ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags29h11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK061725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 708 0.0
2ref|XM_481630.1| Oryza sativa (japonica cultivar-group), mRNA 605 e-170
3ref|XM_507578.1| PREDICTED Oryza sativa (japonica cultivar-group... 605 e-170
4ref|XM_507194.2| PREDICTED Oryza sativa (japonica cultivar-group... 605 e-170
5dbj|AK121204.1| Oryza sativa (japonica cultivar-group) cDNA clon... 605 e-170
6dbj|AK062210.1| Oryza sativa (japonica cultivar-group) cDNA clon... 605 e-170
7dbj|D12631.1|RICRPL7AB Oryza sativa (japonica cultivar-group) mR... 605 e-170
8dbj|AK098843.1| Oryza sativa (japonica cultivar-group) cDNA clon... 581 e-162
9gb|BT016736.1| Zea mays clone Contig569 mRNA sequence 563 e-157
10gb|BT018084.1| Zea mays clone EL01N0552B03.c mRNA sequence 563 e-157
11gb|AY103834.1| Zea mays PCO109701 mRNA sequence 547 e-152
12gb|AY105417.1| Zea mays PCO109699 mRNA sequence 529 e-147
13ref|XM_463662.1| Oryza sativa (japonica cultivar-group), predic... 335 1e-88
14gb|AY086353.1| Arabidopsis thaliana clone 24272 mRNA, complete s... 268 2e-68
15ref|NM_116152.2| Arabidopsis thaliana structural constituent of ... 252 1e-63
16gb|AY114667.1| Arabidopsis thaliana 60S ribosomal protein L7A pr... 252 1e-63
17gb|AY062758.1| Arabidopsis thaliana 60S RIBOSOMAL PROTEIN L7A pr... 252 1e-63
18gb|AY060519.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, co... 252 1e-63
19gb|AY052264.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, co... 252 1e-63
20emb|BX825094.1|CNS0A7RE Arabidopsis thaliana Full-length cDNA Co... 252 1e-63
21emb|BX823982.1|CNS0A6PP Arabidopsis thaliana Full-length cDNA Co... 252 1e-63
22emb|BX824662.1|CNS0A4TO Arabidopsis thaliana Full-length cDNA Co... 252 1e-63
23emb|BX824325.1|CNS0A7R8 Arabidopsis thaliana Full-length cDNA Co... 244 3e-61
24emb|BX824178.1|CNS0A6S9 Arabidopsis thaliana Full-length cDNA Co... 244 3e-61
25emb|BX822281.1|CNS0A71I Arabidopsis thaliana Full-length cDNA Co... 244 3e-61
26ref|NM_130329.2| Arabidopsis thaliana structural constituent of ... 238 2e-59
27gb|AY052674.1| Arabidopsis thaliana At2g47610/T30B22.8 mRNA, com... 238 2e-59
28gb|AF385719.1|AF385719 Arabidopsis thaliana At2g47610/T30B22.8 m... 238 2e-59
29emb|BX821062.1|CNS0A8OD Arabidopsis thaliana Full-length cDNA Co... 238 2e-59
30gb|AY088386.1| Arabidopsis thaliana clone 6394 mRNA, complete se... 238 2e-59
31gb|BT000500.1| Arabidopsis thaliana 60S ribosomal protein L7A (... 236 7e-59
32gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome ... 232 1e-57
33dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 232 1e-57
34emb|BX819217.1|CNS0A8T4 Arabidopsis thaliana Full-length cDNA Co... 222 1e-54
35emb|BX842094.1|CNS09Y94 Arabidopsis thaliana Full-length cDNA Co... 222 1e-54
36emb|BX842006.1|CNS09Y9Z Arabidopsis thaliana Full-length cDNA Co... 208 2e-50
37dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 204 2e-49
38dbj|AP004637.3| Oryza sativa (japonica cultivar-group) genomic D... 204 2e-49
39dbj|AP003884.2| Oryza sativa (japonica cultivar-group) genomic D... 204 2e-49
40dbj|AK220651.1| Arabidopsis thaliana mRNA for 60S ribosomal prot... 202 1e-48
41gb|DQ241858.1| Solanum tuberosum clone 014F11 60S ribosomal prot... 200 4e-48
42emb|BX821934.1|CNS0A88T Arabidopsis thaliana Full-length cDNA Co... 182 9e-43
43gb|DQ268850.1| Solanum tuberosum clone 155G10 60S ribosomal prot... 176 6e-41
44gb|BT014547.1| Lycopersicon esculentum clone 133964F, mRNA sequence 165 2e-37
45dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 133 7e-28
46dbj|AP004672.3| Oryza sativa (japonica cultivar-group) genomic D... 133 7e-28
47dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic D... 133 7e-28
48emb|AL162651.1|ATF26K9 Arabidopsis thaliana DNA chromosome 3, BA... 131 3e-27
49gb|AY496113.1| Capsicum annuum 60S ribosomal protein L7A mRNA, p... 127 5e-26
50gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 ma... 121 3e-24
51gb|BC106480.1| Xenopus laevis cDNA clone IMAGE:7211162 117 4e-23
52gb|AY393839.1| Xenopus laevis ribosomal protein L7a mRNA, partia... 117 4e-23
53gb|AC155335.1| Brassica rapa subsp. pekinensis chromosome Cytoge... 107 4e-20
54gb|AC155339.1| Brassica rapa subsp. pekinensis chromosome Cytoge... 94 6e-16
55emb|BX821043.1|CNS0A8L9 Arabidopsis thaliana Full-length cDNA Co... 90 1e-14
56emb|AJ718619.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC3-31-30... 90 1e-14
57dbj|AK108838.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
58gb|AF401560.1| Ictalurus punctatus ribosomal protein L7a mRNA, c... 78 4e-11
59emb|BX825080.1|CNS0A6S2 Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
60gb|AY924997.1| Jakoba libera Rpl7A mRNA, partial cds 70 9e-09
61gb|AY924998.1| Seculamonas ecuadoriensis Rpl7A mRNA, partial cds 66 1e-07
62gb|BC072834.1| Xenopus laevis MGC80199 protein, mRNA (cDNA clone... 64 6e-07
63gb|AY769275.1| Bombyx mori ribosomal protein L7A (RpL7A) mRNA, c... 62 2e-06
64gb|AY439881.1| Armigeres subalbatus ASAP ID: 38933 cytosolic lar... 60 9e-06
65ref|XM_575193.1| PREDICTED: Rattus norvegicus similar to 60S rib... 60 9e-06
66gb|AC140446.5| Mus musculus BAC clone RP24-114J11 from chromosom... 60 9e-06
67gb|AY924996.1| Malawimonas jakobiformis Rpl7A mRNA, partial cds 56 1e-04
68gb|BC076693.1| Xenopus tropicalis hypothetical protein LOC447981... 54 5e-04
69gb|AY925004.1| Malawimonas jakobiformis isolate MJL00000703 Rpl7... 54 5e-04
70ref|XM_575291.1| PREDICTED: Rattus norvegicus similar to 60S rib... 54 5e-04
71emb|AL824703.12| Mouse DNA sequence from clone RP23-317M2 on chr... 54 5e-04
72gb|AC154486.2| Mus musculus BAC clone RP24-118H13 from chromosom... 52 0.002
73gb|AC110194.11| Mus musculus chromosome 7, clone RP23-238J3, com... 52 0.002
74gb|AC182749.2| Mus musculus BAC clone RP23-464D14 from chromosom... 52 0.002
75ref|XM_909062.2| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
76ref|XM_921134.2| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
77ref|XM_193790.7| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
78ref|XM_898600.2| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
79gb|AC110262.12| Mus musculus chromosome 17, clone RP23-291L10, c... 52 0.002
80ref|XR_002714.1| PREDICTED: Mus musculus similar to 60S ribosoma... 52 0.002
81gb|AC124412.3| Mus musculus BAC clone RP24-274J3 from chromosome... 52 0.002
82emb|AM049005.1| Meladema coriacea mRNA for ribosomal protein L7A... 52 0.002
83gb|AC115304.3| Mus musculus BAC clone RP24-156K1 from 15, comple... 52 0.002
84gb|AC154411.2| Mus musculus BAC clone RP24-221F4 from chromosome... 52 0.002
85gb|AC166246.1| Mus musculus BAC clone RP24-80F22 from chromosome... 52 0.002
86gb|AC093926.6| Genomic sequence for Mus musculus, clone RP23-342... 52 0.002
87gb|AC154546.2| Mus musculus BAC clone RP23-431I7 from chromosome... 52 0.002
88dbj|AK034073.1| Mus musculus adult male diencephalon cDNA, RIKEN... 52 0.002
89gb|AY925007.1| Reclinomonas americana Rpl7A gene, partial cds 52 0.002
90gb|AY924999.1| Reclinomonas americana Rpl7A mRNA, partial cds 52 0.002
91ref|XM_577004.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
92ref|XM_576987.1| PREDICTED: Rattus norvegicus similar to PRO1477... 52 0.002
93ref|XM_346319.2| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
94ref|XM_225910.3| PREDICTED: Rattus norvegicus similar to Rpl7a p... 52 0.002
95ref|XM_222251.3| PREDICTED: Rattus norvegicus E1A binding protei... 52 0.002
96ref|XM_573092.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
97ref|XM_575493.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
98ref|XM_345462.2| PREDICTED: Rattus norvegicus similar to Rpl7a p... 52 0.002
99ref|XM_575149.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
100ref|XM_216024.3| PREDICTED: Rattus norvegicus ribosomal protein ... 52 0.002
101ref|XM_574881.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
102ref|XM_574302.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
103gb|AC154252.1| Mus musculus BAC clone RP24-197M20 from chromosom... 52 0.002
104emb|X15013.1|RNPPL7A Rat mRNA for ribosomal protein L7a 52 0.002
105emb|AL603787.8| Mouse DNA sequence from clone RP23-169J19 on chr... 52 0.002
106gb|AC147366.5| Mus musculus BAC clone RP23-386J3 from 15, comple... 52 0.002
107gb|AC171211.1| Mus musculus BAC clone RP23-34I14 from chromosome... 52 0.002
108emb|AL772228.5| Mouse DNA sequence from clone RP23-236D1 on chro... 52 0.002
109gb|AC121151.11| Mus musculus chromosome 17, clone RP24-342C2, co... 50 0.009
110gb|DQ118092.1| Trimastix pyriformis ribosomal protein L7A mRNA, ... 50 0.009
111ref|XR_002826.1| PREDICTED: Mus musculus similar to 60S ribosoma... 50 0.009
112ref|XM_846090.1| PREDICTED: Canis familiaris similar to 60S ribo... 50 0.009
113emb|AJ718795.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC31-3-31... 50 0.009
114dbj|AP003158.1| Mus musculus genomic DNA, chromosome 16q clone:R... 50 0.009
115dbj|AP003156.1| Mus musculus genomic DNA, chromosome 16q clone:R... 50 0.009
116gb|AY702208.1| Loligo pealei ribosomal protein L7 mRNA, partial cds 48 0.034
117gb|AY925011.1| Trimastix pyriformis ATCC50562 Rpl7A gene, partia... 48 0.034
118ref|XM_759559.1| Theileria parva strain Muguga 60S ribosomal pro... 48 0.034
119gb|AY130409.1| Scyliorhinus canicula ribosomal protein L7A-like ... 48 0.034
120gb|AC152111.1| Pichia stipitis clone JGIAHYZ-17L1, complete sequ... 46 0.13
121gb|DQ214069.1| Taeniopygia guttata clone 0058P0022B08 ribosomal ... 46 0.13
122gb|AC114662.11| Mus musculus chromosome 1, clone RP24-170M24, co... 46 0.13
123gb|AY925003.1| Malawimonas californiana Rpl7A gene, partial cds 46 0.13
124gb|AY925000.1| Acanthamoeba castellanii Rpl7A mRNA, partial cds 46 0.13
125ref|XR_003122.1| PREDICTED: Mus musculus hypothetical protein LO... 46 0.13
126ref|XM_746084.1| Aspergillus fumigatus Af293 cytosolic large rib... 46 0.13
127emb|AM049007.1| Scarabaeus laticollis mRNA for ribosomal protein... 46 0.13
128ref|XM_644983.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal p... 46 0.13
129gb|AY310805.1| Nicotiana benthamiana clone 12-101 unknown mRNA 46 0.13
130gb|AY925013.1| Capsaspora owczarzaki Rpl7A gene, partial cds 46 0.13
131gb|AY130406.1| Branchiostoma lanceolatum ribosomal protein L7A-l... 46 0.13
132ref|XM_223019.3| PREDICTED: Rattus norvegicus hypothetical LOC28... 46 0.13
133ref|XM_576280.1| PREDICTED: Rattus norvegicus similar to 60S rib... 46 0.13
134gb|AC107710.5| Mus musculus chromosome 19, clone RP23-269K10, co... 44 0.53
135gb|AC120404.25| Mus musculus chromosome 6, clone RP24-405O23, co... 44 0.53
136gb|BC084678.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
137gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chr... 44 0.53
138gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hos... 44 0.53
139gb|AC138741.7| Mus musculus chromosome 1, clone RP24-260D21, com... 44 0.53
140gb|AC123658.9| Mus musculus chromosome 15, clone RP23-192C13, co... 44 0.53
141gb|BC065176.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
142gb|AC140799.6| Mus musculus chromosome 15, clone RP24-147N23, co... 44 0.53
143ref|NM_013721.2| Mus musculus ribosomal protein L7a (Rpl7a), mRNA 44 0.53
144gb|AC132575.3| Mus musculus BAC clone RP24-425F2 from chromosome... 44 0.53
145ref|XM_980392.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
146ref|XM_977480.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
147ref|XM_484651.4| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
148ref|XM_992217.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
149gb|AC116421.8| Mus musculus chromosome 9, clone RP24-142L1, comp... 44 0.53
150ref|XR_003588.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
151ref|XR_002452.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
152ref|XR_002706.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
153ref|XM_909282.2| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
154ref|XM_891531.2| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
155ref|XR_002439.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
156ref|XM_991689.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
157ref|XM_987783.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
158ref|XM_987455.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
159ref|XM_975817.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
160ref|XM_887179.2| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
161ref|XM_906238.2| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
162ref|XM_486245.4| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
163ref|XM_985293.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
164ref|XR_003443.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
165ref|XM_905543.2| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
166ref|XM_620604.3| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
167ref|XM_979771.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
168ref|XR_003274.1| PREDICTED: Mus musculus similar to Ribosomal pr... 44 0.53
169ref|XR_002857.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
170ref|XM_974409.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
171ref|XR_004630.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
172ref|XR_001873.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
173ref|XM_143236.6| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
174ref|XR_003744.1| PREDICTED: Mus musculus similar to 60S ribosoma... 44 0.53
175gb|AC120548.15| Mus musculus chromosome 17, clone RP23-211H11, c... 44 0.53
176ref|XM_572378.1| Cryptococcus neoformans var. neoformans JEC21 r... 44 0.53
177gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 44 0.53
178gb|AC121580.3| Mus musculus BAC clone RP23-255J21 from 9, comple... 44 0.53
179gb|AC098705.2| Mus musculus BAC clone RP23-1B19 from 3, complete... 44 0.53
180gb|AC098724.3| Mus musculus BAC clone RP23-3D14 from 4, complete... 44 0.53
181gb|BC052339.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
182gb|BC016489.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
183emb|CR648468.2|CNS0EZBU Tetraodon nigroviridis full-length cDNA 44 0.53
184gb|AC115910.6| Mus musculus, clone RP24-480O17, complete sequence 44 0.53
185gb|AC102675.9| Mus musculus, clone RP23-232O16, complete sequence 44 0.53
186gb|AC112406.5| Rattus norvegicus 11 BAC CH230-329D3 (Children's ... 44 0.53
187gb|BC099389.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
188emb|BX908789.1| Neurospora crassa DNA linkage group VII BAC clon... 44 0.53
189gb|AC153153.4| Mus musculus BAC clone RP23-79G18 from chromosome... 44 0.53
190emb|AL606528.7| Mouse DNA sequence from clone RP23-45H23 on chro... 44 0.53
191dbj|AB246884.1| Lethenteron japonicum RPL7A mRNA for ribosomal p... 44 0.53
192gb|AC083913.2| Genomic sequence for Mus musculus, clone RP23-376... 44 0.53
193dbj|AK135447.1| Mus musculus 12 days embryo female mullerian duc... 44 0.53
194dbj|AK160044.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 44 0.53
195dbj|AK160622.1| Mus musculus 11 days embryo whole body cDNA, RIK... 44 0.53
196dbj|AK160621.1| Mus musculus 11 days embryo whole body cDNA, RIK... 44 0.53
197gb|AC162454.3| Mus musculus chromosome 1, clone RP23-7D20, compl... 44 0.53
198gb|AC119212.15| Mus musculus chromosome 1, clone RP24-192L21, co... 44 0.53
199gb|BC089624.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
200gb|AC155934.2| Mus musculus BAC clone RP23-58N8 from chromosome ... 44 0.53
201gb|AC156637.2| Mus musculus BAC clone RP24-241I18 from chromosom... 44 0.53
202dbj|AK081115.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 44 0.53
203gb|AC153869.7| Mus musculus 6 BAC RP23-386A17 (Roswell Park Canc... 44 0.53
204dbj|AK019449.1| Mus musculus 14, 17 days embryo head cDNA, RIKEN... 44 0.53
205gb|AC153952.4| Mus musculus 10 BAC RP24-82M14 (Roswell Park Canc... 44 0.53
206dbj|AK030194.1| Mus musculus adult male testis cDNA, RIKEN full-... 44 0.53
207dbj|AK014551.1| Mus musculus 0 day neonate skin cDNA, RIKEN full... 44 0.53
208gb|AY967504.1| Schmidtea mediterranea clone HE.3.01B mRNA sequence 44 0.53
209gb|AC130530.4| Mus musculus BAC clone RP23-153P2 from chromosome... 44 0.53
210ref|XM_221603.3| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.53
211ref|XM_580204.1| PREDICTED: Rattus norvegicus LOC501505 (LOC5015... 44 0.53
212ref|XM_221473.3| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.53
213ref|XM_576256.1| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.53
214ref|XM_578581.1| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.53
215ref|XM_576046.1| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.53
216ref|XM_574700.1| PREDICTED: Rattus norvegicus similar to Rpl7a p... 44 0.53
217ref|NM_001013830.1| Mus musculus similar to 60S ribosomal protei... 44 0.53
218gb|BC091731.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
219gb|BC091769.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
220gb|BC080712.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
221gb|BC080669.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
222gb|BC080663.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
223gb|AC154477.2| Mus musculus BAC clone RP24-134B24 from 14, compl... 44 0.53
224gb|AC133581.22| Mus musculus chromosome 1, clone RP24-395P3, com... 44 0.53
225gb|AC153627.2| Mus musculus 6 BAC RP23-104H13 (Roswell Park Canc... 44 0.53
226gb|AC153621.5| Mus musculus 6 BAC RP23-272K20 (Roswell Park Canc... 44 0.53
227gb|AC139040.8| Mus musculus chromosome 19, clone RP23-292H20, co... 44 0.53
228emb|AL671935.30| Mouse DNA sequence from clone RP23-421J13 on ch... 44 0.53
229gb|AC154649.3| Mus musculus BAC clone RP23-156O5 from chromosome... 44 0.53
230gb|AC123825.5| Mus musculus BAC clone RP24-93F18 from 8, complet... 44 0.53
231gb|BC029992.1| Mus musculus ribosomal protein L7a, mRNA (cDNA cl... 44 0.53
232gb|AC132438.3| Mus musculus BAC clone RP23-234G15 from 3, comple... 44 0.53
233gb|AC112266.6| Mus musculus BAC clone RP23-422B6 from 13, comple... 44 0.53
234gb|AC139575.3| Mus musculus BAC clone RP23-430K5 from 8, complet... 44 0.53
235ref|NG_005356.1| Mus musculus ribosomal protein L7a pseudogene (... 44 0.53
236emb|AL831733.4| Mouse DNA sequence from clone RP23-109O11 on chr... 44 0.53
237emb|AL732328.12| Mouse DNA sequence from clone RP23-106P4 on chr... 44 0.53
238emb|AL670660.8| Mouse DNA sequence from clone RP23-265D6 on chro... 44 0.53
239emb|AL606915.12| Mouse DNA sequence from clone RP23-185C16 on ch... 44 0.53
240gb|AY067190.1| Schmidtea mediterranea clone H.16.9f unknown mRNA... 44 0.53
241gb|M20743.1|MUSSURFC Mouse surfeit locus (Surf-3) processed pseu... 44 0.53
242gb|M20741.1|MUSSURFB Mouse surfeit locus (Surf-3) processed pseu... 44 0.53
243ref|NM_023091.1| Rattus norvegicus gamma-aminobutyric acid A rec... 42 2.1
244ref|NM_017369.1| Mus musculus gamma-aminobutyric acid (GABA-A) r... 42 2.1
245gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7... 42 2.1
246gb|AC124212.2| Mus musculus chromosome X clone CT7-532E7 map qA7... 42 2.1
247ref|XM_535657.2| PREDICTED: Canis familiaris similar to 60S ribo... 42 2.1
248gb|AC117241.4| Mus musculus BAC clone RP24-147H15 from chromosom... 42 2.1
249emb|AL731628.4|OSJN00282 Oryza sativa genomic DNA, chromosome 4,... 42 2.1
250gb|AC147798.30| Mus musculus strain C57BL/6J chromosome 17 clone... 42 2.1
251dbj|AB226265.1| Aspergillus oryzae cDNA, contig sequence: AoEST3124 42 2.1
252dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 42 2.1
253gb|AC102131.20| Mus musculus chromosome 18, clone RP23-223O13, c... 42 2.1
254gb|AC008381.8|AC008381 Homo sapiens chromosome 5 clone CTC-216O1... 42 2.1
255dbj|AK079258.1| Mus musculus adult male urinary bladder cDNA, RI... 42 2.1
256emb|AL115993.1|CNS01CU9 Botrytis cinerea strain T4 cDNA library 42 2.1
257emb|AL116480.1|CNS01D7S Botrytis cinerea strain T4 cDNA library 42 2.1
258emb|AL114151.1|CNS01BF3 Botrytis cinerea strain T4 cDNA library 42 2.1
259emb|AL113067.1|CNS01AKZ Botrytis cinerea strain T4 cDNA library 42 2.1
260emb|AL112537.1|CNS01A69 Botrytis cinerea strain T4 cDNA library 42 2.1
261dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
262gb|AY925005.1| Seculamonas ecuadoriensis Rpl7A gene, partial cds 42 2.1
263gb|AC148610.9| Mus musculus chromosome 17, clone RP24-260D18, co... 42 2.1
264ref|XM_221689.3| PREDICTED: Rattus norvegicus similar to 60S rib... 42 2.1
265gb|AF189265.1|AF189264S2 Mus musculus GABA-A receptor epsilon-li... 42 2.1
266gb|AF189263.1|AF189263 Mus musculus GABA-A receptor epsilon-like... 42 2.1
267gb|AF189262.1|AF189262 Rattus norvegicus GABA-A receptor epsilon... 42 2.1
268gb|AC174679.2| Mus musculus BAC clone CH36-470B20 from chromosom... 42 2.1
269gb|AC166099.2| Mus musculus BAC clone RP24-254H22 from chromosom... 42 2.1
270gb|AC166360.4| Mus musculus BAC clone RP24-497L5 from chromosome... 42 2.1
271dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 42 2.1
272emb|AL807816.7| Mouse DNA sequence from clone RP23-13H12 on chro... 42 2.1
273gb|AC166493.6| Mus musculus chromosome 1, clone RP24-317E14, com... 40 8.2
274ref|XM_453972.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E00506g ... 40 8.2
275ref|XR_003404.1| PREDICTED: Mus musculus similar to 60S ribosoma... 40 8.2
276ref|XR_001826.1| PREDICTED: Mus musculus similar to 60S ribosoma... 40 8.2
277gb|AC114423.16| Mus musculus chromosome 6, clone RP23-461C23, co... 40 8.2
278emb|AM049004.1| Curculio glandium mRNA for ribosomal protein L7A... 40 8.2
279gb|AC122915.2| Mus musculus BAC clone RP23-27G7 from 5, complete... 40 8.2
280emb|CR699967.2|CNS0G31N Tetraodon nigroviridis full-length cDNA 40 8.2
281emb|CR956634.3| Pig DNA sequence from clone CH242-277I8 on chrom... 40 8.2
282emb|AL049842.5|HSDJ129L7 Human DNA sequence from clone RP1-129L7... 40 8.2
283emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 8.2
284gb|AC153615.4| Mus musculus 6 BAC RP23-24I14 (Roswell Park Cance... 40 8.2
285gb|AC154397.8| Mus musculus chromosome 7, clone RP23-53N23, comp... 40 8.2
286gb|AC101688.13| Mus musculus chromosome 5, clone RP23-212P12, co... 40 8.2
287gb|AC109474.2| Homo sapiens chromosome 5 clone RP11-414I19, comp... 40 8.2
288gb|U21310.1| Caenorhabditis elegans cosmid F40H6, complete sequence 40 8.2
289gb|AC016764.8| Homo sapiens BAC clone RP11-549G13 from 2, comple... 40 8.2
290gb|AC148828.2| Pan troglodytes BAC clone CH251-136M2 from chromo... 40 8.2
291emb|BX530060.6| Zebrafish DNA sequence from clone DKEY-283F16 in... 40 8.2
292ref|XM_574781.1| PREDICTED: Rattus norvegicus similar to 60S rib... 40 8.2
293gb|AY961486.1| Lysiphlebus testaceipes ribosomal protein L7a (Rp... 40 8.2
294dbj|AP005389.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
295dbj|AP005298.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
296gb|AC119176.10| Mus musculus chromosome 1, clone RP24-359F24, co... 40 8.2
297gb|AC118223.11| Mus musculus chromosome 7, clone RP23-337G6, com... 40 8.2
298emb|CT033296.1| Platynereis dumerilii EST IB0AAA23AB07EM1 40 8.2
299emb|CT032318.1| Platynereis dumerilii EST IB0AAA40DB09EM1 40 8.2
300emb|CT032317.1| Platynereis dumerilii EST IB0AAA40DB09FM1 40 8.2
301emb|AL732626.8| Mouse DNA sequence from clone RP23-191F22 on chr... 40 8.2

