaagcgggcgatcctgc-cgacggggaactggagccc 70
>emb|CR700361.2|CNS0G3CL Tetraodon nigroviridis full-length cDNA Length = 547 Score = 137 bits (69), Expect = 3e-29 Identities = 207/252 (82%), Gaps = 1/252 (0%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||||| | ||| ||||| | ||||||||| || |||||||| || | Sbjct: 387 tcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgggcgatggtcactc 328 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 || ||||||||||| ||||||||||| || | ||||| ||| ||||||| ||||||| Sbjct: 327 cgcccagcagcttgttcagctcctcgtcgttgcgcacggccagctgcaggtgccgcggga 268 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcg 288 |||| | | ||||||||||||| ||||||||||||||| |||||||| | ||| ||| Sbjct: 267 tgatcctggtcttcttgttgtcgcgggcggcgttcccggccagctccagga-tctcagcg 209 Query: 289 gcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcg 348 | |||||||| || ||||| || ||| |||| |||||||||| |||||| ||||||||| Sbjct: 208 gtcaggtactccagcacggccgccaggtagaccggggcgccggcgccgacacgctgggcg 149 Query: 349 tatctgcccttc 360 || |||||||| Sbjct: 148 tagttgcccttc 137
>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0031O09, complete sequence Length = 161339 Score = 129 bits (65), Expect = 8e-27 Identities = 108/121 (89%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 ||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||| Sbjct: 38206 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 38147 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 || ||||| |||| |||||||||||| ||||||||| |||||||||||||||||| Sbjct: 38146 ctccgcgtacttgccggccttgaggtagcgggcgatgcggc-cgacggggaactggagcc 38088 Query: 402 c 402 | Sbjct: 38087 c 38087 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Minus Query: 238 tcttcttgttgtccttggcggcgttcccggcgagctccagca 279 |||||||||||||| | || ||||||||||| |||||||||| Sbjct: 38353 tcttcttgttgtccctcgccgcgttcccggccagctccagca 38312
>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map near C10769, complete sequence Length = 194856 Score = 129 bits (65), Expect = 8e-27 Identities = 108/121 (89%), Gaps = 1/121 (0%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 ||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||| Sbjct: 141226 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 141285 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 || ||||| |||| |||||||||||| ||||||||| |||||||||||||||||| Sbjct: 141286 ctccgcgtacttgccggccttgaggtagcgggcgatgcggc-cgacggggaactggagcc 141344 Query: 402 c 402 | Sbjct: 141345 c 141345 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Plus Query: 238 tcttcttgttgtccttggcggcgttcccggcgagctccagca 279 |||||||||||||| | || ||||||||||| |||||||||| Sbjct: 141079 tcttcttgttgtccctcgccgcgttcccggccagctccagca 141120
>gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic sequence, complete sequence Length = 184366 Score = 129 bits (65), Expect = 8e-27 Identities = 108/121 (89%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 ||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||| Sbjct: 181360 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 181301 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 || ||||| |||| |||||||||||| ||||||||| |||||||||||||||||| Sbjct: 181300 ctccgcgtacttgccggccttgaggtagcgggcgatgcggc-cgacggggaactggagcc 181242 Query: 402 c 402 | Sbjct: 181241 c 181241 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Minus Query: 238 tcttcttgttgtccttggcggcgttcccggcgagctccagca 279 |||||||||||||| | || ||||||||||| |||||||||| Sbjct: 181507 tcttcttgttgtccctcgccgcgttcccggccagctccagca 181466
>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-10 Length = 691 Score = 125 bits (63), Expect = 1e-25 Identities = 181/218 (83%), Gaps = 2/218 (0%) Strand = Plus / Minus Query: 185 gagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttctt 244 |||||||||||| || | |||||||||| | | ||||||||| | ||||||| ||||||| Sbjct: 369 gagctcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttctt 310 Query: 245 gttgtccttggcggcgttcccggcgagctccagcagnctcggcggcgaggtactcgagga 304 ||||||| | || ||||||||||| | |||||| | ||| |||||||| ||||| || | Sbjct: 309 gttgtccctcgccgcgttcccggccaactccag-aacctcagcggcgagatactccagca 251 Query: 305 cggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtatctgcccttcttga 364 ||||||||||| ||||||||||||||| |||||| | || |||||| |||| ||||| Sbjct: 250 cggcggcgaggtagacgggggcgccggcgccgaccctctcggcgtacttgccggccttga 191 Query: 365 ggtagcgcccgatgcggcncgacggggaactggagccc 402 || | ||| |||| | || ||||||||||||||||||| Sbjct: 190 ggaaccgcgcgatcctgc-cgacggggaactggagccc 154
>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4 Length = 725 Score = 125 bits (63), Expect = 1e-25 Identities = 181/218 (83%), Gaps = 2/218 (0%) Strand = Plus / Minus Query: 185 gagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttctt 244 |||||||||||| || | |||||||||| | | ||||||||| | ||||||| ||||||| Sbjct: 367 gagctcctcgtcgttgcggacggcgagctggatgtggcgcggcacgatgcgggtcttctt 308 Query: 245 gttgtccttggcggcgttcccggcgagctccagcagnctcggcggcgaggtactcgagga 304 ||||||| | || ||||||||||| | |||||| | ||| |||||||| ||||| || | Sbjct: 307 gttgtccctcgccgcgttcccggccaactccag-aacctcagcggcgagatactccagca 249 Query: 305 cggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtatctgcccttcttga 364 ||||||||||| ||||||||||||||| |||||| | || |||||| |||| ||||| Sbjct: 248 cggcggcgaggtagacgggggcgccggcgccgaccctctcggcgtacttgccggccttga 189 Query: 365 ggtagcgcccgatgcggcncgacggggaactggagccc 402 || | ||| |||| | || ||||||||||||||||||| Sbjct: 188 ggaaccgcgcgatcctgc-cgacggggaactggagccc 152
>ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA Length = 830 Score = 123 bits (62), Expect = 5e-25 Identities = 131/153 (85%), Gaps = 1/153 (0%) Strand = Plus / Minus Query: 186 agctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 245 ||||||||||| || | |||||||||| | | |||||| || | |||||| |||||||| Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380 Query: 246 ttgtccttggcggcgttcccggcgagctccagcagnctcggcggcgaggtactcgaggac 305 |||||| | || ||||||||||||||||| || | ||| |||||||||||||||||||| Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaa-cctcagcggcgaggtactcgaggac 321 Query: 306 ggcggcgaggaagacgggggcgccggtgccgac 338 |||||||||| |||| |||||||||| |||||| Sbjct: 320 ggcggcgaggtagaccggggcgccggcgccgac 288
>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete cds Length = 2120 Score = 123 bits (62), Expect = 5e-25 Identities = 209/257 (81%), Gaps = 1/257 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||||| || || ||||||| Sbjct: 1169 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgcctccctgggcgatgg 1110 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 |||||||| ||||||||||| |||||||||||| || | ||||| ||| ||||||| | Sbjct: 1109 tgacgccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgac 1050 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 | |||||||||||| ||||||||||||| |||||| || ||||| |||||||| | | Sbjct: 1049 gggggatgatgcgggtcttcttgttgtcgcgggcggcattgccggccagctccagga-tc 991 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||||| ||| |||||||| || ||||| | | ||||||| ||||||| ||| || | | Sbjct: 990 tcggcggtgagatactcgagcacagcggccaagtagacgggagcgccggcgcccaccctc 931 Query: 343 tgggcgtatctgccctt 359 |||||||| ||||||| Sbjct: 930 tgggcgtagttgccctt 914
>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full insert sequence Length = 830 Score = 123 bits (62), Expect = 5e-25 Identities = 131/153 (85%), Gaps = 1/153 (0%) Strand = Plus / Minus Query: 186 agctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 245 ||||||||||| || | |||||||||| | | |||||| || | |||||| |||||||| Sbjct: 439 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 380 Query: 246 ttgtccttggcggcgttcccggcgagctccagcagnctcggcggcgaggtactcgaggac 305 |||||| | || ||||||||||||||||| || | ||| |||||||||||||||||||| Sbjct: 379 ttgtccctcgccgcgttcccggcgagctcaagaa-cctcagcggcgaggtactcgaggac 321 Query: 306 ggcggcgaggaagacgggggcgccggtgccgac 338 |||||||||| |||| |||||||||| |||||| Sbjct: 320 ggcggcgaggtagaccggggcgccggcgccgac 288
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 121 bits (61), Expect = 2e-24 Identities = 107/121 (88%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| Sbjct: 20566248 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacgcg 20566189 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 || |||||| |||| ||||||| |||| |||| | || |||||||||||||||||| Sbjct: 20566188 ctcggcgtacttgccggccttgaggaagcgggcgatcctgc-cgacggggaactggagcc 20566130 Query: 402 c 402 | Sbjct: 20566129 c 20566129 Score = 67.9 bits (34), Expect = 2e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 286 gcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgg 345 ||||| |||||| |||||||||| |||||| ||||||||| ||| ||||||||||| || Sbjct: 11503417 gcggcaaggtacccgaggacggcagcgaggtagacgggggtgccagtgccgacgcgttgc 11503476 Query: 346 gcgtatctgcccttcttgaggtagcg 371 |||| | ||| |||| ||||||||| Sbjct: 11503477 gcgtgccggccgttctcgaggtagcg 11503502 Score = 48.1 bits (24), Expect = 0.022 Identities = 24/24 (100%) Strand = Plus / Plus Query: 257 ggcgttcccggcgagctccagcag 280 |||||||||||||||||||||||| Sbjct: 17645345 ggcgttcccggcgagctccagcag 17645368 Score = 42.1 bits (21), Expect = 1.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 238 tcttcttgttgtccttggcggcgttcccggcgagctc 274 |||||||||||||| || ||||||||||||||||| Sbjct: 20566388 tcttcttgttgtcccgcgccgcgttcccggcgagctc 20566352
>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0032E15 Length = 120419 Score = 121 bits (61), Expect = 2e-24 Identities = 107/121 (88%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| Sbjct: 70209 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacgcg 70150 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 || |||||| |||| ||||||| |||| |||| | || |||||||||||||||||| Sbjct: 70149 ctcggcgtacttgccggccttgaggaagcgggcgatcctgc-cgacggggaactggagcc 70091 Query: 402 c 402 | Sbjct: 70090 c 70090 Score = 42.1 bits (21), Expect = 1.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 238 tcttcttgttgtccttggcggcgttcccggcgagctc 274 |||||||||||||| || ||||||||||||||||| Sbjct: 70349 tcttcttgttgtcccgcgccgcgttcccggcgagctc 70313
>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1663_D06 Length = 139103 Score = 121 bits (61), Expect = 2e-24 Identities = 107/121 (88%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| Sbjct: 40620 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggggcgccggcgccgacgcg 40561 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggagcc 401 || |||||| |||| ||||||| |||| |||| | || |||||||||||||||||| Sbjct: 40560 ctcggcgtacttgccggccttgaggaagcgggcgatcctgc-cgacggggaactggagcc 40502 Query: 402 c 402 | Sbjct: 40501 c 40501 Score = 42.1 bits (21), Expect = 1.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 238 tcttcttgttgtccttggcggcgttcccggcgagctc 274 |||||||||||||| || ||||||||||||||||| Sbjct: 40760 tcttcttgttgtcccgcgccgcgttcccggcgagctc 40724
>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA Length = 393 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 186 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 185 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 126 Query: 343 t 343 | Sbjct: 125 t 125
>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2 (LOC665433), mRNA Length = 465 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 396 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 337 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 336 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 277 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 276 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 218 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 217 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 158 Query: 343 t 343 | Sbjct: 157 t 157
>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1 (LOC665433), mRNA Length = 467 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 398 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 339 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 338 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 279 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 278 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 220 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 219 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 160 Query: 343 t 343 | Sbjct: 159 t 159
>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a novel gene, the genes for three H1, four H2a, five H2b, four H3 and four H4 histone family members, the 3' end of a variant of the Hfe gene for hemochromatosis protein (Mr2) and ten CpG islands, complete sequence Length = 184730 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 163969 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 164028 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 164029 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 164088 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 164089 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 164147 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 164148 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 164207 Query: 343 t 343 | Sbjct: 164208 t 164208 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 55440 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 55381 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 55380 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 55321 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 55320 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 55262 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 55261 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 55202 Query: 343 t 343 | Sbjct: 55201 t 55201 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 51351 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 51410 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 51411 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 51470 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 51471 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 51529 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 51530 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 51589 Query: 343 t 343 | Sbjct: 51590 t 51590 Score = 99.6 bits (50), Expect = 7e-18 Identities = 194/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 14876 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 14817 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||| ||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 14816 tcacgcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 14757 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 14756 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 14698 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 14697 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 14638 Query: 343 t 343 | Sbjct: 14637 t 14637
>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA Length = 2493 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 408 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 349 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 348 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 289 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 288 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 230 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 229 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 170 Query: 343 t 343 | Sbjct: 169 t 169
>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the genes for H2b histone family member A, two H2a, two H4 and an H2b histone family member, a serine/threonine protein kinase pseudogene, a novel pseudogene, a novel gene (4930500C15Rik), the gene for a novel KRAB box and C2H2 Zinc Finger containing protein, a ribosomal protein L21 (RPL21) pseudogene, a TU mitochondrial translation elongation factor (tufa) pseudogene, the 5' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121 and four CpG islands, complete sequence Length = 182817 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 33279 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 33338 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 33339 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 33398 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 33399 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 33457 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 33458 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 33517 Query: 343 t 343 | Sbjct: 33518 t 33518 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 10997 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 10938 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 10937 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 10878 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 10877 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 10819 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 10818 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 10759 Query: 343 t 343 | Sbjct: 10758 t 10758