>dbj|AK061725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B03, full
           insert sequence
          Length = 1055

 Score =  708 bits (357), Expect = 0.0
 Identities = 488/531 (91%), Gaps = 1/531 (0%)
 Strand = Plus / Minus

                                                                       
Query: 76  ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
           |||| |||||| ||| || |||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 855 ttaggtcatccgctgggcggcctccttagcgagaagcttttccctggccttggtcttcgc 796

                                                                       
Query: 136 ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
           ||||||||||||||||||||| || || ||||||||| |||||||||| ||||||||| |
Sbjct: 795 ctgcgacttggagcccatgacgccgcctccccacttcttcctgacctcgtcgaacttgtc 736

                                                                       
Query: 196 attgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttctt 255
            ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 735 gttgaagttcgccttgatggcctccaagatcttgctgaactcaagcttgtcctcgttctt 676

                                                                       
Query: 256 cacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtga 315
            |||||||| | |||||||||||| |||||||||||||||||||||||||||||||| | 
Sbjct: 675 gacagtggtcaagcacagaacagatgcagtcttcttgtgaacaatcgatccaaggcgagc 616

                                                                       
Query: 316 ttttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacac 375
           ||| |||||||| |||||||| ||||||||||||||||| || |||||||| ||||||||
Sbjct: 615 tttgcccttaacgatgcagtaagggacctccatcttcctacacagggctggaagccacac 556

                                                                       
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctc 435
           ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 555 aaccagctcaattggatcaacatcatgagcgatgacaaccagctgggccttgctctgctc 496

                                                                       
Query: 436 aataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaa 495
           ||| |||||||| || |||||| | |||||||||||||||||||||||||||||||||||
Sbjct: 495 aatgaggtaagtcacgtggtta-agaccatacttcacaacaattggcttcttggcctcaa 437

                                                                       
Query: 496 cggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccacct 555
           |||||||||| |||||||||||||| |||||||||| ||||||||||||||| ||  |||
Sbjct: 436 cggttttcccttcagcctcagcctgggccctcttcaaaagcctctccttcttggcagcct 377

                                                              
Query: 556 tgtcctcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           ||||||||||||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 376 tgtcctcagggcggtacttgagaagcatcttaaacaggttggttgcgaggt 326



to top

>ref|XM_481630.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1023

 Score =  605 bits (305), Expect = e-170
 Identities = 475/531 (89%), Gaps = 1/531 (0%)
 Strand = Plus / Minus

                                                                       
Query: 76  ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
           |||| |||||| ||| ||||||||||||||||  ||| ||||||||||||||||||||||
Sbjct: 866 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 807

                                                                       
Query: 136 ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
           |||||||||||| |||||||| || || ||||||||| |||| ||||||||||| ||| |
Sbjct: 806 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 747

                                                                       
Query: 196 attgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttctt 255
            ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 746 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 687

                                                                       
Query: 256 cacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtga 315
            |||||||| | ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 686 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 627

                                                                       
Query: 316 ttttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacac 375
           |||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 626 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 567

                                                                       
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctc 435
           |||||||||||| || || ||||||||||| ||||| ||||| || ||||||||||||||
Sbjct: 566 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 507

                                                                       
Query: 436 aataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaa 495
           ||| ||||| |||||||||||| | ||||||||||||||||||||| ||||| |||||||
Sbjct: 506 aatgaggtatgtgacatggtta-agaccatacttcacaacaattggtttctttgcctcaa 448

                                                                       
Query: 496 cggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccacct 555
           ||||||| || |||||||||||||| |||||||||| ||||||||||||||||||  |||
Sbjct: 447 cggttttaccttcagcctcagcctgggccctcttcaaaagcctctccttcttagcagcct 388

                                                              
Query: 556 tgtcctcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           |||||||||||||||||||||| |||||||| ||||| || || |||||||
Sbjct: 387 tgtcctcagggcggtacttgaggagcatcttaaacagattagttgcgaggt 337



to top

>ref|XM_507578.1| PREDICTED Oryza sativa (japonica cultivar-group), P0703C03.43 mRNA
          Length = 1041

 Score =  605 bits (305), Expect = e-170
 Identities = 475/531 (89%), Gaps = 1/531 (0%)
 Strand = Plus / Minus

                                                                       
Query: 76  ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
           |||| |||||| ||| ||||||||||||||||  ||| ||||||||||||||||||||||
Sbjct: 867 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 808

                                                                       
Query: 136 ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
           |||||||||||| |||||||| || || ||||||||| |||| ||||||||||| ||| |
Sbjct: 807 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 748

                                                                       
Query: 196 attgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttctt 255
            ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 747 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 688

                                                                       
Query: 256 cacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtga 315
            |||||||| | ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 687 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 628

                                                                       
Query: 316 ttttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacac 375
           |||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 627 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 568

                                                                       
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctc 435
           |||||||||||| || || ||||||||||| ||||| ||||| || ||||||||||||||
Sbjct: 567 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 508

                                                                       
Query: 436 aataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaa 495
           ||| ||||| |||||||||||| | ||||||||||||||||||||| ||||| |||||||
Sbjct: 507 aatgaggtatgtgacatggtta-agaccatacttcacaacaattggtttctttgcctcaa 449

                                                                       
Query: 496 cggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccacct 555
           ||||||| || |||||||||||||| |||||||||| ||||||||||||||||||  |||
Sbjct: 448 cggttttaccttcagcctcagcctgggccctcttcaaaagcctctccttcttagcagcct 389

                                                              
Query: 556 tgtcctcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           |||||||||||||||||||||| |||||||| ||||| || || |||||||
Sbjct: 388 tgtcctcagggcggtacttgaggagcatcttaaacagattagttgcgaggt 338



to top

>ref|XM_507194.2| PREDICTED Oryza sativa (japonica cultivar-group), P0703C03.43 mRNA
          Length = 1091

 Score =  605 bits (305), Expect = e-170
 Identities = 475/531 (89%), Gaps = 1/531 (0%)
 Strand = Plus / Minus

                                                                       
Query: 76  ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
           |||| |||||| ||| ||||||||||||||||  ||| ||||||||||||||||||||||
Sbjct: 870 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 811

                                                                       
Query: 136 ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
           |||||||||||| |||||||| || || ||||||||| |||| ||||||||||| ||| |
Sbjct: 810 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 751

                                                                       
Query: 196 attgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttctt 255
            ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 750 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 691

                                                                       
Query: 256 cacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtga 315
            |||||||| | ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 690 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 631

                                                                       
Query: 316 ttttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacac 375
           |||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 630 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 571

                                                                       
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctc 435
           |||||||||||| || || ||||||||||| ||||| ||||| || ||||||||||||||
Sbjct: 570 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 511

                                                                       
Query: 436 aataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaa 495
           ||| ||||| |||||||||||| | ||||||||||||||||||||| ||||| |||||||
Sbjct: 510 aatgaggtatgtgacatggtta-agaccatacttcacaacaattggtttctttgcctcaa 452

                                                                       
Query: 496 cggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccacct 555
           ||||||| || |||||||||||||| |||||||||| ||||||||||||||||||  |||
Sbjct: 451 cggttttaccttcagcctcagcctgggccctcttcaaaagcctctccttcttagcagcct 392

                                                              
Query: 556 tgtcctcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           |||||||||||||||||||||| |||||||| ||||| || || |||||||
Sbjct: 391 tgtcctcagggcggtacttgaggagcatcttaaacagattagttgcgaggt 341



to top

>dbj|AK121204.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023087N22, full
           insert sequence
          Length = 1091

 Score =  605 bits (305), Expect = e-170
 Identities = 475/531 (89%), Gaps = 1/531 (0%)
 Strand = Plus / Minus

                                                                       
Query: 76  ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
           |||| |||||| ||| ||||||||||||||||  ||| ||||||||||||||||||||||
Sbjct: 870 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 811

                                                                       
Query: 136 ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
           |||||||||||| |||||||| || || ||||||||| |||| ||||||||||| ||| |
Sbjct: 810 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 751

                                                                       
Query: 196 attgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttctt 255
            ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 750 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 691

                                                                       
Query: 256 cacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtga 315
            |||||||| | ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 690 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 631

                                                                       
Query: 316 ttttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacac 375
           |||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 630 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 571

                                                                       
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctc 435
           |||||||||||| || || ||||||||||| ||||| ||||| || ||||||||||||||
Sbjct: 570 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 511

                                                                       
Query: 436 aataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaa 495
           ||| ||||| |||||||||||| | ||||||||||||||||||||| ||||| |||||||
Sbjct: 510 aatgaggtatgtgacatggtta-agaccatacttcacaacaattggtttctttgcctcaa 452

                                                                       
Query: 496 cggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccacct 555
           ||||||| || |||||||||||||| |||||||||| ||||||||||||||||||  |||
Sbjct: 451 cggttttaccttcagcctcagcctgggccctcttcaaaagcctctccttcttagcagcct 392

                                                              
Query: 556 tgtcctcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           |||||||||||||||||||||| |||||||| ||||| || || |||||||
Sbjct: 391 tgtcctcagggcggtacttgaggagcatcttaaacagattagttgcgaggt 341



to top

>dbj|AK062210.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A04, full
           insert sequence
          Length = 1041

 Score =  605 bits (305), Expect = e-170
 Identities = 475/531 (89%), Gaps = 1/531 (0%)
 Strand = Plus / Minus

                                                                       
Query: 76  ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
           |||| |||||| ||| ||||||||||||||||  ||| ||||||||||||||||||||||
Sbjct: 867 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 808

                                                                       
Query: 136 ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
           |||||||||||| |||||||| || || ||||||||| |||| ||||||||||| ||| |
Sbjct: 807 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 748

                                                                       
Query: 196 attgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttctt 255
            ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 747 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 688

                                                                       
Query: 256 cacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtga 315
            |||||||| | ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 687 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 628

                                                                       
Query: 316 ttttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacac 375
           |||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 627 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 568

                                                                       
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctc 435
           |||||||||||| || || ||||||||||| ||||| ||||| || ||||||||||||||
Sbjct: 567 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 508

                                                                       
Query: 436 aataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaa 495
           ||| ||||| |||||||||||| | ||||||||||||||||||||| ||||| |||||||
Sbjct: 507 aatgaggtatgtgacatggtta-agaccatacttcacaacaattggtttctttgcctcaa 449

                                                                       
Query: 496 cggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccacct 555
           ||||||| || |||||||||||||| |||||||||| ||||||||||||||||||  |||
Sbjct: 448 cggttttaccttcagcctcagcctgggccctcttcaaaagcctctccttcttagcagcct 389

                                                              
Query: 556 tgtcctcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           |||||||||||||||||||||| |||||||| ||||| || || |||||||
Sbjct: 388 tgtcctcagggcggtacttgaggagcatcttaaacagattagttgcgaggt 338



to top

>dbj|D12631.1|RICRPL7AB Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein
           L7A, complete cds
          Length = 954

 Score =  605 bits (305), Expect = e-170
 Identities = 475/531 (89%), Gaps = 1/531 (0%)
 Strand = Plus / Minus

                                                                       
Query: 76  ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
           |||| |||||| ||| ||||||||||||||||  ||| ||||||||||||||||||||||
Sbjct: 797 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 738

                                                                       
Query: 136 ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
           |||||||||||| |||||||| || || ||||||||| |||| ||||||||||| ||| |
Sbjct: 737 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 678

                                                                       
Query: 196 attgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttctt 255
            ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 677 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 618

                                                                       
Query: 256 cacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtga 315
            |||||||| | ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 617 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 558

                                                                       
Query: 316 ttttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacac 375
           |||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 557 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 498

                                                                       
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctc 435
           |||||||||||| || || ||||||||||| ||||| ||||| || ||||||||||||||
Sbjct: 497 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 438

                                                                       
Query: 436 aataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaa 495
           ||| ||||| |||||||||||| | ||||||||||||||||||||| ||||| |||||||
Sbjct: 437 aatgaggtatgtgacatggtta-agaccatacttcacaacaattggtttctttgcctcaa 379

                                                                       
Query: 496 cggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccacct 555
           ||||||| || |||||||||||||| |||||||||| ||||||||||||||||||  |||
Sbjct: 378 cggttttaccttcagcctcagcctgggccctcttcaaaagcctctccttcttagcagcct 319

                                                              
Query: 556 tgtcctcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           |||||||||||||||||||||| |||||||| ||||| || || |||||||
Sbjct: 318 tgtcctcagggcggtacttgaggagcatcttaaacagattagttgcgaggt 268



to top

>dbj|AK098843.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000B08, full
           insert sequence
          Length = 1022

 Score =  581 bits (293), Expect = e-162
 Identities = 473/531 (89%), Gaps = 2/531 (0%)
 Strand = Plus / Minus

                                                                       
Query: 76  ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
           |||| |||||| ||| |||||||||||| |||  ||| ||||||||||||||||||||||
Sbjct: 865 ttaggtcatccgctgggcagcctccttg-cgagcagcttttccctggccttggtcttcgc 807

                                                                       
Query: 136 ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
           |||||||||||  |||||||| || || ||||||||| |||| ||||||||||| ||| |
Sbjct: 806 ctgcgacttggttcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 747

                                                                       
Query: 196 attgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttctt 255
            ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 746 gttgaagttcgccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttctt 687

                                                                       
Query: 256 cacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtga 315
            |||||||| | ||| || ||||| ||||| |||||||||||||| |||||||| || | 
Sbjct: 686 gacagtggtcaagcagaggacagatgcagttttcttgtgaacaattgatccaagacgggc 627

                                                                       
Query: 316 ttttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacac 375
           |||||| || ||||||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 626 ttttcctttcacaatgcagtaagggacctccatcttcctgcacagggctggaagccacac 567

                                                                       
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctc 435
           |||||||||||| || || ||||||||||| ||||| ||||| || ||||||||||||||
Sbjct: 566 aaccagctcaatcggatcgacatcatgagcaatgacgaccagttgggccttgctctgctc 507

                                                                       
Query: 436 aataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaa 495
           ||| ||||| |||||||||||| | ||||||||||||||||||||| ||||| |||||||
Sbjct: 506 aatgaggtatgtgacatggtta-agaccatacttcacaacaattggtttctttgcctcaa 448

                                                                       
Query: 496 cggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccacct 555
           ||||||| || |||||||||||||| |||||||||| ||||||||||||||||||  |||
Sbjct: 447 cggttttaccttcagcctcagcctgggccctcttcaaaagcctctccttcttagcagcct 388

                                                              
Query: 556 tgtcctcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           |||||||||||||||||||||| |||||||| ||||| || || |||||||
Sbjct: 387 tgtcctcagggcggtacttgaggagcatcttaaacagattagttgcgaggt 337



to top

>gb|BT016736.1| Zea mays clone Contig569 mRNA sequence
          Length = 1092

 Score =  563 bits (284), Expect = e-157
 Identities = 466/526 (88%), Gaps = 1/526 (0%)
 Strand = Plus / Minus

                                                                       
Query: 81  tcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcctgcg 140
           |||||| ||| || ||||||||||| |  | | ||||||||||||||||||| |||||||
Sbjct: 839 tcatccgctgggcggcctccttggccagcaacttttccctggccttggtcttggcctgcg 780

                                                                       
Query: 141 acttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgncattga 200
           |||||||||||||||  ||||| ||||||||| ||||||| ||||| |||||| ||||||
Sbjct: 779 acttggagcccatgatgccacctccccacttcttcctgacttcatcaaacttgtcattga 720

                                                                       
Query: 201 agttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacag 260
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 719 agttcgccttaatagcctccaagatcttgctgaactcaagcttgtcctcgttcttgacag 660

                                                                       
Query: 261 tggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgattttc 320
           |||| || ||||  || || ||||||||||||||||| |||||||||||||| |  ||||
Sbjct: 659 tggtcagacacaagactgatgcagtcttcttgtgaacgatcgatccaaggcgagcctttc 600

                                                                       
Query: 321 ccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaacca 380
           | ||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||
Sbjct: 599 ctttaacaatgcagtatgggacctccatcttcctgcacagggctggaagccaaacaacca 540

                                                                       
Query: 381 gctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctcaataa 440
           | ||||| || || |||||||||||||||||||| |||||||||||| |||||||||| |
Sbjct: 539 gttcaatcggatccacatcatgagcgatgacaacgagctgagccttgttctgctcaatga 480

                                                                       
Query: 441 ggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaacggtt 500
           ||||||| ||||||||| |  |||||||||||||||||||| |||||||  ||||| |||
Sbjct: 479 ggtaagtcacatggtta-aggccatacttcacaacaattggtttcttggattcaacagtt 421