>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the 3' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121, the Prss16 gene for thymus serine protease16, three novel genes, the genes for two H2a, two H2b and one H4 histone family members, a ribosomal protein L37A (Rpl37a) pseudogene, a novel pseudogene, three genes for novel vomeronasal 1 receptor H (V1rh) family members, the gene for a novel vomeronasal 1 receptor I (V1ri) family member, six V1ri pseudogenes, a V1rh pseudogene and six CpG islands, complete sequence Length = 210845 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 59920 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 59979 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 59980 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 60039 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 60040 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 60098 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 60099 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 60158 Query: 343 t 343 | Sbjct: 60159 t 60159 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 52545 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 52604 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 52605 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 52664 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 52665 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 52723 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 52724 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 52783 Query: 343 t 343 | Sbjct: 52784 t 52784
>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771 IMAGE:1263745), complete cds Length = 527 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 386 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 327 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 326 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 267 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 266 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 208 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 207 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 148 Query: 343 t 343 | Sbjct: 147 t 147
>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length enriched library, clone:I0C0045N09 product:histone 1, H2ad, full insert sequence Length = 446 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 397 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 338 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 337 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 278 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 277 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 219 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 218 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 159 Query: 343 t 343 | Sbjct: 158 t 158
>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched library, clone:I920064A15 product:histone 1, H2ad, full insert sequence Length = 445 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 395 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 336 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 335 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 276 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 275 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 217 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 216 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 157 Query: 343 t 343 | Sbjct: 156 t 156
>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds Length = 444 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 376 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 317 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 316 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 257 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 256 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 198 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 197 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 138 Query: 343 t 343 | Sbjct: 137 t 137
>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA Length = 527 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 386 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 327 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 326 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 267 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 266 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 208 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 207 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 148 Query: 343 t 343 | Sbjct: 147 t 147
>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched library, clone:9030420B16 product:histone 1, H2ac, full insert sequence Length = 2493 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 408 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 349 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 348 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 289 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 288 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 230 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 229 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 170 Query: 343 t 343 | Sbjct: 169 t 169
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 115 bits (58), Expect = 1e-22 Identities = 104/118 (88%), Gaps = 1/118 (0%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 ||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||| Sbjct: 20924705 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 20924764 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggag 399 || |||||| |||| ||||||||| | ||||||||| |||||||||||||||| Sbjct: 20924765 ctcggcgtacttgccggccttgaggtacctggcgatgcggc-cgacggggaactggag 20924821 Score = 105 bits (53), Expect = 1e-19 Identities = 65/69 (94%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||| Sbjct: 14468902 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacgcg 14468961 Query: 342 ctgggcgta 350 || |||||| Sbjct: 14468962 ctcggcgta 14468970 Score = 89.7 bits (45), Expect = 6e-15 Identities = 120/145 (82%) Strand = Plus / Plus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| || ||||||||| ||||||||| ||||| | ||||||||| |||||||||| Sbjct: 14468553 ttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctcctcg 14468612 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 || || | || |||||| | | ||||||||| | |||||| |||||||||||||| | Sbjct: 14468613 tcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtccctc 14468672 Query: 255 gcggcgttcccggcgagctccagca 279 || |||||||||||||||||||||| Sbjct: 14468673 gccgcgttcccggcgagctccagca 14468697 Score = 54.0 bits (27), Expect = 4e-04 Identities = 135/171 (78%) Strand = Plus / Plus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||||||| | ||| ||| ||||| | |||||||||| |||||||||||| Sbjct: 20924435 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 20924494 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 || | |||||| ||| ||||||||||| || | || || ||| | | ||| | ||| | Sbjct: 20924495 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 20924554 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagca 279 ||| ||| |||||||||||||| | || |||||||| || |||||||||| Sbjct: 20924555 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctccagca 20924605 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 299 cgaggacggcggcgaggaag 318 |||||||||||||||||||| Sbjct: 4175481 cgaggacggcggcgaggaag 4175500
>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds Length = 1390 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 804 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 745 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 744 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 686 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 685 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 626 Query: 343 t 343 | Sbjct: 625 t 625
>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds Length = 1392 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 863 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 804 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 803 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 744 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 743 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 685 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 684 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 625 Query: 343 t 343 | Sbjct: 624 t 624
>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds Length = 1390 Score = 115 bits (58), Expect = 1e-22 Identities = 196/241 (81%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 804 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 745 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 744 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 686 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| |||| |||||||||| ||| |||||| Sbjct: 685 tcggccgtcaggtactccagcacggccgccaggtagaccggggcgccggcgcccacgcgc 626 Query: 343 t 343 | Sbjct: 625 t 625
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 115 bits (58), Expect = 1e-22 Identities = 104/118 (88%), Gaps = 1/118 (0%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 ||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||| Sbjct: 20850919 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 20850978 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggag 399 || |||||| |||| ||||||||| | ||||||||| |||||||||||||||| Sbjct: 20850979 ctcggcgtacttgccggccttgaggtacctggcgatgcggc-cgacggggaactggag 20851035 Score = 105 bits (53), Expect = 1e-19 Identities = 65/69 (94%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||| Sbjct: 14423186 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacgcg 14423245 Query: 342 ctgggcgta 350 || |||||| Sbjct: 14423246 ctcggcgta 14423254 Score = 89.7 bits (45), Expect = 6e-15 Identities = 120/145 (82%) Strand = Plus / Plus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| || ||||||||| ||||||||| ||||| | ||||||||| |||||||||| Sbjct: 14422837 ttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctcctcg 14422896 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 || || | || |||||| | | ||||||||| | |||||| |||||||||||||| | Sbjct: 14422897 tcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtccctc 14422956 Query: 255 gcggcgttcccggcgagctccagca 279 || |||||||||||||||||||||| Sbjct: 14422957 gccgcgttcccggcgagctccagca 14422981 Score = 54.0 bits (27), Expect = 4e-04 Identities = 135/171 (78%) Strand = Plus / Plus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||||||| | ||| ||| ||||| | |||||||||| |||||||||||| Sbjct: 20850649 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 20850708 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 || | |||||| ||| ||||||||||| || | || || ||| | | ||| | ||| | Sbjct: 20850709 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 20850768 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagca 279 ||| ||| |||||||||||||| | || |||||||| || |||||||||| Sbjct: 20850769 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctccagca 20850819 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 299 cgaggacggcggcgaggaag 318 |||||||||||||||||||| Sbjct: 4175468 cgaggacggcggcgaggaag 4175487
>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 182172 Score = 115 bits (58), Expect = 1e-22 Identities = 104/118 (88%), Gaps = 1/118 (0%) Strand = Plus / Plus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 ||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||| Sbjct: 10195 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 10254 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggag 399 || |||||| |||| ||||||||| | ||||||||| |||||||||||||||| Sbjct: 10255 ctcggcgtacttgccggccttgaggtacctggcgatgcggc-cgacggggaactggag 10311 Score = 54.0 bits (27), Expect = 4e-04 Identities = 135/171 (78%) Strand = Plus / Plus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||||||| | ||| ||| ||||| | |||||||||| |||||||||||| Sbjct: 9925 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 9984 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 || | |||||| ||| ||||||||||| || | || || ||| | | ||| | ||| | Sbjct: 9985 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 10044 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagca 279 ||| ||| |||||||||||||| | || |||||||| || |||||||||| Sbjct: 10045 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctccagca 10095
>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 107819 Score = 115 bits (58), Expect = 1e-22 Identities = 104/118 (88%), Gaps = 1/118 (0%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 ||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||| Sbjct: 34290 ctcggcggcgaggtactcgaggacggcggagaggtagacgggggcgccggcgccgacgcg 34231 Query: 342 ctgggcgtatctgcccttcttgaggtagcgcccgatgcggcncgacggggaactggag 399 || |||||| |||| ||||||||| | ||||||||| |||||||||||||||| Sbjct: 34230 ctcggcgtacttgccggccttgaggtacctggcgatgcggc-cgacggggaactggag 34174 Score = 54.0 bits (27), Expect = 4e-04 Identities = 135/171 (78%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||||||| | ||| ||| ||||| | |||||||||| |||||||||||| Sbjct: 34560 tcttggggagcagcgtctggtggatgttgggcagcacgccgccggcggcgatggtgacgg 34501 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 || | |||||| ||| ||||||||||| || | || || ||| | | ||| | ||| | Sbjct: 34500 cgccgagcagcctgctcagctcctcgtcgttgcgcaccgccagctggatgtgcctcggca 34441 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagca 279 ||| ||| |||||||||||||| | || |||||||| || |||||||||| Sbjct: 34440 cgatccggttcttcttgttgtccctcgccgcgttccccgccagctccagca 34390
>gb|BT016168.1| Zea mays clone Contig1 mRNA sequence Length = 676 Score = 113 bits (57), Expect = 4e-22 Identities = 144/172 (83%), Gaps = 1/172 (0%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 |||||||||||| ||||||||||| |||| || || ||| | | ||||||||| | || Sbjct: 396 ccagcagcttgctcagctcctcgtcgttccgcaccgccagctggatgtggcgcggcacga 337 Query: 232 tgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcggcg 291 | ||| |||||||||||||| || ||||||||||| |||||||||| |||||||||| Sbjct: 336 tacggttcttcttgttgtcccgagcagcgttcccggccagctccagca-cctcggcggcg 278 Query: 292 aggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgct 343 || |||||||| ||||||| |||| | |||||||| |||| ||||||||||| Sbjct: 277 agatactcgagaacggcggagaggtacacgggggccccggcgccgacgcgct 226
>gb|AY105006.1| Zea mays PCO108932 mRNA sequence Length = 841 Score = 113 bits (57), Expect = 4e-22 Identities = 144/172 (83%), Gaps = 1/172 (0%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 |||||||||||| ||||||||||| |||| || || ||| | | ||||||||| | || Sbjct: 384 ccagcagcttgctcagctcctcgtcgttccgcaccgccagctggatgtggcgcggcacga 325 Query: 232 tgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcggcg 291 | ||| |||||||||||||| || ||||||||||| |||||||||| |||||||||| Sbjct: 324 tacggttcttcttgttgtcccgagcagcgttcccggccagctccagca-cctcggcggcg 266 Query: 292 aggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgct 343 || |||||||| ||||||| |||| | |||||||| |||| ||||||||||| Sbjct: 265 agatactcgagaacggcggagaggtacacgggggccccggcgccgacgcgct 214
>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone MGC:11561 IMAGE:3156946), complete cds Length = 1414 Score = 111 bits (56), Expect = 2e-21 Identities = 134/159 (84%), Gaps = 1/159 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||||| ||||||||||| |||||||||||| || | | Sbjct: 370 acgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctcctcgtcgttgcgg 311 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| ||| ||||| Sbjct: 310 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 251 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgag 302 || || |||||||| | |||||| | |||||||||||| Sbjct: 250 cccgccagctccagga-tctcggcagtgaggtactcgag 213
>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence Length = 185902 Score = 111 bits (56), Expect = 2e-21 Identities = 134/159 (84%), Gaps = 1/159 (0%) Strand = Plus / Plus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||||| ||||||||||| |||||||||||| || | | Sbjct: 149691 acgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctcctcgtcgttgcgg 149750 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| ||| ||||| Sbjct: 149751 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 149810 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgag 302 || || |||||||| | |||||| | |||||||||||| Sbjct: 149811 cccgccagctccagga-tctcggcagtgaggtactcgag 149848
>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA Length = 1414 Score = 111 bits (56), Expect = 2e-21 Identities = 134/159 (84%), Gaps = 1/159 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||||| ||||||||||| |||||||||||| || | | Sbjct: 370 acgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctcctcgtcgttgcgg 311 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| ||| ||||| Sbjct: 310 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 251 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgag 302 || || |||||||| | |||||| | |||||||||||| Sbjct: 250 cccgccagctccagga-tctcggcagtgaggtactcgag 213