                                                                       
Query: 501 ttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccaccttgtcc 560
           || || |||  ||||||||| |||||||||||||||||||||||||| ||  ||||||| 
Sbjct: 420 tttccttcattctcagcctgggccctcttcagaagcctctccttcttggcagccttgtct 361

                                                         
Query: 561 tcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           || || |||||||| ||||||||||||||||||||||| |||||||
Sbjct: 360 tcgggccggtacttaagaagcatcttgaacaggttggtagcgaggt 315



to top

>gb|BT018084.1| Zea mays clone EL01N0552B03.c mRNA sequence
          Length = 849

 Score =  563 bits (284), Expect = e-157
 Identities = 466/526 (88%), Gaps = 1/526 (0%)
 Strand = Plus / Minus

                                                                       
Query: 81  tcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcctgcg 140
           |||||| ||||||||||||||||||||  ||| |||||| |||||||||||| |||||||
Sbjct: 666 tcatccgctgcgcagcctccttggcgagcagcttttcccgggccttggtcttggcctgcg 607

                                                                       
Query: 141 acttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgncattga 200
           ||||||| |||||||  ||||| ||||||||| |||||||||||||||||||| | ||||
Sbjct: 606 acttggatcccatgatgccacctccccacttcttcctgacctcatcgaacttgtcgttga 547

                                                                       
Query: 201 agttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacag 260
           |||| ||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 546 agtttgccttaatagcctccaagatcttgctgaactcaagcttatcctcgttcttgacag 487

                                                                       
Query: 261 tggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgattttc 320
           ||||||| ||||  || || ||| |||||||||||||||||||||||||||| |  ||||
Sbjct: 486 tggtgagacacaagactgatgcattcttcttgtgaacaatcgatccaaggcgagcctttc 427

                                                                       
Query: 321 ccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaacca 380
           | |||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 426 ctttaacaatgcagtaagggacctccatcttcctgcacagggctggaagccacacaacca 367

                                                                       
Query: 381 gctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctcaataa 440
           | ||||| || || || ||||||||||||||||| |||||||||||| |||||||||| |
Sbjct: 366 gttcaatcggatccacgtcatgagcgatgacaacaagctgagccttgttctgctcaatga 307

                                                                       
Query: 441 ggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaacggtt 500
           ||||||| ||||||||| |  |||||||||||||||||||| ||||| | |||||| |||
Sbjct: 306 ggtaagtcacatggtta-aggccatacttcacaacaattggtttcttcgactcaacagtt 248

                                                                       
Query: 501 ttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccaccttgtcc 560
           || || |||  |||||| || |||||||||||||||||||||||||| ||  ||||||| 
Sbjct: 247 tttccttcattctcagcttgggccctcttcagaagcctctccttcttggcagccttgtct 188

                                                         
Query: 561 tcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           ||||| |||||||||||||||||||| |||||||| || |||||||
Sbjct: 187 tcaggccggtacttgagaagcatcttaaacaggttcgtagcgaggt 142



to top

>gb|AY103834.1| Zea mays PCO109701 mRNA sequence
          Length = 1105

 Score =  547 bits (276), Expect = e-152
 Identities = 464/526 (88%), Gaps = 1/526 (0%)
 Strand = Plus / Minus

                                                                       
Query: 81  tcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcctgcg 140
           |||||| ||||||||||||||||||||  | | |||||| |||||||||||| |||||||
Sbjct: 843 tcatccgctgcgcagcctccttggcgagcaacttttcccgggccttggtcttggcctgcg 784

                                                                       
Query: 141 acttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgncattga 200
           ||||||| |||||||  ||||| ||||||||| |||||||||||||||||||| | ||||
Sbjct: 783 acttggatcccatgatgccacctccccacttcttcctgacctcatcgaacttgtcgttga 724

                                                                       
Query: 201 agttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacag 260
           |||| ||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 723 agtttgccttaatagcctccaagatcttgctgaactcaagcttatcctcgttcttgacag 664

                                                                       
Query: 261 tggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgattttc 320
           |||| || ||||  || || ||| |||||||||||||||||||||||||||| |  ||||
Sbjct: 663 tggtcagacacaagactgatgcattcttcttgtgaacaatcgatccaaggcgagcctttc 604

                                                                       
Query: 321 ccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaacca 380
           | |||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 603 ctttaacaatgcagtaagggacctccatcttcctgcacagggctggaagccacacaacca 544

                                                                       
Query: 381 gctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctcaataa 440
           | ||||| || || || ||||||||||||||||| |||||||||||| |||||||||| |
Sbjct: 543 gttcaatcggatccacgtcatgagcgatgacaacaagctgagccttgttctgctcaatga 484

                                                                       
Query: 441 ggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaacggtt 500
           ||||||| ||||||||| |  |||||||||||||||||||| ||||| | |||||| |||
Sbjct: 483 ggtaagtcacatggtta-aggccatacttcacaacaattggtttcttcgactcaacagtt 425

                                                                       
Query: 501 ttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccaccttgtcc 560
           || || |||  |||||| || |||||||||||||||||||||||||| ||  ||||||| 
Sbjct: 424 tttccttcattctcagcttgggccctcttcagaagcctctccttcttggcagccttgtct 365

                                                         
Query: 561 tcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           ||||| |||||||||||||||||||| |||||||| || |||||||
Sbjct: 364 tcaggccggtacttgagaagcatcttaaacaggttcgtagcgaggt 319



to top

>gb|AY105417.1| Zea mays PCO109699 mRNA sequence
          Length = 1103

 Score =  529 bits (267), Expect = e-147
 Identities = 455/517 (88%), Gaps = 1/517 (0%)
 Strand = Plus / Minus

                                                                       
Query: 75  cttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcg 134
           ||||| |||||| ||| ||||| |||||||| |  ||| |||||||||||||||| ||||
Sbjct: 844 cttaggtcatccgctgggcagcttccttggcaagcagcttttccctggccttggttttcg 785

                                                                       
Query: 135 cctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgn 194
           |||| || ||||||||||||| |||||||||||||||| ||||||||||||| |||||| 
Sbjct: 784 cctgtgatttggagcccatgataccaccaccccacttcttcctgacctcatcaaacttgt 725

                                                                       
Query: 195 cattgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttct 254
           | |||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||
Sbjct: 724 cgttgaagttagccttgatagcctccaggattttgctgaactcaagcttgtcctcgttct 665

                                                                       
Query: 255 tcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtg 314
           | || ||||| | ||| |||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 664 tgacggtggtcaagcaaagaacagatgcagtcttcttgtgaacgatcgatccaaggcgtg 605

                                                                       
Query: 315 attttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccaca 374
            ||||||||| |||||||||||||| |||||||| |||||||| ||||| ||||||||||
Sbjct: 604 cttttcccttgacaatgcagtatggaacctccattttcctgcaaagggccgggagccaca 545

                                                                       
Query: 375 caaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgct 434
           | |||||||| || || |||||||||||||| |||||||||||||| |||||||||||||
Sbjct: 544 cgaccagctcgatcggatcaacatcatgagctatgacaaccagctgggccttgctctgct 485

                                                                       
Query: 435 caataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctca 494
           | || |||||||| ||||||||| |  || ||||||||||||||||| ||||| | ||||
Sbjct: 484 cgatgaggtaagtcacatggtta-aggccgtacttcacaacaattggtttctttgactca 426

                                                                       
Query: 495 acggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccacc 554
           || |||||||||||    |||||||| ||||||||||  |||||||||||||| ||  | 
Sbjct: 425 acagttttcccctcgttttcagcctgggccctcttcaagagcctctccttcttggcagct 366

                                                
Query: 555 ttgtcctcagggcggtacttgagaagcatcttgaaca 591
           |||||||| ||||||||||| ||||||||||||||||
Sbjct: 365 ttgtcctcggggcggtacttaagaagcatcttgaaca 329



to top

>ref|XM_463662.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 927

 Score =  335 bits (169), Expect = 1e-88
 Identities = 396/471 (84%), Gaps = 1/471 (0%)
 Strand = Plus / Minus

                                                                       
Query: 76  ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
           |||| |||||||||| ||||| |||||||| |  ||| |||||||||| |||||||| ||
Sbjct: 927 ttaggtcatcctctgggcagcttccttggctagaagcttttccctggctttggtcttggc 868

                                                                       
Query: 136 ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
            || ||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
Sbjct: 867 ttgtgactttgagcccatgataccaccaccccacttcttcctgacctcatcgaacttgtc 808

                                                                       
Query: 196 attgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttctt 255
            |||||||| | ||| || ||||||||||| ||||||||||| | |||||| || |||||
Sbjct: 807 gttgaagtttgacttaatggcctccaagattttgctgaactccaacttgtcttcattctt 748

                                                                       
Query: 256 cacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtga 315
           |||||| || || || || ||||| || ||||||||||| |||||||||||||| || | 
Sbjct: 747 cacagtcgtcagacaaaggacagatgctgtcttcttgtgcacaatcgatccaagacgagc 688

                                                                       
Query: 316 ttttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacac 375
            |||||||| |||||||| || ||||  |||||||||||||| | |||||||||||| ||
Sbjct: 687 ctttcccttcacaatgcaataagggatttccatcttcctgcacaaggctgggagccaaac 628

                                                                       
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctc 435
            || || ||||| ||||| ||||||||||| ||||| || ||||| ||||||||||| ||
Sbjct: 627 gacgagttcaatggggtcgacatcatgagcaatgaccacaagctgtgccttgctctgttc 568

                                                                       
Query: 436 aataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttggcctcaa 495
           ||| |  || || ||||||| | | ||||||||||||||||||||| |||||||| ||||
Sbjct: 567 aatcaaataggtcacatggtca-agaccatacttcacaacaattggtttcttggcttcaa 509

                                                              
Query: 496 cggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttct 546
           | || ||||| |||||||| || || || || |||| |||||| |||||||
Sbjct: 508 cagtcttcccttcagcctctgcttgcgctcttttcaaaagcctttccttct 458



to top

>gb|AY086353.1| Arabidopsis thaliana clone 24272 mRNA, complete sequence
          Length = 1020

 Score =  268 bits (135), Expect = 2e-68
 Identities = 344/413 (83%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 850 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 791

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| ||
Sbjct: 790 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtca 731

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 730 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttc 671

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 670 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 611

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||||||||||||| ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 610 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 551

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 550 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 491

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || |||||||| |||||||| || ||||||||| |||||||| ||||||||||
Sbjct: 490 atgaggtaagtcacatggtt-gagaccatacttaacaacaatgggcttcttgg 439



to top

>ref|NM_116152.2| Arabidopsis thaliana structural constituent of ribosome AT3G62870
           mRNA, complete cds
          Length = 1048

 Score =  252 bits (127), Expect = 1e-63
 Identities = 342/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 850 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 791

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 790 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 731

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||| 
Sbjct: 730 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 671

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 670 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 611

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||||||||||||| ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 610 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 551

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 550 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 491

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || |||||||| |||||||| || ||||||||| |||||||| ||||||||||
Sbjct: 490 atgaggtaagtcacatggtt-gagaccatacttaacaacaatgggcttcttgg 439



to top

>gb|AY114667.1| Arabidopsis thaliana 60S ribosomal protein L7A protein (At3g62870)
           mRNA, complete cds
          Length = 883

 Score =  252 bits (127), Expect = 1e-63
 Identities = 342/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 770 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 711

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 710 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 651

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||| 
Sbjct: 650 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 591

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 590 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 531

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||||||||||||| ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 530 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 471

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 470 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 411

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || |||||||| |||||||| || ||||||||| |||||||| ||||||||||
Sbjct: 410 atgaggtaagtcacatggtt-gagaccatacttaacaacaatgggcttcttgg 359



to top

>gb|AY062758.1| Arabidopsis thaliana 60S RIBOSOMAL PROTEIN L7A protein (At3g62870;
           F26K9_300) mRNA, complete cds
          Length = 976

 Score =  252 bits (127), Expect = 1e-63
 Identities = 342/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 806 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 747

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 746 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 687

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||| 
Sbjct: 686 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 627

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 626 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 567

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||||||||||||| ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 566 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 507

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 506 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 447

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || |||||||| |||||||| || ||||||||| |||||||| ||||||||||
Sbjct: 446 atgaggtaagtcacatggtt-gagaccatacttaacaacaatgggcttcttgg 395



to top

>gb|AY060519.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, complete cds
          Length = 771

 Score =  252 bits (127), Expect = 1e-63
 Identities = 342/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 770 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 711

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 710 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 651

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||| 
Sbjct: 650 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 591

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 590 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 531

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||||||||||||| ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 530 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 471

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 470 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 411

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || |||||||| |||||||| || ||||||||| |||||||| ||||||||||
Sbjct: 410 atgaggtaagtcacatggtt-gagaccatacttaacaacaatgggcttcttgg 359



to top

>gb|AY052264.1| Arabidopsis thaliana AT3g62870/F26K9_300 mRNA, complete cds
          Length = 1013

 Score =  252 bits (127), Expect = 1e-63
 Identities = 342/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 843 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 784

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 783 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 724

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||| 
Sbjct: 723 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 664

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 663 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 604

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||||||||||||| ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 603 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 544

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 543 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 484

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || |||||||| |||||||| || ||||||||| |||||||| ||||||||||
Sbjct: 483 atgaggtaagtcacatggtt-gagaccatacttaacaacaatgggcttcttgg 432



to top

>emb|BX825094.1|CNS0A7RE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH9ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 835

 Score =  252 bits (127), Expect = 1e-63
 Identities = 342/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 726 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 667

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 666 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 607

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||| 
Sbjct: 606 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 547

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 546 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 487

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||||||||||||| ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 486 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 427

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 426 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 367

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || |||||||| |||||||| || ||||||||| |||||||| ||||||||||
Sbjct: 366 atgaggtaagtcacatggtt-gagaccatacttaacaacaatgggcttcttgg 315



to top

>emb|BX823982.1|CNS0A6PP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH12ZB02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score =  252 bits (127), Expect = 1e-63
 Identities = 342/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 790 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 731

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 730 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 671

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||| 
Sbjct: 670 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 611

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 610 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 551

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||||||||||||| ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 550 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 491

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 490 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 431

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || |||||||| |||||||| || ||||||||| |||||||| ||||||||||
Sbjct: 430 atgaggtaagtcacatggtt-gagaccatacttaacaacaatgggcttcttgg 379



to top

>emb|BX824662.1|CNS0A4TO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 940

 Score =  252 bits (127), Expect = 1e-63
 Identities = 342/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 808 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 749

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 748 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 689

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||| 
Sbjct: 688 ttgaagttagccttgatggcctcaaggattttgctgaactcaagcttgtcctcgttcttg 629

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 628 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 569

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||||||||||||| ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 568 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 509

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 508 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 449

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || |||||||| |||||||| || ||||||||| |||||||| ||||||||||
Sbjct: 448 atgaggtaagtcacatggtt-gagaccatacttaacaacaatgggcttcttgg 397



to top

>emb|BX824325.1|CNS0A7R8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH3ZF06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 793

 Score =  244 bits (123), Expect = 3e-61
 Identities = 341/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 720 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 661

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 660 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 601

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||| 
Sbjct: 600 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 541

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 540 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 481

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||| ||||||||  ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 480 tttcccttaaaaatgcagtgagggacttccattttcctgcagagtgcaggtaaccagacc 421

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 420 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 361

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || ||||||||||||||||| || ||||||||| |||||||| ||||||||||
Sbjct: 360 atgaggtaagtgacatggtt-gagaccatacttaacaacaatgggcttcttgg 309



to top

>emb|BX824178.1|CNS0A6S9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH28ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 983

 Score =  244 bits (123), Expect = 3e-61
 Identities = 341/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 809 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 750

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 749 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 690

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||| 
Sbjct: 689 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 630

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 629 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 570

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||||||||||||| ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 569 tttcccttaacaatgcagtaagggacttccattttcctgcagagtgcaggtaaccagacc 510

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 509 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 450

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || |||||||| ||||||||  | ||||||||| |||||||| ||||||||||
Sbjct: 449 atgaggtaagtcacatggtt-tacaccatacttaacaacaatgggcttcttgg 398



to top

>emb|BX822281.1|CNS0A71I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB26ZA10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 870

 Score =  244 bits (123), Expect = 3e-61
 Identities = 341/413 (82%), Gaps = 1/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 763 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 704

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 703 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 644

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||| |||||||| ||||| | ||| ||||||||||||||||||||||||||||| 
Sbjct: 643 ttgaagttagccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttg 584

                                                                       
Query: 257 acagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgat 316
           |||||||| | |||||   |||  |||||||||| |||||| | || |||||| || |||
Sbjct: 583 acagtggtcaagcacaaggcagcagcagtcttctggtgaacgaccgctccaagacgagat 524

                                                                       
Query: 317 tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
           |||||||||||||||||||  ||||| ||||| |||||||| || || || | ||| || 
Sbjct: 523 tttcccttaacaatgcagttagggacttccattttcctgcagagtgcaggtaaccagacc 464

                                                                       
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctca 436
           |||| ||| || ||||||||||| || || ||||| || ||||| |||||| ||||||| 
Sbjct: 463 accaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgccttgttctgctcg 404

                                                                
Query: 437 ataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
           || |||||||| |||||||| || ||||||||| |||||||| ||||||||||
Sbjct: 403 atgaggtaagttacatggtt-gagaccatacttaacaacaatgggcttcttgg 352



to top

>ref|NM_130329.2| Arabidopsis thaliana structural constituent of ribosome AT2G47610
           mRNA, complete cds
          Length = 1092

 Score =  238 bits (120), Expect = 2e-59
 Identities = 316/382 (82%)
 Strand = Plus / Minus

                                                                       
Query: 75  cttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcg 134
           |||| |||||||| || ||||||||||| || || |  |||||| | ||||||||||| |
Sbjct: 839 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 780

                                                                       
Query: 135 cctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgn 194
           |||| ||||| || ||||| |  || || ||||| ||| |||||  ||| ||| ||||| 
Sbjct: 779 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 720

                                                                       
Query: 195 cattgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttct 254
           |||||||||| ||||||||||| |||| ||| ||||||||||| ||||||||||||||||
Sbjct: 719 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 660

                                                                       
Query: 255 tcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtg 314
           | |||||||| |  ||||    ||| |||||||||| |||||||| || |||||| || |
Sbjct: 659 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 600

                                                                       
Query: 315 attttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccaca 374
           |||| ||||| ||||||||||| ||||| |||||||||||||| || || || | ||| |
Sbjct: 599 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 540

                                                                       
Query: 375 caaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgct 434
           |||||| |||||||||||| ||||||||||| || ||||| || || |||||| ||||||
Sbjct: 539 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 480

                                 
Query: 435 caataaggtaagtgacatggtt 456
           |||| ||||| || ||||||||
Sbjct: 479 caatgaggtaggtcacatggtt 458



to top

>gb|AY052674.1| Arabidopsis thaliana At2g47610/T30B22.8 mRNA, complete cds
          Length = 984

 Score =  238 bits (120), Expect = 2e-59
 Identities = 316/382 (82%)
 Strand = Plus / Minus

                                                                       
Query: 75  cttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcg 134
           |||| |||||||| || ||||||||||| || || |  |||||| | ||||||||||| |
Sbjct: 837 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 778

                                                                       
Query: 135 cctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgn 194
           |||| ||||| || ||||| |  || || ||||| ||| |||||  ||| ||| ||||| 
Sbjct: 777 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 718

                                                                       
Query: 195 cattgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttct 254
           |||||||||| ||||||||||| |||| ||| ||||||||||| ||||||||||||||||
Sbjct: 717 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 658

                                                                       
Query: 255 tcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtg 314
           | |||||||| |  ||||    ||| |||||||||| |||||||| || |||||| || |
Sbjct: 657 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 598

                                                                       
Query: 315 attttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccaca 374
           |||| ||||| ||||||||||| ||||| |||||||||||||| || || || | ||| |
Sbjct: 597 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 538

                                                                       
Query: 375 caaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgct 434
           |||||| |||||||||||| ||||||||||| || ||||| || || |||||| ||||||
Sbjct: 537 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 478

                                 
Query: 435 caataaggtaagtgacatggtt 456
           |||| ||||| || ||||||||
Sbjct: 477 caatgaggtaggtcacatggtt 456



to top

>gb|AF385719.1|AF385719 Arabidopsis thaliana At2g47610/T30B22.8 mRNA, complete cds
          Length = 999

 Score =  238 bits (120), Expect = 2e-59
 Identities = 316/382 (82%)
 Strand = Plus / Minus

                                                                       
Query: 75  cttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcg 134
           |||| |||||||| || ||||||||||| || || |  |||||| | ||||||||||| |
Sbjct: 837 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 778

                                                                       
Query: 135 cctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgn 194
           |||| ||||| || ||||| |  || || ||||| ||| |||||  ||| ||| ||||| 
Sbjct: 777 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 718

                                                                       
Query: 195 cattgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttct 254
           |||||||||| ||||||||||| |||| ||| ||||||||||| ||||||||||||||||
Sbjct: 717 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 658

                                                                       
Query: 255 tcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtg 314
           | |||||||| |  ||||    ||| |||||||||| |||||||| || |||||| || |
Sbjct: 657 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 598

                                                                       
Query: 315 attttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccaca 374
           |||| ||||| ||||||||||| ||||| |||||||||||||| || || || | ||| |
Sbjct: 597 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 538