>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X Length = 2166 Score = 111 bits (56), Expect = 2e-21 Identities = 134/159 (84%), Gaps = 1/159 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||||| ||||||||||| |||||||||||| || | | Sbjct: 949 acgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctcctcgtcgttgcgg 890 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| ||| ||||| Sbjct: 889 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 830 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgag 302 || || |||||||| | |||||| | |||||||||||| Sbjct: 829 cccgccagctccagga-tctcggcagtgaggtactcgag 792
>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone MGC:6616 IMAGE:3490058), complete cds Length = 1367 Score = 111 bits (56), Expect = 2e-21 Identities = 134/159 (84%), Gaps = 1/159 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||||| ||||||||||| |||||||||||| || | | Sbjct: 364 acgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctcctcgtcgttgcgg 305 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| ||| ||||| Sbjct: 304 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 245 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgag 302 || || |||||||| | |||||| | |||||||||||| Sbjct: 244 cccgccagctccagga-tctcggcagtgaggtactcgag 207
>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430002L09 product:H2A histone family, member X, full insert sequence Length = 1379 Score = 111 bits (56), Expect = 2e-21 Identities = 134/159 (84%), Gaps = 1/159 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||||| ||||||||||| |||||||||||| || | | Sbjct: 393 acgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctcctcgtcgttgcgg 334 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| ||| ||||| Sbjct: 333 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 274 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgag 302 || || |||||||| | |||||| | |||||||||||| Sbjct: 273 cccgccagctccagga-tctcggcagtgaggtactcgag 236
>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010005I09 product:H2A histone family, member X, full insert sequence Length = 564 Score = 111 bits (56), Expect = 2e-21 Identities = 134/159 (84%), Gaps = 1/159 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||||| ||||||||||| |||||||||||| || | | Sbjct: 390 acgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctcctcgtcgttgcgg 331 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| ||| ||||| Sbjct: 330 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 271 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgag 302 || || |||||||| | |||||| | |||||||||||| Sbjct: 270 cccgccagctccagga-tctcggcagtgaggtactcgag 233
>gb|AY104828.1| Zea mays PCO072413 mRNA sequence Length = 741 Score = 109 bits (55), Expect = 7e-21 Identities = 109/126 (86%), Gaps = 1/126 (0%) Strand = Plus / Minus Query: 218 gtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccag 277 ||||||||| | |||||| |||||||||||||| | |||||||||||||| || || || Sbjct: 309 gtggcgcggcacaatgcgggtcttcttgttgtccctcgcggcgttcccggcaagttcgag 250 Query: 278 cagnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccga 337 | ||| || ||||||||||||||||||||||||||| | ||||||||||||| ||||| Sbjct: 249 aa-cctcagccgcgaggtactcgaggacggcggcgaggtacacgggggcgccggcgccga 191 Query: 338 cgcgct 343 |||||| Sbjct: 190 cgcgct 185
>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence Length = 209720 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 64633 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 64574 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 64573 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 64514 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 64513 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 64455 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 64454 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 64395 Query: 343 t 343 | Sbjct: 64394 t 64394 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 60544 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 60603 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 60604 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 60663 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 60664 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 60722 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 60723 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 60782 Query: 343 t 343 | Sbjct: 60783 t 60783 Score = 99.6 bits (50), Expect = 7e-18 Identities = 194/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 101104 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 101163 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||| ||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 101164 tcacgcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 101223 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 101224 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 101282 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 101283 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 101342 Query: 343 t 343 | Sbjct: 101343 t 101343
>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome 13 Length = 1357 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 846 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 787 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 786 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 727 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 726 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 668 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 667 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 608 Query: 343 t 343 | Sbjct: 607 t 607
>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained intron Length = 497 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 395 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 336 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 335 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 276 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 275 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 217 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 216 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 157 Query: 343 t 343 | Sbjct: 156 t 156
>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) Length = 1826 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 1312 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1253 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 1252 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 1193 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 1192 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 1134 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 1133 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 1074 Query: 343 t 343 | Sbjct: 1073 t 1073
>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) Length = 1797 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 1313 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1254 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 1253 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 1194 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 1193 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 1135 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 1134 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 1075 Query: 343 t 343 | Sbjct: 1074 t 1074
>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571 IMAGE:30789778), complete cds Length = 1075 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 374 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 315 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 314 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 255 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 254 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 196 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 195 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 136 Query: 343 t 343 | Sbjct: 135 t 135
>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five genes for olfactory receptors, a novel gene, the H1f5 gene for H1 histone family member 5, three genes and one pseudogene for H2a histone family members, four genes for H2b, two genes for H4, and two genes for H3 histone family members and seven CpG islands, complete sequence Length = 222823 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 142446 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 142505 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 142506 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 142565 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 142566 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 142624 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 142625 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 142684 Query: 343 t 343 | Sbjct: 142685 t 142685 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 137775 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 137716 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 137715 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 137656 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 137655 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 137597 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 137596 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 137537 Query: 343 t 343 | Sbjct: 137536 t 137536 Score = 105 bits (53), Expect = 1e-19 Identities = 164/200 (82%), Gaps = 1/200 (0%) Strand = Plus / Plus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 207886 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 207945 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| ||| ||||| Sbjct: 207946 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 208005 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 || || |||||||| | |||||| | |||||||| || ||||| || ||| | || || Sbjct: 208006 cccgccagctccagga-tctcggccgtcaggtactccagcacggccgccaggtacaccgg 208064 Query: 324 ggcgccggtgccgacgcgct 343 |||||||| ||| ||||||| Sbjct: 208065 ggcgccggcgcccacgcgct 208084 Score = 99.6 bits (50), Expect = 7e-18 Identities = 194/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 174454 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 174513 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 174514 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 174573 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||| ||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 174574 gcgggataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 174632 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 174633 tcggccgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgc 174692 Query: 343 t 343 | Sbjct: 174693 t 174693
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 136882 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 136941 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 136942 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 137001 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 137002 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 137060 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 137061 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 137120 Query: 343 t 343 | Sbjct: 137121 t 137121 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 142184 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 142125 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 142124 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 142065 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 142064 gcgggatgatgcgcgtcttcttgttgtc 142037
>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847 IMAGE:5713252), complete cds Length = 492 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 394 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 335 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 334 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 275 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 274 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 216 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 215 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 156 Query: 343 t 343 | Sbjct: 155 t 155
>gb|AF493985.1| Triticum aestivum H2A-1 gene, partial sequence Length = 538 Score = 107 bits (54), Expect = 3e-20 Identities = 72/78 (92%) Strand = Plus / Plus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 |||||||||||||||| | |||||| ||||||||||| |||||||| ||||||||||||| Sbjct: 266 tcttggggagcagcacggagttgatgttggggatcacaccgccgtgggcgatggtgacgc 325 Query: 169 cggccagcagcttgccga 186 |||| ||||||||||||| Sbjct: 326 cggcgagcagcttgccga 343
>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730004H15 product:histone 1, H2ai, full insert sequence Length = 1396 Score = 107 bits (54), Expect = 3e-20 Identities = 196/241 (81%), Gaps = 2/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 375 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 316 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| ||||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 315 tcacgc-ggccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 257 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 256 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 198 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 197 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 138 Query: 343 t 343 | Sbjct: 137 t 137
>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA Length = 506 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 409 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 350 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 349 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 290 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 289 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 231 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 230 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 171 Query: 343 t 343 | Sbjct: 170 t 170
>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds Length = 447 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 376 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 317 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 316 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 257 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 256 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 198 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 197 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 138 Query: 343 t 343 | Sbjct: 137 t 137
>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 Length = 2110 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 634 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 575 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 574 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 515 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 514 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 456 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 455 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 396 Query: 343 t 343 | Sbjct: 395 t 395
>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 Length = 2221 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 632 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 573 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 572 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 513 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 512 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 454 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 453 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 394 Query: 343 t 343 | Sbjct: 393 t 393
>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA Length = 705 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 477 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 418 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 417 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 358 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 357 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 299 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 298 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 239 Query: 343 t 343 | Sbjct: 238 t 238
>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA Length = 393 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 186 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 185 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 126 Query: 343 t 343 | Sbjct: 125 t 125