                                                                       
Query: 375 caaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgct 434
           |||||| |||||||||||| ||||||||||| || ||||| || || |||||| ||||||
Sbjct: 537 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 478

                                 
Query: 435 caataaggtaagtgacatggtt 456
           |||| ||||| || ||||||||
Sbjct: 477 caatgaggtaggtcacatggtt 456



to top

>emb|BX821062.1|CNS0A8OD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH9ZF10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 897

 Score =  238 bits (120), Expect = 2e-59
 Identities = 316/382 (82%)
 Strand = Plus / Minus

                                                                       
Query: 75  cttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcg 134
           |||| |||||||| || ||||||||||| || || |  |||||| | ||||||||||| |
Sbjct: 773 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 714

                                                                       
Query: 135 cctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgn 194
           |||| ||||| || ||||| |  || || ||||| ||| |||||  ||| ||| ||||| 
Sbjct: 713 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 654

                                                                       
Query: 195 cattgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttct 254
           |||||||||| ||||||||||| |||| ||| ||||||||||| ||||||||||||||||
Sbjct: 653 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 594

                                                                       
Query: 255 tcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtg 314
           | |||||||| |  ||||    ||| |||||||||| |||||||| || |||||| || |
Sbjct: 593 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 534

                                                                       
Query: 315 attttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccaca 374
           |||| ||||| ||||||||||| ||||| |||||||||||||| || || || | ||| |
Sbjct: 533 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 474

                                                                       
Query: 375 caaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgct 434
           |||||| |||||||||||| ||||||||||| || ||||| || || |||||| ||||||
Sbjct: 473 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 414

                                 
Query: 435 caataaggtaagtgacatggtt 456
           |||| ||||| || ||||||||
Sbjct: 413 caatgaggtaggtcacatggtt 392



to top

>gb|AY088386.1| Arabidopsis thaliana clone 6394 mRNA, complete sequence
          Length = 1092

 Score =  238 bits (120), Expect = 2e-59
 Identities = 316/382 (82%)
 Strand = Plus / Minus

                                                                       
Query: 75  cttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcg 134
           |||| |||||||| || ||||||||||| || || |  |||||| | ||||||||||| |
Sbjct: 840 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 781

                                                                       
Query: 135 cctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgn 194
           |||| ||||| || ||||| |  || || ||||| ||| |||||  ||| ||| ||||| 
Sbjct: 780 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 721

                                                                       
Query: 195 cattgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttct 254
           |||||||||| ||||||||||| |||| ||| ||||||||||| ||||||||||||||||
Sbjct: 720 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 661

                                                                       
Query: 255 tcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtg 314
           | |||||||| |  ||||    ||| |||||||||| |||||||| || |||||| || |
Sbjct: 660 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 601

                                                                       
Query: 315 attttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccaca 374
           |||| ||||| ||||||||||| ||||| |||||||||||||| || || || | ||| |
Sbjct: 600 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 541

                                                                       
Query: 375 caaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgct 434
           |||||| |||||||||||| ||||||||||| || ||||| || || |||||| ||||||
Sbjct: 540 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 481

                                 
Query: 435 caataaggtaagtgacatggtt 456
           |||| ||||| || ||||||||
Sbjct: 480 caatgaggtaggtcacatggtt 459



to top

>gb|BT000500.1| Arabidopsis thaliana 60S ribosomal protein L7A
           (At2g47610/T30B22.8) mRNA, complete cds
          Length = 774

 Score =  236 bits (119), Expect = 7e-59
 Identities = 312/377 (82%)
 Strand = Plus / Minus

                                                                       
Query: 80  ttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcctgc 139
           |||||||| || ||||||||||| || || |  |||||| | ||||||||||| ||||| 
Sbjct: 770 ttcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttgcctga 711

                                                                       
Query: 140 gacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgncattg 199
           ||||| || ||||| |  || || ||||| ||| |||||  ||| ||| ||||| |||||
Sbjct: 710 gacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgtcattg 651

                                                                       
Query: 200 aagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcaca 259
           ||||| ||||||||||| |||| ||| ||||||||||| ||||||||||||||||| |||
Sbjct: 650 aagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttcttgaca 591

                                                                       
Query: 260 gtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgatttt 319
           ||||| |  ||||    ||| |||||||||| |||||||| || |||||| || ||||| 
Sbjct: 590 gtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgagatttg 531

                                                                       
Query: 320 cccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaacc 379
           ||||| ||||||||||| ||||| |||||||||||||| || || || | ||| ||||||
Sbjct: 530 cccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccagacaacc 471

                                                                       
Query: 380 agctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctcaata 439
           | |||||||||||| ||||||||||| || ||||| || || |||||| |||||||||| 
Sbjct: 470 aactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgctcaatg 411

                            
Query: 440 aggtaagtgacatggtt 456
           ||||| || ||||||||
Sbjct: 410 aggtaggtcacatggtt 394



to top

>gb|AC108759.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone
              OSJNBa0072P02, complete sequence
          Length = 157488

 Score =  232 bits (117), Expect = 1e-57
 Identities = 157/169 (92%), Gaps = 1/169 (0%)
 Strand = Plus / Plus

                                                                          
Query: 430    ctgctcaataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
              ||||||||| |||||||| || |||||| | |||||||||||||||||||||||||||||
Sbjct: 108785 ctgctcaatgaggtaagtcacgtggtta-agaccatacttcacaacaattggcttcttgg 108843

                                                                          
Query: 490    cctcaacggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttag 549
              |||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||| |
Sbjct: 108844 cctcaacggttttcccttcagcctcagcctgggccctcttcaaaagcctctccttcttgg 108903

                                                               
Query: 550    ccaccttgtcctcagggcggtacttgagaagcatcttgaacaggttggt 598
              |  |||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 108904 cagccttgtcctcagggcggtacttgagaagcatcttaaacaggttggt 108952



 Score =  184 bits (93), Expect = 2e-43
 Identities = 123/133 (92%)
 Strand = Plus / Plus

                                                                          
Query: 301    cgatccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcatag 360
              |||||||||||| | ||| |||||||| |||||||| ||||||||||||||||| || ||
Sbjct: 108543 cgatccaaggcgagctttgcccttaacgatgcagtaagggacctccatcttcctacacag 108602

                                                                          
Query: 361    ggctgggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctg 420
              |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 108603 ggctggaagccacacaaccagctcaattggatcaacatcatgagcgatgacaaccagctg 108662

                           
Query: 421    agccttgctctgc 433
               ||||||||||||
Sbjct: 108663 ggccttgctctgc 108675



 Score =  151 bits (76), Expect = 3e-33
 Identities = 119/134 (88%)
 Strand = Plus / Plus

                                                                          
Query: 76     ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
              |||| |||||| ||| || |||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 108114 ttaggtcatccgctgggcggcctccttagcgagaagcttttccctggccttggtcttcgc 108173

                                                                          
Query: 136    ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
              ||||||||||||||||||||| || || ||||||||| |||||||||| ||||||||| |
Sbjct: 108174 ctgcgacttggagcccatgacgccgcctccccacttcttcctgacctcgtcgaacttgtc 108233

                            
Query: 196    attgaagttcgcct 209
               |||||||||||||
Sbjct: 108234 gttgaagttcgcct 108247



 Score =  149 bits (75), Expect = 1e-32
 Identities = 90/95 (94%)
 Strand = Plus / Plus

                                                                          
Query: 207    ccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggtga 266
              ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
Sbjct: 108349 ccttgatggcctccaagatcttgctgaactcaagcttgtcctcgttcttgacagtggtca 108408

                                                 
Query: 267    ggcacagaacagaggcagtcttcttgtgaacaatc 301
               |||||||||||| |||||||||||||||||||||
Sbjct: 108409 agcacagaacagatgcagtcttcttgtgaacaatc 108443



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  232 bits (117), Expect = 1e-57
 Identities = 157/169 (92%), Gaps = 1/169 (0%)
 Strand = Plus / Plus

                                                                            
Query: 430      ctgctcaataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
                ||||||||| |||||||| || |||||| | |||||||||||||||||||||||||||||
Sbjct: 19389559 ctgctcaatgaggtaagtcacgtggtta-agaccatacttcacaacaattggcttcttgg 19389617

                                                                            
Query: 490      cctcaacggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttag 549
                |||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||| |
Sbjct: 19389618 cctcaacggttttcccttcagcctcagcctgggccctcttcaaaagcctctccttcttgg 19389677

                                                                 
Query: 550      ccaccttgtcctcagggcggtacttgagaagcatcttgaacaggttggt 598
                |  |||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 19389678 cagccttgtcctcagggcggtacttgagaagcatcttaaacaggttggt 19389726



 Score =  184 bits (93), Expect = 2e-43
 Identities = 123/133 (92%)
 Strand = Plus / Plus

                                                                            
Query: 301      cgatccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcatag 360
                |||||||||||| | ||| |||||||| |||||||| ||||||||||||||||| || ||
Sbjct: 19389317 cgatccaaggcgagctttgcccttaacgatgcagtaagggacctccatcttcctacacag 19389376

                                                                            
Query: 361      ggctgggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctg 420
                |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 19389377 ggctggaagccacacaaccagctcaattggatcaacatcatgagcgatgacaaccagctg 19389436

                             
Query: 421      agccttgctctgc 433
                 ||||||||||||
Sbjct: 19389437 ggccttgctctgc 19389449



 Score =  151 bits (76), Expect = 3e-33
 Identities = 119/134 (88%)
 Strand = Plus / Plus

                                                                            
Query: 76       ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
                |||| |||||| ||| || |||||||| ||||  ||| ||||||||||||||||||||||
Sbjct: 19388888 ttaggtcatccgctgggcggcctccttagcgagaagcttttccctggccttggtcttcgc 19388947

                                                                            
Query: 136      ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
                ||||||||||||||||||||| || || ||||||||| |||||||||| ||||||||| |
Sbjct: 19388948 ctgcgacttggagcccatgacgccgcctccccacttcttcctgacctcgtcgaacttgtc 19389007

                              
Query: 196      attgaagttcgcct 209
                 |||||||||||||
Sbjct: 19389008 gttgaagttcgcct 19389021



 Score =  149 bits (75), Expect = 1e-32
 Identities = 90/95 (94%)
 Strand = Plus / Plus

                                                                            
Query: 207      ccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggtga 266
                ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
Sbjct: 19389123 ccttgatggcctccaagatcttgctgaactcaagcttgtcctcgttcttgacagtggtca 19389182

                                                   
Query: 267      ggcacagaacagaggcagtcttcttgtgaacaatc 301
                 |||||||||||| |||||||||||||||||||||
Sbjct: 19389183 agcacagaacagatgcagtcttcttgtgaacaatc 19389217



to top

>emb|BX819217.1|CNS0A8T4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB58ZF10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 747

 Score =  222 bits (112), Expect = 1e-54
 Identities = 314/382 (82%)
 Strand = Plus / Minus

                                                                       
Query: 75  cttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcg 134
           |||| |||||||| || ||||||||||| || || |  |||||| | ||||||||||| |
Sbjct: 585 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 526

                                                                       
Query: 135 cctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgn 194
           |||| ||||| || ||||| |  || || ||||| ||| |||||  ||| ||| ||||| 
Sbjct: 525 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 466

                                                                       
Query: 195 cattgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttct 254
           |||||||||| ||||||||||| |||| ||| ||||||||||| ||||||||||||||||
Sbjct: 465 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 406

                                                                       
Query: 255 tcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtg 314
           | |||||||| |  ||||    ||| |||||||||| |||||||| || |||||| || |
Sbjct: 405 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 346

                                                                       
Query: 315 attttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccaca 374
           |||| ||||| | ||||||||| ||||| |||||||||||||| || || || | ||| |
Sbjct: 345 atttgcccttgaaaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 286

                                                                       
Query: 375 caaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgct 434
           |||||| || ||||||||| ||||||||||| || ||||| || || |||||| ||||||
Sbjct: 285 caaccaacttaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 226

                                 
Query: 435 caataaggtaagtgacatggtt 456
           |||| ||||| || ||||||||
Sbjct: 225 caatgaggtaggtcacatggtt 204



to top

>emb|BX842094.1|CNS09Y94 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZH02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 877

 Score =  222 bits (112), Expect = 1e-54
 Identities = 314/382 (82%)
 Strand = Plus / Minus

                                                                       
Query: 75  cttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcg 134
           |||| |||||||| || ||||||||||| || || |  |||||| | ||||||||||| |
Sbjct: 814 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 755

                                                                       
Query: 135 cctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgn 194
           |||| ||||| || ||||| |  || |   |||| ||| |||||  ||| ||| ||||| 
Sbjct: 754 cctgagacttagatcccattatgcctctttcccatttcttcctgtactcctcgtacttgt 695

                                                                       
Query: 195 cattgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttct 254
           |||||||||| ||||||||||| |||| ||| ||||||||||| ||||||||||||||||
Sbjct: 694 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 635

                                                                       
Query: 255 tcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtg 314
           | |||||||| |  ||||    ||| |||||||||| |||||||| || |||||| || |
Sbjct: 634 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 575

                                                                       
Query: 315 attttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccaca 374
           |||| ||||| ||||||||||| ||||| |||||||||||||| || || || | ||| |
Sbjct: 574 atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 515

                                                                       
Query: 375 caaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgct 434
           |||||| |||||||||||| ||||||||||| || ||||| || || |||||| ||||||
Sbjct: 514 caaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 455

                                 
Query: 435 caataaggtaagtgacatggtt 456
           |||| ||||| || ||||||||
Sbjct: 454 caatgaggtaggtcacatggtt 433



to top

>emb|BX842006.1|CNS09Y9Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 979

 Score =  208 bits (105), Expect = 2e-50
 Identities = 227/268 (84%)
 Strand = Plus / Minus

                                                                       
Query: 189 acttgncattgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcct 248
           ||||| |||||||||| |||||||||||  ||| ||| ||||||||||| ||||||||||
Sbjct: 704 acttgtcattgaagttggccttgatagctcccaggattttgctgaactctagcttgtcct 645

                                                                       
Query: 249 cgttcttcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaa 308
           |||||||||||||||| |  ||||    ||| |||||||||| |||||||| || |||||
Sbjct: 644 cgttcttcacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaa 585

                                                                       
Query: 309 ggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcatagggctggga 368
           | ||  |||| ||||| ||||||||||| ||||| |||||||||||||| || || || |
Sbjct: 584 gacgacatttgcccttcacaatgcagtacgggacttccatcttcctgcacagagcaggca 525

                                                                       
Query: 369 gccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgc 428
            ||||||||||| |||||||||||| ||||||||||| || ||||| || || |||||| 
Sbjct: 524 accacacaaccaactcaattgggtcgacatcatgagcaataacaacaagttgggccttgt 465

                                       
Query: 429 tctgctcaataaggtaagtgacatggtt 456
           |||||||||| ||||| || ||||||||
Sbjct: 464 tctgctcaatgaggtaggtcacatggtt 437



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  204 bits (103), Expect = 2e-49
 Identities = 149/163 (91%), Gaps = 1/163 (0%)
 Strand = Plus / Plus

                                                                            
Query: 430      ctgctcaataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
                ||||||||| ||||| |||||||||||| | ||||||||||||||||||||| ||||| |
Sbjct: 14334220 ctgctcaatgaggtatgtgacatggtta-agaccatacttcacaacaattggtttctttg 14334278

                                                                            
Query: 490      cctcaacggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttag 549
                ||||||||||||| || |||||||||||||| |||||||||| |||||||||||||||||
Sbjct: 14334279 cctcaacggttttaccttcagcctcagcctgggccctcttcaaaagcctctccttcttag 14334338

                                                           
Query: 550      ccaccttgtcctcagggcggtacttgagaagcatcttgaacag 592
                |  ||||||||||||||||||||||||| |||||||| |||||
Sbjct: 14334339 cagccttgtcctcagggcggtacttgaggagcatcttaaacag 14334381



 Score =  151 bits (76), Expect = 3e-33
 Identities = 119/134 (88%)
 Strand = Plus / Plus

                                                                            
Query: 76       ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
                |||| |||||| ||| ||||||||||||||||  ||| ||||||||||||||||||||||
Sbjct: 14333553 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 14333612

                                                                            
Query: 136      ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
                |||||||||||| |||||||| || || ||||||||| |||| ||||||||||| ||| |
Sbjct: 14333613 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 14333672

                              
Query: 196      attgaagttcgcct 209
                 |||||||||||||
Sbjct: 14333673 gttgaagttcgcct 14333686



 Score =  143 bits (72), Expect = 8e-31
 Identities = 117/132 (88%)
 Strand = Plus / Plus

                                                                            
Query: 302      gatccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcatagg 361
                |||||||| || | |||||| || ||||||||||| |||||||||||||||||||| |||
Sbjct: 14333978 gatccaagacgggcttttcctttcacaatgcagtaagggacctccatcttcctgcacagg 14334037

                                                                            
Query: 362      gctgggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctga 421
                ||||| |||||||||||||||||||| || || ||||||||||| ||||| ||||| || 
Sbjct: 14334038 gctggaagccacacaaccagctcaatcggatcgacatcatgagcaatgacgaccagttgg 14334097

                            
Query: 422      gccttgctctgc 433
                ||||||||||||
Sbjct: 14334098 gccttgctctgc 14334109



 Score =  125 bits (63), Expect = 2e-25
 Identities = 87/95 (91%)
 Strand = Plus / Plus

                                                                            
Query: 207      ccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggtga 266
                ||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
Sbjct: 14333794 ccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttcttgacagtggtca 14333853

                                                   
Query: 267      ggcacagaacagaggcagtcttcttgtgaacaatc 301
                 ||| || ||||| ||||| |||||||||||||||
Sbjct: 14333854 agcagaggacagatgcagttttcttgtgaacaatc 14333888



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 236      tcaagcttgtcctcgttcttcaca 259
                |||||||||||||||| |||||||
Sbjct: 17165697 tcaagcttgtcctcgtgcttcaca 17165720



to top

>dbj|AP004637.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0703C03
          Length = 162620

 Score =  204 bits (103), Expect = 2e-49
 Identities = 149/163 (91%), Gaps = 1/163 (0%)
 Strand = Plus / Plus

                                                                          
Query: 430    ctgctcaataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
              ||||||||| ||||| |||||||||||| | ||||||||||||||||||||| ||||| |
Sbjct: 149776 ctgctcaatgaggtatgtgacatggtta-agaccatacttcacaacaattggtttctttg 149834

                                                                          
Query: 490    cctcaacggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttag 549
              ||||||||||||| || |||||||||||||| |||||||||| |||||||||||||||||
Sbjct: 149835 cctcaacggttttaccttcagcctcagcctgggccctcttcaaaagcctctccttcttag 149894

                                                         
Query: 550    ccaccttgtcctcagggcggtacttgagaagcatcttgaacag 592
              |  ||||||||||||||||||||||||| |||||||| |||||
Sbjct: 149895 cagccttgtcctcagggcggtacttgaggagcatcttaaacag 149937



 Score =  151 bits (76), Expect = 3e-33
 Identities = 119/134 (88%)
 Strand = Plus / Plus

                                                                          
Query: 76     ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
              |||| |||||| ||| ||||||||||||||||  ||| ||||||||||||||||||||||
Sbjct: 149109 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 149168

                                                                          
Query: 136    ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
              |||||||||||| |||||||| || || ||||||||| |||| ||||||||||| ||| |
Sbjct: 149169 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 149228

                            
Query: 196    attgaagttcgcct 209
               |||||||||||||
Sbjct: 149229 gttgaagttcgcct 149242



 Score =  143 bits (72), Expect = 8e-31
 Identities = 117/132 (88%)
 Strand = Plus / Plus

                                                                          
Query: 302    gatccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcatagg 361
              |||||||| || | |||||| || ||||||||||| |||||||||||||||||||| |||
Sbjct: 149534 gatccaagacgggcttttcctttcacaatgcagtaagggacctccatcttcctgcacagg 149593

                                                                          
Query: 362    gctgggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctga 421
              ||||| |||||||||||||||||||| || || ||||||||||| ||||| ||||| || 
Sbjct: 149594 gctggaagccacacaaccagctcaatcggatcgacatcatgagcaatgacgaccagttgg 149653

                          
Query: 422    gccttgctctgc 433
              ||||||||||||
Sbjct: 149654 gccttgctctgc 149665



 Score =  125 bits (63), Expect = 2e-25
 Identities = 87/95 (91%)
 Strand = Plus / Plus

                                                                          
Query: 207    ccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggtga 266
              ||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
Sbjct: 149350 ccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttcttgacagtggtca 149409

                                                 
Query: 267    ggcacagaacagaggcagtcttcttgtgaacaatc 301
               ||| || ||||| ||||| |||||||||||||||
Sbjct: 149410 agcagaggacagatgcagttttcttgtgaacaatc 149444



to top

>dbj|AP003884.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1136_A10
          Length = 101249

 Score =  204 bits (103), Expect = 2e-49
 Identities = 149/163 (91%), Gaps = 1/163 (0%)
 Strand = Plus / Plus

                                                                         
Query: 430   ctgctcaataaggtaagtgacatggttagaaaccatacttcacaacaattggcttcttgg 489
             ||||||||| ||||| |||||||||||| | ||||||||||||||||||||| ||||| |
Sbjct: 37300 ctgctcaatgaggtatgtgacatggtta-agaccatacttcacaacaattggtttctttg 37358

                                                                         
Query: 490   cctcaacggttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttag 549
             ||||||||||||| || |||||||||||||| |||||||||| |||||||||||||||||
Sbjct: 37359 cctcaacggttttaccttcagcctcagcctgggccctcttcaaaagcctctccttcttag 37418