>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone H2b-F (H2b-F) genes, complete cds Length = 2822 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 1465 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1524 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 1525 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 1584 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 1585 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 1643 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 1644 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 1703 Query: 343 t 343 | Sbjct: 1704 t 1704
>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1190022L06 product:HISTONE H2A homolog [Homo sapiens], full insert sequence Length = 705 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 477 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 418 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 417 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 358 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 357 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 299 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 298 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 239 Query: 343 t 343 | Sbjct: 238 t 238
>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA Length = 393 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 186 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 185 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 126 Query: 343 t 343 | Sbjct: 125 t 125
>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds Length = 1390 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 804 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 745 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 744 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 686 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 685 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 626 Query: 343 t 343 | Sbjct: 625 t 625
>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds Length = 1390 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 804 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 745 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 744 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 686 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 685 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 626 Query: 343 t 343 | Sbjct: 625 t 625
>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds Length = 1390 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 864 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 805 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 804 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 745 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 744 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 686 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 685 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 626 Query: 343 t 343 | Sbjct: 625 t 625
>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds Length = 1381 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 861 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 802 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 801 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 742 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 741 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 683 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 682 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 623 Query: 343 t 343 | Sbjct: 622 t 622
>gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene, partial sequence Length = 1357 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 846 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 787 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 786 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 727 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 726 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 668 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 667 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 608 Query: 343 t 343 | Sbjct: 607 t 607
>gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, complete cds Length = 1387 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 861 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 802 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 801 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 742 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 741 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 683 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 682 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 623 Query: 343 t 343 | Sbjct: 622 t 622
>ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA Length = 387 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 186 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 185 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 126 Query: 343 t 343 | Sbjct: 125 t 125
>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and histone H2A genes, complete cds Length = 4358 Score = 107 bits (54), Expect = 3e-20 Identities = 184/225 (81%), Gaps = 2/225 (0%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||||| ||||||||||| || | || ||| ||| | | |||||| || | || Sbjct: 4095 ccagcagcttgcccagctcctcgtcgttgcggatggccagctggatgtggcggggcacga 4036 Query: 232 tgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcggcg 291 ||||| ||||||||||||| ||||||||| ||||| |||||||||| ||| |||| Sbjct: 4035 tgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagca-cctcagcggtc 3977 Query: 292 aggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtat 351 |||||||| || || ||||| ||| | ||||| ||||||| |||| ||||| |||||| Sbjct: 3976 aggtactccagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtac 3917 Query: 352 ctgcccttcttgaggtagcgcccgatgcggcncgacggggaactg 396 |||||||||| ||||||||| | ||||||| | ||||||||||| Sbjct: 3916 ttgcccttcttcaggtagcgcgcaatgcggc-caacggggaactg 3873
>gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 gene Length = 668 Score = 107 bits (54), Expect = 3e-20 Identities = 195/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 487 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 428 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 427 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 368 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 367 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 309 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 308 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 249 Query: 343 t 343 | Sbjct: 248 t 248
>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700), mRNA Length = 393 Score = 105 bits (53), Expect = 1e-19 Identities = 164/200 (82%), Gaps = 1/200 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 ||||| || ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 323 acgccaccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 264 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| || ||||| Sbjct: 263 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgcgccgcgttg 204 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 ||||| |||||||| | |||||| | ||||||||||| || ||||| || |||| || Sbjct: 203 ccggcaagctccagga-tctcggcagtcaggtactcgagcaccgcggccagatagaccgg 145 Query: 324 ggcgccggtgccgacgcgct 343 |||||||| ||| ||||||| Sbjct: 144 ggcgccggcgcccacgcgct 125
>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA Length = 393 Score = 105 bits (53), Expect = 1e-19 Identities = 164/200 (82%), Gaps = 1/200 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 323 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 264 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| ||| ||||| Sbjct: 263 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 204 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 || || |||||||| | |||||| | |||||||| || ||||| || ||| | || || Sbjct: 203 cccgccagctccagga-tctcggccgtcaggtactccagcacggccgccaggtacaccgg 145 Query: 324 ggcgccggtgccgacgcgct 343 |||||||| ||| ||||||| Sbjct: 144 ggcgccggcgcccacgcgct 125
>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted) (Hist1h2an_predicted), mRNA Length = 546 Score = 105 bits (53), Expect = 1e-19 Identities = 140/169 (82%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||||| | ||| ||||| | |||||||| || |||||||| |||| Sbjct: 358 tcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgtgcgatggtcacgc 299 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 | ||||||||||| |||||||||||| || | || ||| ||| ||||||||||||||| Sbjct: 298 ggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcggga 239 Query: 229 tgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccag 277 ||||||| |||||||||||||| | || ||||| || || |||||||| Sbjct: 238 tgatgcgcgtcttcttgttgtccctcgctgcgttgcccgccagctccag 190
>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds Length = 1390 Score = 105 bits (53), Expect = 1e-19 Identities = 164/200 (82%), Gaps = 1/200 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 823 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 764 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| ||| ||||| Sbjct: 763 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 704 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 || || |||||||| | |||||| | |||||||| || ||||| || ||| | || || Sbjct: 703 cccgccagctccagga-tctcggccgtcaggtactccagcacggccgccaggtacaccgg 645 Query: 324 ggcgccggtgccgacgcgct 343 |||||||| ||| ||||||| Sbjct: 644 ggcgccggcgcccacgcgct 625
>gb|AY104826.1| Zea mays PCO099353 mRNA sequence Length = 793 Score = 105 bits (53), Expect = 1e-19 Identities = 176/216 (81%), Gaps = 1/216 (0%) Strand = Plus / Minus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| || ||||||||| |||||||||| | || | ||||||||| ||||||||| Sbjct: 434 ttgggcataacgccgccgctcgcgatggtggcaccaccaagcagcttggtcagctcctcg 375 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 || || | ||||||||| | | ||| ||||| | ||||||| |||||||||| ||| | Sbjct: 374 tcgttgcgcacggcgagctggatgtgacgcggcacgatgcgggtcttcttgttatccctc 315 Query: 255 gcggcgttcccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgag 314 || |||||||| || |||||||| | ||| |||||||||||||||||||| || ||||| Sbjct: 314 gctgcgttcccagcaagctccagga-cctcagcggcgaggtactcgaggacagctgcgag 256 Query: 315 gaagacgggggcgccggtgccgacgcgctgggcgta 350 | |||| |||||||||| ||| ||||||| |||||| Sbjct: 255 gtagacaggggcgccggcgcccacgcgctcggcgta 220
>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118101 Score = 105 bits (53), Expect = 1e-19 Identities = 65/69 (94%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcg 341 |||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||| Sbjct: 48390 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcgccggcgccgacgcg 48331 Query: 342 ctgggcgta 350 || |||||| Sbjct: 48330 ctcggcgta 48322 Score = 89.7 bits (45), Expect = 6e-15 Identities = 120/145 (82%) Strand = Plus / Minus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| || ||||||||| ||||||||| ||||| | ||||||||| |||||||||| Sbjct: 48739 ttgggcatgacgccgccgctggcgatggtggcgccgccgagcagcttggtgagctcctcg 48680 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 || || | || |||||| | | ||||||||| | |||||| |||||||||||||| | Sbjct: 48679 tcgttgcgcaccgcgagctggatgtggcgcggcacaatgcgggtcttcttgttgtccctc 48620 Query: 255 gcggcgttcccggcgagctccagca 279 || |||||||||||||||||||||| Sbjct: 48619 gccgcgttcccggcgagctccagca 48595
>gb|U70133.1|BBU70133 Bufo bufo gagarizans replication-dependent histone H2A mRNA, complete cds Length = 466 Score = 105 bits (53), Expect = 1e-19 Identities = 167/204 (81%), Gaps = 1/204 (0%) Strand = Plus / Minus Query: 156 gcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagc 215 ||||||||||| ||| ||||||||||| |||||||||||| || | ||||| ||| || Sbjct: 332 gcgatggtgactccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgc 273 Query: 216 aggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctcc 275 ||||| || ||||||||||| ||||||||||||| |||||| || ||||| |||||| Sbjct: 272 aggtgacgggggatgatgcgagtcttcttgttgtcgcgggcggcattgccggccagctcc 213 Query: 276 agcagnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgcc 335 || | |||||||| ||| |||||||| || ||||| | | ||||||| ||||||| ||| Sbjct: 212 agga-tctcggcggtgagatactcgagcacagcggccaagtagacgggagcgccggcgcc 154 Query: 336 gacgcgctgggcgtatctgccctt 359 || | ||||||||| ||||||| Sbjct: 153 caccctctgggcgtagttgccctt 130
>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488308), mRNA Length = 456 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 427 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 368 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 367 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 308 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 307 gcgggatgatgcgcgtcttcttgttgtc 280
>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC611496), mRNA Length = 393 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488291), mRNA Length = 387 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289), mRNA Length = 393 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488278), mRNA Length = 576 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488272), mRNA Length = 393 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132), mRNA Length = 393 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488270), mRNA Length = 462 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 433 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 374 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 373 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 314 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 313 gcgggatgatgcgcgtcttcttgttgtc 286
>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488262), mRNA Length = 393 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082), mRNA Length = 393 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488254), mRNA Length = 417 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 388 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 329 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 328 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 269 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 268 gcgggatgatgcgcgtcttcttgttgtc 241
>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251), mRNA Length = 396 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l), transcript variant 2 (LOC488268), mRNA Length = 402 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l), transcript variant 1 (LOC488268), mRNA Length = 393 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203), mRNA Length = 393 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 Length = 3210 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 1937 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1878 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 1877 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 1818 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 1817 gcgggatgatgcgcgtcttcttgttgtc 1790
>emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X Length = 1359 Score = 103 bits (52), Expect = 4e-19 Identities = 133/159 (83%), Gaps = 1/159 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||||| ||||||||||| |||||||||||| || | | Sbjct: 374 acgccgccctgcgcgatggtcacgccgcccagcagcttgttgagctcctcgtcgttgcgg 315 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||| ||||||||||| ||||||||||||| ||| ||||| Sbjct: 314 atggccagctgcaggtggcgagggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 255 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgag 302 || || |||||||| | |||||| | |||||||||||| Sbjct: 254 cccgccagctccagga-tctcggcagtgaggtactcgag 217
>gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, complete sequence Length = 531 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 391 cggtcttcttgggcagcagcacggcctggatgttgggcacgacgccgccctgcgcgatgg 332 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 331 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 272 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 271 gcgggatgatgcgcgtcttcttgttgtc 244
>gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds Length = 929 Score = 103 bits (52), Expect = 4e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 527 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 468 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 467 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 408 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 407 gcgggatgatgcgcgtcttcttgttgtc 380
>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488304), mRNA Length = 588 Score = 101 bits (51), Expect = 2e-18 Identities = 93/107 (86%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 470 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 411 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 | ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 410 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 364
>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129), mRNA Length = 393 Score = 101 bits (51), Expect = 2e-18 Identities = 144/175 (82%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||||| | ||| || || | |||||||| || ||||||| Sbjct: 364 cggtcttcttgggcagcagcaccgcctggatgtttggcagaacgccgccctgtgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccag 277 ||||||||||||| |||||||||||||| | || ||||| || || |||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtccctcgctgcgttgcccgccagctccag 190
>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962), mRNA Length = 437 Score = 101 bits (51), Expect = 2e-18 Identities = 111/131 (84%) Strand = Plus / Minus Query: 147 ccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacg 206 ||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | || | Sbjct: 334 ccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcggatg 275 Query: 207 gcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccg 266 || ||| |||||||||||||||||||||| |||||||||||||| | || ||||| || Sbjct: 274 gccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtccctcgccgcgttgccc 215 Query: 267 gcgagctccag 277 || |||||||| Sbjct: 214 gccagctccag 204
>gb|AY108339.1| Zea mays PCO070432 mRNA sequence Length = 811 Score = 101 bits (51), Expect = 2e-18 Identities = 129/154 (83%), Gaps = 1/154 (0%) Strand = Plus / Minus Query: 185 gagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttctt 244 |||||||||||| || | |||||||||| | | ||||||||||| ||||||| ||||||| Sbjct: 395 gagctcctcgtcgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttctt 336 Query: 245 gttgtccttggcggcgttcccggcgagctccagcagnctcggcggcgaggtactcgagga 304 ||||||| || ||||||||||| ||||| || | ||| || || || |||||||| | Sbjct: 335 gttgtcccgagccgcgttcccggcaagctcgag-aacctcagcagcaagatactcgagca 277 Query: 305 cggcggcgaggaagacgggggcgccggtgccgac 338 |||| |||||| ||||||||||||||| |||||| Sbjct: 276 cggcagcgaggtagacgggggcgccggcgccgac 243
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 99.6 bits (50), Expect = 7e-18 Identities = 138/166 (83%), Gaps = 1/166 (0%) Strand = Plus / Minus Query: 114 gggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgccggcc 173 |||||||||||||||||||| || || | ||| || || ||||||||||||||||| ||| Sbjct: 7508467 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 7508408 Query: 174 agcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatg 233 |||||||| |||||||| ||||| || || || ||||||| ||| | ||||||||| Sbjct: 7508407 agcagctt-ccgagctcatcgtcgttgtagatcgccagcagcacgtgcctcgggatgatc 7508349 Query: 234 cggctcttcttgttgtccttggcggcgttcccggcgagctccagca 279 ||| | ||||||||| || || |||||||||||||||||||||| Sbjct: 7508348 cggtttttcttgttgccccgcgccgcgttcccggcgagctccagca 7508303 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 305 cggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtatctgcccttcttga 364 ||||||||||| ||||||| |||||| ||||||||||||| || || | |||||||||| Sbjct: 7508224 cggcggcgaggtagacgggtgcgccgatgccgacgcgctgcgcatagcgtcccttcttga 7508165 Query: 365 ggtagcgcccga 376 ||||||| |||| Sbjct: 7508164 ggtagcggccga 7508153 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 44 cttcttgggggacttggtggc 64 ||||||||||||||||||||| Sbjct: 7508532 cttcttgggggacttggtggc 7508512
>ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA Length = 393 Score = 99.6 bits (50), Expect = 7e-18 Identities = 194/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||| ||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 244 gcgggataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 186 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 185 tcggccgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgc 126 Query: 343 t 343 | Sbjct: 125 t 125
>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds Length = 1390 Score = 99.6 bits (50), Expect = 7e-18 Identities = 194/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 888 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 829 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||| ||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 828 tcacgcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 769 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 768 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 710 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 709 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 650 Query: 343 t 343 | Sbjct: 649 t 649
>gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, complete cds Length = 1201 Score = 99.6 bits (50), Expect = 7e-18 Identities = 194/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 898 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 839 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 838 tcacgcggcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 779 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||| ||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 778 gcgggataatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 720 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 719 tcggccgtcaggtactctagcacggctgccaggtacaccggggcgccggcgcccacgcgc 660 Query: 343 t 343 | Sbjct: 659 t 659
>ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA Length = 393 Score = 99.6 bits (50), Expect = 7e-18 Identities = 194/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||| ||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccaacagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 186 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 185 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 126 Query: 343 t 343 | Sbjct: 125 t 125
>emb|AL662960.3|OSJN00162 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0021F22, complete sequence Length = 181498 Score = 99.6 bits (50), Expect = 7e-18 Identities = 138/166 (83%), Gaps = 1/166 (0%) Strand = Plus / Minus Query: 114 gggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgccggcc 173 |||||||||||||||||||| || || | ||| || || ||||||||||||||||| ||| Sbjct: 30940 gggagcagcaccgggttgatgttcggcagcacaccaccatgcgcgatggtgacgccagcc 30881 Query: 174 agcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatg 233 |||||||| |||||||| ||||| || || || ||||||| ||| | ||||||||| Sbjct: 30880 agcagctt-ccgagctcatcgtcgttgtagatcgccagcagcacgtgcctcgggatgatc 30822 Query: 234 cggctcttcttgttgtccttggcggcgttcccggcgagctccagca 279 ||| | ||||||||| || || |||||||||||||||||||||| Sbjct: 30821 cggtttttcttgttgccccgcgccgcgttcccggcgagctccagca 30776 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Minus Query: 305 cggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtatctgcccttcttga 364 ||||||||||| ||||||| |||||| ||||||||||||| || || | |||||||||| Sbjct: 30697 cggcggcgaggtagacgggtgcgccgatgccgacgcgctgcgcatagcgtcccttcttga 30638 Query: 365 ggtagcgcccga 376 ||||||| |||| Sbjct: 30637 ggtagcggccga 30626 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 44 cttcttgggggacttggtggc 64 ||||||||||||||||||||| Sbjct: 31005 cttcttgggggacttggtggc 30985
>gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complete sequence Length = 567 Score = 99.6 bits (50), Expect = 7e-18 Identities = 194/241 (80%), Gaps = 1/241 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 427 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 368 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| ||||||| |||| || | || ||| ||| ||||||||| Sbjct: 367 tcacgcggcccagcagcttgttgagctccacgtcgttgcggatggccagctgcaggtggc 308 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 ||||||||||||| ||||||||||||| ||| ||||| || || |||||||| | | Sbjct: 307 gcgggatgatgcgcgtcttcttgttgtcgcgggccgcgttgcccgccagctccagga-tc 249 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||| | |||||||| || ||||| || ||| | || |||||||||| ||| |||||| Sbjct: 248 tcggccgtcaggtactccagcacggccgccaggtacaccggggcgccggcgcccacgcgc 189 Query: 343 t 343 | Sbjct: 188 t 188
>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165 IMAGE:3355200), complete cds Length = 897 Score = 97.6 bits (49), Expect = 3e-17 Identities = 163/200 (81%), Gaps = 1/200 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 ||||| || ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 365 acgccaccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 306 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| || ||||| Sbjct: 305 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgcgccgcgttg 246 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 ||||| |||||||| | |||||| | | ||||||||| || ||||| || |||| || Sbjct: 245 ccggcaagctccagga-tctcggcagtcaagtactcgagcaccgcggccagatagaccgg 187 Query: 324 ggcgccggtgccgacgcgct 343 |||||||| ||| ||||||| Sbjct: 186 ggcgccggcgcccacgcgct 167
>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456 IMAGE:6671338), complete cds Length = 889 Score = 97.6 bits (49), Expect = 3e-17 Identities = 163/200 (81%), Gaps = 1/200 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 ||||| || ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 355 acgccaccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 296 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| || ||||| Sbjct: 295 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgcgccgcgttg 236 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 ||||| |||||||| | |||||| | | ||||||||| || ||||| || |||| || Sbjct: 235 ccggcaagctccagga-tctcggcagtcaagtactcgagcaccgcggccagatagaccgg 177 Query: 324 ggcgccggtgccgacgcgct 343 |||||||| ||| ||||||| Sbjct: 176 ggcgccggcgcccacgcgct 157
>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA Length = 496 Score = 97.6 bits (49), Expect = 3e-17 Identities = 163/200 (81%), Gaps = 1/200 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 ||||| || ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 365 acgccaccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 306 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| || ||||| Sbjct: 305 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgcgccgcgttg 246 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 ||||| |||||||| | |||||| | | ||||||||| || ||||| || |||| || Sbjct: 245 ccggcaagctccagga-tctcggcagtcaagtactcgagcaccgcggccagatagaccgg 187 Query: 324 ggcgccggtgccgacgcgct 343 |||||||| ||| ||||||| Sbjct: 186 ggcgccggcgcccacgcgct 167
>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3, complete sequence Length = 151563 Score = 97.6 bits (49), Expect = 3e-17 Identities = 163/200 (81%), Gaps = 1/200 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 ||||| || ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 100870 acgccaccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 100811 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| || ||||| Sbjct: 100810 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgcgccgcgttg 100751 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 ||||| |||||||| | |||||| | | ||||||||| || ||||| || |||| || Sbjct: 100750 ccggcaagctccagga-tctcggcagtcaagtactcgagcaccgcggccagatagaccgg 100692 Query: 324 ggcgccggtgccgacgcgct 343 |||||||| ||| ||||||| Sbjct: 100691 ggcgccggcgcccacgcgct 100672
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 97.6 bits (49), Expect = 3e-17 Identities = 61/65 (93%) Strand = Plus / Minus Query: 286 gcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgg 345 |||||||||||||||||||||||||||||| |||||||||| |||| ||||||||||| | Sbjct: 21536573 gcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacgcgctcg 21536514 Query: 346 gcgta 350 ||||| Sbjct: 21536513 gcgta 21536509 Score = 81.8 bits (41), Expect = 2e-12 Identities = 50/53 (94%) Strand = Plus / Minus Query: 286 gcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgac 338 |||||||||||||||||||||||||||||| |||| |||||||||| |||||| Sbjct: 21539253 gcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 21539201 Score = 81.8 bits (41), Expect = 2e-12 Identities = 119/145 (82%) Strand = Plus / Minus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| |||||||||||| ||||||||| ||||| | ||||||||| | ||||||| Sbjct: 21536999 ttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactcctcg 21536940 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 || || | || |||||| | | ||||||||| | ||||||| |||||||||||||| | Sbjct: 21536939 tcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtccctc 21536880 Query: 255 gcggcgttcccggcgagctccagca 279 || ||||||||||||||||| |||| Sbjct: 21536879 gccgcgttcccggcgagctcgagca 21536855 Score = 65.9 bits (33), Expect = 9e-08 Identities = 75/89 (84%) Strand = Plus / Minus Query: 186 agctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 245 ||||||||||| || | |||||||||| | | |||||| || | |||||| |||||||| Sbjct: 21539587 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 21539528 Query: 246 ttgtccttggcggcgttcccggcgagctc 274 |||||| | || ||||||||||||||||| Sbjct: 21539527 ttgtccctcgccgcgttcccggcgagctc 21539499 Score = 52.0 bits (26), Expect = 0.001 Identities = 41/45 (91%), Gaps = 1/45 (2%) Strand = Plus / Plus Query: 358 ttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 |||||||||||||||||||| |||| |||||| ||||||||||| Sbjct: 22313886 ttcttgaggtagcgcccgatacggct-gacgggcaactggagccc 22313929
>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1582_D10 Length = 103475 Score = 97.6 bits (49), Expect = 3e-17 Identities = 61/65 (93%) Strand = Plus / Minus Query: 286 gcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgg 345 |||||||||||||||||||||||||||||| |||||||||| |||| ||||||||||| | Sbjct: 74357 gcggcgaggtactcgaggacggcggcgaggtagacgggggccccggcgccgacgcgctcg 74298 Query: 346 gcgta 350 ||||| Sbjct: 74297 gcgta 74293 Score = 81.8 bits (41), Expect = 2e-12 Identities = 50/53 (94%) Strand = Plus / Minus Query: 286 gcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgac 338 |||||||||||||||||||||||||||||| |||| |||||||||| |||||| Sbjct: 77037 gcggcgaggtactcgaggacggcggcgaggtagaccggggcgccggcgccgac 76985 Score = 81.8 bits (41), Expect = 2e-12 Identities = 119/145 (82%) Strand = Plus / Minus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| |||||||||||| ||||||||| ||||| | ||||||||| | ||||||| Sbjct: 74783 ttgggcatcacgccgccgctggcgatggtggcgccgccgagcagcttggtcaactcctcg 74724 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 || || | || |||||| | | ||||||||| | ||||||| |||||||||||||| | Sbjct: 74723 tcgttgcgcaccgcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtccctc 74664 Query: 255 gcggcgttcccggcgagctccagca 279 || ||||||||||||||||| |||| Sbjct: 74663 gccgcgttcccggcgagctcgagca 74639 Score = 65.9 bits (33), Expect = 9e-08 Identities = 75/89 (84%) Strand = Plus / Minus Query: 186 agctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttg 245 ||||||||||| || | |||||||||| | | |||||| || | |||||| |||||||| Sbjct: 77371 agctcctcgtcgttgcggacggcgagctggatgtggcggggcactatgcgggtcttcttg 77312 Query: 246 ttgtccttggcggcgttcccggcgagctc 274 |||||| | || ||||||||||||||||| Sbjct: 77311 ttgtccctcgccgcgttcccggcgagctc 77283
>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II), histone H2B (ch2b-II) and histone H2A (ch2a-II) genes, complete cds Length = 3777 Score = 97.6 bits (49), Expect = 3e-17 Identities = 163/200 (81%), Gaps = 1/200 (0%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||||| |||||||| || || | || ||| ||| | | |||||| || | || Sbjct: 3514 ccagcagcttgcccagctcctcatcgttgcggatggccagctggatgtggcggggcacga 3455 Query: 232 tgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcggcg 291 ||||| ||||||||||||| ||||||||| ||||| |||||||||| ||| |||| Sbjct: 3454 tgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagca-cctcagcggtc 3396 Query: 292 aggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtat 351 ||||||||||| || ||||| ||| | ||||| ||||||| |||| ||||| |||||| Sbjct: 3395 aggtactcgagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtac 3336 Query: 352 ctgcccttcttgaggtagcg 371 |||||||||| |||||||| Sbjct: 3335 ttgcccttcttcaggtagcg 3316
>gb|AY131974.1| Homo sapiens histone H2A (HIST3H2A) gene, complete cds Length = 1173 Score = 97.6 bits (49), Expect = 3e-17 Identities = 163/200 (81%), Gaps = 1/200 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 ||||| || ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 715 acgccaccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 656 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||||||||||||||| ||||||||||||| || ||||| Sbjct: 655 atggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtcgcgcgccgcgttg 596 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 ||||| |||||||| | |||||| | | ||||||||| || ||||| || |||| || Sbjct: 595 ccggcaagctccagga-tctcggcagtcaagtactcgagcaccgcggccagatagaccgg 537 Query: 324 ggcgccggtgccgacgcgct 343 |||||||| ||| ||||||| Sbjct: 536 ggcgccggcgcccacgcgct 517
>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299), mRNA Length = 387 Score = 95.6 bits (48), Expect = 1e-16 Identities = 123/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tgactttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297), mRNA Length = 393 Score = 95.6 bits (48), Expect = 1e-16 Identities = 123/148 (83%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaagacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tgactttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 ||||||||||||| ||||||||||||| Sbjct: 244 gcgggatgatgcgcgtcttcttgttgtc 217