                                                        
Query: 550   ccaccttgtcctcagggcggtacttgagaagcatcttgaacag 592
             |  ||||||||||||||||||||||||| |||||||| |||||
Sbjct: 37419 cagccttgtcctcagggcggtacttgaggagcatcttaaacag 37461



 Score =  151 bits (76), Expect = 3e-33
 Identities = 119/134 (88%)
 Strand = Plus / Plus

                                                                         
Query: 76    ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
             |||| |||||| ||| ||||||||||||||||  ||| ||||||||||||||||||||||
Sbjct: 36633 ttaggtcatccgctgggcagcctccttggcgagcagcttttccctggccttggtcttcgc 36692

                                                                         
Query: 136   ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
             |||||||||||| |||||||| || || ||||||||| |||| ||||||||||| ||| |
Sbjct: 36693 ctgcgacttggatcccatgacgccgcctccccacttcttcctaacctcatcgaatttgtc 36752

                           
Query: 196   attgaagttcgcct 209
              |||||||||||||
Sbjct: 36753 gttgaagttcgcct 36766



 Score =  143 bits (72), Expect = 8e-31
 Identities = 117/132 (88%)
 Strand = Plus / Plus

                                                                         
Query: 302   gatccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcatagg 361
             |||||||| || | |||||| || ||||||||||| |||||||||||||||||||| |||
Sbjct: 37058 gatccaagacgggcttttcctttcacaatgcagtaagggacctccatcttcctgcacagg 37117

                                                                         
Query: 362   gctgggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctga 421
             ||||| |||||||||||||||||||| || || ||||||||||| ||||| ||||| || 
Sbjct: 37118 gctggaagccacacaaccagctcaatcggatcgacatcatgagcaatgacgaccagttgg 37177

                         
Query: 422   gccttgctctgc 433
             ||||||||||||
Sbjct: 37178 gccttgctctgc 37189



 Score =  125 bits (63), Expect = 2e-25
 Identities = 87/95 (91%)
 Strand = Plus / Plus

                                                                         
Query: 207   ccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggtga 266
             ||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
Sbjct: 36874 ccttgatagcctccaggatcttgctgaactcaagcttgtcctcgttcttgacagtggtca 36933

                                                
Query: 267   ggcacagaacagaggcagtcttcttgtgaacaatc 301
              ||| || ||||| ||||| |||||||||||||||
Sbjct: 36934 agcagaggacagatgcagttttcttgtgaacaatc 36968



to top

>dbj|AK220651.1| Arabidopsis thaliana mRNA for 60S ribosomal protein L7A, complete
           cds, clone: RAFL21-65-D24
          Length = 498

 Score =  202 bits (102), Expect = 1e-48
 Identities = 271/328 (82%)
 Strand = Plus / Minus

                                                                       
Query: 75  cttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcg 134
           |||| |||||||| || ||||||||||| || || |  |||||| | ||||||||||| |
Sbjct: 328 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 269

                                                                       
Query: 135 cctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgn 194
           |||| ||||| || ||||| |  || || ||||| ||| |||||  ||| ||| ||||| 
Sbjct: 268 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 209

                                                                       
Query: 195 cattgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttct 254
           |||||||||| ||||||||||| |||| ||| ||||||||||| ||||||||||||||||
Sbjct: 208 cattgaagttggccttgatagcttccaggattttgctgaactctagcttgtcctcgttct 149

                                                                       
Query: 255 tcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtg 314
           | |||||||| |  ||||    ||| |||||||||| |||||||| || |||||| || |
Sbjct: 148 tgacagtggtcaaacacaagcaagaagcagtcttctggtgaacaaccgctccaagacgag 89

                                                                       
Query: 315 attttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccaca 374
           |||| ||||| ||||||||||| ||||| |||||||||||||| || || || | ||| |
Sbjct: 88  atttgcccttgacaatgcagtacgggacttccatcttcctgcacagagcaggcaaccaga 29

                                       
Query: 375 caaccagctcaattgggtcaacatcatg 402
           |||||| |||||||||||| ||||||||
Sbjct: 28  caaccaactcaattgggtcgacatcatg 1



to top

>gb|DQ241858.1| Solanum tuberosum clone 014F11 60S ribosomal protein L7A-like mRNA,
           complete cds
          Length = 983

 Score =  200 bits (101), Expect = 4e-48
 Identities = 391/487 (80%), Gaps = 1/487 (0%)
 Strand = Plus / Minus

                                                                       
Query: 120 tggccttggtcttcgcctgcgacttggagcccatgacaccaccaccccacttcntcctga 179
           ||||||||||| | ||||| |||||||||||||||| ||| |||||||||||| ||||| 
Sbjct: 741 tggccttggtcctggcctgtgacttggagcccatgataccgccaccccacttcttcctgt 682

                                                                       
Query: 180 cctcatcgaacttgncattgaagttcgccttgatagcctccaagatcttgctgaactcaa 239
            ||| ||  ||||  |||||||||| ||||| || |||||||| |   |||||||||| |
Sbjct: 681 tctcttcatacttatcattgaagttggccttaattgcctccaaaactctgctgaactcca 622

                                                                       
Query: 240 gcttgtcctcgttcttcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaa 299
             ||||| || |||||||| || || |  ||||   | || ||||| |||||||| || |
Sbjct: 621 ttttgtcttcattcttcacggtagtcaaacacaaggctgaagcagttttcttgtgcacga 562

                                                                       
Query: 300 tcgatccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcata 359
           | ||||| |  |||| ||| ||||| ||||||||||| || |  |||||||| |||||||
Sbjct: 561 ttgatcctaaacgtgctttccccttcacaatgcagtaaggaatttccatctttctgcata 502

                                                                       
Query: 360 gggctgggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagct 419
           | || || ||||| ||||||| ||| |||||||| ||||||||||| || || || || |
Sbjct: 501 gtgcaggaagccagacaaccaactctattgggtccacatcatgagcaatcactactagtt 442

                                                                       
Query: 420 gagccttgctctgctcaataaggtaagtgacatggttagaaaccatacttcacaacaatt 479
           |||| ||| ||||||||||||||||||||| ||| ||| |  ||||||||||||| ||| 
Sbjct: 441 gagctttgttctgctcaataaggtaagtgatatgctta-aggccatacttcacaataatg 383

                                                                       
Query: 480 ggcttcttggcctcaacggttttcccctcagcctcagcctgtgccctcttcagaagcctc 539
           || ||||| |  |||   ||||| || ||||| ||||| || ||||| || | ||| | |
Sbjct: 382 ggtttctttgtttcaggtgtttttccttcagcttcagcttgagcccttttaacaagacgc 323

                                                                       
Query: 540 tccttcttagccaccttgtcctcagggcggtacttgagaagcatcttgaacaggttggtg 599
           |||||||| ||  | ||||||||||| | |||||| |||||||||||||| |||||||||
Sbjct: 322 tccttctttgcagctttgtcctcaggcctgtacttaagaagcatcttgaaaaggttggtg 263

                  
Query: 600 gcgaggt 606
           |||||||
Sbjct: 262 gcgaggt 256



to top

>emb|BX821934.1|CNS0A88T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL86ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 829

 Score =  182 bits (92), Expect = 9e-43
 Identities = 309/382 (80%)
 Strand = Plus / Minus

                                                                       
Query: 75  cttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcg 134
           |||| |||||||| || ||||||||||| || || |  |||||| | ||||||||||| |
Sbjct: 656 cttaattcatcctttgggcagcctcctttgcaattactctttcctttgccttggtctttg 597

                                                                       
Query: 135 cctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgn 194
           |||| ||||| || ||||| |  || || ||||| ||| |||||  ||| ||| ||||| 
Sbjct: 596 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 537

                                                                       
Query: 195 cattgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttct 254
            ||||||||| ||||| ||||| |||| ||| ||||||||||| ||||||| ||||||||
Sbjct: 536 aattgaagttggccttaatagcttccaggattttgctgaactctagcttgttctcgttct 477

                                                                       
Query: 255 tcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtg 314
           | | |||||| |  ||||    ||| |||||||||| |||||||| || |||||| || |
Sbjct: 476 tgatagtggtcaaacacaagcaagatgcagtcttctggtgaacaaccgctccaagacgag 417

                                                                       
Query: 315 attttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccaca 374
           |||| ||||| | ||||||||  ||||| |||||||||||||| || || || | ||| |
Sbjct: 416 atttgccctttataatgcagttcgggacttccatcttcctgcacagagcaggtaaccaga 357

                                                                       
Query: 375 caaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgct 434
           |||||| || ||||||||| ||||||||||| || ||||| || || |||||| ||||||
Sbjct: 356 caaccaacttaattgggtcgacatcatgagcaataacaacaagttgggccttgttctgct 297

                                 
Query: 435 caataaggtaagtgacatggtt 456
           |||| ||||| || ||||||||
Sbjct: 296 caatgaggtaggtcacatggtt 275



to top

>gb|DQ268850.1| Solanum tuberosum clone 155G10 60S ribosomal protein L7A-like
           protein mRNA, complete cds
          Length = 1003

 Score =  176 bits (89), Expect = 6e-41
 Identities = 388/487 (79%), Gaps = 1/487 (0%)
 Strand = Plus / Minus

                                                                       
Query: 120 tggccttggtcttcgcctgcgacttggagcccatgacaccaccaccccacttcntcctga 179
           ||||||||||  | ||||| |||||||||||||||| |||||||||||||||| ||||| 
Sbjct: 747 tggccttggttctggcctgtgacttggagcccatgataccaccaccccacttcttcctgt 688

                                                                       
Query: 180 cctcatcgaacttgncattgaagttcgccttgatagcctccaagatcttgctgaactcaa 239
            ||| ||  ||||| |||||||||| ||||| || |||||||| ||  |||||||||| |
Sbjct: 687 tctcttcatacttgtcattgaagttagccttaatggcctccaaaattctgctgaactcca 628

                                                                       
Query: 240 gcttgtcctcgttcttcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaa 299
             |||||||| |||||||| || || |  ||||   | || ||||| ||||  || ||||
Sbjct: 627 ttttgtcctcattcttcacggttgtcaaacacaaggctgaagcagttttctgatgcacaa 568

                                                                       
Query: 300 tcgatccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcata 359
           ||||||| |  || | ||| ||||| ||||||||||| || |  |||||||| |||||||
Sbjct: 567 tcgatcctaaacgagctttgcccttcacaatgcagtaaggaatttccatctttctgcata 508

                                                                       
Query: 360 gggctgggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagct 419
           | || || ||||| ||||||| ||| |||||||| ||||||||||| || || |||| ||
Sbjct: 507 gcgcaggaagccagacaaccaactctattgggtccacatcatgagcaatcactaccaact 448

                                                                       
Query: 420 gagccttgctctgctcaataaggtaagtgacatggttagaaaccatacttcacaacaatt 479
           |||| ||| |||||||||||||||||||||  || ||| |  ||||||||||||| ||| 
Sbjct: 447 gagctttgttctgctcaataaggtaagtgatgtgctta-agcccatacttcacaataata 389

                                                                       
Query: 480 ggcttcttggcctcaacggttttcccctcagcctcagcctgtgccctcttcagaagcctc 539
           || ||||| |  |||   ||||| || || || ||||| || || || || | ||| | |
Sbjct: 388 ggtttctttgtttcaggagtttttccttctgcttcagcttgagctcttttgacaagacgc 329

                                                                       
Query: 540 tccttcttagccaccttgtcctcagggcggtacttgagaagcatcttgaacaggttggtg 599
           |||||||| ||  | |||||||| || | |||||| |||||||||||||| ||||| || 
Sbjct: 328 tccttctttgcagctttgtcctcgggcctgtacttaagaagcatcttgaaaaggtttgta 269

                  
Query: 600 gcgaggt 606
           |||||||
Sbjct: 268 gcgaggt 262



to top

>gb|BT014547.1| Lycopersicon esculentum clone 133964F, mRNA sequence
          Length = 1092

 Score =  165 bits (83), Expect = 2e-37
 Identities = 379/477 (79%), Gaps = 1/477 (0%)
 Strand = Plus / Minus

                                                                       
Query: 113 ctttccctggccttggtcttcgcctgcgacttggagcccatgacaccaccaccccacttc 172
           |||||| ||||||||||  | ||||| ||||| |||||||||| ||||||||||||||||
Sbjct: 795 ctttccttggccttggttctggcctgtgacttagagcccatgataccaccaccccacttc 736

                                                                       
Query: 173 ntcctgacctcatcgaacttgncattgaagttcgccttgatagcctccaagatcttgctg 232
            |||||  ||| ||  ||||| |||||||||| ||||| || |||||||| ||  |||||
Sbjct: 735 ttcctgttctcttcatacttgtcattgaagttagccttaatggcctccaaaattctgctg 676

                                                                       
Query: 233 aactcaagcttgtcctcgttcttcacagtggtgaggcacagaacagaggcagtcttcttg 292
           ||||| |  ||||| || |||||||| || |  |  ||||   | || ||||| ||||| 
Sbjct: 675 aactccattttgtcttcattcttcacggttgacaaacacaaggctgaagcagttttctta 616

                                                                       
Query: 293 tgaacaatcgatccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttc 352
           || || |||||||| |  || | ||| ||||| ||||||||||| || |  |||||||| 
Sbjct: 615 tgcacgatcgatcctaaacgagctttgcccttcacaatgcagtaaggaatttccatcttt 556

                                                                       
Query: 353 ctgcatagggctgggagccacacaaccagctcaattgggtcaacatcatgagcgatgaca 412
           |||||||| || || ||||| ||||||| ||| |||||||| || |||||||| || || 
Sbjct: 555 ctgcatagcgcaggaagccagacaaccaactctattgggtccacgtcatgagcaatcact 496

                                                                       
Query: 413 accagctgagccttgctctgctcaataaggtaagtgacatggttagaaaccatacttcac 472
           |||| |||||| ||| |||||||||||||||||||||  || ||| |  |||||||||||
Sbjct: 495 accaactgagctttgttctgctcaataaggtaagtgatgtgctta-agcccatacttcac 437

                                                                       
Query: 473 aacaattggcttcttggcctcaacggttttcccctcagcctcagcctgtgccctcttcag 532
           |||||| || ||||| |  |||   ||||| || || || ||||| || ||||| || | 
Sbjct: 436 aacaatgggtttctttgtttcaggagtttttccttctgcttcagcttgagcccttttgac 377

                                                                    
Query: 533 aagcctctccttcttagccaccttgtcctcagggcggtacttgagaagcatcttgaa 589
           ||| | ||||||||| ||  | ||||||||||| | |||||| ||||||||||||||
Sbjct: 376 aagacgctccttctttgcagctttgtcctcaggcctgtacttaagaagcatcttgaa 320



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  133 bits (67), Expect = 7e-28
 Identities = 113/129 (87%)
 Strand = Plus / Plus

                                                                            
Query: 76       ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
                |||| |||||||||| ||||| |||||||| |  ||| |||||||||| |||||||| ||
Sbjct: 40488702 ttaggtcatcctctgggcagcttccttggctagaagcttttccctggctttggtcttggc 40488761

                                                                            
Query: 136      ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
                 || ||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
Sbjct: 40488762 ttgtgactttgagcccatgataccaccaccccacttcttcctgacctcatcgaacttgtc 40488821

                         
Query: 196      attgaagtt 204
                 ||||||||
Sbjct: 40488822 gttgaagtt 40488830



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 100/117 (85%)
 Strand = Plus / Plus

                                                                            
Query: 317      tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
                |||||||| |||||||| || ||||  |||||||||||||| | |||||||||||| || 
Sbjct: 40489141 tttcccttcacaatgcaataagggatttccatcttcctgcacaaggctgggagccaaacg 40489200

                                                                         
Query: 377      accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgc 433
                || || ||||| ||||| ||||||||||| ||||| || ||||| ||||||||||||
Sbjct: 40489201 acgagttcaatggggtcgacatcatgagcaatgaccacaagctgtgccttgctctgc 40489257



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 108/129 (83%), Gaps = 1/129 (0%)
 Strand = Plus / Plus

                                                                            
Query: 461      accatacttcacaacaattggcttcttggcctcaacggttttcccctcagcctcagcctg 520
                ||||||||||||||||||||| |||||||| ||||| || ||||| |||||||| || ||
Sbjct: 40489409 accatacttcacaacaattggtttcttggcttcaacagtcttcccttcagcctctgcttg 40489468

                                                                            
Query: 521      tgccctcttcagaagcctctccttcttagccaccttgtcctcagggcggtacttgagaag 580
                 || || |||| |||||| |||||| | ||  |||| || |||||||||||||| |  ||
Sbjct: 40489469 cgctcttttcaaaagcctttccttc-tggcagccttatcttcagggcggtacttcaacag 40489527

                         
Query: 581      catcttgaa 589
                |||||||||
Sbjct: 40489528 catcttgaa 40489536



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                            
Query: 215      gcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggtgaggcacaga 274
                ||||||||||| ||||||||||| | |||||| || ||||||||||| || || || || 
Sbjct: 40488935 gcctccaagattttgctgaactccaacttgtcttcattcttcacagtcgtcagacaaagg 40488994

                                           
Query: 275      acagaggcagtcttcttgtgaacaatc 301
                ||||| || ||||||||||| ||||||
Sbjct: 40488995 acagatgctgtcttcttgtgcacaatc 40489021



to top

>dbj|AP004672.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0592G05
          Length = 146220

 Score =  133 bits (67), Expect = 7e-28
 Identities = 113/129 (87%)
 Strand = Plus / Plus

                                                                          
Query: 76     ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
              |||| |||||||||| ||||| |||||||| |  ||| |||||||||| |||||||| ||
Sbjct: 139943 ttaggtcatcctctgggcagcttccttggctagaagcttttccctggctttggtcttggc 140002

                                                                          
Query: 136    ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
               || ||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
Sbjct: 140003 ttgtgactttgagcccatgataccaccaccccacttcttcctgacctcatcgaacttgtc 140062

                       
Query: 196    attgaagtt 204
               ||||||||
Sbjct: 140063 gttgaagtt 140071



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 100/117 (85%)
 Strand = Plus / Plus

                                                                          
Query: 317    tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
              |||||||| |||||||| || ||||  |||||||||||||| | |||||||||||| || 
Sbjct: 140382 tttcccttcacaatgcaataagggatttccatcttcctgcacaaggctgggagccaaacg 140441

                                                                       
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgc 433
              || || ||||| ||||| ||||||||||| ||||| || ||||| ||||||||||||
Sbjct: 140442 acgagttcaatggggtcgacatcatgagcaatgaccacaagctgtgccttgctctgc 140498



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 108/129 (83%), Gaps = 1/129 (0%)
 Strand = Plus / Plus

                                                                          
Query: 461    accatacttcacaacaattggcttcttggcctcaacggttttcccctcagcctcagcctg 520
              ||||||||||||||||||||| |||||||| ||||| || ||||| |||||||| || ||
Sbjct: 140650 accatacttcacaacaattggtttcttggcttcaacagtcttcccttcagcctctgcttg 140709

                                                                          
Query: 521    tgccctcttcagaagcctctccttcttagccaccttgtcctcagggcggtacttgagaag 580
               || || |||| |||||| |||||| | ||  |||| || |||||||||||||| |  ||
Sbjct: 140710 cgctcttttcaaaagcctttccttc-tggcagccttatcttcagggcggtacttcaacag 140768

                       
Query: 581    catcttgaa 589
              |||||||||
Sbjct: 140769 catcttgaa 140777



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                          
Query: 215    gcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggtgaggcacaga 274
              ||||||||||| ||||||||||| | |||||| || ||||||||||| || || || || 
Sbjct: 140176 gcctccaagattttgctgaactccaacttgtcttcattcttcacagtcgtcagacaaagg 140235

                                         
Query: 275    acagaggcagtcttcttgtgaacaatc 301
              ||||| || ||||||||||| ||||||
Sbjct: 140236 acagatgctgtcttcttgtgcacaatc 140262



to top

>dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1033B05
          Length = 138882

 Score =  133 bits (67), Expect = 7e-28
 Identities = 113/129 (87%)
 Strand = Plus / Plus

                                                                         
Query: 76    ttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgc 135
             |||| |||||||||| ||||| |||||||| |  ||| |||||||||| |||||||| ||
Sbjct: 50326 ttaggtcatcctctgggcagcttccttggctagaagcttttccctggctttggtcttggc 50385

                                                                         
Query: 136   ctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnc 195
              || ||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
Sbjct: 50386 ttgtgactttgagcccatgataccaccaccccacttcttcctgacctcatcgaacttgtc 50445

                      
Query: 196   attgaagtt 204
              ||||||||
Sbjct: 50446 gttgaagtt 50454



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 100/117 (85%)
 Strand = Plus / Plus

                                                                         
Query: 317   tttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacaca 376
             |||||||| |||||||| || ||||  |||||||||||||| | |||||||||||| || 
Sbjct: 50765 tttcccttcacaatgcaataagggatttccatcttcctgcacaaggctgggagccaaacg 50824

                                                                      
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgc 433
             || || ||||| ||||| ||||||||||| ||||| || ||||| ||||||||||||
Sbjct: 50825 acgagttcaatggggtcgacatcatgagcaatgaccacaagctgtgccttgctctgc 50881



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 108/129 (83%), Gaps = 1/129 (0%)
 Strand = Plus / Plus