>gb|AF255740.1|AF255740 Bufo bufo gagarizans histone H1 (H1) and histone H2A variant (H2AInr) genes, complete cds Length = 2396 Score = 95.6 bits (48), Expect = 1e-16 Identities = 206/257 (80%), Gaps = 4/257 (1%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| || ||||||| Sbjct: 1588 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgggcgatgg 1529 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 |||| ||| ||||||||||| |||||||||||| || | ||||| ||| ||||||| | Sbjct: 1528 tgactccgcccagcagcttgttgagctcctcgtcgttgcgcacggccagctgcaggtgac 1469 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 | |||||||||||| |||||||||| |||||| || ||||| |||||||| | | Sbjct: 1468 gggggatgatgcgg---gtcttgttgtcgcgggcggcattgccggccagctccagga-tc 1413 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgc 342 ||||||| ||| |||||||| || ||||| | | ||||||| ||||||| ||| || | | Sbjct: 1412 tcggcggtgagatactcgagcacagcggccaagtagacgggagcgccggcgcccaccctc 1353 Query: 343 tgggcgtatctgccctt 359 |||||||| ||||||| Sbjct: 1352 tgggcgtagttgccctt 1336
>ref|XM_576399.1| PREDICTED: Rattus norvegicus similar to Histone H2A.x (H2a/x) (LOC500987), mRNA Length = 1569 Score = 95.6 bits (48), Expect = 1e-16 Identities = 168/207 (81%), Gaps = 1/207 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| |||||||| || |||||| ||||||||||| |||||||||||| || | | Sbjct: 602 acgccgccctgcgcgatagtcacgccgcccagcagcttgttgagctcctcgtcgttgcgg 543 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | || ||| |||||||||||||||| ||||| |||||||||||||| || ||||| Sbjct: 542 atagccagctgcaggtggcgcgggataatgcgcgtcttcttgttgtcccgagccgcgttg 483 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 || || |||||||| | |||||| | |||||||||||| || || || ||| | ||||| Sbjct: 482 cccgccagctccagga-tctcggcagtgaggtactcgagcaccgccgccaggtacacggg 424 Query: 324 ggcgccggtgccgacgcgctgggcgta 350 ||||| | ||| ||||||| |||||| Sbjct: 423 cgcgcctgcgcccacgcgctcggcgta 397
>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV), and histone H2B (ch2b-IV) genes, complete cds Length = 4502 Score = 95.6 bits (48), Expect = 1e-16 Identities = 171/211 (81%), Gaps = 1/211 (0%) Strand = Plus / Plus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||||| |||||||| || || | || ||| ||| | | |||||| || | | Sbjct: 3180 ccagcagcttgcccagctcctcatcgttgcggatggccagctggatgtggcgaggcacaa 3239 Query: 232 tgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcggcg 291 ||||| ||||||||||||| ||||||||| ||||| |||||||||| ||| |||| Sbjct: 3240 tgcggttcttcttgttgtcgcgggcggcgttgccggccagctccagca-cctcagcggtc 3298 Query: 292 aggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtat 351 |||||||| || |||||||| ||| | ||||| ||||||| |||| ||||| |||||| Sbjct: 3299 aggtactccagcacggcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtac 3358 Query: 352 ctgcccttcttgaggtagcgcccgatgcggc 382 |||||||||| ||||||||| | ||||||| Sbjct: 3359 ttgcccttcttcaggtagcgcgcaatgcggc 3389
>emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA Length = 775 Score = 93.7 bits (47), Expect = 4e-16 Identities = 177/218 (81%), Gaps = 2/218 (0%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||||| | ||| ||||| | ||||||||| || ||||||| Sbjct: 402 cggtcttcttgggcagcagcaccgcctggatgttgggcagcacgccgccctgagcgatgg 343 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || || ||||||||||| |||||||||||| || | || || ||| ||||||||| Sbjct: 342 tcactcctcccagcagcttgttgagctcctcgtcgttgcgcaccgccagctgcaggtggc 283 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnc 282 | |||||||||||| | ||||||||||| ||| ||||| ||||| |||||||| | | Sbjct: 282 gggggatgatgcgggt-ttcttgttgtcgcgggcagcgttgccggccagctccagga-tc 225 Query: 283 tcggcggcgaggtactcgaggacggcggcgaggaagac 320 ||||||| |||||||| || |||||||| ||| |||| Sbjct: 224 tcggcggtcaggtactccagcacggcggccaggtagac 187
>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J (LOC632401), mRNA Length = 1833 Score = 91.7 bits (46), Expect = 2e-15 Identities = 112/134 (83%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| || | | ||||||||||| |||||||||||| || | | Sbjct: 419 acgccgccctgcgcgatggtcacacggcccagcagcttgttgagctcctcgtcgttgcgg 360 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||| ||||||||||| |||||||||||||| | || ||||| Sbjct: 359 atggccagctgcaggtggcgagggatgatgcgcgtcttcttgttgtccctcgccgcgttg 300 Query: 264 ccggcgagctccag 277 || || |||||||| Sbjct: 299 cccgccagctccag 286
>emb|BX063165.1|CNS09KWH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Plus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||||||||| || |||||||| || | Sbjct: 526 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 585 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 ||| |||||||||| ||||||||||| || | || ||| ||| ||||||||||||||| Sbjct: 586 cggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcggga 645 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 646 tgatgcgcgtcttcttgttgtc 667
>emb|BX063164.1|CNS09KWG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 924 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||||||||| || |||||||| || | Sbjct: 475 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 416 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 ||| |||||||||| ||||||||||| || | || ||| ||| ||||||||||||||| Sbjct: 415 cggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcggga 356 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 355 tgatgcgcgtcttcttgttgtc 334
>emb|BX040864.1|CNS093P0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC11DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||||||||| || |||||||| || | Sbjct: 468 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 409 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 ||| |||||||||| ||||||||||| || | || ||| ||| ||||||||||||||| Sbjct: 408 cggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcggga 349 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 348 tgatgcgcgtcttcttgttgtc 327
>emb|BX019683.1|CNS08NCN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA3AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||||||||| || |||||||| || | Sbjct: 479 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 420 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 ||| |||||||||| ||||||||||| || | || ||| ||| ||||||||||||||| Sbjct: 419 cggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcggga 360 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 359 tgatgcgcgtcttcttgttgtc 338
>emb|BX016451.1|CNS08KUV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 556 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||||||||| || |||||||| || | Sbjct: 402 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 343 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 ||| |||||||||| ||||||||||| || | || ||| ||| ||||||||||||||| Sbjct: 342 cggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcggga 283 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 282 tgatgcgcgtcttcttgttgtc 261
>emb|BX009846.1|CNS08FRE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 357 Score = 91.7 bits (46), Expect = 2e-15 Identities = 118/142 (83%) Strand = Plus / Plus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||||||||| || |||||||| || | Sbjct: 119 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 178 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 ||| |||||||||| ||||||||||| || | || ||| ||| ||||||||||||||| Sbjct: 179 cggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcggga 238 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 239 tgatgcgcgtcttcttgttgtc 260
>gb|AY110108.1| Zea mays CL14299_1 mRNA sequence Length = 712 Score = 91.7 bits (46), Expect = 2e-15 Identities = 185/229 (80%), Gaps = 2/229 (0%) Strand = Plus / Plus Query: 174 agcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatg 233 |||||||||| ||| |||||||| || | ||||||||| | | ||| ||||| | |||| Sbjct: 339 agcagcttgctgagttcctcgtcgttgcgcacggcgagctggatgtgacgcggcacgatg 398 Query: 234 cggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcggcgag 293 ||| ||||||||||||| || ||||| || || || |||| || ||| || ||||| Sbjct: 399 cggttcttcttgttgtcgcgcgccgcgttgcccgccagttccaaca-cctctgccgcgag 457 Query: 294 gtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtatct 353 |||||||||||||||| |||| ||||||| || || ||||||||||| |||||| | Sbjct: 458 atactcgaggacggcggagaggtagacgggcgcaccaccgccgacgcgctcggcgtactt 517 Query: 354 gcccttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 ||| ||||||||||||| ||||||||| ||||||||||||| ||||| Sbjct: 518 gccggccttgaggtagcgcgcgatgcggc-cgacggggaactgcagccc 565
>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone MGC:36202 IMAGE:5055276), complete cds Length = 550 Score = 91.7 bits (46), Expect = 2e-15 Identities = 112/134 (83%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| || | | ||||||||||| |||||||||||| || | | Sbjct: 375 acgccgccctgcgcgatggtcacacggcccagcagcttgttgagctcctcgtcgttgcgg 316 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||| ||||||||||| |||||||||||||| | || ||||| Sbjct: 315 atggccagctgcaggtggcgagggatgatgcgcgtcttcttgttgtccctcgccgcgttg 256 Query: 264 ccggcgagctccag 277 || || |||||||| Sbjct: 255 cccgccagctccag 242
>emb|X94693.1|TAH2A254 T.aestivum histone H2A gene Length = 2241 Score = 89.7 bits (45), Expect = 6e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 286 gcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgg 345 |||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||| | Sbjct: 1287 gcggcgaggtactcaaggacggcggcgaggtagacgggggcgccggctccgacgcgctcg 1228 Query: 346 gcgta 350 ||||| Sbjct: 1227 gcgta 1223 Score = 85.7 bits (43), Expect = 1e-13 Identities = 118/143 (82%) Strand = Plus / Minus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| ||||| |||||| ||||||||| ||||| | |||| |||| ||||||||| Sbjct: 1703 ttgggcatcacaccgccgctggcgatggtggcgccgccgagcaacttggtcagctcctcg 1644 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 ||||| | ||||||||| | | ||||||||| | ||| ||| |||||||||||||| || Sbjct: 1643 tcattgcgcacggcgagctggatgtggcgcggcacgatacgggtcttcttgttgtccctg 1584 Query: 255 gcggcgttcccggcgagctccag 277 |||||||| ||||| |||||||| Sbjct: 1583 gcggcgtttccggccagctccag 1561
>emb|X59961.1|RNH2AB R.norvegicus genes for H2A and H2B histones Length = 1635 Score = 89.7 bits (45), Expect = 6e-15 Identities = 123/149 (82%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 1246 cggtcttcttgggcagcagcacagcctggatgttgggcagaacgccgccctgcgcgatgg 1187 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | ||||||||||| ||||||||| || || | || ||| ||| ||||||||| Sbjct: 1186 tcacgcggcccagcagcttgttgagctcctcatcgttgcggatggccagctgcaggtggc 1127 Query: 223 gcgggatgatgcggctcttcttgttgtcc 251 |||||||||| || |||||||||||||| Sbjct: 1126 gcgggatgatccgcgtcttcttgttgtcc 1098
>gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, complete cds Length = 2241 Score = 89.7 bits (45), Expect = 6e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 286 gcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgg 345 |||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||| | Sbjct: 1287 gcggcgaggtactcaaggacggcggcgaggtagacgggggcgccggctccgacgcgctcg 1228 Query: 346 gcgta 350 ||||| Sbjct: 1227 gcgta 1223 Score = 85.7 bits (43), Expect = 1e-13 Identities = 118/143 (82%) Strand = Plus / Minus Query: 135 ttggggatcacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcg 194 ||||| ||||| |||||| ||||||||| ||||| | |||| |||| ||||||||| Sbjct: 1703 ttgggcatcacaccgccgctggcgatggtggcgccgccgagcaacttggtcagctcctcg 1644 Query: 195 tcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttg 254 ||||| | ||||||||| | | ||||||||| | ||| ||| |||||||||||||| || Sbjct: 1643 tcattgcgcacggcgagctggatgtggcgcggcacgatacgggtcttcttgttgtccctg 1584 Query: 255 gcggcgttcccggcgagctccag 277 |||||||| ||||| |||||||| Sbjct: 1583 gcggcgtttccggccagctccag 1561
>gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, complete sequence Length = 571 Score = 89.7 bits (45), Expect = 6e-15 Identities = 162/200 (81%), Gaps = 1/200 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 390 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 331 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| ||||||||| |||||||||||| | ||||||||||| ||| ||||| Sbjct: 330 atggccagctgcaggtggcacgggatgatgcgcgttttcttgttgtcgcgggccgcgttg 271 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 || || |||||||| | |||||| | |||||||| || ||||| || ||| | || || Sbjct: 270 cccgccagctccagga-tctcggccgtcaggtactccagcacggccgccaggtacaccgg 212 Query: 324 ggcgccggtgccgacgcgct 343 |||||||| ||| ||||||| Sbjct: 211 ggcgccggcgcccacgcgct 192
>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x) (LOC489372), mRNA Length = 841 Score = 87.7 bits (44), Expect = 3e-14 Identities = 167/207 (80%), Gaps = 1/207 (0%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 ||||| || |||||||| || |||||| ||||||||||| |||||||||||| || | | Sbjct: 620 acgcctccctgcgcgatcgtcacgccgcccagcagcttgttgagctcctcgtcgttgcgg 561 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| |||||||||| ||||||||||| ||||||||||||| ||| ||||| Sbjct: 560 atggccagctgcaggtggcgggggatgatgcgcgtcttcttgttgtcgcgggccgcgttg 501 Query: 264 ccggcgagctccagcagnctcggcggcgaggtactcgaggacggcggcgaggaagacggg 323 || || |||||||| | |||||| | ||||||||||| ||||| || ||| | || || Sbjct: 500 cccgccagctccagga-tctcggccgtcaggtactcgagcacggccgccaggtacaccgg 442 Query: 324 ggcgccggtgccgacgcgctgggcgta 350 ||||||| ||| || |||| |||||| Sbjct: 441 cgcgccggcgcccacccgctcggcgta 415
>emb|BX007458.1|CNS08DX2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 349 Score = 87.7 bits (44), Expect = 3e-14 Identities = 92/108 (85%) Strand = Plus / Minus Query: 143 cacgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcct 202 ||||||||| || |||||||| || |||| |||||||||| ||||||||||| || | Sbjct: 129 cacgccgccctgggcgatggtcaccccggacagcagcttgttcagctcctcgtcgttgcg 70 Query: 203 gacggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 || ||| ||| |||||||||||||||||||||| ||||||||||||| Sbjct: 69 gatggccagctgcaggtggcgcgggatgatgcgcgtcttcttgttgtc 22
>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III), histone H2B (ch2b-III) and histone H2A (ch2a-III) genes, complete cds Length = 4582 Score = 87.7 bits (44), Expect = 3e-14 Identities = 170/211 (80%), Gaps = 1/211 (0%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||||| |||||||| ||||| | || ||| ||| | | |||||| || | || Sbjct: 3393 ccagcagcttgcccagctcctcatcattgcggatggccagctggatgtggcggggcacga 3334 Query: 232 tgcggctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcggcg 291 | ||| ||||||||||||| ||||||||| ||||| ||||| |||| ||| |||| Sbjct: 3333 tacggttcttcttgttgtcgcgggcggcgttgccggccagctctagca-cctcagcggtc 3275 Query: 292 aggtactcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtat 351 |||||||| || || ||||| ||| | ||||| ||||||| |||| ||||| |||||| Sbjct: 3274 aggtactccagcacagcggccaggtacacgggcgcgccggcaccgatgcgctcggcgtac 3215 Query: 352 ctgcccttcttgaggtagcgcccgatgcggc 382 |||||||||| ||||||||| | ||||||| Sbjct: 3214 ttgcccttcttcaggtagcgcgcaatgcggc 3184
>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA Length = 393 Score = 85.7 bits (43), Expect = 1e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| |||| ||||||||||| | | ||| ||||| | |||||||| || ||||||| Sbjct: 364 cggtcttcttagggagcagcacggcctggatgttgggcaggacgccgccctgagcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 |||| | ||||||||||| |||||||||||| || | || ||| ||| ||| ||| | Sbjct: 304 tgactttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaagtgac 245 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccag 277 |||||||||||||| |||||||||||||| ||| ||||| || || |||||||| Sbjct: 244 gcgggatgatgcgggtcttcttgttgtcccgggccgcgttgcccgccagctccag 190
>gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds Length = 643 Score = 85.7 bits (43), Expect = 1e-13 Identities = 227/286 (79%), Gaps = 2/286 (0%) Strand = Plus / Minus Query: 117 agcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgccggccagc 176 |||| |||||||||||| || || | || || ||||| ||||| |||||||| || || Sbjct: 404 agcaacaccgggttgatgttcggcaggactccaccgtgagcgatcgtgacgcctgcaagt 345 Query: 177 agcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatgcgg 236 |||||||| | ||||| || ||||| || || ||||||| ||| | || ||||| || Sbjct: 344 agcttgcccaattcctcatcgttcctcactgccagcagcacgtgcctgggtatgatccga 285 Query: 237 ctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcggcgaggta 296 ||||||| |||||| | || ||||| ||||| | ||||| | ||| || |||||||| Sbjct: 284 ttcttcttattgtccctcgccgcgtttccggccaactccaata-cctcagcagcgaggta 226 Query: 297 ctcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtatctgcc 356 ||| | ||||||||||||| |||| || || ||||||||||| ||||| ||||| ||||| Sbjct: 225 ctccaagacggcggcgaggtagaccggagctccggtgccgacacgctgagcgtacctgcc 166 Query: 357 cttcttgaggtagcgcccgatgcggcncgacggggaactggagccc 402 |||||| | ||| || |||| |||| | ||||||||||||||||| Sbjct: 165 cttcttcaagtatcggccgagacggc-caacggggaactggagccc 121
>ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616611), mRNA Length = 393 Score = 85.7 bits (43), Expect = 1e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||||| | ||| ||||| | |||||||| || ||||||| Sbjct: 364 cggtcttcttgggcagcagcaccgcctggatgttgggcaggacgccgccctgagcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 |||| | ||||||||||| |||||||||||| || | || ||| ||| ||||||| | Sbjct: 304 tgactttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgac 245 Query: 223 gcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccag 277 ||||||| || ||| |||||||||||||| ||| ||||| || || |||||||| Sbjct: 244 gcgggataatacgggtcttcttgttgtcccgggccgcgttgcccgccagctccag 190
>gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 H2ai-like mRNA, complete sequence Length = 786 Score = 83.8 bits (42), Expect = 4e-13 Identities = 117/142 (82%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||||||||| |||||||| || || Sbjct: 441 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcacct 382 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 | ||||||||||| |||||||||||| || | || ||||||| |||||||||| |||| Sbjct: 381 tgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcggggga 322 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 321 tgatgcgcgtcttcttgttgtc 300
>gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 H2ai-like mRNA, complete sequence Length = 786 Score = 83.8 bits (42), Expect = 4e-13 Identities = 117/142 (82%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||||||||| |||||||| || || Sbjct: 441 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgcgcgatcgtcacct 382 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 | ||||||||||| |||||||||||| || | || ||||||| |||||||||| |||| Sbjct: 381 tgcccagcagcttgttgagctcctcgtcgttgcggatggcgagctgcaggtggcggggga 322 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 321 tgatgcgcgtcttcttgttgtc 300
>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA Length = 1754 Score = 83.8 bits (42), Expect = 4e-13 Identities = 111/134 (82%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| || | | ||||||||||| |||||||||||| || | | Sbjct: 340 acgccgccctgcgcgatggtcacacggcccagcagcttgttgagctcctcgtcgttgcgg 281 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| ||||||| || ||||||||||| |||||||||||||| | || ||||| Sbjct: 280 atggccagctgcaggtgacgagggatgatgcgcgtcttcttgttgtccctcgccgcgttg 221 Query: 264 ccggcgagctccag 277 || || |||||||| Sbjct: 220 cccgccagctccag 207
>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence Length = 205659 Score = 83.8 bits (42), Expect = 4e-13 Identities = 111/134 (82%) Strand = Plus / Plus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| || | | ||||||||||| |||||||||||| || | | Sbjct: 108621 acgccgccctgcgcgatggtcacacggcccagcagcttgttgagctcctcgtcgttgcgg 108680 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| ||||||| || ||||||||||| |||||||||||||| | || ||||| Sbjct: 108681 atggccagctgcaggtgacgagggatgatgcgcgtcttcttgttgtccctcgccgcgttg 108740 Query: 264 ccggcgagctccag 277 || || |||||||| Sbjct: 108741 cccgccagctccag 108754
>emb|BX016452.1|CNS08KUW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 594 Score = 83.8 bits (42), Expect = 4e-13 Identities = 117/142 (82%) Strand = Plus / Plus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||||||||| || |||||||| || | Sbjct: 76 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 135 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 ||| |||||||||| ||||||||||| || | || ||| | | ||||||||||||||| Sbjct: 136 cggacagcagcttgttcagctcctcgtcgttgcggatggccaactgcaggtggcgcggga 195 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 196 tgatgcgcgtcttcttgttgtc 217
>emb|X14730.1|CMHIST2A Duck H2A histone gene Length = 845 Score = 83.8 bits (42), Expect = 4e-13 Identities = 117/142 (82%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||||||| Sbjct: 508 tcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatggtgacct 449 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 | ||||||||||| |||||||||||| || | || ||| ||| |||||||||| |||| Sbjct: 448 tgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcggggga 389 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 388 tgatgcgcgtcttcttgttgtc 367
>dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130307C13 product:HISTONE H2A homolog [Gallus gallus], full insert sequence Length = 1754 Score = 83.8 bits (42), Expect = 4e-13 Identities = 111/134 (82%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| || | | ||||||||||| |||||||||||| || | | Sbjct: 340 acgccgccctgcgcgatggtcacacggcccagcagcttgttgagctcctcgtcgttgcgg 281 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| ||||||| || ||||||||||| |||||||||||||| | || ||||| Sbjct: 280 atggccagctgcaggtgacgagggatgatgcgcgtcttcttgttgtccctcgccgcgttg 221 Query: 264 ccggcgagctccag 277 || || |||||||| Sbjct: 220 cccgccagctccag 207
>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 (ENSANGG00000013551), partial mRNA Length = 375 Score = 83.8 bits (42), Expect = 4e-13 Identities = 117/142 (82%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||||||||| || |||||||| || | Sbjct: 355 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 296 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 ||| |||||||||| ||||||||||| || | || ||| ||| |||| |||||||||| Sbjct: 295 cggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcggga 236 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 235 tgatgcgcgtcttcttgttgtc 214
>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 (ENSANGG00000000004), mRNA Length = 630 Score = 83.8 bits (42), Expect = 4e-13 Identities = 117/142 (82%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgc 168 ||||||| |||||||| | | ||| ||||| | ||||||||| || |||||||| || | Sbjct: 469 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcaccc 410 Query: 169 cggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggga 228 ||| |||||||||| ||||||||||| || | || ||| ||| |||| |||||||||| Sbjct: 409 cggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcagatggcgcggga 350 Query: 229 tgatgcggctcttcttgttgtc 250 ||||||| ||||||||||||| Sbjct: 349 tgatgcgcgtcttcttgttgtc 328
>gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone MGC:118637 IMAGE:1383389), complete cds Length = 587 Score = 83.8 bits (42), Expect = 4e-13 Identities = 111/134 (82%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| || | | ||||||||||| |||||||||||| || | | Sbjct: 397 acgccgccctgcgcgatggtcacacggcccagcagcttgttgagctcctcgtcgttgcgg 338 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttc 263 | ||| ||| ||||||| || ||||||||||| |||||||||||||| | || ||||| Sbjct: 337 atggccagctgcaggtgacgagggatgatgcgcgtcttcttgttgtccctcgccgcgttg 278 Query: 264 ccggcgagctccag 277 || || |||||||| Sbjct: 277 cccgccagctccag 264
>emb|X59962.1|RNTH2AB R.norvegicus genes for TH2A and TH2B histones Length = 1653 Score = 81.8 bits (41), Expect = 2e-12 Identities = 119/145 (82%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 1500 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 1441 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | |||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 1440 tcacgcggcccagcagcttattgagctcctcgtcgttgcggatggccagctgcaggtggc 1381 Query: 223 gcgggatgatgcggctcttcttgtt 247 ||||||| ||||| |||||||||| Sbjct: 1380 gcgggataatgcgcgtcttcttgtt 1356
>ref|NM_021839.1| Rattus norvegicus testis-specific histone 2a (Hist1h2aa), mRNA Length = 393 Score = 81.8 bits (41), Expect = 2e-12 Identities = 119/145 (82%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | |||| | |||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcacgcggcccagcagcttattgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgtt 247 ||||||| ||||| |||||||||| Sbjct: 244 gcgggataatgcgcgtcttcttgtt 220
>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds Length = 2132 Score = 81.8 bits (41), Expect = 2e-12 Identities = 164/204 (80%), Gaps = 1/204 (0%) Strand = Plus / Plus Query: 159 atggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcagg 218 ||||| ||| || ||||||||||||| ||||||||||| || | || ||||||| | | | Sbjct: 523 atggtcacgtcgcccagcagcttgcccagctcctcgtcgttgcggatggcgagctggatg 582 Query: 219 tggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctccagc 278 |||||||||| ||||||| ||||||||||||| ||| ||||| || || |||||||| Sbjct: 583 tggcgcgggacgatgcggttcttcttgttgtcgcgggccgcgttgccagccagctccag- 641 Query: 279 agnctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccgac 338 | ||| || | |||||||| || || ||||| ||| ||||||||||||| | |||| Sbjct: 642 aacctcagcagtcaggtactccagcacagcggccaggtagacgggggcgccagcaccgat 701 Query: 339 gcgctgggcgtatctgcccttctt 362 ||||| ||| || |||||||||| Sbjct: 702 gcgctcggcatacttgcccttctt 725
>gb|M14141.1|SUPH2A2 P.miliaris histone H2A-2.2 gene, complete cds Length = 375 Score = 81.8 bits (41), Expect = 2e-12 Identities = 131/160 (81%), Gaps = 1/160 (0%) Strand = Plus / Minus Query: 156 gcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagc 215 ||||||||||| || | || |||||| |||||||||||| || | ||| || ||| | Sbjct: 308 gcgatggtgactcctcctagaagcttgttgagctcctcgtcgttgcggacagccagctga 249 Query: 216 aggtggcgcgggatgatgcggctcttcttgttgtccttggcggcgttcccggcgagctcc 275 || ||||| |||||||| | ||||||||||||||| ||||||||| ||||||||||| Sbjct: 248 agatggcgggggatgatcctgctcttcttgttgtcgcgggcggcgttgccggcgagctcg 189 Query: 276 agcagnctcggcggcgaggtactcgaggacggcggcgagg 315 || | ||| |||| |||||||||||||||||| |||||| Sbjct: 188 agga-tctcagcggtgaggtactcgaggacggctgcgagg 150
>gb|AY389592.1| Hyacinthus orientalis histone H2A mRNA, complete cds Length = 635 Score = 79.8 bits (40), Expect = 6e-12 Identities = 224/283 (79%), Gaps = 2/283 (0%) Strand = Plus / Minus Query: 117 agcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacgccggccagc 176 |||| |||||||||||| || || | || || ||||| ||||| || ||||| || ||| Sbjct: 389 agcaacaccgggttgatgttcggcaggactccaccgtgagcgatcgtcacgcctgcaagc 330 Query: 177 agcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatgcgg 236 ||||| || | ||||| || ||||| || || ||||||| ||| | ||| ||||| || Sbjct: 329 agctttcccaattcctcatcgttcctcactgccagcagcacgtgcctcggtatgatccga 270 Query: 237 ctcttcttgttgtccttggcggcgttcccggcgagctccagcagnctcggcggcgaggta 296 ||||||||||||| | || ||||| ||||| | ||||| | ||| ||||| ||||| Sbjct: 269 ttcttcttgttgtctctcgccgcgtttccggccaactccaata-cctctgcggctaggta 211 Query: 297 ctcgaggacggcggcgaggaagacgggggcgccggtgccgacgcgctgggcgtatctgcc 356 ||||||||||||||| ||| |||| || || ||||| ||||| ||||| ||||| ||||| Sbjct: 210 ctcgaggacggcggcaaggtagaccggagctccggtaccgacacgctgagcgtacctgcc 151 Query: 357 cttcttgaggtagcgcccgatgcggcncgacggggaactggag 399 |||||| | ||| || |||| || | |||||||||||||||| Sbjct: 150 cttcttcaagtatcggccgagacgac-cgacggggaactggag 109
>ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427895), mRNA Length = 390 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 244 gggggatgatgcgcgtcttcttgttgtc 217
>ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427891), mRNA Length = 390 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 244 gggggatgatgcgcgtcttcttgttgtc 217
>ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427885), mRNA Length = 918 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 364 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 305 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 304 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 245 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 244 gggggatgatgcgcgtcttcttgttgtc 217
>ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC427881), mRNA Length = 534 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 508 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 449 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 448 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 389 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 388 gggggatgatgcgcgtcttcttgttgtc 361
>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA Length = 1220 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 1194 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 1135 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 1134 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 1075 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 1074 gggggatgatgcgcgtcttcttgttgtc 1047
>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1 (LOC417953), mRNA Length = 2271 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 1167 cggtcttcttgggcagcagcacagcctggatgttgggcagcaccccgccctgcgcgatgg 1226 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 1227 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 1286 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 1287 gggggatgatgcgcgtcttcttgttgtc 1314
>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene (LOC417952), mRNA Length = 1374 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 726 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 785 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 786 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 845 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 846 gggggatgatgcgcgtcttcttgttgtc 873
>ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616790), mRNA Length = 413 Score = 79.8 bits (40), Expect = 6e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| ||||||| |||||||||| Sbjct: 315 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatga 256 Query: 232 tgcggctcttcttgttgtcc 251 ||||| |||||||||||||| Sbjct: 255 tgcgggtcttcttgttgtcc 236
>ref|XM_543796.2| PREDICTED: Canis familiaris similar to H2A histone family, member J isoform 2 (LOC486669), mRNA Length = 598 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | |||||||| |||||||||| Sbjct: 442 cggtcttcttgggcagcagcacggcctggatgttgggcaggacgccgccctgcgcgatgg 383 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 |||| ||||||||||| |||||||||||| || | || |||||| ||||||||| Sbjct: 382 tgactttccccagcagcttgttgagctcctcgtcgttgcggatggcgagttgcaggtggc 323 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 |||||||||| | | ||||||||||||| Sbjct: 322 gcgggatgatcctggtcttcttgttgtc 295
>emb|AL512384.9| Human DNA sequence from clone RP11-317E16 on chromosome 6 Contains the 3' end of the gene for sectretagogin (SECRET), the genes for novel H2A and H2B histone family members, H2A and H2B histone family pseudogenes, complete sequence Length = 49963 Score = 79.8 bits (40), Expect = 6e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 170 ggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggat 229 ||||||||||||| ||||||||| ||| || | || ||| ||| |||||||||||||||| Sbjct: 39877 ggccagcagcttgtcgagctccttgtcgttgcggatggccagctgcaggtggcgcgggat 39818 Query: 230 gatgcggctcttcttgttgt 249 ||||||| ||||||| |||| Sbjct: 39817 gatgcgggtcttcttcttgt 39798
>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene Length = 8384 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 5295 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 5236 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 5235 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 5176 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 5175 gggggatgatgcgcgtcttcttgttgtc 5148 Score = 71.9 bits (36), Expect = 2e-09 Identities = 120/148 (81%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| || || |||||||||| Sbjct: 2149 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccaccctgcgcgatgg 2208 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 2209 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 2268 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 2269 gggggatgatgcgcgtcttcttgttgtc 2296
>emb|V00413.1|GGH2AX Chicken gene for histone H2A with flanking regions Length = 843 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 697 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 638 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 637 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 578 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 577 gggggatgatgcgcgtcttcttgttgtc 550
>emb|BX933556.1| Gallus gallus finished cDNA, clone ChEST42h4 Length = 895 Score = 79.8 bits (40), Expect = 6e-12 Identities = 88/104 (84%) Strand = Plus / Plus Query: 147 ccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctgacg 206 ||||| |||||||||||||| ||| ||||||||||| |||||||||||| || | || Sbjct: 75 ccgccctgcgcgatggtgacaccgcccagcagcttgttgagctcctcgtcgttgcgcacc 134 Query: 207 gcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 || ||| | |||||||| ||||||||||| ||||||||||||| Sbjct: 135 gccagctgtaggtggcgggggatgatgcgcgtcttcttgttgtc 178
>dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, complete cds Length = 1028 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 695 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 636 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 635 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 576 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 575 gggggatgatgcgcgtcttcttgttgtc 548
>gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, complete cds Length = 740 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 542 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 483 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 482 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 423 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 422 gggggatgatgcgcgtcttcttgttgtc 395
>gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, complete cds Length = 827 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 525 cggtcttcttgggcagcagcacagcctggatgttgggcagcaccccgccctgcgcgatgg 466 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 465 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 406 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 405 gggggatgatgcgcgtcttcttgttgtc 378
>gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, complete cds Length = 743 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Minus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 387 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 328 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 327 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 268 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 267 gggggatgatgcgcgtcttcttgttgtc 240
>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks Length = 1564 Score = 79.8 bits (40), Expect = 6e-12 Identities = 121/148 (81%) Strand = Plus / Plus Query: 103 cggtcctcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatgg 162 ||||| ||||||| |||||||| | | ||| ||||| | ||| ||||| |||||||||| Sbjct: 282 cggtcttcttgggcagcagcacggcctggatgttgggcagcaccccgccctgcgcgatgg 341 Query: 163 tgacgccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggc 222 | || | ||||||||||| |||||||||||| || | || ||| ||| ||||||||| Sbjct: 342 tcaccttgcccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggc 401 Query: 223 gcgggatgatgcggctcttcttgttgtc 250 | ||||||||||| ||||||||||||| Sbjct: 402 gggggatgatgcgcgtcttcttgttgtc 429
>ref|NM_178218.2| Mus musculus histone 3, H2a (Hist3h2a), mRNA Length = 1991 Score = 77.8 bits (39), Expect = 2e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 377 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 318 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 | ||| | | ||||||||||||||||||| || ||||||| ||||| Sbjct: 317 atggccaactgcaggtggcgcgggatgattcgcgtcttcttattgtc 271
>ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA Length = 390 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 295 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 236 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 235 tgcgcgtcttcttgttgtc 217
>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA Length = 578 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 338 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 279 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 278 tgcgcgtcttcttgttgtc 260
>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 Length = 2972 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 322 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 263 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 262 tgcgcgtcttcttgttgtc 244
>gb|BC063781.1| Mus musculus histone 3, H2a, mRNA (cDNA clone MGC:70265 IMAGE:6493838), complete cds Length = 1607 Score = 77.8 bits (39), Expect = 2e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 343 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 284 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 | ||| | | ||||||||||||||||||| || ||||||| ||||| Sbjct: 283 atggccaactgcaggtggcgcgggatgattcgcgtcttcttattgtc 237
>gb|BC058119.1| Mus musculus histone 3, H2a, mRNA (cDNA clone IMAGE:6819179), with apparent retained intron Length = 1490 Score = 77.8 bits (39), Expect = 2e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 349 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 290 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 | ||| | | ||||||||||||||||||| || ||||||| ||||| Sbjct: 289 atggccaactgcaggtggcgcgggatgattcgcgtcttcttattgtc 243
>gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone IMAGE:3582122), partial cds Length = 543 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 322 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 263 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 262 tgcgcgtcttcttgttgtc 244
>ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA Length = 390 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 295 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 236 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 235 tgcgcgtcttcttgttgtc 217
>ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC670497), mRNA Length = 3003 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 301 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 242 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 241 tgcgagtcttcttgttgtc 223
>ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC667728), mRNA Length = 3054 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 352 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 293 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 292 tgcgagtcttcttgttgtc 274
>ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC677006), mRNA Length = 2991 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 289 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 230 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 229 tgcgagtcttcttgttgtc 211
>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA Length = 2956 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 322 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 263 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 262 tgcgcgtcttcttgttgtc 244
>gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds Length = 819 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 321 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 262 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 261 tgcgcgtcttcttgttgtc 243
>gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, complete cds Length = 1680 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 503 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 444 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 443 tgcgcgtcttcttgttgtc 425 Score = 52.0 bits (26), Expect = 0.001 Identities = 56/66 (84%) Strand = Plus / Plus Query: 185 gagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttctt 244 ||||||||| || ||||| || || || |||| ||||||||||||||||| ||||||| Sbjct: 856 gagctcctcatcgttcctcacagctagttgcagatggcgcgggatgatgcgcgtcttctt 915 Query: 245 gttgtc 250 |||||| Sbjct: 916 gttgtc 921
>emb|BX008487.1|CNS08EPN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA13DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 408 Score = 77.8 bits (39), Expect = 2e-11 Identities = 118/143 (82%), Gaps = 1/143 (0%) Strand = Plus / Minus Query: 109 tcttggggagcagcaccgggttgatcttggggatcacgccgccgtgcgcgatggtgacg- 167 ||||||| |||||||| | | ||| ||||| | ||||||||| || |||||||| || Sbjct: 229 tcttgggcagcagcacggcctggatgttgggcagcacgccgccctgggcgatggtcacct 170 Query: 168 ccggccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcggg 227 |||| |||||||||| ||||||||||| || | || ||| ||| |||||||||||||| Sbjct: 169 ccggacagcagcttgttcagctcctcgtcgttgcggatggccagctgcaggtggcgcggg 110 Query: 228 atgatgcggctcttcttgttgtc 250 |||||||| ||||||||||||| Sbjct: 109 atgatgcgcgtcttcttgttgtc 87
>emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A (partial) Length = 523 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 317 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 258 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 257 tgcgagtcttcttgttgtc 239
>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 Length = 2724 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 1111 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 1052 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 1051 tgcgcgtcttcttgttgtc 1033
>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes Length = 3098 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 1152 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 1093 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 1092 tgcgcgtcttcttgttgtc 1074
>emb|AJ245999.1|BNA245999 Brassica napus H2A gene for Histone H2A Length = 971 Score = 77.8 bits (39), Expect = 2e-11 Identities = 51/55 (92%) Strand = Plus / Minus Query: 282 ctcggcggcgaggtactcgaggacggcggcgaggaagacgggggcgccggtgccg 336 |||||||||||||||||||||||||||||||||| ||||||| || |||| |||| Sbjct: 505 ctcggcggcgaggtactcgaggacggcggcgaggtagacgggagcaccggcgccg 451 Score = 40.1 bits (20), Expect = 5.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 238 tcttcttgttgtccttggcggcgttcccggcgagctccag 277 |||||||||||||| | || |||||||| || |||||||| Sbjct: 662 tcttcttgttgtccctcgctgcgttcccagcaagctccag 623
>dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched library, clone:F930118D21 product:unclassifiable, full insert sequence Length = 2833 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Plus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 507 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 566 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 567 tgcgcgtcttcttgttgtc 585
>dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700048I17 product:histone gene complex 2, full insert sequence Length = 578 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 338 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 279 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 278 tgcgcgtcttcttgttgtc 260
>dbj|AK077568.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length enriched library, clone:5730450G06 product:H2A HISTONE FAMILY, MEMBER L homolog [Homo sapiens], full insert sequence Length = 924 Score = 77.8 bits (39), Expect = 2e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 377 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 318 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 | ||| | | ||||||||||||||||||| || ||||||| ||||| Sbjct: 317 atggccaactgcaggtggcgcgggatgattcgcgtcttcttattgtc 271
>dbj|AK051448.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length enriched library, clone:D130049H21 product:H2A HISTONE FAMILY, MEMBER L homolog [Homo sapiens], full insert sequence Length = 1991 Score = 77.8 bits (39), Expect = 2e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 377 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 318 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 | ||| | | ||||||||||||||||||| || ||||||| ||||| Sbjct: 317 atggccaactgcaggtggcgcgggatgattcgcgtcttcttattgtc 271
>dbj|AK087537.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130315C04 product:H2A HISTONE FAMILY, MEMBER L homolog [Homo sapiens], full insert sequence Length = 1500 Score = 77.8 bits (39), Expect = 2e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 378 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 319 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 | ||| | | ||||||||||||||||||| || ||||||| ||||| Sbjct: 318 atggccaactgcaggtggcgcgggatgattcgcgtcttcttattgtc 272
>dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932439K17 product:histone gene complex 2, full insert sequence Length = 2876 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 153 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 94 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 93 tgcgagtcttcttgttgtc 75
>dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610031H01 product:histone gene complex 2, full insert sequence Length = 545 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 339 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 280 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 279 tgcgcgtcttcttgttgtc 261
>dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930558E18 product:histone gene complex 2, full insert sequence Length = 1059 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Plus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 87 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 146 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 147 tgcgcgtcttcttgttgtc 165
>dbj|AK015962.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930534G10 product:unclassifiable, full insert sequence Length = 767 Score = 77.8 bits (39), Expect = 2e-11 Identities = 90/107 (84%) Strand = Plus / Plus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 230 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 289 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 | ||| | | ||||||||||||||||||| || ||||||| ||||| Sbjct: 290 atggccaactgcaggtggcgcgggatgattcgcgtcttcttattgtc 336
>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), and histone H3.2-615 (H3-615) genes, complete cds Length = 2997 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 1301 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 1242 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 1241 tgcgcgtcttcttgttgtc 1223
>gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2a(B)-613, and histone H2b-613 (H2b) genes, complete cds Length = 2618 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Plus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 1298 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 1357 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 1358 tgcgcgtcttcttgttgtc 1376 Score = 52.0 bits (26), Expect = 0.001 Identities = 56/66 (84%) Strand = Plus / Minus Query: 185 gagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatgatgcggctcttctt 244 ||||||||| || ||||| || || || |||| ||||||||||||||||| ||||||| Sbjct: 945 gagctcctcatcgttcctcacagctagttgcagatggcgcgggatgatgcgcgtcttctt 886 Query: 245 gttgtc 250 |||||| Sbjct: 885 gttgtc 880
>dbj|AK083155.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched library, clone:C630019H19 product:H2A HISTONE FAMILY, MEMBER L homolog [Homo sapiens]; RING finger protein TERF, full insert sequence Length = 3665 Score = 77.8 bits (39), Expect = 2e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 377 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 318 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 | ||| | | ||||||||||||||||||| || ||||||| ||||| Sbjct: 317 atggccaactgcaggtggcgcgggatgattcgcgtcttcttattgtc 271
>dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched library, clone:2210403F13 product:histone gene complex 2, full insert sequence Length = 2428 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Plus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 565 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 624 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 625 tgcgcgtcttcttgttgtc 643
>dbj|AK082083.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230003M12 product:H2A HISTONE FAMILY, MEMBER L homolog [Homo sapiens], full insert sequence Length = 2150 Score = 77.8 bits (39), Expect = 2e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 380 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 321 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 | ||| | | ||||||||||||||||||| || ||||||| ||||| Sbjct: 320 atggccaactgcaggtggcgcgggatgattcgcgtcttcttattgtc 274
>ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA Length = 393 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 295 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 236 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 235 tgcgcgtcttcttgttgtc 217
>gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, complete cds Length = 1440 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Plus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 489 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 548 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 549 tgcgcgtcttcttgttgtc 567
>gb|AY158926.1| Mus musculus histone protein Hist3h2a gene, complete cds Length = 1201 Score = 77.8 bits (39), Expect = 2e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 144 acgccgccgtgcgcgatggtgacgccggccagcagcttgccgagctcctcgtcattcctg 203 |||||||| ||||||||||| |||| | ||||||||||| |||||||||||| || | | Sbjct: 857 acgccgccctgcgcgatggtcacgcggcccagcagcttgttgagctcctcgtcgttgcgg 798 Query: 204 acggcgagcagcaggtggcgcgggatgatgcggctcttcttgttgtc 250 | ||| | | ||||||||||||||||||| || ||||||| ||||| Sbjct: 797 atggccaactgcaggtggcgcgggatgattcgcgtcttcttattgtc 751
>gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, complete cds Length = 1387 Score = 77.8 bits (39), Expect = 2e-11 Identities = 69/79 (87%) Strand = Plus / Minus Query: 172 ccagcagcttgccgagctcctcgtcattcctgacggcgagcagcaggtggcgcgggatga 231 ||||||||||| |||||||||||| || | || ||| ||| |||||||||||||||||| Sbjct: 792 ccagcagcttgttgagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatga 733 Query: 232 tgcggctcttcttgttgtc 250 |||| ||||||||||||| Sbjct: 732 tgcgcgtcttcttgttgtc 714 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,761,058 Number of Sequences: 3902068 Number of extensions: 2761058 Number of successful extensions: 67565 Number of sequences better than 10.0: 683 Number of HSP's better than 10.0 without gapping: 690 Number of HSP's successfully gapped in prelim test: 6 Number of HSP's that attempted gapping in prelim test: 63548 Number of HSP's gapped (non-prelim): 3782 length of query: 402 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 380 effective length of database: 17,147,199,772 effective search space: 6515935913360 effective search space used: 6515935913360 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