                                                                         
Query: 461   accatacttcacaacaattggcttcttggcctcaacggttttcccctcagcctcagcctg 520
             ||||||||||||||||||||| |||||||| ||||| || ||||| |||||||| || ||
Sbjct: 51033 accatacttcacaacaattggtttcttggcttcaacagtcttcccttcagcctctgcttg 51092

                                                                         
Query: 521   tgccctcttcagaagcctctccttcttagccaccttgtcctcagggcggtacttgagaag 580
              || || |||| |||||| |||||| | ||  |||| || |||||||||||||| |  ||
Sbjct: 51093 cgctcttttcaaaagcctttccttc-tggcagccttatcttcagggcggtacttcaacag 51151

                      
Query: 581   catcttgaa 589
             |||||||||
Sbjct: 51152 catcttgaa 51160



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                         
Query: 215   gcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggtgaggcacaga 274
             ||||||||||| ||||||||||| | |||||| || ||||||||||| || || || || 
Sbjct: 50559 gcctccaagattttgctgaactccaacttgtcttcattcttcacagtcgtcagacaaagg 50618

                                        
Query: 275   acagaggcagtcttcttgtgaacaatc 301
             ||||| || ||||||||||| ||||||
Sbjct: 50619 acagatgctgtcttcttgtgcacaatc 50645



to top

>emb|AL162651.1|ATF26K9 Arabidopsis thaliana DNA chromosome 3, BAC clone F26K9
          Length = 110257

 Score =  131 bits (66), Expect = 3e-27
 Identities = 157/186 (84%), Gaps = 1/186 (0%)
 Strand = Plus / Plus

                                                                         
Query: 304   tccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcatagggc 363
             |||||| || ||||||||||||||||||||||| ||||| ||||| |||||||| || ||
Sbjct: 96271 tccaagacgagattttcccttaacaatgcagtaagggacttccattttcctgcagagtgc 96330

                                                                         
Query: 364   tgggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagc 423
              || | ||| || |||| ||| || ||||||||||| || || ||||| || ||||| ||
Sbjct: 96331 aggtaaccagaccaccaactcgatagggtcaacatcgtgtgcaatgaccacaagctgtgc 96390

                                                                         
Query: 424   cttgctctgctcaataaggtaagtgacatggttagaaaccatacttcacaacaattggct 483
             |||| ||||||| || |||||||| |||||||| || ||||||||| |||||||| ||||
Sbjct: 96391 cttgttctgctcgatgaggtaagtcacatggtt-gagaccatacttaacaacaatgggct 96449

                   
Query: 484   tcttgg 489
             ||||||
Sbjct: 96450 tcttgg 96455



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 207   ccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggtga 266
             ||||||| ||||| | ||| ||||||||||||||||||||||||||||| |||||||| |
Sbjct: 96071 ccttgatggcctcgaggattttgctgaactcaagcttgtcctcgttcttgacagtggtca 96130

                                            
Query: 267   ggcacagaacagaggcagtcttcttgtgaac 297
              |||||   |||  |||||||||| ||||||
Sbjct: 96131 agcacaaggcagcagcagtcttctggtgaac 96161



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 107/133 (80%)
 Strand = Plus / Plus

                                                                         
Query: 77    tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
             |||||||| ||||| ||||||||||| || || | ||| ||| | || |||||||| || 
Sbjct: 95837 tagttcattctctgggcagcctccttagcaataaccctctccttagctttggtcttggct 95896

                                                                         
Query: 137   tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
             || |||||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 95897 tgagacttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 95956

                          
Query: 197   ttgaagttcgcct 209
             |||||||| ||||
Sbjct: 95957 ttgaagttagcct 95969



to top

>gb|AY496113.1| Capsicum annuum 60S ribosomal protein L7A mRNA, partial cds
          Length = 737

 Score =  127 bits (64), Expect = 5e-26
 Identities = 246/306 (80%), Gaps = 1/306 (0%)
 Strand = Plus / Minus

                                                                       
Query: 144 tggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgncattgaagt 203
           |||||||||||| ||| |||||||||||  |||||  ||| ||  ||||| |||||||||
Sbjct: 735 tggagcccatgatacccccaccccactt-ttcctgttctcctcatacttgtcattgaagt 677

                                                                       
Query: 204 tcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtgg 263
           | ||||| ||||||||||| |   |||||||||| | |||||| || ||||||||||| |
Sbjct: 676 tagccttaatagcctccaaaactctgctgaactccatcttgtcttcattcttcacagttg 617

                                                                       
Query: 264 tgaggcacagaacagaggcagtcttcttgtgaacaatcgatccaaggcgtgattttccct 323
           | |  |||||  | || ||||| ||||| || || || ||||| |  || | ||| || |
Sbjct: 616 tcaaacacagggctgaagcagttttcttatgcacgattgatcctaaacgggctttccctt 557

                                                                       
Query: 324 taacaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaaccagct 383
           | ||||||||||| || |  |||||||| ||||||||||| || ||||| ||||||| ||
Sbjct: 556 tcacaatgcagtaaggaatttccatctttctgcatagggccggaagccagacaaccaact 497

                                                                       
Query: 384 caattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctcaataaggt 443
           |||||||||| ||||||||||| || || || | |||||| ||  |||||||||||||||
Sbjct: 496 caattgggtccacatcatgagcaatcactactaactgagctttattctgctcaataaggt 437

                 
Query: 444 aagtga 449
           | ||||
Sbjct: 436 acgtga 431



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 555 ttgtcctcagggcggtacttgagaagcatcttgaa 589
           ||||||||||| | |||||| ||||||||||||||
Sbjct: 326 ttgtcctcaggcctgtacttcagaagcatcttgaa 292



to top

>gb|AC002535.3| Arabidopsis thaliana chromosome 2 clone T30B22 map CIC06C03, complete
             sequence
          Length = 98937

 Score =  121 bits (61), Expect = 3e-24
 Identities = 130/153 (84%)
 Strand = Plus / Plus

                                                                         
Query: 304   tccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcatagggc 363
             |||||| || ||||| ||||| ||||||||||| ||||| |||||||||||||| || ||
Sbjct: 17640 tccaagacgagatttgcccttgacaatgcagtacgggacttccatcttcctgcacagagc 17699

                                                                         
Query: 364   tgggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagc 423
              || | ||| ||||||| |||||||||||| ||||||||||| || ||||| || || ||
Sbjct: 17700 aggcaaccagacaaccaactcaattgggtcgacatcatgagcaataacaacaagttgggc 17759

                                              
Query: 424   cttgctctgctcaataaggtaagtgacatggtt 456
             |||| |||||||||| ||||| || ||||||||
Sbjct: 17760 cttgttctgctcaatgaggtaggtcacatggtt 17792



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                       
Query: 207   ccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggt 264
             |||||||||| |||| ||| ||||||||||| ||||||||||||||||| ||||||||
Sbjct: 17462 ccttgatagcttccaggattttgctgaactctagcttgtcctcgttcttgacagtggt 17519



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 108/135 (80%)
 Strand = Plus / Plus

                                                                         
Query: 75    cttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcg 134
             |||| |||||||| || ||||||||||| || || |  |||||| | ||||||||||| |
Sbjct: 17238 cttaattcatcctttgggcagcctcctttgcaataactctttcctttgccttggtctttg 17297

                                                                         
Query: 135   cctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgn 194
             |||| ||||| || ||||| |  || || ||||| ||| |||||  ||| ||| ||||| 
Sbjct: 17298 cctgagacttagatcccattatgcctcctccccatttcttcctgtactcctcgtacttgt 17357

                            
Query: 195   cattgaagttcgcct 209
             |||||||||| ||||
Sbjct: 17358 cattgaagttggcct 17372



to top

>gb|BC106480.1| Xenopus laevis cDNA clone IMAGE:7211162
          Length = 935

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Plus

                                                                       
Query: 320 cccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaacc 379
           ||||| |||||||||||||||||  ||||||||||||| | ||| |||||  ||||||| 
Sbjct: 335 cccttgacaatgcagtatgggactcccatcttcctgcacaaggcagggaggaacacaaca 394

                                                          
Query: 380 agctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||||||||||||||| ||||| |||||||||||
Sbjct: 395 agctcaattggatcaacatcatgagcgatcacaacaagctgagcctt 441



to top

>gb|AY393839.1| Xenopus laevis ribosomal protein L7a mRNA, partial cds
          Length = 715

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                       
Query: 320 cccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaacc 379
           ||||| |||||||||||||||||  ||||||||||||| | ||| |||||  ||||||| 
Sbjct: 522 cccttgacaatgcagtatgggactcccatcttcctgcacaaggcagggaggaacacaaca 463

                                                          
Query: 380 agctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||||||||||||||| ||||| |||||||||||
Sbjct: 462 agctcaattggatcaacatcatgagcgatcacaacaagctgagcctt 416



to top

>gb|AC155335.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone
              KBrH001H24, complete sequence
          Length = 118144

 Score =  107 bits (54), Expect = 4e-20
 Identities = 154/186 (82%), Gaps = 1/186 (0%)
 Strand = Plus / Plus

                                                                          
Query: 304    tccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcatagggc 363
              |||||| || ||||| || |||||||||||||| || || ||||||||||| || || ||
Sbjct: 112054 tccaagacgagatttgcctttaacaatgcagtaaggcacttccatcttcctacaaagagc 112113

                                                                          
Query: 364    tgggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagc 423
               || | ||| || || |||||||| ||||||||||| ||||| |||||||| ||||| ||
Sbjct: 112114 aggtaaccagacgacaagctcaatggggtcaacatcgtgagcaatgacaacaagctgcgc 112173

                                                                          
Query: 424    cttgctctgctcaataaggtaagtgacatggttagaaaccatacttcacaacaattggct 483
              |||| ||||||| || | |||||| || ||||| ||  |||||||| |||||||| ||||
Sbjct: 112174 cttgttctgctcgatcaagtaagtcacgtggtt-gagcccatacttgacaacaatgggct 112232

                    
Query: 484    tcttgg 489
              ||||||
Sbjct: 112233 tcttgg 112238



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                        
Query: 207    ccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggt 264
              |||||||||| || | ||| ||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 111879 ccttgatagcttcaaggattttgctgaactcgagcttatcctcgttcttgacagtggt 111936



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 109/136 (80%)
 Strand = Plus / Plus

                                                                          
Query: 74     gcttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttc 133
              ||||||||||| ||||| |||||||||||||| |  | ||| ||| | || |||||||| 
Sbjct: 111666 gcttagttcattctctgggcagcctccttggcaagaaccctctccttagctttggtcttg 111725

                                                                          
Query: 134    gcctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttg 193
              || || |||||||| ||||| |  || || ||||||||| |||||  ||| ||| |||||
Sbjct: 111726 gcttgagacttggatcccattatgcctcctccccacttcttcctgtactcctcgtacttg 111785

                              
Query: 194    ncattgaagttcgcct 209
               | |||||||| ||||
Sbjct: 111786 tcgttgaagtttgcct 111801



to top

>gb|AC155339.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1
             clone KBrH015H17, complete sequence
          Length = 110885

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 154/187 (82%), Gaps = 2/187 (1%)
 Strand = Plus / Plus

                                                                         
Query: 304   tccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcatagggc 363
             |||||| || ||||| || |||||||||||||| || || ||||||||||| || || ||
Sbjct: 25877 tccaagacgagatttgcctttaacaatgcagtaaggcacttccatcttcctacaaagagc 25936

                                                                         
Query: 364   tgggagccacacaaccagctcaattgggtcaacatc-atgagcgatgacaaccagctgag 422
              || | ||| || || |||||||| |||||||||||  ||||| |||||||| ||||| |
Sbjct: 25937 aggtaaccagacgacaagctcaatggggtcaacatcgttgagcaatgacaacaagctgcg 25996

                                                                         
Query: 423   ccttgctctgctcaataaggtaagtgacatggttagaaaccatacttcacaacaattggc 482
             ||||| ||||||| || | |||||| || ||||| ||  |||||||| |||||||| |||
Sbjct: 25997 ccttgttctgctcgatcaagtaagtcacgtggtt-gagcccatacttgacaacaatgggc 26055

                    
Query: 483   ttcttgg 489
             |||||||
Sbjct: 26056 ttcttgg 26062



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                         
Query: 380   agctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctcaata 439
             |||||||| ||||||||||| ||||| |||||||| ||||| |||||| ||||||| || 
Sbjct: 27390 agctcaatggggtcaacatcgtgagcaatgacaacaagctgcgccttgttctgctcgatc 27331

                              
Query: 440   aggtaagtgacatggtt 456
             | |||||| || |||||
Sbjct: 27330 aagtaagtcacgtggtt 27314



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                       
Query: 207   ccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttcacagtggt 264
             |||||||||| || | ||| ||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 25702 ccttgatagcttcaaggattttgctgaactcgagcttatcctcgttcttgacagtggt 25759



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 109/136 (80%)
 Strand = Plus / Plus

                                                                         
Query: 74    gcttagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttc 133
             ||||||||||| ||||| |||||||||||||| |  | ||| ||| | || |||||||| 
Sbjct: 25489 gcttagttcattctctgggcagcctccttggcaagaaccctctccttagctttggtcttg 25548

                                                                         
Query: 134   gcctgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttg 193
             || || |||||||| ||||| |  || || ||||||||| |||||  ||| ||| |||||
Sbjct: 25549 gcttgagacttggatcccattatgcctcctccccacttcttcctgtactcctcgtacttg 25608

                             
Query: 194   ncattgaagttcgcct 209
              | |||||||| ||||
Sbjct: 25609 tcgttgaagtttgcct 25624



to top

>emb|BX821043.1|CNS0A8L9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH94ZE02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 764

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 162/201 (80%)
 Strand = Plus / Minus

                                                                       
Query: 243 tgtcctcgttcttcacagtggtgaggcacagaacagaggcagtcttcttgtgaacaatcg 302
           |||||||||||||||||||| | |  ||||    ||| ||| |||||| |||||||| ||
Sbjct: 436 tgtcctcgttcttcacagtgctcacacacaagcgagaagcactcttctggtgaacaaccg 377

                                                                       
Query: 303 atccaaggcgtgattttcccttaacaatgcagtatgggacctccatcttcctgcataggg 362
            ||||||  | ||||| ||||| ||||||||||| || || |||||||||||||| |  |
Sbjct: 376 ctccaagaggagatttgcccttcacaatgcagtacggcacttccatcttcctgcacatag 317

                                                                       
Query: 363 ctgggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctgag 422
           | || | ||||||||||| |||||||||||| |||||||| || || ||||| ||  | |
Sbjct: 316 caggaaaccacacaaccaactcaattgggtcgacatcatgcgcaatcacaacaagtgggg 257

                                
Query: 423 ccttgctctgctcaataaggt 443
           ||||  |||||||||| ||||
Sbjct: 256 ccttcttctgctcaatcaggt 236



to top

>emb|AJ718619.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC3-31-300, cultivar Bright
           Yellow 2
          Length = 236

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 93/109 (85%)
 Strand = Plus / Minus

                                                                       
Query: 498 gttttcccctcagcctcagcctgtgccctcttcagaagcctctccttcttagccaccttg 557
           ||||| || ||||| ||||| || ||||| |||| ||| | ||||||||| ||  | |||
Sbjct: 198 gtttttccttcagcttcagcttgagcccttttcacaagacgctccttctttgcagctttg 139

                                                            
Query: 558 tcctcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           |||||||| | |||||||||||||||||||||||||||||| |||||||
Sbjct: 138 tcctcaggcctgtacttgagaagcatcttgaacaggttggtcgcgaggt 90



to top

>dbj|AK108838.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-151-H01, full
           insert sequence
          Length = 983

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 92/109 (84%)
 Strand = Plus / Minus

                                                                       
Query: 320 cccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaacc 379
           ||||| || ||||||||||| ||  |||||||| |||| || ||||| |||||||| |||
Sbjct: 581 cccttgacgatgcagtatggcacgcccatcttcttgcacagtgctggcagccacaccacc 522

                                                            
Query: 380 agctcaattgggtcaacatcatgagcgatgacaaccagctgagccttgc 428
           |||||||| ||||| || || || |||||||| |||||||| |||||||
Sbjct: 521 agctcaatggggtccacgtcgtgggcgatgaccaccagctgcgccttgc 473



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 226 cttgctgaactcaagcttgtcctcgttcttcac 258
           ||||| ||||||| ||| |||||||||||||||
Sbjct: 675 cttgccgaactcacgctggtcctcgttcttcac 643



to top

>gb|AF401560.1| Ictalurus punctatus ribosomal protein L7a mRNA, complete cds
          Length = 860

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 93/111 (83%)
 Strand = Plus / Minus

                                                                       
Query: 316 ttttcccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacac 375
           |||||| ||||| ||||||||||||||  ||||||| | ||| || || || ||  ||| 
Sbjct: 566 ttttcctttaacgatgcagtatgggacacccatcttacggcacagagcaggcaggaacaa 507

                                                              
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
            |||||||| |||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 506 caccagctcgattgggtcgacatcatgagcgatcacaaccagctgggcctt 456



to top

>emb|BX825080.1|CNS0A6S2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH94ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 932

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 156/196 (79%)
 Strand = Plus / Minus

                                                                       
Query: 77  tagttcatcctctgcgcagcctccttggcgatgagcctttccctggccttggtcttcgcc 136
           |||||||| ||||| ||||| ||||| || || | ||| ||| | || |||||||| || 
Sbjct: 799 tagttcattctctgggcagcgtccttagcaataaccctctccttcgctttggtcttggct 740

                                                                       
Query: 137 tgcgacttggagcccatgacaccaccaccccacttcntcctgacctcatcgaacttgnca 196
           || || ||||| ||||| |  ||||| ||||||||| |||||  ||| ||| ||||| | 
Sbjct: 739 tgagagttggatcccattatgccacctccccacttcttcctgtactcctcgtacttgtcg 680

                                                                       
Query: 197 ttgaagttcgccttgatagcctccaagatcttgctgaactcaagcttgtcctcgttcttc 256
           |||||||  || ||||| ||||| | ||| |||| ||||| |||| ||||||||||||| 
Sbjct: 679 ttgaagtgagcgttgatggcctcgaggattttgcggaactgaagcgtgtcctcgttcttg 620

                           
Query: 257 acagtggtgaggcaca 272
           | |||||||| |||||
Sbjct: 619 agagtggtgaagcaca 604



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 461 accatacttcacaacaattggcttcttgg 489
           |||||||||||||||||| ||||||||||
Sbjct: 416 accatacttcacaacaatgggcttcttgg 388



to top

>gb|AY924997.1| Jakoba libera Rpl7A mRNA, partial cds
          Length = 750

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 329 atgcagtatgggacctccatcttcctgcatagggctgggagccacacaaccagctcaatt 388
           |||||||| ||||| |||||||| | ||| ||||| |||||||| |  |||||||| || 
Sbjct: 606 atgcagtaggggacatccatcttgcggcacagggcggggagccagaggaccagctcgatg 547

                                          
Query: 389 gggtcaacatcatgagcgatgacaaccagct 419
           ||||||||||| || |||||||| |||||||
Sbjct: 546 gggtcaacatcgtgggcgatgaccaccagct 516



to top

>gb|AY924998.1| Seculamonas ecuadoriensis Rpl7A mRNA, partial cds
          Length = 653

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 554 cttgtcctcagggcggtacttgagaagcatcttgaacaggttggtggcgaggt 606
           ||||||||| |||||||||||||  |||| |||||||||||||||||| ||||
Sbjct: 298 cttgtcctccgggcggtacttgatgagcagcttgaacaggttggtggccaggt 246



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 320 cccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaacc 379
           ||||| ||||||||||| |||||  |||||||| |||| ||||  |||||||| || || 
Sbjct: 522 cccttgacaatgcagtacgggacacccatcttcttgcagagggtcgggagccagacgacg 463

                         
Query: 380 agctcaattgggtc 393
           |||||||| |||||
Sbjct: 462 agctcaatcgggtc 449



to top

>gb|BC072834.1| Xenopus laevis MGC80199 protein, mRNA (cDNA clone MGC:80199
           IMAGE:4970819), complete cds
          Length = 916

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 320 cccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaacc 379
           ||||| |||||||||||||||||  ||||||||| ||| | ||| |||||  ||||||| 
Sbjct: 602 cccttgacaatgcagtatgggactcccatcttccggcacaaggcagggaggaacacaacg 543

                                                       
Query: 380 agctcaattgggtcaacatcatgagcgatgacaaccagctgagc 423
           |||||||| || || || ||||| || || ||||| ||||||||
Sbjct: 542 agctcaatgggatccacgtcatgggcaatcacaacaagctgagc 499



to top

>gb|AY769275.1| Bombyx mori ribosomal protein L7A (RpL7A) mRNA, complete cds
          Length = 964

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           |||||||||||| || |||||||||||||||||||| || ||||| |||||
Sbjct: 624 aaccagctcaataggatcaacatcatgagcgatgaccacaagctgcgcctt 574



to top

>gb|AY439881.1| Armigeres subalbatus ASAP ID: 38933 cytosolic large ribosomal
           subunit L7a mRNA sequence
          Length = 786

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           |||||||||||||| |||||||| |||| |||||||||||| || |||||
Sbjct: 571 accagctcaattggatcaacatcgtgagagatgacaaccagttgtgcctt 522



to top

>ref|XM_575193.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499852), mRNA
          Length = 684

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| ||||||||||| || || ||||||||||||||
Sbjct: 383 accagctcaatggggtctacatcatgagcaatcaccaccagctgagcctt 334



to top

>gb|AC140446.5| Mus musculus BAC clone RP24-114J11 from chromosome 8, complete sequence
          Length = 152392

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| |||||||||||||| || || || ||||||||||||||
Sbjct: 44592 accagctcaatggggtcaacatcatgggcaatcaccaccagctgagcctt 44543



to top

>gb|AY924996.1| Malawimonas jakobiformis Rpl7A mRNA, partial cds
          Length = 735

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 365 gggagccacacaaccagctcaattgggtcaacatcatgagcgatgacaacca 416
           |||||||| | ||| |||||||| ||||||||||| ||||||||||| ||||
Sbjct: 568 gggagccagagaacaagctcaatcgggtcaacatcgtgagcgatgacgacca 517



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 553 ccttgtcctcagggcggtacttgagaagcatcttgaaca 591
           ||||||||||||||||||||||| | |||| ||||||||
Sbjct: 381 ccttgtcctcagggcggtacttgtggagcagcttgaaca 343



to top

>gb|BC076693.1| Xenopus tropicalis hypothetical protein LOC447981, mRNA (cDNA clone
           IMAGE:6983424), partial cds
          Length = 864

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 320 cccttaacaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaacc 379
           ||||| |||||||||||||||||  ||||||| | ||| |  || |||||  |||| || 
Sbjct: 553 cccttgacaatgcagtatgggactcccatcttgcggcacaaagcagggaggaacacgacg 494

                                                          
Query: 380 agctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||| || || || |||||||| ||||| ||||| |||||||||||
Sbjct: 493 agctcgatgggatcgacatcatgggcgatcacaacaagctgagcctt 447



to top

>gb|AY925004.1| Malawimonas jakobiformis isolate MJL00000703 Rpl7A gene, partial
           cds
          Length = 488

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 553 ccttgtcctcagggcggtacttgagaagcatcttgaaca 591
           ||||||||||||||||||||||| | |||| ||||||||
Sbjct: 216 ccttgtcctcagggcggtacttgtggagcagcttgaaca 178



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 382 ctcaattgggtcaacatcatgagcgatgacaacca 416
           |||||| ||||||||||| ||||||||||| ||||
Sbjct: 386 ctcaatcgggtcaacatcgtgagcgatgacgacca 352



to top

>ref|XM_575291.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC366258), mRNA
          Length = 651

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 376 aaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           |||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 471 aaccagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 421



to top

>emb|AL824703.12| Mouse DNA sequence from clone RP23-317M2 on chromosome 4, complete
             sequence
          Length = 80922

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 380   agctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             |||||||| ||||| |||||||| || || |||||||||||||||||
Sbjct: 32516 agctcaatggggtctacatcatgggcaatcacaaccagctgagcctt 32562



to top

>gb|AC154486.2| Mus musculus BAC clone RP24-118H13 from chromosome 17, complete
             sequence
          Length = 197387

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 26773 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 26822



to top

>gb|AC110194.11| Mus musculus chromosome 7, clone RP23-238J3, complete sequence
          Length = 223663

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 161235 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 161186



to top

>gb|AC182749.2| Mus musculus BAC clone RP23-464D14 from chromosome 17, complete
             sequence
          Length = 211198

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 64095 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 64046



to top

>ref|XM_909062.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 3
           (LOC268795), mRNA
          Length = 892

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 528 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 479



to top

>ref|XM_921134.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 4
           (LOC268795), mRNA
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 514 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 465



to top

>ref|XM_193790.7| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 1
           (LOC268795), mRNA
          Length = 892

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 528 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 479



to top

>ref|XM_898600.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 2
           (LOC268795), mRNA
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 514 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 465



to top

>gb|AC110262.12| Mus musculus chromosome 17, clone RP23-291L10, complete sequence
          Length = 210850

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 126974 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 127023



to top

>ref|XR_002714.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC434227), mRNA
          Length = 834

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 484 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 435



to top

>gb|AC124412.3| Mus musculus BAC clone RP24-274J3 from chromosome 9, complete sequence
          Length = 175945

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 130248 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 130199



to top

>emb|AM049005.1| Meladema coriacea mRNA for ribosomal protein L7Ae (rpL7Ae gene)
          Length = 807

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Minus

                                                                       
Query: 326 acaatgcagtatgggacctccatcttcctgcatagggctgggagccacacaaccagctca 385
           ||||| || ||||||||  |||| |||||||| |||||||||||  | | ||||| ||||
Sbjct: 557 acaatacaatatgggacacccattttcctgcacagggctgggagatagagaaccaactca 498

                                                             
Query: 386 attgggtcaacatcatgagcgatgacaaccagctgagccttgctctgctc 435
           |  || |||||||||||||| || ||||| || || |||||  |||||||
Sbjct: 497 agaggatcaacatcatgagcaataacaacaagttgggcctttttctgctc 448



to top

>gb|AC115304.3| Mus musculus BAC clone RP24-156K1 from 15, complete sequence
          Length = 144026

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 19416 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 19465



to top

>gb|AC154411.2| Mus musculus BAC clone RP24-221F4 from chromosome 17, complete sequence
          Length = 174229

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 19370 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 19419



to top

>gb|AC166246.1| Mus musculus BAC clone RP24-80F22 from chromosome 17, complete sequence
          Length = 194452

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 161518 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 161567



to top

>gb|AC093926.6| Genomic sequence for Mus musculus, clone RP23-342N3, complete sequence
          Length = 210913

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 20951 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 20902



to top

>gb|AC154546.2| Mus musculus BAC clone RP23-431I7 from chromosome 16, complete sequence
          Length = 180261

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 173669 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 173718



to top

>dbj|AK034073.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330154F04
           product:unclassifiable, full insert sequence
          Length = 4030

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 427 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 476



to top

>gb|AY925007.1| Reclinomonas americana Rpl7A gene, partial cds
          Length = 1357

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 564 gggcggtacttgagaagcatcttgaacaggttggtggc 601
           ||||||||||| || |||| ||||||||||||||||||
Sbjct: 245 gggcggtacttcagcagcagcttgaacaggttggtggc 208



to top

>gb|AY924999.1| Reclinomonas americana Rpl7A mRNA, partial cds
          Length = 618

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 564 gggcggtacttgagaagcatcttgaacaggttggtggc 601
           ||||||||||| || |||| ||||||||||||||||||
Sbjct: 234 gggcggtacttcagcagcagcttgaacaggttggtggc 197



to top

>ref|XM_577004.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC501604), mRNA
          Length = 877

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 528 accagctcaatagggtctacatcatgggcaatcaccaccagctgagcctt 479



to top

>ref|XM_576987.1| PREDICTED: Rattus norvegicus similar to PRO1477 (LOC501585), mRNA
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 363 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 412



to top

>ref|XM_346319.2| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC367835), mRNA
          Length = 831

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 488 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 439



to top

>ref|XM_225910.3| PREDICTED: Rattus norvegicus similar to Rpl7a protein (LOC307416),
           mRNA
          Length = 900

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 599 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 550



to top

>ref|XM_222251.3| PREDICTED: Rattus norvegicus E1A binding protein p400 (predicted)
            (Ep400_predicted), mRNA
          Length = 11061

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 377  accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
            ||||||||||  ||||| ||||||||||| || || ||||||||||||||
Sbjct: 3053 accagctcaacggggtctacatcatgagcaatcaccaccagctgagcctt 3102



to top

>ref|XM_573092.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC497905), mRNA
          Length = 903

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 554 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 505



to top

>ref|XM_575493.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500141), mRNA
          Length = 1008

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 527 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 478



to top

>ref|XM_345462.2| PREDICTED: Rattus norvegicus similar to Rpl7a protein (LOC366239),
           mRNA
          Length = 621

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 323 accagctcaatggggtccacatcatgggcaatcaccaccagctgagcctt 274



to top

>ref|XM_575149.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499809), mRNA
          Length = 880

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 540 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 491



to top

>ref|XM_216024.3| PREDICTED: Rattus norvegicus ribosomal protein L7a (predicted)
           (Rpl7a_predicted), mRNA
          Length = 865

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 521 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 472



to top

>ref|XM_574881.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499556), mRNA
          Length = 880

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 528 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 479



to top

>ref|XM_574302.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC499009), mRNA
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 500 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 451



to top

>gb|AC154252.1| Mus musculus BAC clone RP24-197M20 from chromosome 13, complete sequence
          Length = 176702

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 143421 accagctcaatggggtctacatcatgggcaattaccaccagctgagcctt 143470



to top

>emb|X15013.1|RNPPL7A Rat mRNA for ribosomal protein L7a
          Length = 851

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 507 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 458



to top

>emb|AL603787.8| Mouse DNA sequence from clone RP23-169J19 on chromosome 11 Contains the
              3' end of a novel gene, the gene for a novel protein
              similar to nascent polypeptide-associated complex alpha
              polypeptide Naca, the Tbrg4 gene for transforming growth
              factor beta regulated gene 4, the Wap gene for whey acidic
              protein, an ethanol induced 6 (Etohi6) pseudogene, two
              novel genes, the Ramp3 gene for receptor (calcitonin)
              activity modifying protein 3, a lactate dehydrogenase 1 A
              chain (Ldh1) pseudogene, a mitochondrial ribosomal protein
              L36 (Mrpl36) pseudogene, a retinoblastoma binding protein 5
              (Rbbp5) pseudogene, a ribosomal protein L7A (Rpl7a)
              pseudogene and two CpG islands, complete sequence
          Length = 225879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 199556 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 199605



to top

>gb|AC147366.5| Mus musculus BAC clone RP23-386J3 from 15, complete sequence
          Length = 175781

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 52199 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 52150



to top

>gb|AC171211.1| Mus musculus BAC clone RP23-34I14 from chromosome 16, complete sequence
          Length = 230462

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 175876 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 175827



to top

>emb|AL772228.5| Mouse DNA sequence from clone RP23-236D1 on chromosome 4, complete
              sequence
          Length = 167555

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 144303 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 144352



to top

>gb|AC121151.11| Mus musculus chromosome 17, clone RP24-342C2, complete sequence
          Length = 205467

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                               
Query: 378    ccagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              |||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 113269 ccagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 113221



to top

>gb|DQ118092.1| Trimastix pyriformis ribosomal protein L7A mRNA, complete cds
          Length = 804

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 539 ctccttcttagccaccttgtcctcagggcggtacttg 575
           ||||||||| |||  ||||||||||||||||||||||
Sbjct: 336 ctccttcttggccttcttgtcctcagggcggtacttg 300



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 320 cccttaacaatgcagtatgggacctccatctt 351
           ||||||||||||||||| ||||| ||||||||
Sbjct: 557 cccttaacaatgcagtaggggacgtccatctt 526



to top

>ref|XR_002826.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC670147), mRNA
          Length = 821

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 378 ccagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           |||||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 519 ccagctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 471



to top

>ref|XM_846090.1| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC490635), mRNA
          Length = 809

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 374 acaaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           |||||||||||||| || || |||||||| || || || ||||||||||||||
Sbjct: 464 acaaccagctcaatgggatccacatcatgtgctatcactaccagctgagcctt 412



to top

>emb|AJ718795.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC31-3-310, cultivar Bright
           Yellow 2
          Length = 262

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 555 ttgtcctcagggcggtacttgagaagcatcttgaacaggttggt 598
           ||||||||||| | || |||||||||||||||  ||||||||||
Sbjct: 166 ttgtcctcaggcctgtncttgagaagcatcttccacaggttggt 123



to top

>dbj|AP003158.1| Mus musculus genomic DNA, chromosome 16q clone:RP21-662M24, complete
              sequences
          Length = 194260

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                               
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcct 425
              ||||||||||| ||||| |||||||| || || || |||||||||||||
Sbjct: 182370 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcct 182322



to top

>dbj|AP003156.1| Mus musculus genomic DNA, chromosome 16q clone:RP21-56O15, complete
             sequences
          Length = 162128

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcct 425
             ||||||||||| ||||| |||||||| || || || |||||||||||||
Sbjct: 46409 accagctcaatggggtctacatcatgggcaatcaccaccagctgagcct 46361



to top

>gb|AY702208.1| Loligo pealei ribosomal protein L7 mRNA, partial cds
          Length = 862

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 380 agctcaattgggtcaacatcatgagcgatgacaaccagctgagc 423
           |||||||| ||||||||||||||||| |||| | ||| ||||||
Sbjct: 512 agctcaatggggtcaacatcatgagcaatgatatccaactgagc 469



to top

>gb|AY925011.1| Trimastix pyriformis ATCC50562 Rpl7A gene, partial cds
          Length = 608

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 320 cccttaacaatgcagtatgggacctccatctt 351
           ||||||||||||||||| ||||| ||||||||
Sbjct: 373 cccttaacaatgcagtaggggacgtccatctt 342



to top

>ref|XM_759559.1| Theileria parva strain Muguga 60S ribosomal protein L7a (TP02_0083)
           partial mRNA
          Length = 915

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 72/88 (81%)
 Strand = Plus / Minus

                                                                       
Query: 332 cagtatgggacctccatcttcctgcatagggctgggagccacacaaccagctcaattggg 391
           ||||| ||||||||| | ||||||||||| || |||||||| | ||| | ||| ||||| 
Sbjct: 635 cagtacgggacctcctttttcctgcatagtgcagggagccataaaactaactcgattgga 576

                                       
Query: 392 tcaacatcatgagcgatgacaaccagct 419
           || || || |||||||| ||||| ||||
Sbjct: 575 tctacgtcgtgagcgattacaacgagct 548



to top

>gb|AY130409.1| Scyliorhinus canicula ribosomal protein L7A-like mRNA, partial
           sequence
          Length = 796

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 372 acacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagc 423
           |||| ||||||||||| |||||||||||||| ||||  |  |||||||||||
Sbjct: 504 acacgaccagctcaatggggtcaacatcatgtgcgacaatcaccagctgagc 453



to top

>gb|AC152111.1| Pichia stipitis clone JGIAHYZ-17L1, complete sequence
          Length = 38449

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 142   cttggagcccatgacaccaccacccca 168
             |||||||||||||| ||||||||||||
Sbjct: 27180 cttggagcccatgataccaccacccca 27206



to top

>gb|DQ214069.1| Taeniopygia guttata clone 0058P0022B08 ribosomal protein L7a-like
           mRNA, complete sequence
          Length = 889

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagc 423
           ||||||||||| ||||| |||||||| || || ||||| ||||||||
Sbjct: 518 accagctcaatagggtccacatcatgggcaataacaacaagctgagc 472



to top

>gb|AC114662.11| Mus musculus chromosome 1, clone RP24-170M24, complete sequence
          Length = 131587

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 380   agctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             |||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 72757 agctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 72711



to top

>gb|AY925003.1| Malawimonas californiana Rpl7A gene, partial cds
          Length = 514

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 553 ccttgtcctcagggcggtacttg 575
           |||||||||||||||||||||||
Sbjct: 26  ccttgtcctcagggcggtacttg 4



to top

>gb|AY925000.1| Acanthamoeba castellanii Rpl7A mRNA, partial cds
          Length = 1040

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 368 agccacacaaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           |||||||| || ||||| || ||||||||||| |||||||| || || |||| ||||||
Sbjct: 625 agccacacgacgagctcgatggggtcaacatcgtgagcgatcacgacgagcttagcctt 567



to top

>ref|XR_003122.1| PREDICTED: Mus musculus hypothetical protein LOC670782 (LOC670782),
           mRNA
          Length = 880

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 380 agctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           |||||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 512 agctcaatggggtctacatcatgggcaatcaccaccagctgagcctt 466



to top

>ref|XM_746084.1| Aspergillus fumigatus Af293 cytosolic large ribosomal subunit
           protein L7A (Afu6g12990) partial mRNA
          Length = 765

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 142 cttggagcccatgacaccaccacccca 168
           |||||||||||||| ||||||||||||
Sbjct: 708 cttggagcccatgataccaccacccca 682



to top

>emb|AM049007.1| Scarabaeus laticollis mRNA for ribosomal protein L7Ae (rpL7Ae gene)
          Length = 810

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 380 agctcaattgggtcaacatcatgagcgatgacaac 414
           |||||||| |||||||||||||| || ||||||||
Sbjct: 506 agctcaatcgggtcaacatcatgcgcaatgacaac 472



to top

>ref|XM_644983.1| Entamoeba histolytica HM-1:IMSS 60S ribosomal protein L7a, putative
           (248.t00005) partial mRNA
          Length = 861

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 317 tttcccttaacaatgcagtatgg 339
           |||||||||||||||||||||||
Sbjct: 539 tttcccttaacaatgcagtatgg 517



to top

>gb|AY310805.1| Nicotiana benthamiana clone 12-101 unknown mRNA
          Length = 417

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 364 tgggagccacacaaccagctcaattgggtcaacatcatg 402
           ||||||||| |||||||  || |||||||||||||||||
Sbjct: 160 tgggagccagacaaccaattctattgggtcaacatcatg 122



to top

>gb|AY925013.1| Capsaspora owczarzaki Rpl7A gene, partial cds
          Length = 394

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 326 acaatgcagtatgggacctccatcttcctgcatagggctgggagcca 372
           ||||||||||||||||  |||||||| | ||| ||||| ||||||||
Sbjct: 207 acaatgcagtatgggatgtccatcttgcggcagagggcggggagcca 161



to top

>gb|AY130406.1| Branchiostoma lanceolatum ribosomal protein L7A-like mRNA, partial
           sequence
          Length = 715

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 138 gcgacttggagcccatgacaccaccacccca 168
           ||||||||  |||||||||||||||||||||
Sbjct: 707 gcgacttgttgcccatgacaccaccacccca 677



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 397 atcatgagcgatgacaaccagctgagcctt 426
           ||||||||||||||| |||||||| |||||
Sbjct: 448 atcatgagcgatgaccaccagctgtgcctt 419



to top

>ref|XM_223019.3| PREDICTED: Rattus norvegicus hypothetical LOC289340 (LOC289340),
           mRNA
          Length = 816

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagc 423
           ||||||||||| ||||| |||||||| || || || |||||||||||
Sbjct: 515 accagctcaatggggtctacatcatgggcaatcaccaccagctgagc 469



to top

>ref|XM_576280.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500880), mRNA
          Length = 868

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagc 423
           ||||||||||| ||||| |||||||| || || || |||||||||||
Sbjct: 524 accagctcaatggggtctacatcatgggcaatcaccaccagctgagc 478



to top

>gb|AC107710.5| Mus musculus chromosome 19, clone RP23-269K10, complete sequence
          Length = 188708

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| ||| |||| || || || ||||||||||||||
Sbjct: 114243 accagctcaatggggtctacaacatgggcaatcaccaccagctgagcctt 114194



to top

>gb|AC120404.25| Mus musculus chromosome 6, clone RP24-405O23, complete sequence
          Length = 202146

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 181303 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 181352



to top

>gb|BC084678.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:103146
           IMAGE:30431224), complete cds
          Length = 897

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 522 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 473



to top

>gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 8, complete
              sequence
          Length = 1194300

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                          
Query: 345    ccatcttcctgcatagggctgggagccacacaaccagctcaattgggtcaacatcatgag 404
              ||||||||||||| || || |||||  | || || |||||||| ||||||||||| |  |
Sbjct: 557822 ccatcttcctgcagagagcggggaggaagacgacgagctcaatagggtcaacatcgtcgg 557763

                                    
Query: 405    cgatgacaaccagctgagcctt 426
              | ||||| || |||||||||||
Sbjct: 557762 caatgacgacgagctgagcctt 557741



to top

>gb|AC128597.3| Rattus norvegicus  BAC CH230-62C6 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 198520

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| ||||| || || || || ||||||||||||||
Sbjct: 173174 accagctcaatggggtctacatcgtgggcaataactaccagctgagcctt 173125



to top

>gb|AC138741.7| Mus musculus chromosome 1, clone RP24-260D21, complete sequence
          Length = 161846

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||| | ||||| |||||||| || || || ||||||||||||||
Sbjct: 80943 accagctcagtggggtctacatcatgggcaatcaccaccagctgagcctt 80992



to top

>gb|AC123658.9| Mus musculus chromosome 15, clone RP23-192C13, complete sequence
          Length = 211158

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 195360 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 195311



to top

>gb|BC065176.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:63353
           IMAGE:6819288), complete cds
          Length = 891

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 509 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 460



to top

>gb|AC140799.6| Mus musculus chromosome 15, clone RP24-147N23, complete sequence
          Length = 162329

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 348 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 299



to top

>ref|NM_013721.2| Mus musculus ribosomal protein L7a (Rpl7a), mRNA
          Length = 867

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 524 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 475



to top

>gb|AC132575.3| Mus musculus BAC clone RP24-425F2 from chromosome 16, complete sequence
          Length = 139828

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| ||||||||  | || || ||||||||||||||
Sbjct: 79838 accagctcaatggggtctacatcatggtcaatcaccaccagctgagcctt 79789



to top

>ref|XM_980392.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC433128), mRNA
          Length = 879

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| |  || || ||||||||||||||
Sbjct: 525 accagctcaatggggtctacatcatgggtaatcaccaccagctgagcctt 476



to top

>ref|XM_977480.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC674419), mRNA
          Length = 901

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| |  || || ||||||||||||||
Sbjct: 547 accagctcaatggggtctacatcatgggtaatcaccaccagctgagcctt 498



to top

>ref|XM_484651.4| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC433128), mRNA
          Length = 879

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| |  || || ||||||||||||||
Sbjct: 525 accagctcaatggggtctacatcatgggtaatcaccaccagctgagcctt 476



to top

>ref|XM_992217.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC633858), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 529 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 480



to top

>gb|AC116421.8| Mus musculus chromosome 9, clone RP24-142L1, complete sequence
          Length = 175142

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 64641 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 64690



to top

>ref|XR_003588.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC435442), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 549 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 500



to top

>ref|XR_002452.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC545567), mRNA
          Length = 919

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 540 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 491



to top

>ref|XR_002706.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC619865), mRNA
          Length = 909

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 536 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 487



to top

>ref|XM_909282.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC633858), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 529 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 480



to top

>ref|XM_891531.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC626683), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 529 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 480



to top

>ref|XR_002439.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC268300), mRNA
          Length = 880

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 519 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 470



to top

>ref|XM_991689.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC672190), mRNA
          Length = 876

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 522 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 473



to top

>ref|XM_987783.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC434426), mRNA
          Length = 958

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 566 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 517



to top

>ref|XM_987455.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC671501), mRNA
          Length = 923

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 551 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 502



to top

>ref|XM_975817.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC674598), mRNA
          Length = 876

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 522 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 473



to top

>ref|XM_887179.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 1
           (LOC622727), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 535 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 486



to top

>ref|XM_906238.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3), transcript variant 2
           (LOC622727), mRNA
          Length = 887

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 533 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 484



to top

>ref|XM_486245.4| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC434426), mRNA
          Length = 958

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 566 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 517



to top

>ref|XM_985293.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC666669), mRNA
          Length = 932

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 560 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 511



to top

>ref|XR_003443.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC671487), mRNA
          Length = 802

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 501 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 452



to top

>ref|XM_905543.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC243872), mRNA
          Length = 801

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 500 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 451



to top

>ref|XM_620604.3| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC243872), mRNA
          Length = 801

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 500 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 451



to top

>ref|XM_979771.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC670197), mRNA
          Length = 607

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 525 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 476



to top

>ref|XR_003274.1| PREDICTED: Mus musculus similar to Ribosomal protein L7A CG3314-PD,
           isoform D (LOC435775), mRNA
          Length = 795

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| ||||||||  | || || ||||||||||||||
Sbjct: 490 accagctcaatagggtctacatcatggtcaatcaccaccagctgagcctt 441



to top

>ref|XR_002857.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC670202), mRNA
          Length = 904

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||| | ||||| |||||||| || || || ||||||||||||||
Sbjct: 611 accagctcagtggggtctacatcatgggcaatcaccaccagctgagcctt 562



to top

>ref|XM_974409.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC669323), mRNA
          Length = 723

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| ||| |||| || || || ||||||||||||||
Sbjct: 422 accagctcaatggggtctacaccatgggcaatcaccaccagctgagcctt 373



to top

>ref|XR_004630.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC674259), mRNA
          Length = 834

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||| | ||||| |||||||| || || || ||||||||||||||
Sbjct: 541 accagctcagtggggtctacatcatgggcaatcaccaccagctgagcctt 492



to top

>ref|XR_001873.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC666444), mRNA
          Length = 746

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| ||| |||| || || || ||||||||||||||
Sbjct: 422 accagctcaatggggtctacaccatgggcaatcaccaccagctgagcctt 373



to top

>ref|XM_143236.6| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (Surfeit locus protein 3) (LOC242025), mRNA
          Length = 744

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| ||| |||| || || || ||||||||||||||
Sbjct: 422 accagctcaatggggtctacaccatgggcaatcaccaccagctgagcctt 373



to top

>ref|XR_003744.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L7a
           (LOC672193), mRNA
          Length = 889

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 526 accagctcaatggggtctacgtcatgggccatcaccaccagctgagcctt 477



to top

>gb|AC120548.15| Mus musculus chromosome 17, clone RP23-211H11, complete sequence
          Length = 198829

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| |||||||| |  || || ||||||||||||||
Sbjct: 38083 accagctcaatggggtctacatcatgggtaatcaccaccagctgagcctt 38034



to top

>ref|XM_572378.1| Cryptococcus neoformans var. neoformans JEC21 ribosomal protein L4
           (CNH02040) partial mRNA
          Length = 921

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 67/82 (81%)
 Strand = Plus / Minus

                                                                       
Query: 345 ccatcttcctgcatagggctgggagccacacaaccagctcaattgggtcaacatcatgag 404
           ||||||||||||| || || |||||  | || || |||||||| ||||||||||| |  |
Sbjct: 547 ccatcttcctgcagagagcggggaggaagacgacgagctcaatagggtcaacatcgtcgg 488

                                 
Query: 405 cgatgacaaccagctgagcctt 426
           | ||||| || |||||||||||
Sbjct: 487 caatgacgacgagctgagcctt 466



to top

>gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-284P20, complete
             sequence
          Length = 203967

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| |||||||| ||  | || ||||||||||||||
Sbjct: 32813 accagctcaatggggtctacatcatgggcagtcaccaccagctgagcctt 32862



to top

>gb|AC121580.3| Mus musculus BAC clone RP23-255J21 from 9, complete sequence
          Length = 200282

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 174114 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 174065



to top

>gb|AC098705.2| Mus musculus BAC clone RP23-1B19 from 3, complete sequence
          Length = 202444

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||| | ||||| |||||||| || || || ||||||||||||||
Sbjct: 93433 accagctcagtggggtctacatcatgggcaatcaccaccagctgagcctt 93482



to top

>gb|AC098724.3| Mus musculus BAC clone RP23-3D14 from 4, complete sequence
          Length = 190437

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 19347 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 19298



to top

>gb|BC052339.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone
           IMAGE:30071790), partial cds
          Length = 880

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 514 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 465



to top

>gb|BC016489.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone
           IMAGE:3155705), complete cds
          Length = 501

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 142 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 93



to top

>emb|CR648468.2|CNS0EZBU Tetraodon nigroviridis full-length cDNA
          Length = 829

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 389 gggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||||||||| ||||  |||||||| |||||
Sbjct: 486 gggtcaacatcatgagcaatgatgaccagctgggcctt 449



to top

>gb|AC115910.6| Mus musculus, clone RP24-480O17, complete sequence
          Length = 257036

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 377  accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
            ||||| ||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 1761 accagttcaatggggtctacatcatgggcaatcactaccagctgagcctt 1712



to top

>gb|AC102675.9| Mus musculus, clone RP23-232O16, complete sequence
          Length = 208734

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 25471 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 25520



to top

>gb|AC112406.5| Rattus norvegicus 11 BAC CH230-329D3 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 182245

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| ||||| || || || || ||||||||||||||
Sbjct: 33536 accagctcaatggggtctacatcgtgggcaataactaccagctgagcctt 33487



to top

>gb|BC099389.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:117534
           IMAGE:30526878), complete cds
          Length = 880

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 505 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 456



to top

>emb|BX908789.1| Neurospora crassa DNA linkage group VII BAC clone B13D24
          Length = 107482

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 516   gcctgtgccctcttcagaagcctctc 541
             |||||||||||| |||||||||||||
Sbjct: 82525 gcctgtgccctcgtcagaagcctctc 82500



to top

>gb|AC153153.4| Mus musculus BAC clone RP23-79G18 from chromosome 13, complete sequence
          Length = 222383

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 87790 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 87839



to top

>emb|AL606528.7| Mouse DNA sequence from clone RP23-45H23 on chromosome 13 Contains a
             ribosomal protein 7A (Rpl7a) pseudogene and a novel gene
             (2610307P16Rik), complete sequence
          Length = 148066

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 36741 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 36692



to top

>dbj|AB246884.1| Lethenteron japonicum RPL7A mRNA for ribosomal protein L7A, partial
           cds
          Length = 710

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           |||||||| || ||||| || || ||||||||||| |||||||| |||||
Sbjct: 506 accagctcgatggggtcgacgtcgtgagcgatgaccaccagctgcgcctt 457



to top

>gb|AC083913.2| Genomic sequence for Mus musculus, clone RP23-376A14, complete sequence
          Length = 218940

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 187869 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 187820



to top

>dbj|AK135447.1| Mus musculus 12 days embryo female mullerian duct includes
           surrounding region cDNA, RIKEN full-length enriched
           library, clone:6820422F17 product:ribosomal protein L7a,
           full insert sequence
          Length = 870

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 527 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 478



to top

>dbj|AK160044.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420045F08 product:ribosomal protein L7a,
           full insert sequence
          Length = 865

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 523 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 474



to top

>dbj|AK160622.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700055M03 product:ribosomal
           protein L7a, full insert sequence
          Length = 866

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 529 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 480



to top

>dbj|AK160621.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700055H02 product:ribosomal
           protein L7a, full insert sequence
          Length = 859

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 522 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 473



to top

>gb|AC162454.3| Mus musculus chromosome 1, clone RP23-7D20, complete sequence
          Length = 209951

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 174549 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 174598



to top

>gb|AC119212.15| Mus musculus chromosome 1, clone RP24-192L21, complete sequence
          Length = 174380

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 102238 accagctcaatggggtctacgtcatgggccatcaccaccagctgagcctt 102287



to top

>gb|BC089624.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:107696
           IMAGE:6763528), complete cds
          Length = 907

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 526 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 477



to top

>gb|AC155934.2| Mus musculus BAC clone RP23-58N8 from chromosome 9, complete sequence
          Length = 198059

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 35958 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 35909



to top

>gb|AC156637.2| Mus musculus BAC clone RP24-241I18 from chromosome 12, complete
             sequence
          Length = 156014

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||| ||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 31892 accagttcaatggggtctacatcatgggcaatcactaccagctgagcctt 31843



to top

>dbj|AK081115.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:B930089I02
            product:unclassifiable, full insert sequence
          Length = 3858

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 377  accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
            ||||| ||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 1993 accagttcaatggggtctacatcatgggcaatcactaccagctgagcctt 2042



to top

>gb|AC153869.7| Mus musculus 6 BAC RP23-386A17 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 222826

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 42038 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 41989



to top

>dbj|AK019449.1| Mus musculus 14, 17 days embryo head cDNA, RIKEN full-length
           enriched library, clone:3230401N15 product:ribosomal
           protein L7a, full insert sequence
          Length = 867

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 524 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 475



to top

>gb|AC153952.4| Mus musculus 10 BAC RP24-82M14 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 183398

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 81152 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 81103



to top

>dbj|AK030194.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4933415M11 product:ribosomal protein L7a,
            full insert sequence
          Length = 1977

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 377  accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
            ||||||||||| ||||| ||||||||  | || || ||||||||||||||
Sbjct: 1571 accagctcaatggggtctacatcatggtcaatcaccaccagctgagcctt 1522



to top

>dbj|AK014551.1| Mus musculus 0 day neonate skin cDNA, RIKEN full-length enriched
            library, clone:4632404N19 product:unclassifiable, full
            insert sequence
          Length = 3701

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 377  accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
            ||||||||| | ||||| |||||||| || || || ||||||||||||||
Sbjct: 1568 accagctcagtggggtctacatcatgggcaatcaccaccagctgagcctt 1617



to top

>gb|AY967504.1| Schmidtea mediterranea clone HE.3.01B mRNA sequence
          Length = 850

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 383 tcaattgggtcaacatcatgagcgatgacaacca 416
           ||||| ||||||||||||||||| || |||||||
Sbjct: 355 tcaatagggtcaacatcatgagcaatcacaacca 388



to top

>gb|AC130530.4| Mus musculus BAC clone RP23-153P2 from chromosome 7, complete sequence
          Length = 202012

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 173993 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 174042



to top

>ref|XM_221603.3| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC304035), mRNA
          Length = 879

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||| ||||| ||||| |||||||| || || || ||||||||||||||
Sbjct: 535 accagttcaatggggtctacatcatgggcaatcaccaccagctgagcctt 486



to top

>ref|XM_580204.1| PREDICTED: Rattus norvegicus LOC501505 (LOC501505), mRNA
          Length = 927

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||  |||||||| || || || ||||||||||||||
Sbjct: 365 accagctcaatggggtttacatcatgggcaatcaccaccagctgagcctt 414



to top

>ref|XM_221473.3| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC498078), mRNA
          Length = 868

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || ||  |||||||||||||
Sbjct: 510 accagctcaatggggtctacatcatgggcaatcaccgccagctgagcctt 461



to top

>ref|XM_576256.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500859), mRNA
          Length = 886

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| || || ||  |||||||||||||
Sbjct: 528 accagctcaatggggtctacatcatgggcaatcaccgccagctgagcctt 479



to top

>ref|XM_578581.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC366702), mRNA
          Length = 801

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| |||||  ||||||| || || || ||||||||||||||
Sbjct: 500 accagctcaatggggtctgcatcatgggcaatcaccaccagctgagcctt 451



to top

>ref|XM_576046.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L7a
           (LOC500669), mRNA
          Length = 622

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           |||||||| || ||||| |||||||| || || || ||||||||||||||
Sbjct: 281 accagctctatggggtctacatcatgggcaatcaccaccagctgagcctt 232



to top

>ref|XM_574700.1| PREDICTED: Rattus norvegicus similar to Rpl7a protein (LOC499382),
           mRNA
          Length = 907

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||| | || || || ||||||||||||||
Sbjct: 566 accagctcaatggggtctacatcacgggcaatcaccaccagctgagcctt 517



to top

>ref|NM_001013830.1| Mus musculus similar to 60S ribosomal protein L7a (Surfeit locus
            protein 3) (PLA-X polypeptide) (LOC436332), mRNA
          Length = 1977

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 377  accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
            ||||||||||| ||||| ||||||||  | || || ||||||||||||||
Sbjct: 1571 accagctcaatggggtctacatcatggtcaatcaccaccagctgagcctt 1522



to top

>gb|BC091731.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:102480
           IMAGE:2655142), complete cds
          Length = 872

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 505 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 456



to top

>gb|BC091769.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:102481
           IMAGE:4158894), complete cds
          Length = 868

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 510 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 461



to top

>gb|BC080712.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:91049
           IMAGE:4457484), complete cds
          Length = 865

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 505 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 456



to top

>gb|BC080669.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:91051
           IMAGE:5060194), complete cds
          Length = 869

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 510 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 461



to top

>gb|BC080663.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone MGC:91050
           IMAGE:4487611), complete cds
          Length = 870

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 510 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 461



to top

>gb|AC154477.2| Mus musculus BAC clone RP24-134B24 from 14, complete sequence
          Length = 167259

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 40262 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 40213



to top

>gb|AC133581.22| Mus musculus chromosome 1, clone RP24-395P3, complete sequence
          Length = 158696

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 64111 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 64062



to top

>gb|AC153627.2| Mus musculus 6 BAC RP23-104H13 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 198060

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 38825 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 38874



to top

>gb|AC153621.5| Mus musculus 6 BAC RP23-272K20 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 215547

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 22492 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 22443



to top

>gb|AC139040.8| Mus musculus chromosome 19, clone RP23-292H20, complete sequence
          Length = 206197

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| ||| |||| || || || ||||||||||||||
Sbjct: 199862 accagctcaatggggtctacaacatgggcaatcaccaccagctgagcctt 199911



to top

>emb|AL671935.30| Mouse DNA sequence from clone RP23-421J13 on chromosome X, complete
              sequence
          Length = 194258

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 114026 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 113977



to top

>gb|AC154649.3| Mus musculus BAC clone RP23-156O5 from chromosome 14, complete sequence
          Length = 227676

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 144486 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 144437



to top

>gb|AC123825.5| Mus musculus BAC clone RP24-93F18 from 8, complete sequence
          Length = 236875

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 377  accagctcaattgggtcaacatcatgagcgatgacaaccagctgag 422
            ||||||||||| ||||| |||||||| || || || ||||||||||
Sbjct: 4837 accagctcaatggggtctacatcatgggcaatcaccaccagctgag 4882



to top

>gb|BC029992.1| Mus musculus ribosomal protein L7a, mRNA (cDNA clone IMAGE:3482983)
          Length = 868

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 510 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 461



to top

>gb|AC132438.3| Mus musculus BAC clone RP23-234G15 from 3, complete sequence
          Length = 180660

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| ||| |||| || || || ||||||||||||||
Sbjct: 20898 accagctcaatggggtctacaccatgggcaatcaccaccagctgagcctt 20849



to top

>gb|AC112266.6| Mus musculus BAC clone RP23-422B6 from 13, complete sequence
          Length = 190943

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 32197 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 32246



to top

>gb|AC139575.3| Mus musculus BAC clone RP23-430K5 from 8, complete sequence
          Length = 192317

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                            
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgag 422
              ||||||||||| ||||| |||||||| || || || ||||||||||
Sbjct: 115186 accagctcaatggggtctacatcatgggcaatcaccaccagctgag 115231



to top

>ref|NG_005356.1| Mus musculus ribosomal protein L7a pseudogene (LOC641660) on
           chromosome X
          Length = 1067

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 624 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 575



to top

>emb|AL831733.4| Mouse DNA sequence from clone RP23-109O11 on chromosome 4, complete
              sequence
          Length = 196863

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| ||||||||  | || || ||||||||||||||
Sbjct: 150234 accagctcaatagggtctacatcatggtcaatcaccaccagctgagcctt 150185



to top

>emb|AL732328.12| Mouse DNA sequence from clone RP23-106P4 on chromosome 2, complete
              sequence
          Length = 177649

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||| | ||||| |||||||| || || || ||||||||||||||
Sbjct: 108935 accagctcattggggtctacatcatgggcaatcaccaccagctgagcctt 108984



to top

>emb|AL670660.8| Mouse DNA sequence from clone RP23-265D6 on chromosome X, complete
             sequence
          Length = 181805

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 377   accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
             ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 34623 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 34672



to top

>emb|AL606915.12| Mouse DNA sequence from clone RP23-185C16 on chromosome 4, complete
              sequence
          Length = 182248

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 377    accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
              ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 134691 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 134642



to top

>gb|AY067190.1| Schmidtea mediterranea clone H.16.9f unknown mRNA sequence
          Length = 669

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 383 tcaattgggtcaacatcatgagcgatgacaacca 416
           ||||| ||||||||||||||||| || |||||||
Sbjct: 355 tcaatagggtcaacatcatgagcaatcacaacca 388



to top

>gb|M20743.1|MUSSURFC Mouse surfeit locus (Surf-3) processed pseudogene 2
          Length = 1200

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| || ||||| || || || ||||||||||||||
Sbjct: 620 accagctcaatggggtctacgtcatgggcaatcaccaccagctgagcctt 571



to top

>gb|M20741.1|MUSSURFB Mouse surfeit locus (Surf-3) processed pseudogene 1
          Length = 1024

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 377 accagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           ||||||||||| ||||| |||||||| ||  | || ||||||||||||||
Sbjct: 645 accagctcaatggggtctacatcatgggcagtcaccaccagctgagcctt 596



to top

>ref|NM_023091.1| Rattus norvegicus gamma-aminobutyric acid A receptor, epsilon
           (Gabre), mRNA
          Length = 3000

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 504 ccctcagcctcagcctgtgcc 524
           |||||||||||||||||||||
Sbjct: 137 ccctcagcctcagcctgtgcc 157



to top

>ref|NM_017369.1| Mus musculus gamma-aminobutyric acid (GABA-A) receptor, subunit
           epsilon (Gabre), mRNA
          Length = 2779

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 504 ccctcagcctcagcctgtgcc 524
           |||||||||||||||||||||
Sbjct: 137 ccctcagcctcagcctgtgcc 157



to top

>gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7.1, complete sequence
          Length = 110310

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 504   ccctcagcctcagcctgtgcc 524
             |||||||||||||||||||||
Sbjct: 18466 ccctcagcctcagcctgtgcc 18446



to top

>gb|AC124212.2| Mus musculus chromosome X clone CT7-532E7 map qA7.1, complete sequence
          Length = 109783

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 504    ccctcagcctcagcctgtgcc 524
              |||||||||||||||||||||
Sbjct: 102427 ccctcagcctcagcctgtgcc 102407



to top

>ref|XM_535657.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L7a
           (LOC478479), mRNA
          Length = 574

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 374 acaaccagctcaattgggtcaacatcatgagcgatgacaaccagctgagcctt 426
           |||||||||||| | || || |||||||| || || || ||||||||||||||
Sbjct: 227 acaaccagctcagtgggatccacatcatgggctatcactaccagctgagcctt 175



to top

>gb|AC117241.4| Mus musculus BAC clone RP24-147H15 from chromosome 17, complete
             sequence
          Length = 191713

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 515   agcctgtgccctcttcagaag 535
             |||||||||||||||||||||
Sbjct: 31715 agcctgtgccctcttcagaag 31695



to top

>emb|AL731628.4|OSJN00282 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0088C09,
             complete sequence
          Length = 96079

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 441   ggtaagtgacatggttagaaa 461
             |||||||||||||||||||||
Sbjct: 41101 ggtaagtgacatggttagaaa 41121



to top

>gb|AC147798.30| Mus musculus strain C57BL/6J chromosome 17 clone rp24-129d12, complete
             sequence
          Length = 168127

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 515   agcctgtgccctcttcagaag 535
             |||||||||||||||||||||
Sbjct: 88235 agcctgtgccctcttcagaag 88255


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,448,582
Number of Sequences: 3902068
Number of extensions: 5448582
Number of successful extensions: 100669
Number of sequences better than 10.0: 301
Number of HSP's better than 10.0 without gapping: 302
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99930
Number of HSP's gapped (non-prelim): 700
length of query: 606
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 583
effective length of database: 17,143,297,704
effective search space: 9994542561432
effective search space used: 9994542561432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top